@article {pmid30220031,
year = {2018},
author = {Kim, MS and Kim, KH},
title = {CRISPR/Cas9-mediated knockout of HIF-1α gene in epithelioma papulosum cyprini (EPC) cells inhibited apoptosis and viral hemorrhagic septicemia virus (VHSV) growth.},
journal = {Archives of virology},
volume = {163},
number = {12},
pages = {3395-3402},
doi = {10.1007/s00705-018-4018-0},
pmid = {30220031},
issn = {1432-8798},
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems ; Cell Line ; Cyprinidae/virology ; Fish Diseases/*genetics/metabolism/physiopathology/virology ; Gene Knockout Techniques ; Hemorrhagic Septicemia, Viral/*genetics/metabolism/physiopathology/virology ; Hypoxia-Inducible Factor 1, alpha Subunit/*genetics/metabolism ; Novirhabdovirus/genetics/*growth & development/physiology ; },
abstract = {Hypoxia-inducible factor-1 (HIF-1) is a heterodimer of HIF-1α and HIF-1β, and its key role in the regulation of cellular responses to hypoxia has been well-demonstrated. The participation of HIF-1α in apoptosis has been reported in mammals, however, a little information is available on the role of HIF-1α in the progression of apoptosis in fish. In this study, to know the role of HIF-1α in the apoptosis of fish cells, we produced HIF-1α knockout Epithelioma papulosum cyprini (EPC) cells using a CRISPR/Cas9 vector, and a single cell clone showing a heterozygous insertion/deletion (indel) mutation (one nucleotide insertion and one nucleotide deletion in HIF-1α gene) was chosen for further experiments. To confirm the knockout of HIF-1α, cells were transfected with a hypoxia reporting vector containing hypoxic response elements (HREs). EPC cells transfected with the reporting plasmids showed significantly increased luminescence by exposure to cobalt chloride, a prolyl hydroxylases inhibitor. On the other hand, HIF-1α knockout EPC cells showed a non-responsiveness to a cobalt chloride exposure, suggesting that functional HIF-1α protein was not produced in the HIF-1α knockout EPC cells. Apoptosis progression induced by camptothecin and viral hemorrhagic septicemia virus (VHSV) infection was severely inhibited by HIF-1α knockout, and the replication of VHSV was significantly retarded in HIF-1α knockout EPC cells. These results suggest that HIF-1α in EPC cells acts as a pro-apoptotic factor in the progression of apoptosis triggered by a DNA damaging agent and rhabdoviral infection.},
}
@article {pmid29956290,
year = {2018},
author = {Cheong, TC and Blasco, RB and Chiarle, R},
title = {The CRISPR/Cas9 System as a Tool to Engineer Chromosomal Translocation In Vivo.},
journal = {Advances in experimental medicine and biology},
volume = {1044},
number = {},
pages = {39-48},
doi = {10.1007/978-981-13-0593-1_4},
pmid = {29956290},
issn = {0065-2598},
support = {R01 CA196703/CA/NCI NIH HHS/United States ; R01 CA222598/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Embryonic Stem Cells/metabolism ; Genetic Engineering/*methods ; Mice ; *Translocation, Genetic ; },
abstract = {The CRISPR/Cas9 system has emerged as a powerful tool to edit the genome. Among many applications, the system generates the exciting possibility of engineering small and large portions of chromosomes to induce a variety of structural alterations such as deletions, inversions, insertions and inter-chromosomal translocations. Furthermore, the availability of viral vectors that express Cas9 has been critical to deliver the CRISPR/Cas9 system directly in vivo to induce chromosomal rearrangements. This review provides an overview of the state-of-the-art CRISPR/Cas9 technology to model a variety of rearrangements in vivo in animal models.},
}
@article {pmid29956288,
year = {2018},
author = {Brunet, E and Jasin, M},
title = {Induction of Chromosomal Translocations with CRISPR-Cas9 and Other Nucleases: Understanding the Repair Mechanisms That Give Rise to Translocations.},
journal = {Advances in experimental medicine and biology},
volume = {1044},
number = {},
pages = {15-25},
doi = {10.1007/978-981-13-0593-1_2},
pmid = {29956288},
issn = {0065-2598},
support = {P30 CA008748/CA/NCI NIH HHS/United States ; R01 CA185660/CA/NCI NIH HHS/United States ; R35 GM118175/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; DNA Breaks, Double-Stranded ; *DNA Repair ; *Endonucleases ; Humans ; Mice ; *Translocation, Genetic ; },
abstract = {Chromosomal translocations are associated with several tumor types, including hematopoietic malignancies, sarcomas, and solid tumors of epithelial origin, due to their activation of a proto-oncogene or generation of a novel fusion protein with oncogenic potential. In many cases, the availability of suitable human models has been lacking because of the difficulty in recapitulating precise expression of the fusion protein or other reasons. Further, understanding how translocations form mechanistically has been a goal, as it may suggest ways to prevent their occurrence. Chromosomal translocations arise when DNA ends from double-strand breaks (DSBs) on two heterologous chromosomes are improperly joined. This review provides a summary of DSB repair mechanisms and their contribution to translocation formation, the various programmable nuclease platforms that have been used to generate translocations, and the successes that have been achieved in this area.},
}
@article {pmid29872189,
year = {2018},
author = {Guglielmi, G},
title = {Million-dollar Kavli prize recognizes scientist scooped on CRISPR.},
journal = {Nature},
volume = {558},
number = {7708},
pages = {17-18},
doi = {10.1038/d41586-018-05308-5},
pmid = {29872189},
issn = {1476-4687},
mesh = {Animals ; Astronomy/standards ; *Awards and Prizes ; *CRISPR-Cas Systems ; *Gene Editing ; Hearing ; Humans ; Mice ; Neurosciences/standards ; Patents as Topic/legislation & jurisprudence ; },
}
@article {pmid29514863,
year = {2018},
author = {Tagliabue, G},
title = {Comment on "Why are NGOs sceptical of genome editing?".},
journal = {EMBO reports},
volume = {19},
number = {4},
pages = {},
doi = {10.15252/embr.201745620},
pmid = {29514863},
issn = {1469-3178},
mesh = {CRISPR-Cas Systems ; *Gene Editing ; *Genome ; },
}
@article {pmid29330493,
year = {2018},
author = {Sawatsubashi, S and Joko, Y and Fukumoto, S and Matsumoto, T and Sugano, SS},
title = {Development of versatile non-homologous end joining-based knock-in module for genome editing.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {593},
doi = {10.1038/s41598-017-18911-9},
pmid = {29330493},
issn = {2045-2322},
mesh = {*CRISPR-Cas Systems ; Cell Line ; *DNA End-Joining Repair ; Gene Editing ; Gene Knock-In Techniques/*methods ; Genetic Engineering ; Humans ; Keratinocytes/cytology/metabolism ; Plasmids/genetics ; Receptors, Calcitriol/*genetics ; },
abstract = {CRISPR/Cas9-based genome editing has dramatically accelerated genome engineering. An important aspect of genome engineering is efficient knock-in technology. For improved knock-in efficiency, the non-homologous end joining (NHEJ) repair pathway has been used over the homology-dependent repair pathway, but there remains a need to reduce the complexity of the preparation of donor vectors. We developed the versatile NHEJ-based knock-in module for genome editing (VIKING). Using the consensus sequence of the time-honored pUC vector to cut donor vectors, any vector with a pUC backbone could be used as the donor vector without customization. Conditions required to minimize random integration rates of the donor vector were also investigated. We attempted to isolate null lines of the VDR gene in human HaCaT keratinocytes using knock-in/knock-out with a selection marker cassette, and found 75% of clones isolated were successfully knocked-in. Although HaCaT cells have hypotetraploid genome composition, the results suggest multiple clones have VDR null phenotypes. VIKING modules enabled highly efficient knock-in of any vectors harboring pUC vectors. Users now can insert various existing vectors into an arbitrary locus in the genome. VIKING will contribute to low-cost genome engineering.},
}
@article {pmid28440293,
year = {2017},
author = {Yeung, ATY and Hale, C and Lee, AH and Gill, EE and Bushell, W and Parry-Smith, D and Goulding, D and Pickard, D and Roumeliotis, T and Choudhary, J and Thomson, N and Skarnes, WC and Dougan, G and Hancock, REW},
title = {Exploiting induced pluripotent stem cell-derived macrophages to unravel host factors influencing Chlamydia trachomatis pathogenesis.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15013},
doi = {10.1038/ncomms15013},
pmid = {28440293},
issn = {2041-1723},
support = {//Wellcome Trust/United Kingdom ; },
mesh = {Adult ; CRISPR-Cas Systems/genetics ; Cell Differentiation ; Chlamydia Infections/*genetics/immunology/microbiology ; Chlamydia trachomatis/immunology/*pathogenicity ; Gene Editing/methods ; Gene Expression Profiling ; Gene Knockout Techniques ; HeLa Cells ; Healthy Volunteers ; Host-Pathogen Interactions/*genetics/immunology ; Humans ; Induced Pluripotent Stem Cells/physiology ; Interferon Regulatory Factors/genetics/immunology ; Interleukin-10 Receptor alpha Subunit/genetics/immunology ; Macrophages/microbiology/*physiology ; Mutation ; Proteomics/methods ; },
abstract = {Chlamydia trachomatis remains a leading cause of bacterial sexually transmitted infections and preventable blindness worldwide. There are, however, limited in vitro models to study the role of host genetics in the response of macrophages to this obligate human pathogen. Here, we describe an approach using macrophages derived from human induced pluripotent stem cells (iPSdMs) to study macrophage-Chlamydia interactions in vitro. We show that iPSdMs support the full infectious life cycle of C. trachomatis in a manner that mimics the infection of human blood-derived macrophages. Transcriptomic and proteomic profiling of the macrophage response to chlamydial infection highlighted the role of the type I interferon and interleukin 10-mediated responses. Using CRISPR/Cas9 technology, we generated biallelic knockout mutations in host genes encoding IRF5 and IL-10RA in iPSCs, and confirmed their roles in limiting chlamydial infection in macrophages. This model can potentially be extended to other pathogens and tissue systems to advance our understanding of host-pathogen interactions and the role of human genetics in influencing the outcome of infections.},
}
@article {pmid28134250,
year = {2017},
author = {Qi, S and Li, Z and Schulze-Gahmen, U and Stjepanovic, G and Zhou, Q and Hurley, JH},
title = {Structural basis for ELL2 and AFF4 activation of HIV-1 proviral transcription.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14076},
doi = {10.1038/ncomms14076},
pmid = {28134250},
issn = {2041-1723},
support = {R01 AI095057/AI/NIAID NIH HHS/United States ; R01 AI041757/AI/NIAID NIH HHS/United States ; P50 GM082250/GM/NIGMS NIH HHS/United States ; S10 OD016268/OD/NIH HHS/United States ; P41 GM103393/GM/NIGMS NIH HHS/United States ; },
mesh = {Acquired Immunodeficiency Syndrome/*genetics/virology ; Binding Sites/genetics ; CRISPR-Cas Systems ; Crystallography, X-Ray ; Gene Expression Regulation, Viral ; Gene Knockout Techniques ; HIV-1/pathogenicity/*physiology ; HeLa Cells ; Humans ; Jurkat Cells ; Mutagenesis ; Protein Binding/genetics ; Protein Domains/genetics ; Proviruses/*physiology ; Recombinant Fusion Proteins/chemistry/genetics/metabolism ; Repressor Proteins/*chemistry/genetics/metabolism ; Transcription Elongation, Genetic/*physiology ; Transcriptional Elongation Factors/*chemistry/genetics/metabolism ; Virus Activation/genetics ; Virus Latency/genetics ; tat Gene Products, Human Immunodeficiency Virus/genetics ; },
abstract = {The intrinsically disordered scaffold proteins AFF1/4 and the transcription elongation factors ELL1/2 are core components of the super elongation complex required for HIV-1 proviral transcription. Here we report the 2.0-Å resolution crystal structure of the human ELL2 C-terminal domain bound to its 50-residue binding site on AFF4, the ELLBow. The ELL2 domain has the same arch-shaped fold as the tight junction protein occludin. The ELLBow consists of an N-terminal helix followed by an extended hairpin that we refer to as the elbow joint, and occupies most of the concave surface of ELL2. This surface is important for the ability of ELL2 to promote HIV-1 Tat-mediated proviral transcription. The AFF4-ELL2 interface is imperfectly packed, leaving a cavity suggestive of a potential binding site for transcription-promoting small molecules.},
}
@article {pmid30451675,
year = {2018},
author = {Croteau, FR and Rousseau, GM and Moineau, S},
title = {[The CRISPR-Cas system: beyond genome editing].},
journal = {Medecine sciences : M/S},
volume = {34},
number = {10},
pages = {813-819},
doi = {10.1051/medsci/2018215},
pmid = {30451675},
issn = {1958-5381},
abstract = {CRISPR-Cas is an adaptive immune system used by many microbes to defend against nucleic acids invasion such as viral genomes. The microbial system uses its CRISPR locus to store genetic information that will generate short CRISPR RNAs. The latter with endonucleases (Cas) prevent future viral infections. Parts of this system were exploited to develop a powerful genome editing tool that was adapted for a variety of organisms. The ability of the CRISPR-Cas9 technology to effectively and precisely cut a targeted genomic DNA region has the potential to may be one day cure genetic diseases. The malleability of this editing tool also offers a wide range of possibilities from modulations of gene expression to epigenetic modifications. The natural CRISPR loci found in bacteria can be used to differentiate microbial strains or to study the interactions between bacteria and its habitat. Addressing CRISPR-Cas fundamentals in microbes and its popular use in eukaryotes, this review presents an update on a system that has revolutionized biological sciences.},
}
@article {pmid29769725,
year = {2018},
author = {Zhang, R and Kim, AS and Fox, JM and Nair, S and Basore, K and Klimstra, WB and Rimkunas, R and Fong, RH and Lin, H and Poddar, S and Crowe, JE and Doranz, BJ and Fremont, DH and Diamond, MS},
title = {Mxra8 is a receptor for multiple arthritogenic alphaviruses.},
journal = {Nature},
volume = {557},
number = {7706},
pages = {570-574},
doi = {10.1038/s41586-018-0121-3},
pmid = {29769725},
issn = {1476-4687},
support = {HHSN272201400058C/AI/NIAID NIH HHS/United States ; R01 AI095436/AI/NIAID NIH HHS/United States ; R01 AI114816/AI/NIAID NIH HHS/United States ; R01 AI123348/AI/NIAID NIH HHS/United States ; },
mesh = {3T3 Cells ; Animals ; Antibodies, Blocking/immunology ; CRISPR-Cas Systems/genetics ; Chikungunya virus/*metabolism/pathogenicity ; Chondrocytes/metabolism ; Fibroblasts/metabolism ; Humans ; Immunoglobulins/immunology/*metabolism ; Male ; Membrane Proteins/antagonists & inhibitors/immunology/*metabolism ; Mice ; Muscle, Skeletal/cytology/metabolism ; O'nyong-nyong Virus/*metabolism/pathogenicity ; Osteoblasts/metabolism ; Receptors, Fc/metabolism ; Receptors, Virus/deficiency/genetics/*metabolism ; },
abstract = {Arthritogenic alphaviruses comprise a group of enveloped RNA viruses that are transmitted to humans by mosquitoes and cause debilitating acute and chronic musculoskeletal disease 1 . The host factors required for alphavirus entry remain poorly characterized 2 . Here we use a genome-wide CRISPR-Cas9-based screen to identify the cell adhesion molecule Mxra8 as an entry mediator for multiple emerging arthritogenic alphaviruses, including chikungunya, Ross River, Mayaro and O'nyong nyong viruses. Gene editing of mouse Mxra8 or human MXRA8 resulted in reduced levels of viral infection of cells and, reciprocally, ectopic expression of these genes resulted in increased infection. Mxra8 bound directly to chikungunya virus particles and enhanced virus attachment and internalization into cells. Consistent with these findings, Mxra8-Fc fusion protein or anti-Mxra8 monoclonal antibodies blocked chikungunya virus infection in multiple cell types, including primary human synovial fibroblasts, osteoblasts, chondrocytes and skeletal muscle cells. Mutagenesis experiments suggest that Mxra8 binds to a surface-exposed region across the A and B domains of chikungunya virus E2 protein, which are a speculated site of attachment. Finally, administration of the Mxra8-Fc protein or anti-Mxra8 blocking antibodies to mice reduced chikungunya and O'nyong nyong virus infection as well as associated foot swelling. Pharmacological targeting of Mxra8 could form a strategy for mitigating infection and disease by multiple arthritogenic alphaviruses.},
}
@article {pmid29323173,
year = {2018},
author = {Teixeira, M and Py, BF and Bosc, C and Laubreton, D and Moutin, MJ and Marvel, J and Flamant, F and Markossian, S},
title = {Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {474},
doi = {10.1038/s41598-017-18826-5},
pmid = {29323173},
issn = {2045-2322},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; DNA End-Joining Repair ; Electroporation ; Endopeptidases/chemistry/genetics ; Female ; Gene Editing/*methods ; Genetic Loci ; Genotyping Techniques ; INDEL Mutation ; Male ; Mice ; Mice, Inbred C57BL ; Mutation, Missense ; RNA, Guide/*genetics ; Zygote/*metabolism ; },
abstract = {In this report, we present an improved protocol for CRISPR/Cas9 genome editing in mice. The procedure consists in the electroporation of intact mouse zygotes with ribonucleoprotein complexes prepared in vitro from recombinant Cas9 nuclease and synthetic dual guide RNA. This simple cloning-free method proves to be extremely efficient for the generation of indels and small deletions by non-homologous end joining, and for the generation of specific point mutations by homology-directed repair. The procedure, which avoids DNA construction, in vitro transcription and oocyte microinjection, greatly simplifies genome editing in mice.},
}
@article {pmid29315387,
year = {2018},
author = {Narimatsu, Y and Joshi, HJ and Yang, Z and Gomes, C and Chen, YH and Lorenzetti, FC and Furukawa, S and Schjoldager, KT and Hansen, L and Clausen, H and Bennett, EP and Wandall, HH},
title = {A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome.},
journal = {Glycobiology},
volume = {28},
number = {5},
pages = {295-305},
doi = {10.1093/glycob/cwx101},
pmid = {29315387},
issn = {1460-2423},
mesh = {CRISPR-Cas Systems/*genetics ; *Gene Library ; Glycosyltransferases/*genetics/metabolism ; HEK293 Cells ; Humans ; RNA, Guide/*genetics/metabolism ; Reproducibility of Results ; },
abstract = {Over 200 glycosyltransferases are involved in the orchestration of the biosynthesis of the human glycome, which is comprised of all glycan structures found on different glycoconjugates in cells. The glycome is vast, and despite advancements in analytic strategies it continues to be difficult to decipher biological roles of glycans with respect to specific glycan structures, type of glycoconjugate, particular glycoproteins, and distinct glycosites on proteins. In contrast to this, the number of glycosyltransferase genes involved in the biosynthesis of the human glycome is manageable, and the biosynthetic roles of most of these enzymes are defined or can be predicted with reasonable confidence. Thus, with the availability of the facile CRISPR/Cas9 gene editing tool it now seems easier to approach investigation of the functions of the glycome through genetic dissection of biosynthetic pathways, rather than by direct glycan analysis. However, obstacles still remain with design and validation of efficient gene targeting constructs, as well as with the interpretation of results from gene targeting and the translation of gene function to glycan structures. This is especially true for glycosylation steps covered by isoenzyme gene families. Here, we present a library of validated high-efficiency gRNA designs suitable for individual and combinatorial targeting of the human glycosyltransferase genome together with a global view of the predicted functions of human glycosyltransferases to facilitate and guide gene targeting strategies in studies of the human glycome.},
}
@article {pmid29197638,
year = {2018},
author = {Lowder, LG and Zhou, J and Zhang, Y and Malzahn, A and Zhong, Z and Hsieh, TF and Voytas, DF and Zhang, Y and Qi, Y},
title = {Robust Transcriptional Activation in Plants Using Multiplexed CRISPR-Act2.0 and mTALE-Act Systems.},
journal = {Molecular plant},
volume = {11},
number = {2},
pages = {245-256},
doi = {10.1016/j.molp.2017.11.010},
pmid = {29197638},
issn = {1752-9867},
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Expression Regulation, Plant/genetics/physiology ; Transcription Factors/genetics/*metabolism ; Transcriptional Activation/genetics/*physiology ; },
abstract = {User-friendly tools for robust transcriptional activation of endogenous genes are highly demanded in plants. We previously showed that a dCas9-VP64 system consisting of the deactivated CRISPR-associated protein 9 (dCas9) fused with four tandem repeats of the transcriptional activator VP16 (VP64) could be used for transcriptional activation of endogenous genes in plants. In this study, we developed a second generation of vector systems for enhanced transcriptional activation in plants. We tested multiple strategies for dCas9-based transcriptional activation, and found that simultaneous recruitment of VP64 by dCas9 and a modified guide RNA scaffold gRNA2.0 (designated CRISPR-Act2.0) yielded stronger transcriptional activation than the dCas9-VP64 system. Moreover, we developed a multiplex transcription activator-like effector activation (mTALE-Act) system for simultaneous activation of up to four genes in plants. Our results suggest that mTALE-Act is even more effective than CRISPR-Act2.0 in most cases tested. In addition, we explored tissue-specific gene activation using positive feedback loops. Interestingly, our study revealed that certain endogenous genes are more amenable than others to transcriptional activation, and tightly regulated genes may cause target gene silencing when perturbed by activation probes. Hence, these new tools could be used to investigate gene regulatory networks and their control mechanisms. Assembly of multiplex CRISPR-Act2.0 and mTALE-Act systems are both based on streamlined and PCR-independent Golden Gate and Gateway cloning strategies, which will facilitate transcriptional activation applications in both dicots and monocots.},
}
@article {pmid28565744,
year = {2017},
author = {Cheng, LH and Liu, Y and Niu, T},
title = {[Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].},
journal = {Zhonghua xue ye xue za zhi = Zhonghua xueyexue zazhi},
volume = {38},
number = {5},
pages = {427-431},
doi = {10.3760/cma.j.issn.0253-2727.2017.05.014},
pmid = {28565744},
issn = {0253-2727},
mesh = {Animals ; *CRISPR-Cas Systems ; Chromosome Deletion ; DNA ; Gene Deletion ; *Gene Editing ; HEK293 Cells ; Humans ; Mice ; Multigene Family ; Mutagenesis, Insertional ; NIH 3T3 Cells ; Plasmids ; },
abstract = {Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.},
}
@article {pmid28561021,
year = {2017},
author = {Shin, HY and Wang, C and Lee, HK and Yoo, KH and Zeng, X and Kuhns, T and Yang, CM and Mohr, T and Liu, C and Hennighausen, L},
title = {CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15464},
doi = {10.1038/ncomms15464},
pmid = {28561021},
issn = {2041-1723},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Female ; Gene Editing/*methods ; Genome/*genetics ; Genotype ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Transgenic ; RNA, Guide/genetics ; Sequence Deletion/*genetics ; },
abstract = {Although CRISPR/Cas9 genome editing has provided numerous opportunities to interrogate the functional significance of any given genomic site, there is a paucity of data on the extent of molecular scars inflicted on the mouse genome. Here we interrogate the molecular consequences of CRISPR/Cas9-mediated deletions at 17 sites in four loci of the mouse genome. We sequence targeted sites in 632 founder mice and analyse 54 established lines. While the median deletion size using single sgRNAs is 9 bp, we also obtain large deletions of up to 600 bp. Furthermore, we show unreported asymmetric deletions and large insertions of middle repetitive sequences. Simultaneous targeting of distant loci results in the removal of the intervening sequences. Reliable deletion of juxtaposed sites is only achieved through two-step targeting. Our findings also demonstrate that an extended analysis of F1 genotypes is required to obtain conclusive information on the exact molecular consequences of targeting events.},
}
@article {pmid28548094,
year = {2017},
author = {Filler Hayut, S and Melamed Bessudo, C and Levy, AA},
title = {Targeted recombination between homologous chromosomes for precise breeding in tomato.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15605},
doi = {10.1038/ncomms15605},
pmid = {28548094},
issn = {2041-1723},
mesh = {CRISPR-Cas Systems/genetics ; DNA Breaks, Double-Stranded ; Gene Targeting/*methods ; Genome, Plant/genetics ; Heterozygote ; High-Throughput Nucleotide Sequencing ; Lycopersicon esculentum/*genetics ; Mutation ; Plant Breeding/*methods ; Plant Proteins/genetics ; Plants, Genetically Modified/*genetics ; Recombinational DNA Repair/*genetics ; Whole Genome Sequencing ; },
abstract = {Homologous recombination (HR) between parental chromosomes occurs stochastically. Here, we report on targeted recombination between homologous chromosomes upon somatic induction of DNA double-strand breaks (DSBs) via CRISPR-Cas9. We demonstrate this via a visual and molecular assay whereby DSB induction between two alleles carrying different mutations in the PHYTOENE SYNTHASE (PSY1) gene results in yellow fruits with wild type red sectors forming via HR-mediated DSB repair. We also show that in heterozygote plants containing one psy1 allele immune and one sensitive to CRISPR, repair of the broken allele using the unbroken allele sequence template is a common outcome. In another assay, we show evidence of a somatically induced DSB in a cross between a psy1 edible tomato mutant and wild type Solanum pimpinellifolium, targeting only the S. pimpinellifolium allele. This enables characterization of germinally transmitted targeted somatic HR events, demonstrating that somatically induced DSBs can be exploited for precise breeding of crops.},
}
@article {pmid28534478,
year = {2017},
author = {Rosenbluh, J and Xu, H and Harrington, W and Gill, S and Wang, X and Vazquez, F and Root, DE and Tsherniak, A and Hahn, WC},
title = {Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15403},
doi = {10.1038/ncomms15403},
pmid = {28534478},
issn = {2041-1723},
support = {U01 CA176058/CA/NCI NIH HHS/United States ; U01 CA199253/CA/NCI NIH HHS/United States ; },
mesh = {A549 Cells ; *CRISPR-Cas Systems ; Catalysis ; Cell Line ; Cell Line, Tumor ; Cell Proliferation ; DNA/analysis ; DNA Copy Number Variations ; Endonucleases/metabolism ; False Positive Reactions ; *Gene Deletion ; Gene Editing ; Gene Expression ; Gene Library ; *Genes, Essential ; *Genome, Human ; HT29 Cells ; Humans ; Phenotype ; },
abstract = {CRISPR-Cas9 provides the means to perform genome editing and facilitates loss-of-function screens. However, we and others demonstrated that expression of the Cas9 endonuclease induces a gene-independent response that correlates with the number of target sequences in the genome. An alternative approach to suppressing gene expression is to block transcription using a catalytically inactive Cas9 (dCas9). Here we directly compare genome editing by CRISPR-Cas9 (cutting, CRISPRc) and gene suppression using KRAB-dCas9 (CRISPRi) in loss-of-function screens to identify cell essential genes. CRISPRc identified 98% of previously defined cell essential genes. After optimizing library construction by analysing transcriptional start sites (TSS), CRISRPi identified 92% of core cell essential genes and did not show a bias to regions involved in copy number alterations. However, bidirectional promoters scored as false positives in CRISRPi. We conclude that CRISPRc and CRISPRi have different off-target effects and combining these approaches provides complementary information in loss-of-function genetic screens.},
}
@article {pmid28474669,
year = {2017},
author = {Morgens, DW and Wainberg, M and Boyle, EA and Ursu, O and Araya, CL and Tsui, CK and Haney, MS and Hess, GT and Han, K and Jeng, EE and Li, A and Snyder, MP and Greenleaf, WJ and Kundaje, A and Bassik, MC},
title = {Genome-scale measurement of off-target activity using Cas9 toxicity in high-throughput screens.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15178},
doi = {10.1038/ncomms15178},
pmid = {28474669},
issn = {2041-1723},
support = {P50 HG007735/HG/NHGRI NIH HHS/United States ; T32 CA009302/CA/NCI NIH HHS/United States ; T32 GM007790/GM/NIGMS NIH HHS/United States ; T32 HG000044/HG/NHGRI NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems/*genetics ; Cell Line ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; DNA Damage/genetics ; Gene Targeting/*methods ; *Genomic Library ; High-Throughput Screening Assays/*methods ; Humans ; Polysaccharides/biosynthesis ; RNA Interference ; RNA, Guide/*genetics ; Ricin/toxicity ; },
abstract = {CRISPR-Cas9 screens are powerful tools for high-throughput interrogation of genome function, but can be confounded by nuclease-induced toxicity at both on- and off-target sites, likely due to DNA damage. Here, to test potential solutions to this issue, we design and analyse a CRISPR-Cas9 library with 10 variable-length guides per gene and thousands of negative controls targeting non-functional, non-genic regions (termed safe-targeting guides), in addition to non-targeting controls. We find this library has excellent performance in identifying genes affecting growth and sensitivity to the ricin toxin. The safe-targeting guides allow for proper control of toxicity from on-target DNA damage. Using this toxicity as a proxy to measure off-target cutting, we demonstrate with tens of thousands of guides both the nucleotide position-dependent sensitivity to single mismatches and the reduction of off-target cutting using truncated guides. Our results demonstrate a simple strategy for high-throughput evaluation of target specificity and nuclease toxicity in Cas9 screens.},
}
@article {pmid28469274,
year = {2017},
author = {Jiang, Y and Qian, F and Yang, J and Liu, Y and Dong, F and Xu, C and Sun, B and Chen, B and Xu, X and Li, Y and Wang, R and Yang, S},
title = {CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15179},
doi = {10.1038/ncomms15179},
pmid = {28469274},
issn = {2041-1723},
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Corynebacterium glutamicum/*genetics ; DNA, Single-Stranded/genetics ; Endonucleases/*metabolism ; Francisella/enzymology ; Gene Editing/*methods ; Genetic Engineering/*methods ; Genome, Bacterial/genetics ; },
abstract = {Corynebacterium glutamicum is an important industrial metabolite producer that is difficult to genetically engineer. Although the Streptococcus pyogenes (Sp) CRISPR-Cas9 system has been adapted for genome editing of multiple bacteria, it cannot be introduced into C. glutamicum. Here we report a Francisella novicida (Fn) CRISPR-Cpf1-based genome-editing method for C. glutamicum. CRISPR-Cpf1, combined with single-stranded DNA (ssDNA) recombineering, precisely introduces small changes into the bacterial genome at efficiencies of 86-100%. Large gene deletions and insertions are also obtained using an all-in-one plasmid consisting of FnCpf1, CRISPR RNA, and homologous arms. The two CRISPR-Cpf1-assisted systems enable N iterative rounds of genome editing in 3N+4 or 3N+2 days. A proof-of-concept, codon saturation mutagenesis at G149 of γ-glutamyl kinase relieves L-proline inhibition using Cpf1-assisted ssDNA recombineering. Thus, CRISPR-Cpf1-based genome editing provides a highly efficient tool for genetic engineering of Corynebacterium and other bacteria that cannot utilize the Sp CRISPR-Cas9 system.},
}
@article {pmid28169275,
year = {2017},
author = {Shin, G and Grimes, SM and Lee, H and Lau, BT and Xia, LC and Ji, HP},
title = {CRISPR-Cas9-targeted fragmentation and selective sequencing enable massively parallel microsatellite analysis.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14291},
doi = {10.1038/ncomms14291},
pmid = {28169275},
issn = {2041-1723},
support = {P01 HG000205/HG/NHGRI NIH HHS/United States ; R01 HG006137/HG/NHGRI NIH HHS/United States ; R33 CA174575/CA/NCI NIH HHS/United States ; },
mesh = {Alleles ; *CRISPR-Cas Systems ; *Genomic Library ; Haplotypes/genetics ; High-Throughput Nucleotide Sequencing/*methods ; *Human Genome Project ; Humans ; Microsatellite Repeats/*genetics ; Polymorphism, Single Nucleotide ; Sequence Analysis, DNA/*methods ; },
abstract = {Microsatellites are multi-allelic and composed of short tandem repeats (STRs) with individual motifs composed of mononucleotides, dinucleotides or higher including hexamers. Next-generation sequencing approaches and other STR assays rely on a limited number of PCR amplicons, typically in the tens. Here, we demonstrate STR-Seq, a next-generation sequencing technology that analyses over 2,000 STRs in parallel, and provides the accurate genotyping of microsatellites. STR-Seq employs in vitro CRISPR-Cas9-targeted fragmentation to produce specific DNA molecules covering the complete microsatellite sequence. Amplification-free library preparation provides single molecule sequences without unique molecular barcodes. STR-selective primers enable massively parallel, targeted sequencing of large STR sets. Overall, STR-Seq has higher throughput, improved accuracy and provides a greater number of informative haplotypes compared with other microsatellite analysis approaches. With these new features, STR-Seq can identify a 0.1% minor genome fraction in a DNA mixture composed of different, unrelated samples.},
}
@article {pmid30446870,
year = {2018},
author = {Liu, Q and Wang, C and Jiao, X and Zhang, H and Song, L and Li, Y and Gao, C and Wang, K},
title = {Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems.},
journal = {Science China. Life sciences},
volume = {},
number = {},
pages = {},
doi = {10.1007/s11427-018-9402-9},
pmid = {30446870},
issn = {1869-1889},
abstract = {The CRISPR/Cas system has been extensively applied to make precise genetic modifications in various organisms. Despite its importance and widespread use, large-scale mutation screening remains time-consuming, labour-intensive and costly. Here, we developed Hi-TOM (available at https://doi.org/www.hi-tom.net/hi-tom/), an online tool to track the mutations with precise percentage for multiple samples and multiple target sites. We also described a corresponding next-generation sequencing (NGS) library construction strategy by fixing the bridge sequences and barcoding primers. Analysis of the samples from rice, hexaploid wheat and human cells reveals that the Hi-TOM tool has high reliability and sensitivity in tracking various mutations, especially complex chimeric mutations frequently induced by genome editing. Hi-TOM does not require special design of barcode primers, cumbersome parameter configuration or additional data analysis. Thus, the streamlined NGS library construction and comprehensive result output make Hi-TOM particularly suitable for high-throughput identification of all types of mutations induced by CRISPR/Cas systems.},
}
@article {pmid30444997,
year = {2018},
author = {Mo, CY and Marraffini, LA},
title = {If You'd Like to Stop a Type III CRISPR Ribonuclease, Then You Should Put a Ring (Nuclease) on It.},
journal = {Molecular cell},
volume = {72},
number = {4},
pages = {608-609},
doi = {10.1016/j.molcel.2018.10.048},
pmid = {30444997},
issn = {1097-4164},
abstract = {Athukoralage et al. (2018) identify a new class of nuclease that degrades cyclic oligoadenylate (cOA), a second messenger that activates non-specific RNA degradation by the type III CRISPR-Cas accessory RNase Csm6/Csx1. This discovery provides a mechanism for regulating the degradation of foreign transcripts during the type III CRISPR immune response.},
}
@article {pmid30443021,
year = {2018},
author = {Riad, A and Zeng, C and Weng, CC and Winters, H and Xu, K and Makvandi, M and Metz, T and Carlin, S and Mach, RH},
title = {Sigma-2 Receptor/TMEM97 and PGRMC-1 Increase the Rate of Internalization of LDL by LDL Receptor through the Formation of a Ternary Complex.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16845},
doi = {10.1038/s41598-018-35430-3},
pmid = {30443021},
issn = {2045-2322},
abstract = {CRISPR/Cas gene studies were conducted in HeLa cells where either PGRMC1, TMEM97 or both proteins were removed via gene editing. A series of radioligand binding studies, confocal microscopy studies, and internalization of radiolabeled or fluorescently tagged LDL particles were then conducted in these cells. The results indicate that PGRMC1 knockout (KO) did not reduce the density of binding sites for the sigma-2 receptor (σ2R) radioligands, [125I]RHM-4 or [3H]DTG, but a reduction in the receptor affinity of both radioligands was observed. TMEM97 KO resulted in a complete loss of binding of [125I]RHM-4 and a significant reduction in binding of [3H]DTG. TMEM97 KO and PGRMC1 KO resulted in an equal reduction in the rate of uptake of fluorescently-tagged or 3H-labeled LDL, and knocking out both proteins did not result in a further rate of reduction of LDL uptake. Confocal microscopy and Proximity Ligation Assay studies indicated a clear co-localization of LDLR, PGRMC1 and TMEM97. These data indicate that the formation of a ternary complex of LDLR-PGRMC1-TMEM97 is necessary for the rapid internalization of LDL by LDLR.},
}
@article {pmid30217040,
year = {2018},
author = {Pan, Q and Wang, J and Gao, Y and Cui, H and Liu, C and Qi, X and Zhang, Y and Wang, Y and Wang, X},
title = {The Natural Large Genomic Deletion Is Unrelated to the Increased Virulence of the Novel Genotype Fowl Adenovirus 4 Recently Emerged in China.},
journal = {Viruses},
volume = {10},
number = {9},
pages = {},
doi = {10.3390/v10090494},
pmid = {30217040},
issn = {1999-4915},
mesh = {Adenoviridae/classification/*genetics ; Adenoviridae Infections/*veterinary ; Animals ; CRISPR-Cas Systems ; Chickens ; China/epidemiology ; Ducks ; Gene Editing ; *Genome, Viral ; Genotype ; Phylogeny ; Poultry Diseases/diagnosis/epidemiology/*virology ; *Sequence Deletion ; Virulence/genetics ; },
abstract = {Since 2015, severe hydropericardium-hepatitis syndrome (HHS), caused by a highly pathogenic fowl adenovirus 4 (FAdV-4), emerged in China. In our previous study, the FAdV-4 has been identified as a novel genotype with a unique 1966-bp nucleotide deletion (1966Del) between open reading frame 42 and 43. In this study, the natural 1966Del was frequently identified among 17 clinical isolates and other reported Chinese clinical strains. To investigate the relationship between 1966Del and the increased virulence of the novel FAdV-4, a CRISPR/Cas9 operating platform for FAdV-4 was developed for the first time in this study. Based on this platform, a Re1966 strain was rescued, inserted the relative 1966Del sequence of a nonpathogenic strain KR5. In the pathogenicity study, the Re1966 strain retained high virulence for specific-pathogen-free chickens, similar to the parental wild-type HLJFAd15, although the survival time of chickens infected with Re1966 was much longer. Therefore, the natural 1966Del was identified as a non-essential site for the increased virulence of the emerged novel FAdV-4. Although further research on the virulence-determining region or point within the genome of the novel FAdV-4 is needed, the CRISPR/Cas9 operating platform for the novel FAdV-4 was developed and successfully applied to edit the genomic DNA for the first time, and it provides a novel powerful tool for both basic virology studies and vaccine vector development of FAdVs.},
}
@article {pmid30210230,
year = {2018},
author = {Zelinka, CP and Sotolongo-Lopez, M and Fadool, JM},
title = {Targeted disruption of the endogenous zebrafish rhodopsin locus as models of rapid rod photoreceptor degeneration.},
journal = {Molecular vision},
volume = {24},
number = {},
pages = {587-602},
pmid = {30210230},
issn = {1090-0535},
support = {R21 EY025410/EY/NEI NIH HHS/United States ; },
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Codon, Terminator/genetics ; *Disease Models, Animal ; Frameshift Mutation/genetics ; Gene Targeting ; Immunoblotting ; Polymorphism, Restriction Fragment Length ; RNA, Messenger/genetics ; Retinal Degeneration/*genetics/pathology ; Retinal Rod Photoreceptor Cells/*pathology ; Rhodopsin/*genetics ; Zebrafish/*genetics ; Zebrafish Proteins/*genetics ; },
abstract = {Purpose: Retinitis pigmentosa (RP) is a collection of genetic disorders that results in the degeneration of light-sensitive photoreceptor cells, leading to blindness. RP is associated with more than 70 loci that may display dominant or recessive modes of inheritance, but mutations in the gene encoding the visual pigment rhodopsin (RHO) are the most frequent cause. In an effort to develop precise mutations in zebrafish as novel models of photoreceptor degeneration, we describe the generation and germline transmission of a series of novel clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-induced insertion and deletion (indel) mutations in the major zebrafish rho locus, rh1-1.<br><br>Methods: One- or two-cell staged zebrafish embryos were microinjected with in vitro transcribed mRNA encoding Cas9 and a single guide RNA (gRNA). Mutations were detected by restriction fragment length polymorphism (RFLP) and DNA sequence analyses in injected embryos and offspring. Immunolabeling with rod- and cone-specific antibodies was used to test for histological and cellular changes.<br><br>Results: Using gRNAs that targeted highly conserved regions of rh1-1, a series of dominant and recessive alleles were recovered that resulted in the rapid degeneration of rod photoreceptors. No effect on cones was observed. Targeting the 5'-coding sequence of rh1-1 led to the recovery of several indels similar to disease-associated alleles. A frame shift mutation leading to a premature stop codon (T17*) resulted in rod degeneration when brought to homozygosity. Immunoblot and fluorescence labeling with a Rho-specific antibody suggest that this is indeed a null allele, illustrating that the Rho expression is essential for rod survival. Two in-frame mutations were recovered that disrupted the highly conserved N-linked glycosylation consensus sequence at N15. Larvae heterozygous for either of the alleles demonstrated rapid rod degeneration. Targeting of the 3'-coding region of rh1-1 resulted in the recovery of an allele encoding a premature stop codon (S347*) upstream of the conserved VSPA sorting sequence and a second in-frame allele that disrupted the putative phosphorylation site at S339. Both alleles resulted in rod death in a dominant inheritance pattern. Following the loss of the targeting sequence, immunolabeling for Rho was no longer restricted to the rod outer segment, but it was also localized to the plasma membrane.<br><br>Conclusions: The efficiency of CRISPR/Cas9 for gene targeting, coupled with the large number of mutations associated with RP, provided a backdrop for the rapid isolation of novel alleles in zebrafish that phenocopy disease. These novel lines will provide much needed in-vivo models for high throughput screens of compounds or genes that protect from photoreceptor degeneration.},
}
@article {pmid30076486,
year = {2018},
author = {Kuruvilla, J and Sasmita, AO and Ling, APK},
title = {Therapeutic potential of combined viral transduction and CRISPR/Cas9 gene editing in treating neurodegenerative diseases.},
journal = {Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology},
volume = {39},
number = {11},
pages = {1827-1835},
doi = {10.1007/s10072-018-3521-0},
pmid = {30076486},
issn = {1590-3478},
mesh = {Animals ; CRISPR-Cas Systems/*physiology ; Gene Editing/*methods ; Genetic Therapy/*methods ; Genetic Vectors ; Humans ; Neurodegenerative Diseases/*genetics/*therapy ; },
abstract = {BACKGROUND AND PURPOSE: The central nervous system (CNS) faces unique difficulties in attaining permanent therapy for neurodegenerative disorder (ND). Genomic level forms of therapy have garnered interest in the recent decade, with the novel CRISPR/Cas9 gene editing tool continuing to be explored due to its efficiency, safety, and adaptability to varying conditions. With the aid of viral vectors as transport vectors, the gene editing tool has produced promising in vitro and in vivo findings in study models. Thus, this review focuses on the recent advancements and update of CRISPR/Cas9 to combat neurodegenerative diseases.<br><br>METHODS: Articles detailing potential applications of CRISPR/Cas9 in neurodegenerative settings were retrieved from PubMed and Google Scholar with the keywords &quot;CRISPR,&quot; &quot;gene editing,&quot; and &quot;neurodegenerative diseases.&quot; Relevant information was collected and critically reviewed.<br><br>RESULTS: The utility of CRISPR/Cas9 coupled with viral transduction ranges from the disruption of amyloid precursor protein (APP) production at a genomic level in Alzheimer's disease (AD) to the deletion of varying exon portions of the Dmd gene in Duchenne muscular dystrophy (DMD) which would increase dystrophin expression. This usage of CRISPR/Cas9 also extends to experimentally ameliorate the neurodegenerative effects caused by viral infections.<br><br>CONCLUSION: The CRISPR/Cas9 gene editing tool is a powerful arsenal in the field of gene therapy and molecular medicine; hence, more research should be called to focus on the ample potential this tool has to offer in the field of neurodegenerative diseases.},
}
@article {pmid29321601,
year = {2018},
author = {Janssen, BD and Chen, YP and Molgora, BM and Wang, SE and Simoes-Barbosa, A and Johnson, PJ},
title = {CRISPR/Cas9-mediated gene modification and gene knock out in the human-infective parasite Trichomonas vaginalis.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {270},
doi = {10.1038/s41598-017-18442-3},
pmid = {29321601},
issn = {2045-2322},
support = {T32 AI007323/AI/NIAID NIH HHS/United States ; R33 AI119721/AI/NIAID NIH HHS/United States ; R01 AI103182/AI/NIAID NIH HHS/United States ; T32 GM007185/GM/NIGMS NIH HHS/United States ; R21 AI119721/AI/NIAID NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; Female ; *Gene Editing ; Gene Expression ; *Gene Knockout Techniques ; Gene Targeting ; Genes, Protozoan ; Genes, Reporter ; Genome, Protozoan ; Humans ; Trichomonas Vaginitis/parasitology ; Trichomonas vaginalis/*genetics ; },
abstract = {The sexually-transmitted parasite Trichomonas vaginalis infects ~1/4 billion people worldwide. Despite its prevalence and myriad adverse outcomes of infection, the mechanisms underlying T. vaginalis pathogenesis are poorly understood. Genetic manipulation of this single-celled eukaryote has been hindered by challenges presented by its complex, repetitive genome and inefficient methods for introducing DNA (i.e. transfection) into the parasite. Here, we have developed methods to increase transfection efficiency using nucleofection, with the goal of efficiently introducing multiple DNA elements into a single T. vaginalis cell. We then created DNA constructs required to express several components essential to drive CRISPR/Cas9-mediated DNA modification: guide RNA (gRNA), the Cas9 endonuclease, short oligonucleotides and large, linearized DNA templates. Using these technical advances, we have established CRISPR/Cas9-mediated repair of mutations in genes contained on circular DNA plasmids harbored by the parasite. We also engineered CRISPR/Cas9 directed homologous recombination to delete (i.e. knock out) two non-essential genes within the T. vaginalis genome. This first report of the use of the CRISPR/Cas9 system in T. vaginalis greatly expands the ability to manipulate the genome of this pathogen and sets the stage for testing of the role of specific genes in many biological processes.},
}
@article {pmid29311693,
year = {2018},
author = {Peretz, L and Besser, E and Hajbi, R and Casden, N and Ziv, D and Kronenberg, N and Gigi, LB and Sweetat, S and Khawaled, S and Aqeilan, R and Behar, O},
title = {Combined shRNA over CRISPR/cas9 as a methodology to detect off-target effects and a potential compensatory mechanism.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {93},
doi = {10.1038/s41598-017-18551-z},
pmid = {29311693},
issn = {2045-2322},
mesh = {Animals ; *CRISPR-Cas Systems ; Cell Death/genetics ; Cell Line, Tumor ; Disease Models, Animal ; Gene Knockdown Techniques ; Glioma/genetics/metabolism/pathology ; Heterografts ; Humans ; Mice ; RNA Interference ; RNA, Small Interfering/*genetics ; Semaphorins/genetics/metabolism ; },
abstract = {Inhibition of genes is a powerful approach to study their function. While RNA interference is a widely used method to achieve this goal, mounting evidence indicates that such an approach is prone to off-target effects. An alternative approach to gene function inhibition is genetic mutation, such as the CRISPR/cas9 method. A recent report, however, demonstrated that genetic mutation and inhibition of gene expression do not always give corresponding results. This can be explained by off-target effects, but it was recently shown, at least in one case, that these differences are the result of a compensatory mechanism induced only by genetic mutation. We present here a combination of RNA inhibition and CRISPR/cas9 methods to identify possible off targets as well as potential compensatory effects. This approach is demonstrated by testing a possible role for Sema4B in glioma biology, in which our results implicate Sema4B as having a critical function. In stark contrast, by using shRNA over CRISPR/cas9 combined methodology, we clearly demonstrate that the Sema4B targeted shRNA effects on cell proliferation is the result of off-target effects. Nevertheless, it also revealed that certain splice variants of Sema4B are important for the ability of glioma cells to grow as individual clones.},
}
@article {pmid29196861,
year = {2018},
author = {Lau, CH and Suh, Y},
title = {CRISPR-based strategies for studying regulatory elements and chromatin structure in mammalian gene control.},
journal = {Mammalian genome : official journal of the International Mammalian Genome Society},
volume = {29},
number = {3-4},
pages = {205-228},
doi = {10.1007/s00335-017-9727-2},
pmid = {29196861},
issn = {1432-1777},
support = {AG017242/NH/NIH HHS/United States ; GM104459/NH/NIH HHS/United States ; CA180126/NH/NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Chromatin/*chemistry ; DNA, Intergenic/genetics ; *Gene Expression Regulation ; Humans ; Mammals/*genetics ; Regulatory Sequences, Nucleic Acid/*genetics ; },
abstract = {The development of high-throughput methods has enabled the genome-wide identification of putative regulatory elements in a wide variety of mammalian cells at an unprecedented resolution. Extensive genomic studies have revealed the important role of regulatory elements and genetic variation therein in disease formation and risk. In most cases, there is only correlative evidence for the roles of these elements and non-coding changes within these elements in pathogenesis. With the advent of genome- and epigenome-editing tools based on the CRISPR technology, it is now possible to test the functional relevance of the regulatory elements and alterations on a genomic scale. Here, we review the various CRISPR-based strategies that have been developed to functionally validate the candidate regulatory elements in mammals as well as the non-coding genetic variants found to be associated with human disease. We also discuss how these synthetic biology tools have helped to elucidate the role of three-dimensional nuclear architecture and higher-order chromatin organization in shaping functional genome and controlling gene expression.},
}
@article {pmid28281536,
year = {2017},
author = {Kerr, MC and Gomez, GA and Ferguson, C and Tanzer, MC and Murphy, JM and Yap, AS and Parton, RG and Huston, WM and Teasdale, RD},
title = {Laser-mediated rupture of chlamydial inclusions triggers pathogen egress and host cell necrosis.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14729},
doi = {10.1038/ncomms14729},
pmid = {28281536},
issn = {2041-1723},
mesh = {CRISPR-Cas Systems ; Calpain/*antagonists &amp; inhibitors/genetics/metabolism ; Cell Death/radiation effects ; Chlamydia trachomatis/pathogenicity/physiology ; Cysteine Proteinase Inhibitors/pharmacology ; Gene Editing ; Genes, Reporter ; Green Fluorescent Proteins/genetics/metabolism ; HeLa Cells ; *Host-Pathogen Interactions ; Humans ; *Laser Therapy ; Leucine/analogs &amp; derivatives/pharmacology ; Luminescent Proteins/genetics/metabolism ; Microscopy, Video ; Necrosis/enzymology/genetics/*parasitology ; Time-Lapse Imaging ; },
abstract = {Remarkably little is known about how intracellular pathogens exit the host cell in order to infect new hosts. Pathogenic chlamydiae egress by first rupturing their replicative niche (the inclusion) before rapidly lysing the host cell. Here we apply a laser ablation strategy to specifically disrupt the chlamydial inclusion, thereby uncoupling inclusion rupture from the subsequent cell lysis and allowing us to dissect the molecular events involved in each step. Pharmacological inhibition of host cell calpains inhibits inclusion rupture, but not subsequent cell lysis. Further, we demonstrate that inclusion rupture triggers a rapid necrotic cell death pathway independent of BAK, BAX, RIP1 and caspases. Both processes work sequentially to efficiently liberate the pathogen from the host cytoplasm, promoting secondary infection. These results reconcile the pathogen's known capacity to promote host cell survival and induce cell death.},
}
@article {pmid30429256,
year = {2018},
author = {Strich, JR and Chertow, DS},
title = {CRISPR-Cas Biology and Infectious Diseases Applications.},
journal = {Journal of clinical microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1128/JCM.01307-18},
pmid = {30429256},
issn = {1098-660X},
abstract = {Infectious diseases remain a global threat contributing to excess morbidity and mortality annually with persistent potential for destabilizing pandemics. Improved understanding of the pathogenesis of bacteria, viruses, fungi, and parasites, along with rapid diagnosis and treatment of human infections are essential to improving infectious diseases outcomes worldwide. Genomic loci in bacteria and archea, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) proteins, function as an adaptive immune system for prokaryotes protecting against foreign invaders. CRISPR-Cas9 is now routinely applied for efficient gene editing contributing to advances in biomedical science. In the past decade improved understanding of other diverse CRISPR-Cas systems has expanded CRISPR applications, including in the field of infectious diseases. In this review, we summarize the biology of CRISPR-Cas systems and discuss existing and emerging applications to evaluate mechanisms of host-pathogen interactions, to develop accurate and portable diagnostics, and to advance prevention and treatment of infectious diseases.},
}
@article {pmid29986379,
year = {2018},
author = {Belvedere, R and Saggese, P and Pessolano, E and Memoli, D and Bizzarro, V and Rizzo, F and Parente, L and Weisz, A and Petrella, A},
title = {miR-196a Is Able to Restore the Aggressive Phenotype of Annexin A1 Knock-Out in Pancreatic Cancer Cells by CRISPR/Cas9 Genome Editing.},
journal = {International journal of molecular sciences},
volume = {19},
number = {7},
pages = {},
doi = {10.3390/ijms19071967},
pmid = {29986379},
issn = {1422-0067},
mesh = {Annexin A1/*genetics ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Movement ; Cell Proliferation ; Disease Progression ; Epithelial-Mesenchymal Transition ; Gene Editing ; Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; Humans ; MicroRNAs/genetics/*metabolism ; Neoplasm Invasiveness ; Neoplasm Metastasis ; Pancreatic Neoplasms/*genetics/*pathology ; },
abstract = {Annexin A1 (ANXA1) is a Ca2+-binding protein that is involved in pancreatic cancer (PC) progression. It is able to mediate cytoskeletal organization maintaining a malignant phenotype. Our previous studies showed that ANXA1 Knock-Out (KO) MIA PaCa-2 cells partially lost their migratory and invasive capabilities and also the metastatization process appeared affected in vivo. Here, we investigated the microRNA (miRNA) profile in ANXA1 KO cells finding that the modification in miRNA expression suggests the significant involvement of ANXA1 in PC development. In this study, we focused on miR-196a which appeared down modulated in absence of ANXA1. This miRNA is a well known oncogenic factor in several tumour models and it is able to trigger the agents of the epithelial to mesenchymal transition (EMT), like ANXA1. Our results show that the reintroduction in ANXA1 KO cells of miR-196a through the mimic sequence restored the early aggressive phenotype of MIA PaCa-2. Then, ANXA1 seems to support the expression of miR-196a and its role. On the other hand, this miRNA is able to mediate cytoskeletal dynamics and other protein functions promoting PC cell migration and invasion. This work describes the correlation between ANXA1 and specific miRNA sequences, particularly miR-196a. These results could lead to further information on ANXA1 intracellular role in PC, explaining other aspects that are apart from its tumorigenic behaviour.},
}
@article {pmid29440227,
year = {2018},
author = {Choi, JH and Wang, W and Park, D and Kim, SH and Kim, KT and Min, KT},
title = {IRES-mediated translation of cofilin regulates axonal growth cone extension and turning.},
journal = {The EMBO journal},
volume = {37},
number = {5},
pages = {},
doi = {10.15252/embj.201695266},
pmid = {29440227},
issn = {1460-2075},
mesh = {5' Untranslated Regions/genetics ; Animals ; Axons/*physiology ; Brain/embryology ; CRISPR-Cas Systems ; Cell Line ; Cell Proliferation/genetics ; Cofilin 1/*genetics/metabolism ; Growth Cones/*physiology ; Internal Ribosome Entry Sites/*genetics ; Mice ; Neurogenesis/*genetics ; Protein Biosynthesis/genetics ; RNA, Messenger/genetics ; },
abstract = {In neuronal development, dynamic rearrangement of actin promotes axonal growth cone extension, and spatiotemporal translation of local mRNAs in response to guidance cues directs axonal growth cone steering, where cofilin plays a critical role. While regulation of cofilin activity is well studied, regulatory mechanism for cofilin mRNA translation in neurons is unknown. In eukaryotic cells, proteins can be synthesized by cap-dependent or cap-independent mechanism via internal ribosome entry site (IRES)-mediated translation. IRES-mediated translation has been reported in various pathophysiological conditions, but its role in normal physiological environment is poorly understood. Here, we report that 5'UTR of cofilin mRNA contains an IRES element, and cofilin is predominantly translated by IRES-mediated mechanism in neurons. Furthermore, we show that IRES-mediated translation of cofilin is required for both axon extension and axonal growth cone steering. Our results provide new insights into the function of IRES-mediated translation in neuronal development.},
}
@article {pmid28876032,
year = {2017},
author = {Luo, W and Lin, Q and Li, X and Zhou, Z and Yang, H and Du, R and Li, H},
title = {[Efficient identification of gene knockout mutant mediated by CRISPR/Cas9 by CELⅠ crude extracts].},
journal = {Sheng wu gong cheng xue bao = Chinese journal of biotechnology},
volume = {33},
number = {5},
pages = {775-784},
doi = {10.13345/j.cjb.160388},
pmid = {28876032},
issn = {1000-3061},
mesh = {*CRISPR-Cas Systems ; *Gene Knockout Techniques ; Oryza/*genetics ; Plant Breeding ; Plant Extracts/*genetics ; },
abstract = {CRISPR/Cas9, emerged as an efficient and powerful gene editing technology, has become the mainstream genome editing technology. Constructing mutants using CRISPR/Cas9 system is of great significance to the functional study and breeding application of useful genes. As the basis of the technology, a method for identification of mutation with efficiency and lower cost is needed. In this report, we studied the factors influencing mutation detected by CEL Ⅰ crude extracts, such as the amount of protein, enzyme incubation time, PCR buffers. Under the optimized conditions, we can integrate the mutation detection steps into one-tube reaction. We used this system to examine the mutation types and frequency of rice stn1 mediated by CRISPR/Cas9. We also used this method to identify different mutation types including homozygous, heterozygous and bi-allelic mutations. The accuracy of this method reached 100% verified by sequencing. Altogether, our results showed that using CELⅠ crude extracts was an efficient and low cost method for identification of CRISPR/Cas9 mediated mutation.},
}
@article {pmid28262680,
year = {2017},
author = {Sonoiki, E and Ng, CL and Lee, MC and Guo, D and Zhang, YK and Zhou, Y and Alley, MR and Ahyong, V and Sanz, LM and Lafuente-Monasterio, MJ and Dong, C and Schupp, PG and Gut, J and Legac, J and Cooper, RA and Gamo, FJ and DeRisi, J and Freund, YR and Fidock, DA and Rosenthal, PJ},
title = {A potent antimalarial benzoxaborole targets a Plasmodium falciparum cleavage and polyadenylation specificity factor homologue.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14574},
doi = {10.1038/ncomms14574},
pmid = {28262680},
issn = {2041-1723},
mesh = {Amino Acid Sequence ; Animals ; Antimalarials/chemical synthesis/*pharmacology ; Boron Compounds/chemical synthesis/*pharmacology ; CRISPR-Cas Systems ; Catalytic Domain ; Cleavage And Polyadenylation Specificity Factor/antagonists &amp; inhibitors/*chemistry/genetics/metabolism ; Drug Resistance/genetics ; Erythrocytes/drug effects/parasitology ; Gene Editing/methods ; Humans ; Malaria/drug therapy/parasitology ; Malaria, Falciparum/drug therapy/parasitology ; Mice ; Molecular Docking Simulation ; Mutation ; Plasmodium berghei/drug effects/genetics/growth &amp; development/metabolism ; Plasmodium falciparum/*drug effects/genetics/growth &amp; development/metabolism ; Protein Binding ; Protein Interaction Domains and Motifs ; Protein Structure, Secondary ; Protozoan Proteins/antagonists &amp; inhibitors/*chemistry/genetics/metabolism ; RNA, Messenger/*genetics/metabolism ; Sequence Alignment ; Sequence Homology, Amino Acid ; Trophozoites/drug effects/genetics/growth &amp; development/metabolism ; },
abstract = {Benzoxaboroles are effective against bacterial, fungal and protozoan pathogens. We report potent activity of the benzoxaborole AN3661 against Plasmodium falciparum laboratory-adapted strains (mean IC50 32 nM), Ugandan field isolates (mean ex vivo IC50 64 nM), and murine P. berghei and P. falciparum infections (day 4 ED90 0.34 and 0.57 mg kg-1, respectively). Multiple P. falciparum lines selected in vitro for resistance to AN3661 harboured point mutations in pfcpsf3, which encodes a homologue of mammalian cleavage and polyadenylation specificity factor subunit 3 (CPSF-73 or CPSF3). CRISPR-Cas9-mediated introduction of pfcpsf3 mutations into parental lines recapitulated AN3661 resistance. PfCPSF3 homology models placed these mutations in the active site, where AN3661 is predicted to bind. Transcripts for three trophozoite-expressed genes were lost in AN3661-treated trophozoites, which was not observed in parasites selected or engineered for AN3661 resistance. Our results identify the pre-mRNA processing factor PfCPSF3 as a promising antimalarial drug target.},
}
@article {pmid28262675,
year = {2017},
author = {Lefebure, M and Tothill, RW and Kruse, E and Hawkins, ED and Shortt, J and Matthews, GM and Gregory, GP and Martin, BP and Kelly, MJ and Todorovski, I and Doyle, MA and Lupat, R and Li, J and Schroeder, J and Wall, M and Craig, S and Poortinga, G and Cameron, D and Bywater, M and Kats, L and Gearhart, MD and Bardwell, VJ and Dickins, RA and Hannan, RD and Papenfuss, AT and Johnstone, RW},
title = {Genomic characterisation of Eμ-Myc mouse lymphomas identifies Bcor as a Myc co-operative tumour-suppressor gene.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14581},
doi = {10.1038/ncomms14581},
pmid = {28262675},
issn = {2041-1723},
support = {R01 CA071540/CA/NCI NIH HHS/United States ; },
mesh = {Alleles ; Animals ; B-Lymphocytes/immunology/*metabolism/pathology ; CRISPR-Cas Systems ; Cyclin-Dependent Kinase Inhibitor p16/genetics/immunology ; Disease Models, Animal ; Gene Editing ; *Gene Expression Regulation, Neoplastic ; Gene Frequency ; Janus Kinase 2/genetics/immunology ; Lymphoma, B-Cell/*genetics/immunology/pathology ; Mice ; Mice, Transgenic ; *Mutation ; Proto-Oncogene Proteins c-myc/*genetics/immunology ; Proto-Oncogene Proteins p21(ras)/genetics/immunology ; Repressor Proteins/*genetics/immunology ; STAT5 Transcription Factor/genetics/immunology ; Transcriptome ; Tumor Suppressor Protein p53/genetics/immunology ; Whole Genome Sequencing ; },
abstract = {The Eμ-Myc mouse is an extensively used model of MYC driven malignancy; however to date there has only been partial characterization of MYC co-operative mutations leading to spontaneous lymphomagenesis. Here we sequence spontaneously arising Eμ-Myc lymphomas to define transgene architecture, somatic mutations, and structural alterations. We identify frequent disruptive mutations in the PRC1-like component and BCL6-corepressor gene Bcor. Moreover, we find unexpected concomitant multigenic lesions involving Cdkn2a loss and other cancer genes including Nras, Kras and Bcor. These findings challenge the assumed two-hit model of Eμ-Myc lymphoma and demonstrate a functional in vivo role for Bcor in suppressing tumorigenesis.},
}
@article {pmid30426198,
year = {2018},
author = {Hahn, F and Nekrasov, V},
title = {CRISPR/Cas precision: do we need to worry about off-targeting in plants?.},
journal = {Plant cell reports},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00299-018-2355-9},
pmid = {30426198},
issn = {1432-203X},
support = {BB/P016855/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {The CRISPR/Cas technology has recently become the tool of choice for targeted genome modification in plants and beyond. Although CRSIPR/Cas offers a rapid and facile way of introducing changes at genomic loci of interest, its application is associated with off-targeting, i.e. introduction of unintended mutations at off-target sites within the genome, which has been reported frequently in the mammalian field. Here we summarise the current knowledge on the precision of CRISPR/Cas in plant systems and provide a summary of state-of the-art strategies for avoiding off-target mutations, as well as unintended on-target changes, in plants. These include using natural (e.g. Cas12a) or engineered (e.g. SpCas9-HF) CRISPR/Cas nucleases characterised by higher precision, as compared to the commonly used wild type SpCas9. In addition, we discuss the usage of CRISPR/Cas nucleases in the form of ribonucleoproteins (RNPs) as an option for reducing off-targeting in plants. Finally, we conclude that the most important factor for reducing CRISPR/Cas off-targeting remains careful selection of target sequences, for which we provide an overview of available online software tools and experimental guidance.},
}
@article {pmid30425154,
year = {2018},
author = {Høyland-Kroghsbo, NM and Muñoz, KA and Bassler, BL},
title = {Temperature, by Controlling Growth Rate, Regulates CRISPR-Cas Activity in Pseudomonas aeruginosa.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
doi = {10.1128/mBio.02184-18},
pmid = {30425154},
issn = {2150-7511},
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR)-associated (CRISPR-Cas) systems are adaptive defense systems that protect bacteria and archaea from invading genetic elements. In Pseudomonas aeruginosa, quorum sensing (QS) induces the CRISPR-Cas defense system at high cell density when the risk of bacteriophage infection is high. Here, we show that another cue, temperature, modulates P. aeruginosa CRISPR-Cas. Increased CRISPR adaptation occurs at environmental (i.e., low) temperatures compared to that at body (i.e., high) temperature. This increase is a consequence of the accumulation of CRISPR-Cas complexes, coupled with reduced P. aeruginosa growth rate at the lower temperature, the latter of which provides additional time prior to cell division for CRISPR-Cas to patrol the cell and successfully eliminate and/or acquire immunity to foreign DNA. Analyses of a QS mutant and synthetic QS compounds show that the QS and temperature cues act synergistically. The diversity and level of phage encountered by P. aeruginosa in the environment exceed that in the human body, presumably warranting increased reliance on CRISPR-Cas at environmental temperatures.IMPORTANCEP. aeruginosa is a soil dwelling bacterium and a plant pathogen, and it also causes life-threatening infections in humans. Thus, P. aeruginosa thrives in diverse environments and over a broad range of temperatures. Some P. aeruginosa strains rely on the CRISPR-Cas adaptive immune system as a phage defense mechanism. Our discovery that low temperatures increase CRISPR adaptation suggests that the rarely occurring but crucial naive adaptation events may take place predominantly under conditions of slow growth, e.g., during the bacterium's soil dwelling existence and during slow growth in biofilms.},
}
@article {pmid30377319,
year = {2018},
author = {Wight, AJ},
title = {Strict EU ruling on gene-edited crops squeezes science.},
journal = {Nature},
volume = {563},
number = {7729},
pages = {15-16},
doi = {10.1038/d41586-018-07166-7},
pmid = {30377319},
issn = {1476-4687},
mesh = {Agriculture/economics/*legislation &amp; jurisprudence ; Animals ; Belgium ; Brazil ; Breeding/legislation &amp; jurisprudence ; CRISPR-Cas Systems/genetics ; Crops, Agricultural/economics/*genetics ; *European Union ; Evaluation Studies as Topic ; France ; Gene Editing/*legislation &amp; jurisprudence ; Humans ; Plants, Genetically Modified/*genetics ; },
}
@article {pmid29141997,
year = {2018},
author = {Zhang, C and Zhou, Y and Xie, S and Yin, Q and Tang, C and Ni, Z and Fei, J and Zhang, Y},
title = {CRISPR/Cas9-mediated genome editing reveals the synergistic effects of β-defensin family members on sperm maturation in rat epididymis.},
journal = {FASEB journal : official publication of the Federation of American Societies for Experimental Biology},
volume = {32},
number = {3},
pages = {1354-1363},
doi = {10.1096/fj.201700936R},
pmid = {29141997},
issn = {1530-6860},
mesh = {Animals ; *CRISPR-Cas Systems ; *Epididymis ; *Fertility ; *Gene Editing ; Gene Knockout Techniques ; Genome ; Male ; Phenotype ; Rats ; *Sperm Maturation ; Sperm Motility/*physiology ; beta-Defensins/antagonists &amp; inhibitors/*physiology ; },
abstract = {The epididymis is a male reproductive organ involved in posttesticular sperm maturation and storage, but the mechanism underlying sperm maturation remains unclear. β-Defensins (Defbs) belong to a family of small, cysteine-rich, cationic peptides that are antimicrobial and modulate the immune response. A large number of Defb genes are expressed abundantly in the male reproductive tract, especially in the epididymis. We and other groups have shown the involvement of several Defb genes in regulation of sperm function. In this study, we found that Defb23, Defb26, and Defb42 were highly expressed in specific regions of the epididymis. Rats with CRISPR/Cas9-mediated single-gene disruption of Defb23, Defb26, or Defb42 had no obvious fertility phenotypes. Those with the deletion of Defb23/ 26 or Defb23/ 26/ 42 became subfertile, and sperm isolated from the epididymal cauda of multiple-mutant rats were demonstrated decreased motility. Meanwhile, the sperm showed precocious capacitation and increased spontaneous acrosome reaction. Consistent with premature capacitation and acrosome reaction, sperm from multiple-gene-knockout rats had significantly increased intracellular calcium. These results suggest that Defb family members affect sperm maturation by a synergistic pattern in the epididymis.-Zhang, C., Zhou, Y., Xie, S., Yin, Q., Tang, C., Ni, Z., Fei, J., Zhang, Y. CRISPR/Cas9-mediated genome editing reveals the synergistic effects of β-defensin family members on sperm maturation in rat epididymis.},
}
@article {pmid29092904,
year = {2018},
author = {Kentala, H and Koponen, A and Kivelä, AM and Andrews, R and Li, C and Zhou, Y and Olkkonen, VM},
title = {Analysis of ORP2-knockout hepatocytes uncovers a novel function in actin cytoskeletal regulation.},
journal = {FASEB journal : official publication of the Federation of American Societies for Experimental Biology},
volume = {32},
number = {3},
pages = {1281-1295},
doi = {10.1096/fj.201700604R},
pmid = {29092904},
issn = {1530-6860},
mesh = {Actin Cytoskeleton/*physiology ; CRISPR-Cas Systems ; Cell Adhesion ; *Cell Movement ; Cell Proliferation ; Gene Knockout Techniques ; Hepatocytes/cytology/*physiology ; Humans ; Receptors, Steroid/genetics/*metabolism ; Signal Transduction ; },
abstract = {ORP2 is implicated in cholesterol transport, triglyceride metabolism, and adrenocortical steroid hormone production. We addressed ORP2 function in hepatocytes by generating ORP2-knockout (KO) HuH7 cells by CRISPR-Cas9 gene editing, followed by analyses of transcriptome, F-actin morphology, migration, adhesion, and proliferation. RNA sequencing of ORP2-KO cells revealed >2-fold changes in 579 mRNAs. The Ingenuity Pathway Analysis (IPA) uncovered alterations in the following functional categories: cellular movement, cell-cell signaling and interaction, cellular development, cellular function and maintenance, cellular growth and proliferation, and cell morphology. Many pathways in these categories involved actin cytoskeleton, cell migration, adhesion, or proliferation. Analysis of the ORP2 interactome uncovered 109 putative new partners. Their IPA analysis revealed Ras homolog A (RhoA) signaling as the most significant pathway. Interactions of ORP2 with SEPT9, MLC12, and ARHGAP12 were validated by independent assays. ORP2-KO resulted in abnormal F-actin morphology characterized by impaired capacity to form lamellipodia, migration defect, and impaired adhesion and proliferation. Rescue of the migration phenotype and generation of typical cell surface morphology required an intact ORP2 phosphoinositide binding site, suggesting that ORP2 function involves phosphoinositide binding and transport. The results point at a novel function of ORP2 as a lipid-sensing regulator of the actin cytoskeleton, with impacts on hepatocellular migration, adhesion, and proliferation.-Kentala, H., Koponen, A., Kivelä, A. M., Andrews, R., Li, C., Zhou, Y., Olkkonen, V. M. Analysis of ORP2-knockout hepatocytes uncovers a novel function in actin cytoskeletal regulation.},
}
@article {pmid29089387,
year = {2017},
author = {Casey, AK and Moehlman, AT and Zhang, J and Servage, KA and Krämer, H and Orth, K},
title = {Fic-mediated deAMPylation is not dependent on homodimerization and rescues toxic AMPylation in flies.},
journal = {The Journal of biological chemistry},
volume = {292},
number = {51},
pages = {21193-21204},
doi = {10.1074/jbc.M117.799296},
pmid = {29089387},
issn = {1083-351X},
support = {P40 OD018537/OD/NIH HHS/United States ; R01 EY010199/EY/NEI NIH HHS/United States ; R01 EY021922/EY/NEI NIH HHS/United States ; R01 GM115188/GM/NIGMS NIH HHS/United States ; },
mesh = {Adenosine Monophosphate/*metabolism ; Amino Acid Substitution ; Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Cell Line ; Dimerization ; Drosophila Proteins/chemistry/genetics/*metabolism ; Drosophila melanogaster/genetics ; Endoplasmic Reticulum Stress ; Eye Abnormalities/genetics/metabolism/pathology/veterinary ; Female ; Heat-Shock Proteins/*metabolism ; Homozygote ; Kinetics ; Male ; Mutation ; Nucleotidyltransferases/chemistry/genetics/*metabolism ; Organ Specificity ; *Protein Processing, Post-Translational ; Recombinant Proteins/chemistry/metabolism ; Survival Analysis ; Synthetic Lethal Mutations ; },
abstract = {Protein chaperones play a critical role in proteostasis. The activity of the major endoplasmic reticulum chaperone BiP (GRP78) is regulated by Fic-mediated AMPylation during resting states. By contrast, during times of stress, BiP is deAMPylated. Here, we show that excessive AMPylation by a constitutively active FicE247G mutant is lethal in Drosophila This lethality is cell-autonomous, as directed expression of the mutant FicE247G to the fly eye does not kill the fly but rather results in a rough and reduced eye. Lethality and eye phenotypes are rescued by the deAMPylation activity of wild-type Fic. Consistent with Fic acting as a deAMPylation enzyme, its activity was both time- and concentration-dependent. Furthermore, Fic deAMPylation activity was sufficient to suppress the AMPylation activity mediated by the constitutively active FicE247G mutant in Drosophila S2 lysates. Further, we show that the dual enzymatic activity of Fic is, in part, regulated by Fic dimerization, as loss of this dimerization increases AMPylation and reduces deAMPylation of BiP.},
}
@article {pmid28322317,
year = {2017},
author = {Park, JY and Moon, BY and Park, JW and Thornton, JA and Park, YH and Seo, KS},
title = {Genetic engineering of a temperate phage-based delivery system for CRISPR/Cas9 antimicrobials against Staphylococcus aureus.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {44929},
doi = {10.1038/srep44929},
pmid = {28322317},
issn = {2045-2322},
support = {P20 GM103646/GM/NIGMS NIH HHS/United States ; P20 GM103436/GM/NIGMS NIH HHS/United States ; },
mesh = {Bacterial Toxins ; Bacteriophages/*physiology ; *CRISPR-Cas Systems ; *Gene Transfer Techniques ; *Genetic Engineering ; Genome, Viral ; Host Specificity ; Humans ; Plasmids/genetics ; Staphylococcus aureus/*genetics/*virology ; },
abstract = {Discovery of clustered, regularly interspaced, short palindromic repeats and the Cas9 RNA-guided nuclease (CRISPR/Cas9) system provides a new opportunity to create programmable gene-specific antimicrobials that are far less likely to drive resistance than conventional antibiotics. However, the practical therapeutic use of CRISPR/Cas9 is still questionable due to current shortcomings in phage-based delivery systems such as inefficient delivery, narrow host range, and potential transfer of virulence genes by generalized transduction. In this study, we demonstrate genetic engineering strategies to overcome these shortcomings by integrating CRISPR/Cas9 system into a temperate phage genome, removing major virulence genes from the host chromosome, and expanding host specificity of the phage by complementing tail fiber protein. This significantly improved the efficacy and safety of CRISPR/Cas9 antimicrobials to therapeutic levels in both in vitro and in vivo assays. The genetic engineering tools and resources established in this study are expected to provide an efficacious and safe CRISPR/Cas9 antimicrobial, broadly applicable to Staphylococcus aureus.},
}
@article {pmid28317879,
year = {2017},
author = {Jones, KR and Choi, U and Gao, JL and Thompson, RD and Rodman, LE and Malech, HL and Kang, EM},
title = {A Novel Method for Screening Adenosine Receptor Specific Agonists for Use in Adenosine Drug Development.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {44816},
doi = {10.1038/srep44816},
pmid = {28317879},
issn = {2045-2322},
support = {ZIA AI000988/AI/NIAID NIH HHS/United States ; ZIA AI000989/AI/NIAID NIH HHS/United States ; },
mesh = {Adenosine/metabolism ; CRISPR-Cas Systems ; Calcium/metabolism ; Cells, Cultured ; Drug Discovery/*methods ; Drug Evaluation, Preclinical/methods ; Flow Cytometry ; Gene Expression ; Gene Knockout Techniques ; Gene Targeting ; Humans ; K562 Cells ; Purinergic P1 Receptor Agonists/*chemistry/*pharmacology ; Receptors, Purinergic P1/chemistry/classification/*genetics/*metabolism ; },
abstract = {Agonists that target the A1, A2A, A2B and A3 adenosine receptors have potential to be potent treatment options for a number of diseases, including autoimmune diseases, cardiovascular disease and cancer. Because each of these adenosine receptors plays a distinct role throughout the body, obtaining highly specific receptor agonists is essential. Of these receptors, the adenosine A2AR and A2BR share many sequence and structural similarities but highly differ in their responses to inflammatory stimuli. Our laboratory, using a combination of specially developed cell lines and calcium release analysis hardware, has created a new and faster method for determining specificity of synthetic adenosine agonist compounds for the A2A and A2B receptors in human cells. A2A receptor expression was effectively removed from K562 cells, resulting in the development of a distinct null line. Using HIV-lentivector and plasmid DNA transfection, we also developed A2A and A2B receptor over-expressing lines. As adenosine is known to cause changes in intracellular calcium levels upon addition to cell culture, calcium release can be determined in these cell lines upon compound addition, providing a functional readout of receptor activation and allowing us to isolate the most specific adenosine agonist compounds.},
}
@article {pmid28291770,
year = {2017},
author = {Yu, W and Mookherjee, S and Chaitankar, V and Hiriyanna, S and Kim, JW and Brooks, M and Ataeijannati, Y and Sun, X and Dong, L and Li, T and Swaroop, A and Wu, Z},
title = {Nrl knockdown by AAV-delivered CRISPR/Cas9 prevents retinal degeneration in mice.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14716},
doi = {10.1038/ncomms14716},
pmid = {28291770},
issn = {2041-1723},
mesh = {Animals ; Basic-Leucine Zipper Transcription Factors/*genetics ; CRISPR-Cas Systems ; Cell Survival/*genetics ; Dependovirus ; Eye Proteins/*genetics ; Gene Editing/methods ; Gene Knockdown Techniques ; Mice ; Retinal Cone Photoreceptor Cells/cytology/*metabolism ; Retinal Degeneration/*genetics ; Retinal Rod Photoreceptor Cells/cytology/*metabolism ; Retinitis Pigmentosa/genetics ; },
abstract = {In retinitis pigmentosa, loss of cone photoreceptors leads to blindness, and preservation of cone function is a major therapeutic goal. However, cone loss is thought to occur as a secondary event resulting from degeneration of rod photoreceptors. Here we report a genome editing approach in which adeno-associated virus (AAV)-mediated CRISPR/Cas9 delivery to postmitotic photoreceptors is used to target the Nrl gene, encoding for Neural retina-specific leucine zipper protein, a rod fate determinant during photoreceptor development. Following Nrl disruption, rods gain partial features of cones and present with improved survival in the presence of mutations in rod-specific genes, consequently preventing secondary cone degeneration. In three different mouse models of retinal degeneration, the treatment substantially improves rod survival and preserves cone function. Our data suggest that CRISPR/Cas9-mediated NRL disruption in rods may be a promising treatment option for patients with retinitis pigmentosa.},
}
@article {pmid28290446,
year = {2017},
author = {Qin, P and Parlak, M and Kuscu, C and Bandaria, J and Mir, M and Szlachta, K and Singh, R and Darzacq, X and Yildiz, A and Adli, M},
title = {Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14725},
doi = {10.1038/ncomms14725},
pmid = {28290446},
issn = {2041-1723},
support = {R01 GM094522/GM/NIGMS NIH HHS/United States ; R01 GM118773/GM/NIGMS NIH HHS/United States ; U01 EB021236/EB/NIBIB NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems ; Cell Cycle/*genetics ; Cell Line ; Cell Line, Tumor ; Cell Nucleus/*metabolism/ultrastructure ; Chromatin/*metabolism/ultrastructure ; Feasibility Studies ; Genetic Loci ; HEK293 Cells ; HeLa Cells ; Humans ; Intravital Microscopy ; Microscopy, Confocal ; RNA, Guide/*metabolism ; Retinal Pigment Epithelium/cytology ; },
abstract = {Imaging chromatin dynamics is crucial to understand genome organization and its role in transcriptional regulation. Recently, the RNA-guidable feature of CRISPR-Cas9 has been utilized for imaging of chromatin within live cells. However, these methods are mostly applicable to highly repetitive regions, whereas imaging regions with low or no repeats remains as a challenge. To address this challenge, we design single-guide RNAs (sgRNAs) integrated with up to 16 MS2 binding motifs to enable robust fluorescent signal amplification. These engineered sgRNAs enable multicolour labelling of low-repeat-containing regions using a single sgRNA and of non-repetitive regions with as few as four unique sgRNAs. We achieve tracking of native chromatin loci throughout the cell cycle and determine differential positioning of transcriptionally active and inactive regions in the nucleus. These results demonstrate the feasibility of our approach to monitor the position and dynamics of both repetitive and non-repetitive genomic regions in live cells.},
}
@article {pmid28195176,
year = {2017},
author = {Liu, NQ and Ter Huurne, M and Nguyen, LN and Peng, T and Wang, SY and Studd, JB and Joshi, O and Ongen, H and Bramsen, JB and Yan, J and Andersen, CL and Taipale, J and Dermitzakis, ET and Houlston, RS and Hubner, NC and Stunnenberg, HG},
title = {The non-coding variant rs1800734 enhances DCLK3 expression through long-range interaction and promotes colorectal cancer progression.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14418},
doi = {10.1038/ncomms14418},
pmid = {28195176},
issn = {2041-1723},
mesh = {Alleles ; CRISPR-Cas Systems ; Cell Line, Tumor ; Colonic Neoplasms/*genetics ; Colorectal Neoplasms/*genetics/metabolism ; DNA Methylation ; DNA-Binding Proteins ; *Disease Progression ; Epigenesis, Genetic ; Genetic Predisposition to Disease ; Genome-Wide Association Study ; Humans ; Intracellular Signaling Peptides and Proteins/*genetics/*metabolism ; MutL Protein Homolog 1/genetics ; Polymorphism, Single Nucleotide ; Promoter Regions, Genetic ; Protein-Serine-Threonine Kinases/*genetics/*metabolism ; Proteome ; Proteomics ; Transcription Factors ; },
abstract = {Genome-wide association studies have identified a great number of non-coding risk variants for colorectal cancer (CRC). To date, the majority of these variants have not been functionally studied. Identification of allele-specific transcription factor (TF) binding is of great importance to understand regulatory consequences of such variants. A recently developed proteome-wide analysis of disease-associated SNPs (PWAS) enables identification of TF-DNA interactions in an unbiased manner. Here we perform a large-scale PWAS study to comprehensively characterize TF-binding landscape that is associated with CRC, which identifies 731 allele-specific TF binding at 116 CRC risk loci. This screen identifies the A-allele of rs1800734 within the promoter region of MLH1 as perturbing the binding of TFAP4 and consequently increasing DCLK3 expression through a long-range interaction, which promotes cancer malignancy through enhancing expression of the genes related to epithelial-to-mesenchymal transition.},
}
@article {pmid28176758,
year = {2017},
author = {Koirala, P and Huang, J and Ho, TT and Wu, F and Ding, X and Mo, YY},
title = {LncRNA AK023948 is a positive regulator of AKT.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14422},
doi = {10.1038/ncomms14422},
pmid = {28176758},
issn = {2041-1723},
support = {R01 CA154989/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; Breast/pathology ; Breast Neoplasms/*genetics/mortality/pathology ; CRISPR-Cas Systems ; Class Ia Phosphatidylinositol 3-Kinase/genetics/metabolism ; DEAD-box RNA Helicases/genetics/metabolism ; Disease Progression ; Female ; *Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; Humans ; MCF-7 Cells ; Mice, Nude ; Neoplasm Proteins/genetics/metabolism ; Proto-Oncogene Proteins c-akt/*genetics/metabolism ; RNA, Long Noncoding/genetics/*metabolism ; RNA, Small Interfering/metabolism ; Up-Regulation ; Xenograft Model Antitumor Assays ; },
abstract = {Despite the overwhelming number of human long non-coding RNAs (lncRNAs) reported so far, little is known about their physiological functions for the majority of them. The present study uses a CRISPR/Cas9-based synergistic activation mediator (SAM) system to identify potential lncRNAs capable of regulating AKT activity. Among lncRNAs identified from this screen, we demonstrate that AK023948 is a positive regulator for AKT. Knockout of AK023948 suppresses, whereas rescue with AK023948 restores the AKT activity. Mechanistically, AK023948 functionally interacts with DHX9 and p85. Importantly, AK023948 is required for the interaction between DHX9 and p85 to hence the p85 stability and promote AKT activity. Finally, AK023948 is upregulated in breast cancer; interrogation of TCGA data set indicates that upregulation of DHX9 in breast cancer is associated with poor survival. Together, this study demonstrates two previously uncharacterized factors AK023948 and DHX9 as important players in the AKT pathway, and that their upregulation may contribute to breast tumour progression.},
}
@article {pmid30354961,
year = {2018},
author = {Pasricha, SR and Drakesmith, H},
title = {Hemoglobinopathies in the Fetal Position.},
journal = {The New England journal of medicine},
volume = {379},
number = {17},
pages = {1675-1677},
doi = {10.1056/NEJMcibr1809628},
pmid = {30354961},
issn = {1533-4406},
mesh = {Anemia, Sickle Cell/*drug therapy/genetics ; CRISPR-Cas Systems ; Carrier Proteins/genetics ; Erythroid Cells/metabolism ; Fetal Hemoglobin/*genetics ; *Gene Expression Regulation ; Humans ; Molecular Targeted Therapy ; eIF-2 Kinase/*antagonists &amp; inhibitors/genetics/metabolism ; },
}
@article {pmid30151606,
year = {2018},
author = {Dong, Z and Huang, L and Dong, F and Hu, Z and Qin, Q and Long, J and Cao, M and Chen, P and Lu, C and Pan, MH},
title = {Establishment of a baculovirus-inducible CRISPR/Cas9 system for antiviral research in transgenic silkworms.},
journal = {Applied microbiology and biotechnology},
volume = {102},
number = {21},
pages = {9255-9265},
doi = {10.1007/s00253-018-9295-8},
pmid = {30151606},
issn = {1432-0614},
support = {31472153//National Natural Science Foundation of China/ ; 31572466//National Natural Science Foundation of China/ ; CARS-18//China Agriculture Research System/ ; },
mesh = {Animals ; Animals, Genetically Modified/*genetics ; Baculoviridae/*genetics ; Bombyx/*genetics/virology ; CRISPR-Cas Systems/*genetics ; Gene Targeting/methods ; Genetic Vectors/genetics ; Nucleopolyhedrovirus/genetics ; Pest Control/methods ; Promoter Regions, Genetic/genetics ; Transcription, Genetic/genetics ; },
abstract = {The CRISPR/Cas9 system is a powerful genetic engineering technique that has been widely used in gene therapy, as well as in the development of novel antimicrobials and transgenic insects. However, several challenges, including the lack of effective host target genes and the off-target effects, limit the application of CRISPR/Cas9 in insects. To mitigate these difficulties, we established a highly efficient virus-inducible CRISPR/Cas9 system in transgenic silkworms. This system includes the baculovirus-inducible promoter 39K, which directs transcription of the gene encoding, the Cas9 protein, and the U6 promoter which targets the sgATAD3A site of the ATPase family AAA domain-containing protein 3 (ATAD3A) gene. The double-positive transgenic line sgATAD3A×39K-Cas9 (ATAD3A-KO) was obtained by hybridization; antiviral activity in this hybrid transgenic line is induced only after Bombyx mori nucleopolyhedrovirus (BmNPV) infection. The BmNPV-inducible system significantly reduced off-target effects and did not affect the economically important characteristics of the transgenic silkworms. Most importantly, this novel system efficiently and consistently edited target genes, inhibiting BmNPV replication after the transgenic silkworms were inoculated with occlusion bodies (OBs). The suppression of BmNPV by the virus-inducible system was comparable to that of the stably expressed CRISPR/Cas9 system. Therefore, we successfully established a highly efficient BmNPV-inducible ATAD3A-KO transgenic silkworm line, with improved gene targeting specificity and antiviral efficiency. Our study thereby provides insights into the treatment of infectious diseases and into the control of insect pests.},
}
@article {pmid29604353,
year = {2018},
author = {Wang, S and Hong, W and Dong, S and Zhang, ZT and Zhang, J and Wang, L and Wang, Y},
title = {Genome engineering of Clostridium difficile using the CRISPR-Cas9 system.},
journal = {Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases},
volume = {24},
number = {10},
pages = {1095-1099},
doi = {10.1016/j.cmi.2018.03.026},
pmid = {29604353},
issn = {1469-0691},
mesh = {Animals ; Bacterial Proteins/genetics ; CRISPR-Cas Systems/*genetics ; Clostridium difficile/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Deletion ; Genetic Engineering/methods ; Genome, Bacterial/genetics ; Humans ; Plasmids/genetics ; },
abstract = {OBJECTIVES: Clostridium difficile is a notorious pathogenic species that can cause severe gastrointestinal infections in humans and animals. C. difficile infection (CDI) results in thousands of deaths worldwide every year. The elucidation of related mechanisms of CDI and exploration of potential therapeutic strategies are largely delayed due to the lack of efficient genetic engineering tools for C. difficile strains.<br><br>METHODS: Plasmids carrying the CRISPR-Cas9 system were constructed and transformed into C. difficile through conjugation. Mutants were identified using colony PCR with primers annealing to the regions flanking the target gene deletion/integration locus. Heat-survival assay was used to compare the sporulation frequency between the mutant with spo0A deletion and the wild type strain. The fluorescence in the mutant with the insertion of the green fluorescent protein (GFP) gene was inspected under a fluorescent microscope.<br><br>RESULTS: An efficient genome editing tool was developed for C. difficile based on the CRISPR-Cas9 system. With this tool, spo0A was deleted with a 100% mutation efficiency. Conversely, an anaerobic GFP gene was successfully inserted into the C. difficile chromosome (with a mutation efficiency of 80%).<br><br>CONCLUSIONS: The developed CRISPR-Cas9-based genome engineering tool will facilitate functional genomic studies in C. difficile as well as the elucidation of mechanisms related to host-bacteria interaction and pathogenesis of CDI. This will be highly beneficial for the development of innovative strategies for CDI diagnostics and therapies.},
}
@article {pmid29540148,
year = {2018},
author = {Vazquez, N and Sanchez, L and Marks, R and Martinez, E and Fanniel, V and Lopez, A and Salinas, A and Flores, I and Hirschmann, J and Gilkerson, R and Schuenzel, E and Dearth, R and Halaby, R and Innis-Whitehouse, W and Keniry, M},
title = {A protocol for custom CRISPR Cas9 donor vector construction to truncate genes in mammalian cells using pcDNA3 backbone.},
journal = {BMC molecular biology},
volume = {19},
number = {1},
pages = {3},
doi = {10.1186/s12867-018-0105-8},
pmid = {29540148},
issn = {1471-2199},
support = {UTRGV College of Sciences (COS) Seed Grant//UTRGV COS/International ; NIH 1SC3GM11666901/GM/NIGMS NIH HHS/United States ; USDA H.S.I. 2016-38422-25760//National Institute of Food and Agriculture/International ; 1463991//National Science Foundation/International ; NIH 5R25GM10086606/GM/NIGMS NIH HHS/United States ; USDA Step 2 2015-38422-24061//National Institute of Food and Agriculture/International ; NSF 1463991//National Science Foundation/International ; NSF Advance 1209210//National Science Foundation/International ; HHMI 52007568/HHMI/Howard Hughes Medical Institute/United States ; SC3 GM116669/GM/NIGMS NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; Cell Line ; Deoxyribonuclease I/metabolism ; Forkhead Box Protein O3/*genetics ; Gene Editing/*methods ; Genetic Vectors ; HEK293 Cells ; Homologous Recombination ; Humans ; Male ; Mutation ; Plasmids/*genetics ; RNA, Guide/metabolism ; },
abstract = {BACKGROUND: Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided adaptive immune systems are found in prokaryotes to defend cells from foreign DNA. CRISPR Cas9 systems have been modified and employed as genome editing tools in wide ranging organisms. Here, we provide a detailed protocol to truncate genes in mammalian cells using CRISPR Cas9 editing. We describe custom donor vector construction using Gibson assembly with the commonly utilized pcDNA3 vector as the backbone.<br><br>RESULTS: We describe a step-by-step method to truncate genes of interest in mammalian cell lines using custom-made donor vectors. Our method employs 2 guide RNAs, mutant Cas9D10A nickase (Cas9 = CRISPR associated sequence 9), and a custom-made donor vector for homologous recombination to precisely truncate a gene of interest with a selectable neomycin resistance cassette (NPTII: Neomycin Phosphotransferase II). We provide a detailed protocol on how to design and construct a custom donor vector using Gibson assembly (and the commonly utilized pcDNA3 vector as the backbone) allowing researchers to obtain specific gene modifications of interest (gene truncation, gene deletion, epitope tagging or knock-in mutation). Selection of mutants in mammalian cell lines with G418 (Geneticin) combined with several screening methods: western blot analysis, polymerase chain reaction, and Sanger sequencing resulted in streamlined mutant isolation. Proof of principle experiments were done in several mammalian cell lines.<br><br>CONCLUSIONS: Here we describe a detailed protocol to employ CRISPR Cas9 genome editing to truncate genes of interest using the commonly employed expression vector pcDNA3 as the backbone for the donor vector. Providing a detailed protocol for custom donor vector design and construction will enable researchers to develop unique genome editing tools. To date, detailed protocols for CRISPR Cas9 custom donor vector construction are limited (Lee et al. in Sci Rep 5:8572, 2015; Ma et al. in Sci Rep 4:4489, 2014). Custom donor vectors are commercially available, but can be expensive. Our goal is to share this protocol to aid researchers in performing genetic investigations that require custom donor vectors for specialized applications (specific gene truncations, knock-in mutations, and epitope tagging applications).},
}
@article {pmid28917642,
year = {2018},
author = {Timin, AS and Muslimov, AR and Lepik, KV and Epifanovskaya, OS and Shakirova, AI and Mock, U and Riecken, K and Okilova, MV and Sergeev, VS and Afanasyev, BV and Fehse, B and Sukhorukov, GB},
title = {Efficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and hybrid microcarriers.},
journal = {Nanomedicine : nanotechnology, biology, and medicine},
volume = {14},
number = {1},
pages = {97-108},
doi = {10.1016/j.nano.2017.09.001},
pmid = {28917642},
issn = {1549-9642},
mesh = {*CRISPR-Cas Systems ; Drug Carriers ; Fluorescence ; *Gene Editing ; Gene Transfer Techniques ; Green Fluorescent Proteins/antagonists &amp; inhibitors/genetics/metabolism ; HEK293 Cells ; Humans ; Lycopersicon esculentum/genetics/*metabolism ; Polymers/*chemistry ; Silicon Dioxide/chemistry ; },
abstract = {CRISPR-Cas9 is a revolutionary genome-editing technology that has enormous potential for the treatment of genetic diseases. However, the lack of efficient and safe, non-viral delivery systems has hindered its clinical application. Here, we report on the application of polymeric and hybrid microcarriers, made of degradable polymers such as polypeptides and polysaccharides and modified by silica shell, for delivery of all CRISPR-Cas9 components. We found that these microcarriers mediate more efficient transfection than a commercially available liposome-based transfection reagent (>70% vs. <50% for mRNA, >40% vs. 20% for plasmid DNA). For proof-of-concept, we delivered CRISPR-Cas9 components using our capsules to dTomato-expressing HEK293T cells-a model, in which loss of red fluorescence indicates successful gene editing. Notably, transfection of indicator cells translated in high-level dTomato knockout in approx. 70% of transfected cells. In conclusion, we have provided proof-of-principle that our micro-sized containers represent promising non-viral platforms for efficient and safe gene editing.},
}
@article {pmid28803899,
year = {2017},
author = {Yang, N and Wang, R and Zhao, Y},
title = {Revolutionize Genetic Studies and Crop Improvement with High-Throughput and Genome-Scale CRISPR/Cas9 Gene Editing Technology.},
journal = {Molecular plant},
volume = {10},
number = {9},
pages = {1141-1143},
doi = {10.1016/j.molp.2017.08.001},
pmid = {28803899},
issn = {1752-9867},
support = {R01 GM114660/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems/*genetics ; Crops, Agricultural/*genetics/growth &amp; development ; Gene Editing/*methods ; *Genomics ; },
}
@article {pmid28645639,
year = {2017},
author = {Meng, X and Yu, H and Zhang, Y and Zhuang, F and Song, X and Gao, S and Gao, C and Li, J},
title = {Construction of a Genome-Wide Mutant Library in Rice Using CRISPR/Cas9.},
journal = {Molecular plant},
volume = {10},
number = {9},
pages = {1238-1241},
doi = {10.1016/j.molp.2017.06.006},
pmid = {28645639},
issn = {1752-9867},
mesh = {CRISPR-Cas Systems/*genetics ; *Gene Library ; *Genomics ; *Mutation ; Oryza/*genetics ; },
}
@article {pmid28645638,
year = {2017},
author = {Lu, Y and Ye, X and Guo, R and Huang, J and Wang, W and Tang, J and Tan, L and Zhu, JK and Chu, C and Qian, Y},
title = {Genome-wide Targeted Mutagenesis in Rice Using the CRISPR/Cas9 System.},
journal = {Molecular plant},
volume = {10},
number = {9},
pages = {1242-1245},
doi = {10.1016/j.molp.2017.06.007},
pmid = {28645638},
issn = {1752-9867},
mesh = {Base Sequence ; CRISPR-Cas Systems/*genetics ; Genome, Plant/*genetics ; Mutagenesis/*genetics ; },
}
@article {pmid28315751,
year = {2017},
author = {Wang, M and Lu, Y and Botella, JR and Mao, Y and Hua, K and Zhu, JK},
title = {Gene Targeting by Homology-Directed Repair in Rice Using a Geminivirus-Based CRISPR/Cas9 System.},
journal = {Molecular plant},
volume = {10},
number = {7},
pages = {1007-1010},
doi = {10.1016/j.molp.2017.03.002},
pmid = {28315751},
issn = {1752-9867},
mesh = {CRISPR-Cas Systems/*genetics ; DNA Repair/*genetics ; Geminiviridae/genetics/*physiology ; Gene Targeting/*methods ; Oryza/*genetics ; *Sequence Homology, Nucleic Acid ; },
}
@article {pmid28272508,
year = {2017},
author = {Mittal, K and Choi, DH and Ogden, A and Donthamsetty, S and Melton, BD and Gupta, MV and Pannu, V and Cantuaria, G and Varambally, S and Reid, MD and Jonsdottir, K and Janssen, EA and Aleskandarany, MA and Ellis, IO and Rakha, EA and Rida, PC and Aneja, R},
title = {Amplified centrosomes and mitotic index display poor concordance between patient tumors and cultured cancer cells.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {43984},
doi = {10.1038/srep43984},
pmid = {28272508},
issn = {2045-2322},
support = {U01 CA179671/CA/NCI NIH HHS/United States ; R01 CA169127/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; Breast Neoplasms/metabolism/*pathology ; CRISPR-Cas Systems/genetics ; Cell Hypoxia ; Cell Line, Tumor ; Centrosome/*metabolism ; Female ; Humans ; Hypoxia-Inducible Factor 1, alpha Subunit/genetics/metabolism ; Male ; Mice ; Mice, Nude ; Microscopy, Fluorescence ; Mitotic Index ; Pancreatic Neoplasms/metabolism/*pathology ; Transplantation, Heterologous ; Urinary Bladder Neoplasms/metabolism/pathology ; },
abstract = {Centrosome aberrations (CA) and abnormal mitoses are considered beacons of malignancy. Cancer cell doubling times in patient tumors are longer than in cultures, but differences in CA between tumors and cultured cells are uncharacterized. We compare mitoses and CA in patient tumors, xenografts, and tumor cell lines. We find that mitoses are rare in patient tumors compared with xenografts and cell lines. Contrastingly, CA is more extensive in patient tumors and xenografts (~35-50% cells) than cell lines (~5-15%), although CA declines in patient-derived tumor cells over time. Intratumoral hypoxia may explain elevated CA in vivo because exposure of cultured cells to hypoxia or mimicking hypoxia pharmacologically or genetically increases CA, and HIF-1α and hypoxic gene signature expression correlate with CA and centrosomal gene signature expression in breast tumors. These results highlight the importance of utilizing low-passage-number patient-derived cell lines in studying CA to more faithfully recapitulate in vivo cellular phenotypes.},
}
@article {pmid28195574,
year = {2017},
author = {Bengtsson, NE and Hall, JK and Odom, GL and Phelps, MP and Andrus, CR and Hawkins, RD and Hauschka, SD and Chamberlain, JR and Chamberlain, JS},
title = {Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14454},
doi = {10.1038/ncomms14454},
pmid = {28195574},
issn = {2041-1723},
support = {R01 AR044533/AR/NIAMS NIH HHS/United States ; U54 AR065139/AR/NIAMS NIH HHS/United States ; U54 HD083091/HD/NICHD NIH HHS/United States ; },
mesh = {Animals ; Bacterial Proteins/genetics ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Dependovirus/genetics ; Disease Models, Animal ; Dystrophin/*genetics ; Endonucleases/genetics ; Gene Editing/*methods ; Genetic Therapy/methods ; Genetic Vectors ; High-Throughput Nucleotide Sequencing ; Male ; Mice ; Mice, Inbred mdx ; Muscle, Skeletal/physiopathology ; Muscular Dystrophy, Duchenne/*genetics/*metabolism/*physiopathology/therapy ; Mutation ; Myocardium ; Neuromuscular Diseases/therapy ; RNA, Guide ; Sequence Deletion ; },
abstract = {Gene replacement therapies utilizing adeno-associated viral (AAV) vectors hold great promise for treating Duchenne muscular dystrophy (DMD). A related approach uses AAV vectors to edit specific regions of the DMD gene using CRISPR/Cas9. Here we develop multiple approaches for editing the mutation in dystrophic mdx4cv mice using single and dual AAV vector delivery of a muscle-specific Cas9 cassette together with single-guide RNA cassettes and, in one approach, a dystrophin homology region to fully correct the mutation. Muscle-restricted Cas9 expression enables direct editing of the mutation, multi-exon deletion or complete gene correction via homologous recombination in myogenic cells. Treated muscles express dystrophin in up to 70% of the myogenic area and increased force generation following intramuscular delivery. Furthermore, systemic administration of the vectors results in widespread expression of dystrophin in both skeletal and cardiac muscles. Our results demonstrate that AAV-mediated muscle-specific gene editing has significant potential for therapy of neuromuscular disorders.},
}
@article {pmid30418590,
year = {2018},
author = {Gordeeva, J and Morozova, N and Sierro, N and Isaev, A and Sinkunas, T and Tsvetkova, K and Matlashov, M and Truncaite, L and Morgan, RD and Ivanov, NV and Siksnys, V and Zeng, L and Severinov, K},
title = {BREX system of Escherichia coli distinguishes self from non-self by methylation of a specific DNA site.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gky1125},
pmid = {30418590},
issn = {1362-4962},
abstract = {Prokaryotes evolved numerous systems that defend against predation by bacteriophages. In addition to well-known restriction-modification and CRISPR-Cas immunity systems, many poorly characterized systems exist. One class of such systems, named BREX, consists of a putative phosphatase, a methyltransferase and four other proteins. A Bacillus cereus BREX system provides resistance to several unrelated phages and leads to modification of specific motif in host DNA. Here, we study the action of BREX system from a natural Escherichia coli isolate. We show that while it makes cells resistant to phage λ infection, induction of λ prophage from cells carrying BREX leads to production of viruses that overcome the defense. The induced phage DNA contains a methylated adenine residue in a specific motif. The same modification is found in the genome of BREX-carrying cells. The results establish, for the first time, that immunity to BREX system defense is provided by an epigenetic modification.},
}
@article {pmid30418108,
year = {2018},
author = {Aung, MS and San, T and San, N and Oo, WM and Ko, PM and Thet, KT and Urushibara, N and Kawaguchiya, M and Sumi, A and Kobayashi, N},
title = {Molecular characterization of Staphylococcus argenteus in Myanmar: identification of novel genotypes/clusters in staphylocoagulase, protein A, alpha-haemolysin and other virulence factors.},
journal = {Journal of medical microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1099/jmm.0.000869},
pmid = {30418108},
issn = {1473-5644},
abstract = {PURPOSE: Staphylococcus argenteus is a novel emerging species of coagulase-positive staphylococcus that is genetically closely related to Staphylococcus aureus. To elucidate the molecular differences in the virulence factors (staphylocoagulase, protein A, alpha-haemolysin, enterotoxin-like toxin and staphylokinase) between these staphylococcal species, S. argenteus that had recently been isolated in Myanmar (five nasal isolates and four clinical isolates) were analysed.<br><br>METHODOLOGY: The nucleotide sequences of the virulence factors were determined by PCR and direct sequencing, followed by phylogenetic analysis by mega6 and multiple alignment by clustalw using the published sequence data for S. aureus and S. argenteus.<br><br>RESULTS: Six S. argenteus isolates belonged to MLST sequence type (ST) 2250, while others belonged to ST4625, ST2198 and ST2854. The novel staphylocoagulase (coa) genotype XIV and the novel coa-XI subtype (XId) were identified in an ST2198 isolate and all other isolates, respectively. Among the S. argenteus isolates, the protein A and alpha-haemolysin genes showed high sequence identity (96-98 % and >99 %, respectively), while lower identity was observed between S. argenteus and S. aureus (88-91 % and 86 %, respectively), with both species showing phylogenetically distinct clusters. Similar findings were found for the staphylococcal enterotoxin (SE)-like toxin genes selw, selx and sely. In contrast, the staphylokinase genes were almost identical between these two species. All of the coa-XId isolates had a CRISPR/Cas locus at the site of orfX without having SCCmec, whereas an ST2198 isolate lacked this locus.<br><br>CONCLUSION: The primary virulence factors (staphylocoagulase, protein A andalpha-haemolysin) as well as the SE-like toxins of S. argenteus were genetically discriminated from those of S. aureus, revealing the presence of the novel coa-type/subtype (coa-IXd, XIV) in S. argenteus.},
}
@article {pmid30413649,
year = {2018},
author = {Li, CJ and Jiang, C and Liu, Y and Bell, T and Ma, W and Ye, Y and Huang, S and Guo, H and Zhang, H and Wang, L and Wang, J and Nomie, K and Zhang, L and Wang, M},
title = {Pleiotropic Action of Novel Bruton's Tyrosine Kinase Inhibitor BGB-3111 in Mantle Cell Lymphoma.},
journal = {Molecular cancer therapeutics},
volume = {},
number = {},
pages = {},
doi = {10.1158/1535-7163.MCT-18-0478},
pmid = {30413649},
issn = {1538-8514},
abstract = {Bruton's tyrosine kinase (BTK) is a key mediator of BCR-dependent cell growth signaling and a clinically effective therapeutic target in mantle cell lymphoma (MCL). The molecular impact of BTK inhibition remains unclear particularly in hematopoietic malignancies. We analyzed the molecular mechanisms of BTK inhibition with the novel inhibitor BGB-3111 (zanubrutinib) in MCL models. The efficacy of BGB-3111 was investigated using growth proliferation/cell viability and apoptosis assays in MCL cell lines and patient-derived xenograft (PDX) MCL cells. The activity and mechanisms of BGB-3111 were further confirmed using a cell line xenograft model, an MCL PDX mouse model, and a human phosphokinase profiler array and reverse phase protein array. Lastly, the mechanisms related to resistance to BTK inhibition were analyzed by creating cell lines with low levels of BTK using CRISPR/Cas 9 genome editing. We found that inhibition of BTK leads to suppression of tumor growth, which was mediated via potent suppression of Akt/mTOR, apoptosis, and metabolic stress. Moreover, targeted disruption of the BTK gene in MCL cells resulted in resistance to BTK inhibition and the emergence of novel survival mechanisms. Our studies suggest a general efficacy of BTK inhibition in MCL and potential drug resistance mechanism via alternative signaling pathways.},
}
@article {pmid30259067,
year = {2018},
author = {Xiang, G and Ren, J and Hai, T and Fu, R and Yu, D and Wang, J and Li, W and Wang, H and Zhou, Q},
title = {Editing porcine IGF2 regulatory element improved meat production in Chinese Bama pigs.},
journal = {Cellular and molecular life sciences : CMLS},
volume = {75},
number = {24},
pages = {4619-4628},
doi = {10.1007/s00018-018-2917-6},
pmid = {30259067},
issn = {1420-9071},
support = {31471215//National Natural Science Foundation of China/ ; 31422038//National Natural Science Foundation of China/ ; 31471395//National Natural Science Foundation of China/ ; 31501188//National Natural Science Foundation of China/ ; XDA16010205//Strategic Priority Research Program of Chinese Academy of Sciences/ ; 2015AA020307//National High-Tech Research and Development Program/ ; 2016ZX08010001//National Special Key Project for Transgenic Breeding/ ; },
mesh = {Alleles ; Animal Husbandry/methods ; Animals ; Breeding/methods ; *CRISPR-Cas Systems ; Female ; Gene Editing/*methods ; Genotype ; Insulin-Like Growth Factor II/*genetics ; *Introns ; Male ; Meat/analysis ; Mutation ; Phenotype ; *Regulatory Sequences, Nucleic Acid ; Swine/*genetics ; },
abstract = {Insulin-like growth factor 2 (IGF2) is an important growth factor, which promotes growth and development in mammals during fetal and postnatal stages. Using CRISPR-Cas9 system, we generated multiple founder pigs containing 12 different mutant alleles around a regulatory element within the intron 3 of IGF2 gene. Crossing two male founders passed four mutant alleles onto F1 generation, and these mutations abolished repressor ZBED6 binding and rendered this regulatory element nonfunctional. Both founders and F1 animals showed significantly faster growth, without affecting meat quality. These results indicated that editing IGF2 intron 3-3072 site using CRISPR-Cas9 technology improved meat production in Bama pigs. This is the first demonstration that editing non-coding region can improve economic traits in livestock.},
}
@article {pmid29079543,
year = {2017},
author = {Li, X and Xie, Y and Zhu, Q and Liu, YG},
title = {Targeted Genome Editing in Genes and cis-Regulatory Regions Improves Qualitative and Quantitative Traits in Crops.},
journal = {Molecular plant},
volume = {10},
number = {11},
pages = {1368-1370},
doi = {10.1016/j.molp.2017.10.009},
pmid = {29079543},
issn = {1752-9867},
mesh = {CRISPR-Cas Systems/genetics ; Crops, Agricultural/*genetics/growth &amp; development ; *Gene Editing ; Genes, Plant/*genetics ; Regulatory Sequences, Nucleic Acid/*genetics ; },
}
@article {pmid30355950,
year = {2018},
author = {Xu, J and Barone, S and Zahedi, K and Brooks, M and Soleimani, M},
title = {Slc4a8 in the Kidney: Expression, Subcellular Localization and Role in Salt Reabsorption.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {50},
number = {4},
pages = {1361-1375},
doi = {10.1159/000494596},
pmid = {30355950},
issn = {1421-9778},
mesh = {Animals ; Bicarbonates/metabolism ; CRISPR-Cas Systems/genetics ; Diuresis/drug effects ; Dogs ; Furosemide/pharmacology ; In Situ Hybridization ; Kidney/*metabolism ; Kidney Tubules, Collecting/metabolism ; Madin Darby Canine Kidney Cells ; Mice ; Mice, Knockout ; Oligoribonucleotides, Antisense/metabolism ; Plasmids/genetics/metabolism ; Sodium/urine ; Sodium Chloride/metabolism ; Sodium-Bicarbonate Symporters/deficiency/genetics/*metabolism ; },
abstract = {BACKGROUND/AIMS: The sodium-dependent bicarbonate transporter Slc4a8 (a.k.a NDCBE) mediates the co-transport of sodium and bicarbonate in exchange for chloride. It is abundantly detected in the brain, with low expression levels in the kidney. The cell distribution and subcellular localization of Slc4a8 in the kidney and its role in acid/base and electrolyte homeostasis has been the subject of conflicting reports. There are no conclusive localization or functional studies to pinpoint the location and demonstrate the function of Slc4a8 in the kidney.<br><br>METHODS: Molecular techniques, including RT-PCR and in situ hybridization, were performed on kidney sections and tagged epitopes were used to examine the membrane targeting of Slc4a8 in polarized kidney cells. Crispr/Cas9 was used to generate and examine Slc4a8 KO mice.<br><br>RESULTS: Zonal distribution and in situ hybridization studies showed very little expression for Slc4a8 (NDCBE) in the cortex or in cortical collecting ducts (CCD). Slc4a8 was predominantly detected in the outer and inner medullary collecting ducts (OMCD and IMCD), and was targeted to the basolateral membrane of osmotically tolerant MDCK cells. Slc4a8 KO mice did not show any abnormal salt or bicarbonate wasting under baseline conditions or in response to bicarbonate loading, salt restriction or furosemide-induced diuresis.<br><br>CONCLUSION: Slc4a8 (NDCBE) is absent in the CCD and is predominantly localized on the basolateral membrane of medullary collecting duct cells. Further, Slc4a8 deletion does not cause significant acid base or electrolyte abnormalities in pathophysiologic states. Additional studies are needed to examine the role of Slc4a8 (NDCBE) in intracellular pH and volume regulation in medullary collecting duct cells.},
}
@article {pmid28224990,
year = {2017},
author = {Senturk, S and Shirole, NH and Nowak, DG and Corbo, V and Pal, D and Vaughan, A and Tuveson, DA and Trotman, LC and Kinney, JB and Sordella, R},
title = {Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14370},
doi = {10.1038/ncomms14370},
pmid = {28224990},
issn = {2041-1723},
support = {P30 CA045508/CA/NCI NIH HHS/United States ; R01 CA137050/CA/NCI NIH HHS/United States ; U01 CA168409/CA/NCI NIH HHS/United States ; },
mesh = {A549 Cells ; Animals ; CRISPR-Associated Proteins/chemistry/metabolism ; CRISPR-Cas Systems/*genetics ; Fibroblasts/metabolism ; Gene Editing/*methods ; Humans ; Integrases/metabolism ; Lentivirus/metabolism ; Ligands ; Mice ; Protein Domains ; Protein Stability ; RNA, Guide/metabolism ; Tamoxifen/pharmacology ; Time Factors ; },
abstract = {The CRISPR/Cas9 system is a powerful tool for studying gene function. Here, we describe a method that allows temporal control of CRISPR/Cas9 activity based on conditional Cas9 destabilization. We demonstrate that fusing an FKBP12-derived destabilizing domain to Cas9 (DD-Cas9) enables conditional Cas9 expression and temporal control of gene editing in the presence of an FKBP12 synthetic ligand. This system can be easily adapted to co-express, from the same promoter, DD-Cas9 with any other gene of interest without co-modulation of the latter. In particular, when co-expressed with inducible Cre-ERT2, our system enables parallel, independent manipulation of alleles targeted by Cas9 and traditional recombinase with single-cell specificity. We anticipate this platform will be used for the systematic characterization and identification of essential genes, as well as the investigation of the interactions between functional genes.},
}
@article {pmid28181494,
year = {2017},
author = {Kim, IS and Heilmann, S and Kansler, ER and Zhang, Y and Zimmer, M and Ratnakumar, K and Bowman, RL and Simon-Vermot, T and Fennell, M and Garippa, R and Lu, L and Lee, W and Hollmann, T and Xavier, JB and White, RM},
title = {Microenvironment-derived factors driving metastatic plasticity in melanoma.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {14343},
doi = {10.1038/ncomms14343},
pmid = {28181494},
issn = {2041-1723},
support = {DP2 CA186572/CA/NCI NIH HHS/United States ; K08 AR055368/AR/NIAMS NIH HHS/United States ; P30 CA008748/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cell Differentiation/genetics ; *Cell Plasticity/genetics ; Cell Proliferation/genetics ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic ; Humans ; Melanoma/genetics/*pathology ; Models, Biological ; Neoplasm Metastasis ; Phenotype ; *Tumor Microenvironment/genetics ; Zebrafish ; Zebrafish Proteins/metabolism ; },
abstract = {Cellular plasticity is a state in which cancer cells exist along a reversible phenotypic spectrum, and underlies key traits such as drug resistance and metastasis. Melanoma plasticity is linked to phenotype switching, where the microenvironment induces switches between invasive/MITFLO versus proliferative/MITFHI states. Since MITF also induces pigmentation, we hypothesize that macrometastatic success should be favoured by microenvironments that induce a MITFHI/differentiated/proliferative state. Zebrafish imaging demonstrates that after extravasation, melanoma cells become pigmented and enact a gene expression program of melanocyte differentiation. We screened for microenvironmental factors leading to phenotype switching, and find that EDN3 induces a state that is both proliferative and differentiated. CRISPR-mediated inactivation of EDN3, or its synthetic enzyme ECE2, from the microenvironment abrogates phenotype switching and increases animal survival. These results demonstrate that after metastatic dissemination, the microenvironment provides signals to promote phenotype switching and provide proof that targeting tumour cell plasticity is a viable therapeutic opportunity.},
}
@article {pmid29907613,
year = {2018},
author = {Pflueger, C and Tan, D and Swain, T and Nguyen, T and Pflueger, J and Nefzger, C and Polo, JM and Ford, E and Lister, R},
title = {A modular dCas9-SunTag DNMT3A epigenome editing system overcomes pervasive off-target activity of direct fusion dCas9-DNMT3A constructs.},
journal = {Genome research},
volume = {28},
number = {8},
pages = {1193-1206},
doi = {10.1101/gr.233049.117},
pmid = {29907613},
issn = {1549-5469},
support = {R01 DA036906/DA/NIDA NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Binding Sites ; CRISPR-Cas Systems/*genetics ; Catalytic Domain/genetics ; Chromatin/genetics ; DNA (Cytosine-5-)-Methyltransferases/*genetics ; DNA Methylation/*genetics ; *Epigenesis, Genetic ; Gene Editing ; Promoter Regions, Genetic ; Protein Binding ; Recombinant Fusion Proteins/*genetics ; },
abstract = {Detection of DNA methylation in the genome has been possible for decades; however, the ability to deliberately and specifically manipulate local DNA methylation states in the genome has been extremely limited. Consequently, this has impeded our understanding of the direct effect of DNA methylation on transcriptional regulation and transcription factor binding in the native chromatin context. Thus, highly specific targeted epigenome editing tools are needed to address this. Recent adaptations of genome editing technologies, including fusion of the DNMT3A DNA methyltransferase catalytic domain to catalytically inactive Cas9 (dC9-D3A), have aimed to alter DNA methylation at desired loci. Here, we show that these tools exhibit consistent off-target DNA methylation deposition in the genome, limiting their capabilities to unambiguously assess the functional consequences of DNA methylation. To address this, we developed a modular dCas9-SunTag (dC9Sun-D3A) system that can recruit multiple DNMT3A catalytic domains to a target site for editing DNA methylation. dC9Sun-D3A is tunable, specific, and exhibits much higher induction of DNA methylation at target sites than the dC9-D3A direct fusion protein. Importantly, genome-wide characterization of dC9Sun-D3A binding sites and DNA methylation revealed minimal off-target protein binding and induction of DNA methylation with dC9Sun-D3A, compared to pervasive off-target methylation by dC9-D3A. Furthermore, we used dC9Sun-D3A to demonstrate the binding sensitivity to DNA methylation for CTCF and NRF1 in situ. Overall, this modular dC9Sun-D3A system enables precise DNA methylation deposition with the lowest off-target DNA methylation levels reported to date, allowing accurate functional determination of the role of DNA methylation at single loci.},
}
@article {pmid29720392,
year = {2018},
author = {Yamamoto, M and Nishio, T and Nasrallah, JB},
title = {Activation of Self-Incompatibility Signaling in Transgenic Arabidopsis thaliana Is Independent of AP2-Based Clathrin-Mediated Endocytosis.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {7},
pages = {2231-2239},
doi = {10.1534/g3.118.200231},
pmid = {29720392},
issn = {2160-1836},
mesh = {Adaptor Protein Complex 2/*metabolism ; Amino Acid Motifs ; Amino Acid Sequence ; Arabidopsis/*genetics/*metabolism ; CRISPR-Cas Systems ; Clathrin/*metabolism ; *Endocytosis ; Gene Expression ; Gene Targeting ; Mutation ; Plant Proteins/chemistry/genetics/metabolism ; Plants, Genetically Modified ; Pollination ; Protein Binding ; Protein Interaction Domains and Motifs ; *Self-Incompatibility in Flowering Plants ; *Signal Transduction ; },
abstract = {Internalization of plasma membrane (PM)-localized ligand-activated receptor kinases and their trafficking to sorting endosomes have traditionally been viewed as functioning primarily in the down-regulation of receptor signaling, but are now considered to be also essential for signaling by some receptors. A major mechanism for internalization of PM proteins is clathrin-mediated endocytosis (CME). CME is mediated by the Adaptor Protein Complex 2 (AP2), which is involved in interaction of the AP2 μ-adaptin subunit with a tyrosine-based Yxxϕ motif located in the cytoplasmic domain of the cargo protein. In this study, we investigated the role of AP2-mediated CME for signaling by the S-locus receptor kinase (SRK), a protein localized in the PM of stigma epidermal cells, which, together with its pollen coat-localized S-locus cysteine-rich (SCR) ligand, functions in the self-incompatibility (SI) response of the Brassicaceae. Using Arabidopsis thaliana plants that were made self-incompatible by transformation with an A. lyrata-derived SRK/SCR gene pair, we tested the effect on SI of site-directed mutations in each of the two Yxxϕ motifs in SRK and of a CRISPR/Cas9-induced null mutation in the AP2 μ-adaptin gene AP2M Both in vitro SRK kinase activity and the in planta SI response were abolished by substitution of tyrosine in one of the two Yxxϕ motifs, but were unaffected by elimination of either the second Yxxϕ motif or AP2M function. Thus, AP2-mediated CME is considered to be unnecessary for SRK signaling in the SI response.},
}
@article {pmid30065322,
year = {2018},
author = {Callaway, E},
title = {CRISPR plants now subject to tough GM laws in European Union.},
journal = {Nature},
volume = {560},
number = {7716},
pages = {16},
doi = {10.1038/d41586-018-05814-6},
pmid = {30065322},
issn = {1476-4687},
mesh = {Agriculture/economics/legislation &amp; jurisprudence/methods ; CRISPR-Cas Systems/*genetics ; *European Union ; *Food, Genetically Modified/economics/standards ; Gene Editing/*legislation &amp; jurisprudence/standards/trends ; Humans ; Mutagenesis ; Plant Breeding/economics/legislation &amp; jurisprudence/methods ; Research/*legislation &amp; jurisprudence/trends ; },
}
@article {pmid29882718,
year = {2018},
author = {Lim, D},
title = {Disruption and development: the evolving CRISPR patent and technology landscape.},
journal = {Pharmaceutical patent analyst},
volume = {7},
number = {4},
pages = {141-145},
doi = {10.4155/ppa-2018-0010},
pmid = {29882718},
issn = {2046-8962},
mesh = {Academies and Institutes ; *CRISPR-Cas Systems ; California ; *Patents as Topic ; Technology ; Universities ; },
}
@article {pmid29718583,
year = {2018},
author = {Hiruta, C and Kakui, K and Tollefsen, KE and Iguchi, T},
title = {Targeted gene disruption by use of CRISPR/Cas9 ribonucleoprotein complexes in the water flea Daphnia pulex.},
journal = {Genes to cells : devoted to molecular &amp; cellular mechanisms},
volume = {23},
number = {6},
pages = {494-502},
doi = {10.1111/gtc.12589},
pmid = {29718583},
issn = {1365-2443},
mesh = {Animals ; Arthropod Proteins/genetics/*metabolism ; *CRISPR-Cas Systems ; Daphnia/embryology/*genetics/growth &amp; development/physiology ; Deoxyribonuclease I/metabolism ; Embryo, Nonmammalian/cytology/metabolism ; Gene Targeting/*methods ; Genomics ; Mutagenesis ; Phenotype ; Ribonucleoproteins/genetics/*metabolism ; },
abstract = {The microcrustacean Daphnia pulex is an important model for environmental, ecological, evolutionary and developmental genomics because its adaptive life history displays plasticity in response to environmental changes. Even though the whole-genome sequence is available and omics data have actively accumulated for this species, the available tools for analyzing gene function have thus far been limited to RNAi (RNA interference) and TALEN (the transcription activator-like effector nuclease) systems. The development of the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is thus expected to further increase the genetic tractability of D. pulex and to advance the understanding of this species. In this study, we developed a genome editing system for D. pulex using CRISPR/Cas9 ribonucleoprotein complexes (Cas9 RNPs). We first assembled a CRISPR single-guide RNA (sgRNA) specific to the Distal-less gene (Dll), which encodes a homeodomain transcription factor essential for distal limb development in invertebrates and vertebrates. Then, we injected Cas9 RNPs into eggs and evaluated its activity in vivo by a T7 endonuclease I assay. Injected embryos showed defective formation of the second antenna and disordered development of appendages, and indel mutations were detected in Dll loci, indicating that this technique successfully knocked out the target gene.},
}
@article {pmid29444903,
year = {2018},
author = {Wei, Y and Yang, L and Zhang, X and Sui, D and Wang, C and Wang, K and Shan, M and Guo, D and Wang, H},
title = {Generation and Characterization of a CYP2C11-Null Rat Model by Using the CRISPR/Cas9 Method.},
journal = {Drug metabolism and disposition: the biological fate of chemicals},
volume = {46},
number = {5},
pages = {525-531},
doi = {10.1124/dmd.117.078444},
pmid = {29444903},
issn = {1521-009X},
mesh = {Animals ; Aryl Hydrocarbon Hydroxylases/*genetics ; CRISPR-Cas Systems/drug effects/*genetics ; Cytochrome P450 Family 2/*genetics ; Female ; Inactivation, Metabolic/physiology ; Male ; Microsomes, Liver/drug effects ; Models, Animal ; Rats ; Rats, Sprague-Dawley ; Steroid 16-alpha-Hydroxylase/*genetics ; Tolbutamide/pharmacology ; },
abstract = {CYP2C11 is involved in the metabolism of many drugs in rats. To assess the roles of CYP2C11 in physiology and drug metabolism, a CYP2C11-null rat model was generated using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9method. A 2-base pair insertion was added to exon 6 of CYP2C11 in Sprague-Dawley rats. CYP2C11 was not detected by western blotting in liver microsomes of CYP2C11-null rats. No off-target effects were found at 11 predicted sites of the knockout model. The CYP2C11-null rats were viable and had no obvious abnormalities, with the exception of reduced fertility. Puberty in CYP2C11-null rats appeared to be delayed by ∼20 days, and the average litter size fell by 43%. Tolbutamide was used as a probe in this drug metabolism study. In the liver microsomes of CYP2C11-null rats, the Vmax and intrinsicclearance values decreased by 22% and 47%, respectively, compared with those of wild-type rats. The Km values increased by 47% compared with that of wild types. However, our pharmacokinetics study showed no major differences in any parameters between the two strains, in both males and females. In conclusion, a CYP2C11-null rat model was successfully generated and is a valuable tool to study the in vivo function of CYP2C11.},
}
@article {pmid28418037,
year = {2017},
author = {Yang, Y and Xiong, S and Cai, B and Luo, H and Dong, E and Li, Q and Ji, G and Zhao, C and Wen, Y and Wei, Y and Yang, H},
title = {Mitochondrial C11orf83 is a potent Antiviral Protein Independent of interferon production.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {44303},
doi = {10.1038/srep44303},
pmid = {28418037},
issn = {2045-2322},
mesh = {2',5'-Oligoadenylate Synthetase/genetics/*immunology ; Animals ; CRISPR-Cas Systems ; Carrier Proteins/genetics/*immunology ; Cercopithecus aethiops ; Endoribonucleases/genetics/*immunology ; Gene Deletion ; Gene Expression Regulation ; Genes, Reporter ; Green Fluorescent Proteins/genetics/metabolism ; HEK293 Cells ; Hep G2 Cells ; *Host-Pathogen Interactions ; Human Umbilical Vein Endothelial Cells ; Humans ; Immunity, Innate ; Interferon-gamma/genetics/immunology ; Luciferases/genetics/metabolism ; Mitochondria/genetics/*immunology ; Signal Transduction ; Vero Cells ; Vesicular stomatitis Indiana virus/genetics/*immunology ; Virus Replication ; },
abstract = {Mitochondria have a central position in innate immune response via the adaptor protein MAVS in mitochondrial outer membrane to limit viral replication by inducing interferon production. Here, we reported that C11orf83, a component of complex III of electronic transfer chain in mitochondrial inner membrane, was a potent antiviral protein independent of interferon production. C11orf83 expression significantly increased in response to viral infection, and endows cells with stronger capability of inhibiting viral replication. Deletion of C11orf83 permits viral replication easier and cells were more vulnerable to viral killing. These effects mainly were mediated by triggering OAS3-RNase L system. C11orf83 overexpression induced higher transcription of OAS3, and knockdown either OAS3 or RNase L impaired the antiviral capability of C11orf83. Interestingly, the signaling from C11orf83 to OAS3-RNase L was independent of interferon production. Thus, our findings suggested a new antiviral mechanism by bridging cell metabolic machinery component with antiviral effectors.},
}
@article {pmid28287132,
year = {2017},
author = {Wrona, D and Siler, U and Reichenbach, J},
title = {CRISPR/Cas9-generated p47phox-deficient cell line for Chronic Granulomatous Disease gene therapy vector development.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {44187},
doi = {10.1038/srep44187},
pmid = {28287132},
issn = {2045-2322},
mesh = {Base Sequence ; *CRISPR-Cas Systems ; Genetic Therapy/*methods ; *Genetic Vectors ; *Granulomatous Disease, Chronic/genetics/metabolism/pathology/therapy ; HL-60 Cells ; Humans ; NADPH Oxidases/genetics/metabolism ; Sequence Deletion ; },
abstract = {Development of gene therapy vectors requires cellular models reflecting the genetic background of a disease thus allowing for robust preclinical vector testing. For human p47phox-deficient chronic granulomatous disease (CGD) vector testing we generated a cellular model using clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 to introduce a GT-dinucleotide deletion (ΔGT) mutation in p47phox encoding NCF1 gene in the human acute myeloid leukemia PLB-985 cell line. CGD is a group of hereditary immunodeficiencies characterized by impaired respiratory burst activity in phagocytes due to a defective phagocytic nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. In Western countries autosomal-recessive p47phox-subunit deficiency represents the second largest CGD patient cohort with unique genetics, as the vast majority of p47phox CGD patients carries ΔGT deletion in exon two of the NCF1 gene. The established PLB-985 NCF1 ΔGT cell line reflects the most frequent form of p47phox-deficient CGD genetically and functionally. It can be differentiated to granulocytes efficiently, what creates an attractive alternative to currently used iPSC models for rapid testing of novel gene therapy approaches.},
}
@article {pmid28281657,
year = {2017},
author = {Pazhakh, V and Clark, S and Keightley, MC and Lieschke, GJ},
title = {A GCSFR/CSF3R zebrafish mutant models the persistent basal neutrophil deficiency of severe congenital neutropenia.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {44455},
doi = {10.1038/srep44455},
pmid = {28281657},
issn = {2045-2322},
mesh = {Animals ; Base Sequence ; CRISPR-Cas Systems ; Disease Models, Animal ; Embryo, Nonmammalian ; Exons ; Gene Editing/*methods ; Gene Expression ; Granulocyte Colony-Stimulating Factor/*genetics/immunology ; Haploinsufficiency ; Heterozygote ; Humans ; Kidney/immunology/*pathology ; Leukocyte Count ; Morpholinos/genetics/metabolism ; Neutropenia/*congenital/genetics/immunology/pathology ; Neutrophils/immunology/*pathology ; Phenotype ; Receptors, Colony-Stimulating Factor/antagonists &amp; inhibitors/deficiency/*genetics/immunology ; Zebrafish ; },
abstract = {Granulocyte colony-stimulating factor (GCSF) and its receptor (GCSFR), also known as CSF3 and CSF3R, are required to maintain normal neutrophil numbers during basal and emergency granulopoiesis in humans, mice and zebrafish. Previous studies identified two zebrafish CSF3 ligands and a single CSF3 receptor. Transient antisense morpholino oligonucleotide knockdown of both these ligands and receptor reduces neutrophil numbers in zebrafish embryos, a technique widely used to evaluate neutrophil contributions to models of infection, inflammation and regeneration. We created an allelic series of zebrafish csf3r mutants by CRISPR/Cas9 mutagenesis targeting csf3r exon 2. Biallelic csf3r mutant embryos are viable and have normal early survival, despite a substantial reduction of their neutrophil population size, and normal macrophage abundance. Heterozygotes have a haploinsufficiency phenotype with an intermediate reduction in neutrophil numbers. csf3r mutants are viable as adults, with a 50% reduction in tissue neutrophil density and a substantial reduction in the number of myeloid cells in the kidney marrow. These csf3r mutants are a new animal model of human CSF3R-dependent congenital neutropenia. Furthermore, they will be valuable for studying the impact of neutrophil loss in the context of other zebrafish disease models by providing a genetically stable, persistent, reproducible neutrophil deficiency state throughout life.},
}
@article {pmid30397647,
year = {2018},
author = {Chatterjee, P and Jakimo, N and Jacobson, JM},
title = {Minimal PAM specificity of a highly similar SpCas9 ortholog.},
journal = {Science advances},
volume = {4},
number = {10},
pages = {eaau0766},
doi = {10.1126/sciadv.aau0766},
pmid = {30397647},
issn = {2375-2548},
abstract = {RNA-guided DNA endonucleases of the CRISPR-Cas system are widely used for genome engineering and thus have numerous applications in a wide variety of fields. CRISPR endonucleases, however, require a specific protospacer adjacent motif (PAM) flanking the target site, thus constraining their targetable sequence space. In this study, we demonstrate the natural PAM plasticity of a highly similar, yet previously uncharacterized, Cas9 from Streptococcus canis (ScCas9) through rational manipulation of distinguishing motif insertions. To this end, we report affinity to minimal 5'-NNG-3' PAM sequences and demonstrate the accurate editing capabilities of the ortholog in both bacterial and human cells. Last, we build an automated bioinformatics pipeline, the Search for PAMs by ALignment Of Targets (SPAMALOT), which further explores the microbial PAM diversity of otherwise overlooked Streptococcus Cas9 orthologs. Our results establish that ScCas9 can be used both as an alternative genome editing tool and as a functional platform to discover novel Streptococcus PAM specificities.},
}
@article {pmid30397343,
year = {2018},
author = {Özcan, A and Pausch, P and Linden, A and Wulf, A and Schühle, K and Heider, J and Urlaub, H and Heimerl, T and Bange, G and Randau, L},
title = {Type IV CRISPR RNA processing and effector complex formation in Aromatoleum aromaticum.},
journal = {Nature microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41564-018-0274-8},
pmid = {30397343},
issn = {2058-5276},
abstract = {Type IV CRISPR-Cas modules belong to class 1 prokaryotic adaptive immune systems, which are defined by the presence of multisubunit effector complexes. They usually lack the known Cas proteins involved in adaptation and target cleavage, and their function has not been experimentally addressed. To investigate RNA and protein components of this CRISPR-Cas type, we located a complete type IV cas gene locus and an adjacent CRISPR array on a megaplasmid of Aromatoleum aromaticum EbN1, which contains an additional type I-C system on its chromosome. RNA sequencing analyses verified CRISPR RNA (crRNA) production and maturation for both systems. Type IV crRNAs were shown to harbour unusually short 7 nucleotide 5'-repeat tags and stable 3' hairpin structures. A unique Cas6 variant (Csf5) was identified that generates crRNAs that are specifically incorporated into type IV CRISPR-ribonucleoprotein (crRNP) complexes. Structures of RNA-bound Csf5 were obtained. Recombinant production and purification of the type IV Cas proteins, together with electron microscopy, revealed that Csf2 acts as a helical backbone for type IV crRNPs that include Csf5, Csf3 and a large subunit (Csf1). Mass spectrometry analyses identified protein-protein and protein-RNA contact sites. These results highlight evolutionary connections between type IV and type I CRISPR-Cas systems and demonstrate that type IV CRISPR-Cas systems employ crRNA-guided effector complexes.},
}
@article {pmid29950430,
year = {2018},
author = {Chen, X and Liao, S and Huang, X and Xu, T and Feng, X and Guang, S},
title = {Targeted Chromosomal Rearrangements via Combinatorial Use of CRISPR/Cas9 and Cre/LoxP Technologies in Caenorhabditis elegans.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2697-2707},
doi = {10.1534/g3.118.200473},
pmid = {29950430},
issn = {2160-1836},
support = {P40 OD010440/OD/NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Caenorhabditis elegans/genetics ; *Chromosome Inversion ; Gene Editing/*methods ; Gene Targeting/*methods ; Integrases/genetics/metabolism ; },
abstract = {Rearranged chromosomes have been applied to construct genetic balancers to manipulate essential genes in C. elegans Although much effort has been put into constructing balancer chromosomes, approximately 6% (map units) of the C. elegans genome has not been covered, and this area lies mostly in pairing centers (PCs). Here, we developed a method for conditional chromosomal engineering through combinatorial use of the CRISPR/Cas9 and Cre/LoxP technologies. Functional DNA fragments containing LoxP sequences were inserted into designated genomic loci using a modified counterselection (cs)-CRISPR method. Then, heat-shock-induced Cre recombinase induced an inversion of the chromosomal region between the two LoxP sites. The chromosomal inversions were subsequently detected by the appearance of pharyngeal GFP. Through this method, we have successfully generated several chromosomal inversion lines, providing valuable resources for studying essential genes in pairing centers.},
}
@article {pmid29934375,
year = {2018},
author = {Ewen-Campen, B and Perrimon, N},
title = {ovoD Co-selection: A Method for Enriching CRISPR/Cas9-Edited Alleles in Drosophila.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2749-2756},
doi = {10.1534/g3.118.200498},
pmid = {29934375},
issn = {2160-1836},
support = {R01 GM084947/GM/NIGMS NIH HHS/United States ; F32 GM113395/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Alleles ; Animals ; *CRISPR-Cas Systems ; Drosophila/*genetics ; Female ; Gene Editing/methods ; Gene Targeting/*methods ; Oogonia/metabolism ; Phenotype ; *Selection, Genetic ; },
abstract = {Screening for successful CRISPR/Cas9 editing events remains a time consuming technical bottleneck in the field of Drosophila genome editing. This step can be particularly laborious for events that do not cause a visible phenotype, or those which occur at relatively low frequency. A promising strategy to enrich for desired CRISPR events is to co-select for an independent CRISPR event that produces an easily detectable phenotype. Here, we describe a simple negative co-selection strategy involving CRISPR-editing of a dominant female sterile allele, ovoD1 In this system (&quot;ovoD co-selection&quot;), the only functional germ cells in injected females are those that have been edited at the ovoD1 locus, and thus all offspring of these flies have undergone editing of at least one locus. We demonstrate that ovoD co-selection can be used to enrich for knock-out mutagenesis via nonhomologous end-joining (NHEJ), and for knock-in alleles via homology-directed repair (HDR). Altogether, our results demonstrate that ovoD co-selection reduces the amount of screening necessary to isolate desired CRISPR events in Drosophila.},
}
@article {pmid29884615,
year = {2018},
author = {Pauwels, L and De Clercq, R and Goossens, J and Iñigo, S and Williams, C and Ron, M and Britt, A and Goossens, A},
title = {A Dual sgRNA Approach for Functional Genomics in Arabidopsis thaliana.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2603-2615},
doi = {10.1534/g3.118.200046},
pmid = {29884615},
issn = {2160-1836},
mesh = {Arabidopsis/*genetics ; Arabidopsis Proteins/genetics/metabolism ; CRISPR-Cas Systems ; DNA End-Joining Repair ; DNA-Directed DNA Polymerase/genetics/metabolism ; Gene Editing/*methods ; Genomics/*methods ; *Mutagenesis ; RNA, Guide/*genetics/metabolism ; },
abstract = {Reverse genetics uses loss-of-function alleles to interrogate gene function. The advent of CRISPR/Cas9-based gene editing now allows the generation of knock-out alleles for any gene and entire gene families. Even in the model plant Arabidopsis thaliana, gene editing is welcomed as T-DNA insertion lines do not always generate null alleles. Here, we show efficient generation of heritable mutations in Arabidopsis using CRISPR/Cas9 with a workload similar to generating overexpression lines. We obtain for several different genes Cas9 null-segregants with bi-allelic mutations in the T2 generation. While somatic mutations were predominantly generated by the canonical non-homologous end joining (cNHEJ) pathway, we observed inherited mutations that were the result of synthesis-dependent microhomology-mediated end joining (SD-MMEJ), a repair pathway linked to polymerase θ (PolQ). We also demonstrate that our workflow is compatible with a dual sgRNA approach in which a gene is targeted by two sgRNAs simultaneously. This paired nuclease method results in more reliable loss-of-function alleles that lack a large essential part of the gene. The ease of the CRISPR/Cas9 workflow should help in the eventual generation of true null alleles of every gene in the Arabidopsis genome, which will advance both basic and applied plant research.},
}
@article {pmid29703785,
year = {2018},
author = {Zhang, XR and He, JB and Wang, YZ and Du, LL},
title = {A Cloning-Free Method for CRISPR/Cas9-Mediated Genome Editing in Fission Yeast.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {6},
pages = {2067-2077},
doi = {10.1534/g3.118.200164},
pmid = {29703785},
issn = {2160-1836},
mesh = {Base Sequence ; CRISPR-Cas Systems/*genetics ; Cloning, Molecular ; DNA Repair/genetics ; Gene Editing/*methods ; Gene Knock-In Techniques ; Point Mutation/genetics ; Schizosaccharomyces/*genetics ; Sequence Deletion ; Temperature ; },
abstract = {The CRISPR/Cas9 system, which relies on RNA-guided DNA cleavage to induce site-specific DNA double-strand breaks, is a powerful tool for genome editing. This system has been successfully adapted for the fission yeast Schizosaccharomyces pombe by expressing Cas9 and the single-guide RNA (sgRNA) from a plasmid. In the procedures published to date, the cloning step that introduces a specific sgRNA target sequence into the plasmid is the most tedious and time-consuming. To increase the efficiency of applying the CRISPR/Cas9 system in fission yeast, we here developed a cloning-free procedure that uses gap repair in fission yeast cells to assemble two linear DNA fragments, a gapped Cas9-encoding plasmid and a PCR-amplified sgRNA insert, into a circular plasmid. Both fragments contain only a portion of the ura4 or bsdMX marker so that only the correctly assembled plasmid can confer uracil prototrophy or blasticidin resistance. We show that this gap-repair-based and cloning-free CRISPR/Cas9 procedure permits rapid and efficient point mutation knock-in, endogenous N-terminal tagging, and genomic sequence deletion in fission yeast.},
}
@article {pmid29542087,
year = {2018},
author = {Gandhi, S and Razy-Krajka, F and Christiaen, L and Stolfi, A},
title = {CRISPR Knockouts in Ciona Embryos.},
journal = {Advances in experimental medicine and biology},
volume = {1029},
number = {},
pages = {141-152},
doi = {10.1007/978-981-10-7545-2_13},
pmid = {29542087},
issn = {0065-2598},
support = {K99 HD084814/HD/NICHD NIH HHS/United States ; R00 HD084814/HD/NICHD NIH HHS/United States ; R01 GM096032/GM/NIGMS NIH HHS/United States ; R01 HL108643/HL/NHLBI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems ; Ciona intestinalis/embryology/*genetics ; Electroporation ; Embryo, Nonmammalian/cytology/metabolism ; Gene Knockout Techniques/*methods ; INDEL Mutation ; Mutagenesis ; Plasmids ; RNA, Guide/administration &amp; dosage/genetics ; },
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 has emerged as a revolutionary tool for fast and efficient targeted gene knockouts and genome editing in almost any organism. The laboratory model tunicate Ciona is no exception. Here, we describe our latest protocol for the design, implementation, and evaluation of successful CRISPR/Cas9-mediated gene knockouts in somatic cells of electroporated Ciona embryos. Using commercially available reagents, publicly accessible plasmids, and free web-based software applications, any Ciona researcher can easily knock out any gene of interest in their favorite embryonic cell lineage.},
}
@article {pmid28256588,
year = {2017},
author = {Li, C and Unver, T and Zhang, B},
title = {A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.).},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {43902},
doi = {10.1038/srep43902},
pmid = {28256588},
issn = {2045-2322},
mesh = {*CRISPR-Cas Systems ; DNA, Plant/genetics/metabolism ; Gene Targeting/*methods ; Gossypium/*genetics ; Recombination, Genetic ; },
abstract = {The complex allotetraploid genome is one of major challenges in cotton for repressing gene expression. Developing site-specific DNA mutation is the long-term dream for cotton breeding scientists. The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system is emerging as a robust biotechnology for targeted-DNA mutation. In this study, two sgRNAs, GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, were designed in the identical genomic regions of GhMYB25-like A and GhMYB25-like D, which were encoded by cotton A subgenome and the D subgenome, respectively, was assembled to direct Cas9-mediated allotetraploid cotton genome editing. High proportion (14.2-21.4%) CRISPR/Cas9-induced specific truncation events, either from GhMYB25-like A DNA site or from GhMYB25-like D DNA site, were detected in 50% examined transgenic cotton through PCR amplification assay and sequencing analyses. Sequencing results also demonstrated that 100% and 98.8% mutation frequency were occurred on GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 target site respectively. The off-target effect was evaluated by sequencing two putative off-target sites, which have 3 and 1 mismatched nucleotides with GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, respectively; all the examined samples were not detected any off-target-caused mutation events. Thus, these results demonstrated that CRISPR/Cas9 is qualified for generating DNA level mutations on allotetraploid cotton genome with high-efficiency and high-specificity.},
}
@article {pmid28240315,
year = {2017},
author = {Sanz, MA and González Almela, E and Carrasco, L},
title = {Translation of Sindbis Subgenomic mRNA is Independent of eIF2, eIF2A and eIF2D.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {43876},
doi = {10.1038/srep43876},
pmid = {28240315},
issn = {2045-2322},
mesh = {Base Sequence ; CRISPR-Cas Systems ; Cell Line ; Eukaryotic Cells/cytology/virology ; Eukaryotic Initiation Factor-2/genetics/*metabolism ; Humans ; Phosphorylation ; *Protein Biosynthesis ; RNA Interference ; RNA, Messenger/*genetics ; RNA, Viral/*genetics ; Sindbis Virus/*genetics/physiology ; Viral Proteins/genetics/metabolism ; },
abstract = {Translation of Sindbis virus subgenomic mRNA (sgmRNA) can occur after inactivation of eIF2 by phosphorylation in mammalian cells. Several studies have suggested that eIF2 can be replaced by eIF2A or eIF2D. HAP1 human cell lines knocked-out for eIF2A, eIF2D or both by CRISPR/Cas9 genome engineering were compared with wild-type (WT) cells to test the potential role of eIF2A and eIF2D in translation. Sindbis virus infection was comparable between the four cell lines. Moreover, synthesis of viral proteins during late stage infection was similar in all four cell lines despite the fact that eIF2α became phosphorylated. These findings demonstrate that eIF2A and eIF2D are not required for the translation of sgmRNA when eIF2α is phosphorylated. Moreover, silencing of eIF2A or eIF2D by transfection of the corresponding siRNAs in HAP1 WT, HAP1-eIF2A- and HAP1-eIF2D- cells had little effect on the synthesis of viral proteins late in infection. Modification of AUGi to other codons in sgmRNA failed to abrogate translation. Sindbis virus replicons containing these sgmRNA variants could still direct the synthesis of viral proteins. No significant differences were found between the cell lines assayed, suggesting that neither eIF2A nor eIF2D are involved in the translation of this sgmRNA bearing non-AUG codons.},
}
@article {pmid30394685,
year = {2018},
author = {Li, P and Fu, X and Zhang, L and Li, S},
title = {CRISPR/Cas-based screening of a gene activation library in Saccharomyces cerevisiae identifies a crucial role of OLE1 in thermotolerance.},
journal = {Microbial biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1751-7915.13333},
pmid = {30394685},
issn = {1751-7915},
support = {21506113//National Natural Science Foundation of China/ ; 31470229//National Natural Science Foundation of China/ ; 31600067//National Natural Science Foundation of China/ ; 2016YFE0108500//National Key R&amp;D Program of China/ ; 2017T100064//China Postdoctoral Science Foundation/ ; 2015M581074//China Postdoctoral Science Foundation/ ; },
abstract = {CRISPR/Cas-based (clustered regularly interspaced short palindromic repeats/CRISPR-associated) screening has been proved to be an efficient method to study functional genomics from yeast to human. In this study, we report the development of a focused CRISPR/Cas-based gene activation library in Saccharomyces cerevisiae and its application in gene identification based on functional screening towards improved thermotolerance. The gene activation library was subjected to screening at 42°C, and the same library cultured at 30°C was set as a control group. After five successive subcultures, five clones were randomly picked from the libraries cultured at 30 and 42°C, respectively. The five clones selected at 30°C contain the specificity sequences of five different single guide RNAs, whereas all the five clones selected at 42°C contain the specificity sequence of one sgRNA that targets the promoter region of OLE1. A crucial role of OLE1 in thermotolerance was identified: the overexpression of OLE1 increased fatty acid unsaturation, and thereby helped counter lipid peroxidation caused by heat stress, rendering the yeast thermotolerant. This study described the application of CRISPR/Cas-based gene activation screening with an example of thermotolerant yeast screening, demonstrating that this method can be used to identify functional genes in yeast.},
}
@article {pmid30394652,
year = {2018},
author = {Borton, MA and Daly, RA and O'Banion, B and Hoyt, DW and Marcus, DN and Welch, S and Hastings, SS and Meulia, T and Wolfe, RA and Booker, AE and Sharma, S and Cole, DR and Wunch, K and Moore, JD and Darrah, TH and Wilkins, MJ and Wrighton, KC},
title = {Comparative genomics and physiology of the genus Methanohalophilus, a prevalent methanogen in hydraulically fractured shale.},
journal = {Environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1462-2920.14467},
pmid = {30394652},
issn = {1462-2920},
abstract = {About 60% of natural gas production in the United States comes from hydraulic fracturing of unconventional reservoirs, such as shales or organic-rich micrites. This process inoculates and enriches for halotolerant microorganisms in these reservoirs over time, resulting in a saline ecosystem that includes methane producing archaea. Here, we survey the biogeography of methanogens across unconventional reservoirs, and report that members of genus Methanohalophilus are recovered from every hydraulically fractured unconventional reservoir sampled by metagenomics. We provide the first genomic sequencing of three isolate genomes, as well as two metagenome assembled genomes. Utilizing six other previously sequenced genomes, we perform comparative analysis of the 11 genomes representing this genus. This genomic investigation revealed distinctions between surface and subsurface derived genomes that are consistent with constraints encountered in each environment. Genotypic differences were also uncovered between isolate genomes recovered from the same well, suggesting niche partitioning among closely related strains. These genomic substrate utilization predictions were then confirmed by physiological investigation. Fine-scale microdiversity was observed in CRISPR-Cas systems of Methanohalophilus, with genomes from geographically distinct unconventional reservoirs sharing spacers targeting the same viral population. These findings have implications for augmentation strategies resulting in enhanced biogenic methane production in hydraulically fractured unconventional reservoirs. This article is protected by copyright. All rights reserved.},
}
@article {pmid30394044,
year = {2018},
author = {Ali, S and Park, SK and Kim, WC},
title = {The pragmatic introduction and expression of microbial transgenes in plants.},
journal = {Journal of microbiology and biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.4014/jmb.1808.08029},
pmid = {30394044},
issn = {1738-8872},
abstract = {Several genetic strategies have been proposed for the successful transformation and expression of microbial transgenes in model and crop plants. Here, we bring into focus the prominent applications of microbial transgenes in plants for the development of disease resistance; mitigation of stress conditions; augmentation of food quality; and use of plants as &quot;bioreactors&quot; for the production of recombinant proteins, industrially important enzymes, vaccines, antimicrobial compounds, and other valuable secondary metabolites. We discuss the applicable and cost-effective approaches of transgenesis in different plants, as well as the limitations thereof. We subsequently present the contemporary developments in targeted genome editing systems that have facilitated the process of genetic modification and manifested stable and consumer-friendly genetically modified plants and their products. Finally, this article presents the different approaches and demonstrates the introduction and expression of microbial transgenes for the improvement of plant resistance to pathogens and abiotic stress conditions and the production of valuable compounds, together with the promising research progress in targeted genome editing technology. We include a special discussion on the highly efficient CRISPR-Cas system helpful in microbial transgene editing in plants.},
}
@article {pmid30393777,
year = {2018},
author = {Zhang, F and Zhao, S and Ren, C and Zhu, Y and Zhou, H and Lai, Y and Zhou, F and Jia, Y and Zheng, K and Huang, Z},
title = {CRISPRminer is a knowledge base for exploring CRISPR-Cas systems in microbe and phage interactions.},
journal = {Communications biology},
volume = {1},
number = {},
pages = {180},
doi = {10.1038/s42003-018-0184-6},
pmid = {30393777},
issn = {2399-3642},
abstract = {CRISPR-Cas systems not only play key roles in prokaryotic acquired immunity, but can also be adapted as powerful genome editing tools. Understanding the native role of CRISPR-Cas systems in providing adaptive immunity can lead to new CRISPR-based technologies. Here, we develop CRISPRminer, a knowledge base and web server to comprehensively collect and investigate the knowledge of CRISPR-Cas systems and generate instructive annotations, including CRISPR arrays and Cas protein annotation, CRISPR-Cas system classification, self-targeting events detection, microbe-phage interaction inference, and anti-CRISPR annotation. CRISPRminer is user-friendly and freely available at http://www.microbiome-bigdata.com/CRISPRminer.},
}
@article {pmid30393194,
year = {2018},
author = {Hussain, W and Mahmood, T and Hussain, J and Ali, N and Shah, T and Qayyum, S and Khan, I},
title = {CRISPR/Cas system: A game changing genome editing technology, to treat human genetic diseases.},
journal = {Gene},
volume = {685},
number = {},
pages = {70-75},
doi = {10.1016/j.gene.2018.10.072},
pmid = {30393194},
issn = {1879-0038},
abstract = {Genes, are the functional units of heredity that used as an instructors to make proteins either to become the functional or structural part of the cell. Hence, the proteins get more attention because most of the life functions depends on it. Any mutation or alteration in genome sequences results in complete loss of function or formation of abnormal protein which leads to hereditary disorder. Gene therapy on the other hand, used as a remedy, a process that make correction in the gene which is responsible for genomic disorders. The treatment of disease state depends on the understanding of their genetic basis. While, numerous molecular genome editing tools have been developed and are being utilized to translate the abstract of gene therapy into reality, but the problem is still a mystery. The genome editing molecular scissors can be applied to dictate the selected genetic products that can have the therapeutic power. Thus, editing the specific sequences depends on the type of strategies being used by a molecule such is HDR or NHEJ. CRISPR/Cas9 editing technology can use in disease model to study the genitival disorders. One side the CRISPR technology seemed to be extremely accurate but on the other side it has some harmful effects i.e. Cas9 proteins sometimes cuts the similar sequences other than the specific targeted and Off-targeting Sequences etc. Urgent attention and improvement are needed for various implication of CRISPR/Cas9 technology, including the delivery, precision and control over the mention system. This review presents the current scenario of genome editing in vivo and its implications for the future of human genetic disease treatment as well as genome throughput potency.},
}
@article {pmid30391232,
year = {2018},
author = {Chen, H and Li, Y and Du, C and Li, Y and Zhao, J and Zheng, X and Mao, Q and Xia, H},
title = {Aptazyme-mediated direct modulation of post-transcriptional sgRNA level for conditional genome editing and gene expression.},
journal = {Journal of biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jbiotec.2018.10.011},
pmid = {30391232},
issn = {1873-4863},
abstract = {RNA-guided endonuclease Cas9 derived from microbial CRISPR-Cas adaptive immune systems is a powerful tool for genome editing, which has been widely used in eukaryotic systems, prokaryotic systems, and plants. However, the off-target effects caused by Cas9/sgRNA remain a major concern. Currently, the efforts to reduce the off-target effects mainly focus on improving the targeting specificity of sgRNA/Cas9, regulating the activity of the Cas9 protein or the sgRNA, and controlling the time window of their expression. In this study, a novel system was established to regulate the post-transcriptional sgRNA level by small molecule-controlled aptazyme. This system was shown to reduce the off-target effects caused by Cas9/sgRNA, while enabling precise temporal control over gene editing and regulatory activity. This new system could provide a potentially safer and more powerful tool for genome editing and therapeutic application.},
}
@article {pmid30389787,
year = {2018},
author = {Lynch, JM and Li, B and Katoli, P and Xiang, C and Leehy, B and Rangaswamy, N and Saenz-Vash, V and Wang, YK and Lei, H and Nicholson, TB and Meredith, E and Rice, D and Prasanna, G and Chen, A},
title = {Binding of a glaucoma-associated myocilin variant to the αB-crystallin chaperone impedes protein clearance in trabecular meshwork cells.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.004325},
pmid = {30389787},
issn = {1083-351X},
abstract = {Myocilin (MYOC) was discovered more than 20 years ago and is the gene whose mutations are most commonly observed in individuals with glaucoma. Despite extensive research efforts, the function of wild-type (wt) MYOC has remained elusive and how mutant MYOC is linked to glaucoma is unclear. Mutant MYOC is believed to be misfolded within the endoplasmic reticulum (ER), and under normal physiological conditions misfolded MYOC should be retro-translocated to the cytoplasm for degradation. To better understand mutant MYOC pathology, we CRISPR-engineered a rat to have a MYOC Y435H substitution which is the equivalent of the pathologic human MYOC Y437H mutation. Using this engineered animal model, we discovered that the chaparone αB-crystallin (CRYAB) is a MYOC-binding partner and that co-expression of these two proteins increases protein aggregates. Our results suggest that the misfolded mutant MYOC aggregates with cytoplasmic CRYAB and thereby compromises protein clearance mechanisms in trabecular meshwork cells and this process represents the primary mode of mutant MYOC pathology. We propose a model by which mutant MYOC causes glaucoma, and we propose that therapeutic treatment of patients having a MYOC mutation may focus on disrupting the MYOC-CRYAB complexes.},
}
@article {pmid30388811,
year = {2018},
author = {Dion, MB and Labrie, SJ and Shah, SA and Moineau, S},
title = {CRISPRStudio: A User-Friendly Software for Rapid CRISPR Array Visualization.},
journal = {Viruses},
volume = {10},
number = {11},
pages = {},
doi = {10.3390/v10110602},
pmid = {30388811},
issn = {1999-4915},
support = {143924//Canadian Institutes of Health Research/Canada ; 259257//Fonds de Recherche du Québec - Nature et Technologies/ ; 950-227645//Canada Research Chairs/ ; RGPIN/05132-2014//Natural Sciences and Engineering Research Council of Canada/ ; },
abstract = {The CRISPR-Cas system biologically serves as an adaptive defense mechanism against phages. However, there is growing interest in exploiting the hypervariable nature of the CRISPR locus, often of viral origin, for microbial typing and tracking. Moreover, the spacer content of any given strain provides a phage resistance profile. Large-scale CRISPR typing studies require an efficient method for showcasing CRISPR array similarities across multiple isolates. Historically, CRISPR arrays found in microbes have been represented by colored shapes based on nucleotide sequence identity and, while this approach is now routinely used, only scarce computational resources are available to automate the process, making it very time-consuming for large datasets. To alleviate this tedious task, we introduce CRISPRStudio, a command-line tool developed to accelerate CRISPR analysis and standardize the preparation of CRISPR array figures. It first compares nucleotide spacer sequences present in a dataset and then clusters them based on sequence similarity to assign a meaningful representative color. CRISPRStudio offers versatility to suit different biological contexts by including options such as automatic sorting of CRISPR loci and highlighting of shared spacers, while remaining fast and user-friendly.},
}
@article {pmid30285624,
year = {2018},
author = {Howells, RM and Craze, M and Bowden, S and Wallington, EJ},
title = {Efficient generation of stable, heritable gene edits in wheat using CRISPR/Cas9.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {215},
doi = {10.1186/s12870-018-1433-z},
pmid = {30285624},
issn = {1471-2229},
support = {BB/J019356/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Agrobacterium/genetics ; *CRISPR-Cas Systems ; DNA, Bacterial ; Gene Editing/*methods ; Genome, Plant ; Hordeum/genetics ; Plant Breeding/methods ; Plants, Genetically Modified/genetics ; Transformation, Genetic ; Triticum/*genetics ; },
abstract = {BACKGROUND: The use of CRISPR/Cas9 systems could prove to be a valuable tool in crop research, providing the ability to fully knockout gene function in complex genomes or to precisely adjust gene function by knockout of individual alleles.<br><br>RESULTS: We compare gene editing in hexaploid wheat (Triticum aestivum) with diploid barley (Hordeum vulgare), using a combination of single genome and tri-genome targeting. High efficiency gene editing, 11-17% for single genome targeted guides and 5% for tri-genome targeted guides, was achieved in wheat using stable Agrobacterium-mediated transformation. Gene editing in wheat was shown to be predominantly heterozygous, edits were inherited in a Mendelian fashion over multiple generations and no off-target effects were observed. Comparison of editing between the two species demonstrated that more stable, heritable edits were produced in wheat, whilst barley exhibited continued and somatic editing.<br><br>CONCLUSION: Our work shows the potential to obtain stable edited transgene-free wheat lines in 36 weeks through only two generations and that targeted mutagenesis of individual homeologues within the wheat genome is achievable with a modest amount of effort, and without off-target mutations or the need for lengthy crossing strategies.},
}
@article {pmid30006230,
year = {2018},
author = {Carroll, D},
title = {p53 Throws CRISPR a Curve.},
journal = {Trends in pharmacological sciences},
volume = {39},
number = {9},
pages = {783-784},
doi = {10.1016/j.tips.2018.06.005},
pmid = {30006230},
issn = {1873-3735},
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Humans ; Tumor Suppressor Protein p53/genetics ; },
abstract = {The efficacy of the powerful CRISPR-Cas9 genome-editing platform depends on DNA repair activities in the cells being targeted. Two new papers show that the low efficiency of targeting in some primary human cell lines is the result of p53-dependent cell arrest in response to the Cas9-induced break. This limitation must be overcome for some anticipated therapies.},
}
@article {pmid29991671,
year = {2018},
author = {Cho, LH and Yoon, J and Wai, AH and An, G},
title = {Histone Deacetylase 701 (HDT701) Induces Flowering in Rice by Modulating Expression of OsIDS1.},
journal = {Molecules and cells},
volume = {41},
number = {7},
pages = {665-675},
doi = {10.14348/molcells.2018.0148},
pmid = {29991671},
issn = {0219-1032},
mesh = {Base Sequence ; CRISPR-Cas Systems/genetics ; Chromatin/metabolism ; Circadian Rhythm/genetics ; Flowers/*enzymology/*physiology ; *Gene Expression Regulation, Plant ; Histone Deacetylases/chemistry/genetics/*metabolism ; Models, Biological ; Mutation/genetics ; Oryza/*enzymology/*genetics/physiology ; Photoperiod ; Plant Leaves/genetics ; Plant Proteins/chemistry/genetics/*metabolism ; },
abstract = {Rice is a facultative short-day (SD) plant in which flowering is induced under SD conditions or by other environmental factors and internal genetic programs. Overexpression of Histone Deacetylase 701 (HDT701) accelerates flowering in hybrid rice. In this study, mutants defective in HDT701 flowered late under both SD and long-day conditions. Expression levels of florigens Heading date 3a (Hd3a) and Rice Flowering Locus T1 (RFT1), and their immediate upstream floral activator Early heading date 1 (Ehd1), were significantly decreased in the hdt701 mutants, indicating that HDT701 functions upstream of Ehd1 in controlling flowering time. Transcript levels of OsINDETERMINATE SPIKELET 1 (OsIDS1), an upstream repressor of Ehd1, were significantly increased in the mutants while those of OsGI and Hd1 were reduced. Chromatin-immunoprecipitation assays revealed that HDT701 directly binds to the promoter region of OsIDS1. These results suggest that HDT701 induces flowering by suppressing OsIDS1.},
}
@article {pmid29964176,
year = {2018},
author = {Fernandez, JP and Vejnar, CE and Giraldez, AJ and Rouet, R and Moreno-Mateos, MA},
title = {Optimized CRISPR-Cpf1 system for genome editing in zebrafish.},
journal = {Methods (San Diego, Calif.)},
volume = {150},
number = {},
pages = {11-18},
doi = {10.1016/j.ymeth.2018.06.014},
pmid = {29964176},
issn = {1095-9130},
abstract = {The impact of the CRISPR-Cas biotechnological systems has recently broadened the genome editing toolbox available to different model organisms further with the addition of new efficient RNA-guided endonucleases. We have recently optimized CRISPR-Cpf1 (renamed Cas12a) system in zebrafish. We showed that (i) in the absence of Cpf1 protein, crRNAs are unstable and degraded in vivo, and CRISPR-Cpf1 RNP complexes efficiently mutagenize the zebrafish genome; and (ii) temperature modulates Cpf1 activity especially affecting AsCpf1, which experiences a reduced performance below 37 °C. Here, we describe a step-by-step protocol on how to easily design and generate crRNAs in vitro, purify recombinant Cpf1 proteins, and assemble ribonucleoprotein complexes to carry out efficient mutagenesis in zebrafish in a constitutive and temperature-controlled manner. Finally, we explain how to induce Cpf1-mediated homology-directed repair using single-stranded DNA oligonucleotides. In summary, this protocol includes the steps to efficiently modify the zebrafish genome and other ectothermic organisms using the CRISPR-Cpf1 system.},
}
@article {pmid29950431,
year = {2018},
author = {Xu, Y and Wang, Y and Song, Y and Deng, J and Chen, M and Ouyang, H and Lai, L and Li, Z},
title = {Generation and Phenotype Identification of PAX4 Gene Knockout Rabbit by CRISPR/Cas9 System.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2833-2840},
doi = {10.1534/g3.118.300448},
pmid = {29950431},
issn = {2160-1836},
mesh = {Animals ; Animals, Genetically Modified ; *CRISPR-Cas Systems ; Gene Expression ; Gene Knockout Techniques ; Gene Order ; Gene Targeting ; Genetic Vectors ; Immunohistochemistry ; Mutation ; Paired Box Transcription Factors/*deficiency/*genetics/metabolism ; *Phenotype ; RNA, Guide ; Rabbits ; },
abstract = {Paired-homeodomain transcription factor 4 (PAX4) gene encodes a transcription factor which plays an important role in the generation, differentiation, development, and survival of insulin-producing β-cells during mammalian pancreas development. PAX4 is a key diabetes mellitus (DM) susceptibility gene, which is associated with many different types of DM, including T1DM, T2DM, maturity onset diabetes of the young 9 (MODY9) and ketosis prone diabetes. In this study, a novel PAX4 gene knockout (KO) model was generated through co-injection of clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) mRNA/sgRNA into rabbit zygotes. Typical phenotypes of growth retardation, persistent hyperglycemia, decreased number of insulin-producing β cells and increased number of glucagon-producing α cells were observed in the homozygous PAX4 KO rabbits. Furthermore, DM associated phenotypes including diabetic nephropathy, hepatopathy, myopathy and cardiomyopathy were also observed in the homozygous PAX4 KO rabbits but not in the wild type (WT) controls and the heterozygous PAX4 KO rabbits. In summary, this is the first PAX4 gene KO rabbit model generated by CRISPR/Cas9 system. This novel rabbit model may provide a new platform for function study of PAX4 gene in rabbit and gene therapy of human DM in clinical trails.},
}
@article {pmid29886029,
year = {2018},
author = {Luo, J and Lu, L and Gu, Y and Huang, R and Gui, L and Li, S and Qi, X and Zheng, W and Chao, T and Zheng, Q and Liang, Y and Zhang, L},
title = {Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion.},
journal = {Journal of biotechnology},
volume = {281},
number = {},
pages = {11-20},
doi = {10.1016/j.jbiotec.2018.06.308},
pmid = {29886029},
issn = {1873-4863},
mesh = {Animals ; CHO Cells ; *CRISPR-Cas Systems ; Cell Line ; Cell Line, Tumor ; Cricetulus ; DNA ; Gene Editing/*methods ; Humans ; Luminescent Proteins/genetics ; Mice ; Sequence Deletion ; Streptococcus pyogenes/genetics ; },
abstract = {Genetic engineering of cell lines and model organisms has been facilitated enormously by the CRISPR/Cas9 system. However, in cell lines it remains labor intensive and time consuming to obtain desirable mutant clones due to the difficulties in isolating the mutated clones and sophisticated genotyping. In this study, we have validated fluorescent protein reporter aided cell sorting which enables the isolation of maximal diversity in mutant cells. We further applied two spectrally distinct fluorescent proteins DsRed2 and ECFP as reporters for independent CRISPR/Cas9 mediated targeting, which allows for one-cell-one-well sorting of the mutant cells. Because of ultra-high efficiency of the CRISPR/Cas9 system with dual reporters and large DNA fragment deletion resulting from independent loci cleavage, monoclonal mutant cells could be easily identified by conventional PCR. In the speed genome editing method presented here, sophisticated genotyping methods are not necessary to identify loss of function mutations after CRISPR/Cas9 genome editing, and desirable loss of function mutant clones could be obtained in less than one month following transfection.},
}
@article {pmid29844549,
year = {2018},
author = {Eisenstein, M},
title = {CRISPR takes on Huntington's disease.},
journal = {Nature},
volume = {557},
number = {7707},
pages = {S42-S43},
doi = {10.1038/d41586-018-05177-y},
pmid = {29844549},
issn = {1476-4687},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Disease Models, Animal ; *Gene Editing ; Genetic Therapy/*methods ; Humans ; Huntingtin Protein/*genetics ; Huntington Disease/*genetics/*therapy ; Mice ; Mice, Knockout ; RNAi Therapeutics ; Trinucleotide Repeat Expansion/genetics ; },
}
@article {pmid29563188,
year = {2018},
author = {Li, M and Ouyang, H and Yuan, H and Li, J and Xie, Z and Wang, K and Yu, T and Liu, M and Chen, X and Tang, X and Jiao, H and Pang, D},
title = {Site-Specific Fat-1 Knock-In Enables Significant Decrease of n-6PUFAs/n-3PUFAs Ratio in Pigs.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {5},
pages = {1747-1754},
doi = {10.1534/g3.118.200114},
pmid = {29563188},
issn = {2160-1836},
mesh = {Animals ; Base Sequence ; CRISPR-Cas Systems ; Caenorhabditis elegans/*genetics ; Caenorhabditis elegans Proteins/*genetics ; Fatty Acid Desaturases/*genetics ; Fatty Acids, Omega-3/*metabolism ; Fatty Acids, Omega-6/*metabolism ; Fetus/cytology ; Fibroblasts/metabolism ; *Gene Knock-In Techniques ; Genetic Loci ; Genetic Vectors/metabolism ; Genotype ; Mice ; *Mutagenesis, Site-Directed ; RNA, Untranslated/genetics ; Sus scrofa/*genetics ; Transcription, Genetic ; },
abstract = {The fat-1 gene from Caenorhabditis elegans encodes a fatty acid desaturase which was widely studied due to its beneficial function of converting n-6 polyunsaturated fatty acids (n-6PUFAs) to n-3 polyunsaturated fatty acids (n-3PUFAs). To date, many fat-1 transgenic animals have been generated to study disease pathogenesis or improve meat quality. However, all of them were generated using a random integration method with variable transgene expression levels and the introduction of selectable marker genes often raise biosafety concern. To this end, we aimed to generate marker-free fat-1 transgenic pigs in a site-specific manner. The Rosa26 locus, first found in mouse embryonic stem cells, has become one of the most common sites for inserting transgenes due to its safe and ubiquitous expression. In our study, the fat-1 gene was inserted into porcine Rosa 26 (pRosa26) locus via Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas9) system. The Southern blot analysis of our knock-in pigs indicated a single copy of the fat-1 gene at the pRosa26 locus. Furthermore, this single-copy fat-1 gene supported satisfactory expression in a variety of tissues in F1 generation pigs. Importantly, the gas chromatography analysis indicated that these fat-1 knock-in pigs exhibited a significant increase in the level of n-3PUFAs, leading to an obvious decrease in the n-6PUFAs/n-3PUFAs ratio from 9.36 to 2.12 (***P < 0.0001). Altogether, our fat-1 knock-in pigs hold great promise for improving the nutritional value of pork and serving as an animal model to investigate therapeutic effects of n-3PUFAs on various diseases.},
}
@article {pmid29555822,
year = {2018},
author = {Li, Y and Ma, S and Sun, L and Zhang, T and Chang, J and Lu, W and Chen, X and Liu, Y and Wang, X and Shi, R and Zhao, P and Xia, Q},
title = {Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {5},
pages = {1701-1709},
doi = {10.1534/g3.118.200134},
pmid = {29555822},
issn = {2160-1836},
mesh = {Animals ; Base Sequence ; Bombyx/enzymology/*genetics ; CRISPR-Cas Systems/genetics ; Cell Line ; Codon, Terminator/genetics ; Cytidine Deaminase/*genetics/metabolism ; Gene Editing/*methods ; Gene Knockout Techniques ; Genes, Reporter ; Genome, Insect ; INDEL Mutation/genetics ; RNA, Guide/*genetics ; },
abstract = {Genome editing using standard tools (ZFN, TALEN, and CRISPR/Cas9) rely on double strand breaks to edit the genome. A series of new CRISPR tools that convert cytidine to thymine (C to T) without the requirement for DNA double-strand breaks was developed recently and quickly applied in a variety of organisms. Here, we demonstrate that CRISPR/Cas9-dependent base editor (BE3) converts C to T with a high frequency in the invertebrate Bombyx mori silkworm. Using BE3 as a knock-out tool, we inactivated exogenous and endogenous genes through base-editing-induced nonsense mutations with an efficiency of up to 66.2%. Furthermore, genome-scale analysis showed that 96.5% of B. mori genes have one or more targetable sites that can be edited by BE3 for inactivation, with a median of 11 sites per gene. The editing window of BE3 reached up to 13 bases (from C1 to C13 in the range of gRNA) in B. mori Notably, up to 14 bases were substituted simultaneously in a single DNA molecule, with a low indel frequency of 0.6%, when 32 gRNAs were co-transfected. Collectively, our data show for the first time that RNA-guided cytidine deaminases are capable of programmable single and multiplex base editing in an invertebrate model.},
}
@article {pmid29548548,
year = {2018},
author = {Milligan, G and Inoue, A},
title = {Genome Editing Provides New Insights into Receptor-Controlled Signalling Pathways.},
journal = {Trends in pharmacological sciences},
volume = {39},
number = {5},
pages = {481-493},
doi = {10.1016/j.tips.2018.02.005},
pmid = {29548548},
issn = {1873-3735},
support = {BB/K019864/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; BB/L027887/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Animals ; *CRISPR-Cas Systems ; GTP-Binding Protein alpha Subunits/genetics/metabolism ; *Gene Editing ; HEK293 Cells ; Humans ; Receptors, G-Protein-Coupled/*genetics/*metabolism ; Signal Transduction/genetics ; },
abstract = {Rapid developments in genome editing, based largely on CRISPR/Cas9 technologies, are offering unprecedented opportunities to eliminate the expression of single or multiple gene products in intact organisms and in model cell systems. Elimination of individual G protein-coupled receptors (GPCRs), both single and multiple G protein subunits, and arrestin adaptor proteins is providing new and sometimes unanticipated insights into molecular details of the regulation of cell signalling pathways and the behaviour of receptor ligands. Genome editing is certain to become a central component of therapeutic target validation, and will provide pharmacologists with new understanding of the complexities of action of novel and previously studied ligands, as well as of the transmission of signals from individual cell-surface receptors to intracellular signalling cascades.},
}
@article {pmid29519936,
year = {2018},
author = {Katigbak, A and Robert, F and Paquet, M and Pelletier, J},
title = {Inducible Genome Editing with Conditional CRISPR/Cas9 Mice.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {5},
pages = {1627-1635},
doi = {10.1534/g3.117.300327},
pmid = {29519936},
issn = {2160-1836},
mesh = {Adoptive Transfer ; Animals ; CRISPR-Cas Systems/*genetics ; Doxycycline/pharmacology ; *Gene Editing ; Gene Expression/drug effects ; Genetic Engineering ; *Genome ; Hematopoietic Stem Cells/drug effects/metabolism ; Mice ; Mice, Transgenic ; Models, Animal ; Mouse Embryonic Stem Cells/drug effects/metabolism ; Proto-Oncogene Proteins c-myc/metabolism ; RNA, Guide/genetics ; },
abstract = {Genetically engineered mouse models (GEMMs) are powerful tools by which to probe gene function in vivo, obtain insight into disease etiology, and identify modifiers of drug response. Increased sophistication of GEMMs has led to the design of tissue-specific and inducible models in which genes of interest are expressed or ablated in defined tissues or cellular subtypes. Here we describe the generation of a transgenic mouse harboring a doxycycline-regulated Cas9 allele for inducible genome engineering. This model provides a flexible platform for genome engineering since editing is achieved by exogenous delivery of sgRNAs and should allow for the modeling of a range of biological and pathological processes.},
}
@article {pmid29326075,
year = {2018},
author = {Ahmad, G and Amiji, M},
title = {Use of CRISPR/Cas9 gene-editing tools for developing models in drug discovery.},
journal = {Drug discovery today},
volume = {23},
number = {3},
pages = {519-533},
doi = {10.1016/j.drudis.2018.01.014},
pmid = {29326075},
issn = {1878-5832},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Drug Discovery/methods ; Gene Editing/methods ; Genome/genetics ; Humans ; Models, Animal ; },
abstract = {Clustered regularly interspaced short palindromic repeat/CRISPR-associated 9 (CRISPR/Cas9) enables targeted genome engineering. The simplicity of this system, its facile engineering, and amenability to multiplex genes make it the system of choice for many applications. This system has revolutionized our ability to carry out gene editing, transcription regulation, genome imaging, and epigenetic modification. In this review, we discuss the discovery of CRISPR/Cas9, its mechanism of action, its application in medicine and animal model development, and its delivery. We also highlight how the CRISPR/Cas9 system can affect the next generation of drugs by accelerating the identification and validation of high-value targets. The generation of precision disease models through this system will provide a rapid avenue for functional drug screening.},
}
@article {pmid28271030,
year = {2017},
author = {Ackermann, AM and Zhang, J and Heller, A and Briker, A and Kaestner, KH},
title = {High-fidelity Glucagon-CreER mouse line generated by CRISPR-Cas9 assisted gene targeting.},
journal = {Molecular metabolism},
volume = {6},
number = {3},
pages = {236-244},
doi = {10.1016/j.molmet.2017.01.003},
pmid = {28271030},
issn = {2212-8778},
support = {P30 DK019525/DK/NIDDK NIH HHS/United States ; P30 DK050306/DK/NIDDK NIH HHS/United States ; P30 DK019525/DK/NIDDK NIH HHS/United States ; P01 DK049210/DK/NIDDK NIH HHS/United States ; UC4 DK104119/DK/NIDDK NIH HHS/United States ; },
mesh = {3' Untranslated Regions/genetics ; Animals ; CRISPR-Cas Systems/drug effects ; Diabetes Mellitus, Type 2/genetics/metabolism ; Gene Knock-In Techniques ; Gene Targeting ; Genetic Engineering/*methods ; Genetic Techniques ; Glucagon/*genetics/metabolism ; Glucagon-Secreting Cells/metabolism/physiology ; Islets of Langerhans/drug effects ; Mice ; Mice, Transgenic/*genetics ; Tamoxifen/pharmacology ; Transgenes/drug effects ; },
abstract = {OBJECTIVE: α-cells are the second most prominent cell type in pancreatic islets and are responsible for producing glucagon to increase plasma glucose levels in times of fasting. α-cell dysfunction and inappropriate glucagon secretion occur in both type 1 and type 2 diabetes. Thus, there is growing interest in studying both normal function and pathophysiology of α-cells. However, tools to target gene ablation or activation specifically of α-cells have been limited, compared to those available for β-cells. Previous Glucagon-Cre and Glucagon-CreER transgenic mouse lines have suffered from transgene silencing, and the only available Glucagon-CreER &quot;knock-in&quot; mouse line results in glucagon haploinsufficiency, which can confound the interpretation of gene deletion analyses. Therefore, we sought to develop a Glucagon-CreERT2 mouse line that would maintain normal glucagon expression and would be less susceptible to transgene silencing.<br><br>METHODS: We utilized CRISPR-Cas9 technology to insert an IRES-CreERT2 sequence into the 3' UTR of the Glucagon (Gcg) locus in mouse embryonic stem cells (ESCs). Targeted ESC clones were then injected into mouse blastocysts to obtain Gcg-CreERT2 mice. Recombination efficiency in GCG+ pancreatic α-cells and glucagon-like peptide 1 positive (GLP1+) enteroendocrine L-cells was measured in Gcg-CreERT2 ;Rosa26-LSL-YFP mice injected with tamoxifen during fetal development and adulthood.<br><br>RESULTS: Tamoxifen injection of Gcg-CreERT2 ;Rosa26-LSL-YFP mice induced high recombination efficiency of the Rosa26-LSL-YFP locus in perinatal and adult α-cells (88% and 95%, respectively), as well as in first-wave fetal α-cells (36%) and adult enteroendocrine L-cells (33%). Mice homozygous for the Gcg-CreERT2 allele were phenotypically normal.<br><br>CONCLUSIONS: We successfully derived a Gcg-CreERT2 mouse line that expresses CreERT2 in pancreatic α-cells and enteroendocrine L-cells without disrupting preproglucagon gene expression. These mice will be a useful tool for performing temporally controlled genetic manipulation specifically in these cell types.},
}
@article {pmid28266557,
year = {2017},
author = {Chen, J and Jiang, D and Tan, D and Fan, Z and Wei, Y and Li, M and Wang, D},
title = {Heterozygous mutation of eEF1A1b resulted in spermatogenesis arrest and infertility in male tilapia, Oreochromis niloticus.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {43733},
doi = {10.1038/srep43733},
pmid = {28266557},
issn = {2045-2322},
mesh = {Animals ; CRISPR-Cas Systems ; Gene Expression Profiling ; Gene Expression Regulation ; Gene Order ; Gene Targeting ; *Genetic Association Studies ; Genetic Loci ; Gonads/metabolism ; *Heterozygote ; Infertility, Male/*genetics/metabolism ; Male ; *Mutation ; Peptide Elongation Factor 1/*genetics/metabolism ; Protein Transport ; Spermatogenesis/*genetics ; Tilapia/*genetics/metabolism ; Transcriptome ; },
abstract = {Eukaryotic elongation factor 1 alpha (eEF1A) is an essential component of the translational apparatus. In the present study, eEF1A1b was isolated from the Nile tilapia. Real-time PCR and Western blot revealed that eEF1A1b was expressed highly in the testis from 90 dah (days after hatching) onwards. In situ hybridization and immunohistochemistry analyses showed that eEF1A1b was highly expressed in the spermatogonia of the testis. CRISPR/Cas9 mediated mutation of eEF1A1b resulted in spermatogenesis arrest and infertility in the F0 XY fish. Consistently, heterozygous mutation of eEF1A1b (eEF1A1b+/-) resulted in an absence of spermatocytes at 90 dah, very few spermatocytes, spermatids and spermatozoa at 180 dah, and decreased Cyp11b2 and serum 11-ketotestosterone level at both stages. Further examination of the fertilization capacity of the sperm indicated that the eEF1A1b+/- XY fish were infertile due to abnormal spermiogenesis. Transcriptomic analyses of the eEF1A1b+/- testis from 180 dah XY fish revealed that key elements involved in spermatogenesis, steroidogenesis and sperm motility were significantly down-regulated compared with the control XY. Transgenic overexpression of eEF1A1b rescued the spermatogenesis arrest phenotype of the eEF1A1b+/- testis. Taken together, our data suggested that eEF1A1b is crucial for spermatogenesis and male fertility in the Nile tilapia.},
}
@article {pmid30388409,
year = {2018},
author = {Terns, MP},
title = {CRISPR-Based Technologies: Impact of RNA-Targeting Systems.},
journal = {Molecular cell},
volume = {72},
number = {3},
pages = {404-412},
doi = {10.1016/j.molcel.2018.09.018},
pmid = {30388409},
issn = {1097-4164},
abstract = {DNA-targeting CRISPR-Cas systems, such as those employing the RNA-guided Cas9 or Cas12 endonucleases, have revolutionized our ability to predictably edit genomes and control gene expression. Here, I summarize information on RNA-targeting CRISPR-Cas systems and describe recent advances in converting them into powerful and programmable RNA-binding and cleavage tools with a wide range of novel and important biotechnological and biomedical applications.},
}
@article {pmid30387552,
year = {2018},
author = {Kumlehn, J and Pietralla, J and Hensel, G and Pacher, M and Puchta, H},
title = {The CRISPR/Cas revolution continues: From efficient gene editing for crop breeding to plant synthetic biology.},
journal = {Journal of integrative plant biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/jipb.12734},
pmid = {30387552},
issn = {1744-7909},
abstract = {Since the discovery that nucleases of the bacterial CRISPR/Cas system can be used as easily programmable tools for genome engineering, their application massively transformed different areas of plant biology. In this review, we assess the current state of their use for crop breeding to incorporate attractive new agronomical traits into specific cultivars of various crop plants. This can be achieved by the use of Cas9/12 nucleases for double strand break induction, resulting in mutations by non-homologous recombination. Strategies for performing such experiments - from the design of guide RNA to the use of different transformation technologies - are evaluated. Furthermore, we sum up recent developments regarding the use of nuclease-deficient Cas9/12 proteins, as DNA-binding moieties for targeting different kinds of enzyme activities to specific sites within the genome. Progress in base deamination, transcriptional induction and transcriptional repression, as well as in imaging in plants, is also discussed. As different Cas9/12 enzymes are at hand, the simultaneous application of various enzyme activities, to multiple genomic sites, is now in reach to redirect plant metabolism in a multifunctional manner and pave the way for a new level of plant synthetic biology.},
}
@article {pmid30386377,
year = {2018},
author = {Guzina, J and Chen, WH and Stankovic, T and Djordjevic, M and Zdobnov, E and Djordjevic, M},
title = {In silico Analysis Suggests Common Appearance of scaRNAs in Type II Systems and Their Association With Bacterial Virulence.},
journal = {Frontiers in genetics},
volume = {9},
number = {},
pages = {474},
doi = {10.3389/fgene.2018.00474},
pmid = {30386377},
issn = {1664-8021},
abstract = {In addition to its well-established defense function, CRISPR/Cas can also exhibit crucial non-canonical activity through endogenous gene expression regulation, which was found to mainly affect bacterial virulence. These non-canonical functions depend on scaRNA, which is a small RNA encoded outside of CRISPR array, that is typically flanked by a transcription start site (TSS) and a terminator, and is in part complementary to another small CRISPR/Cas-associated RNA (tracrRNAs). Identification of scaRNAs is however largely complicated by the scarcity of RNA-Seq data across different bacteria, so that they were identified only in a relatively rare CRISPR/Cas subtype (IIB), and the possibility of finding them in other Type II systems is currently unclear. This study presents the first effort toward systematic detection of small CRISPR/Cas-associated regulatory RNAs, where obtained predictions can guide future experiments. The core of our approach is ab initio detection of small RNAs from bacterial genome, which is based on jointly predicting transcription signals - TSS and terminators - and homology to CRISPR array repeat. Particularly, we employ our improved approach for detecting bacterial TSS, since accurate TSS detection is the main limiting factor for accurate small RNA prediction. We also explore how our predictions match to available RNA-Seq data and analyze their conservation across related bacterial species. In Type IIB systems, our predictions are consistent with experimental data, and we systematically identify scaRNAs throughout this subtype. Furthermore, we identify scaRNA:tracrRNA pairs in a number of IIA/IIC systems, where the appearance of scaRNAs co-occurs with the strains being pathogenic. RNA-Seq and conservation analysis show that our method is well suited for predicting CRISPR/Cas-associated small RNAs. We also find possible existence of a modified mechanism of CRISPR-associated small RNA action, which, interestingly, closely resembles the setup employed in biotechnological applications. Overall, our findings indicate that scaRNA:tracrRNA pairs are present in all subtypes of Type II systems, and point to an underlying connection with bacterial virulence. In addition to formulating these hypotheses, careful manual curation that we performed, makes an important first step toward fully automated predictor of CRISPR/Cas-associated small RNAs, which will allow their large scale analysis across diverse bacterial genomes.},
}
@article {pmid30386178,
year = {2018},
author = {Shankar, S and Sreekumar, A and Prasad, D and Das, AV and Pillai, MR},
title = {Genome editing of oncogenes with ZFNs and TALENs: caveats in nuclease design.},
journal = {Cancer cell international},
volume = {18},
number = {},
pages = {169},
doi = {10.1186/s12935-018-0666-0},
pmid = {30386178},
issn = {1475-2867},
abstract = {Background: Gene knockout technologies involving programmable nucleases have been used to create knockouts in several applications. Gene editing using Zinc-finger nucleases (ZFNs), Transcription activator like effectors (TALEs) and CRISPR/Cas systems has been used to create changes in the genome in order to make it non-functional. In the present study, we have looked into the possibility of using six fingered CompoZr ZFN pair to target the E6 gene of HPV 16 genome.<br><br>Methods: HPV 16+ve cell lines; SiHa and CaSki were used for experiments. CompoZr ZFNs targeting E6 gene were designed and constructed by Sigma-Aldrich. TALENs targeting E6 and E7 genes were made using TALEN assembly kit. Gene editing was monitored by T7E1 mismatch nuclease and Nuclease resistance assays. Levels of E6 and E7 were further analyzed by RT-PCR, western blot as well as immunoflourescence analyses. To check if there is any interference due to methylation, cell lines were treated with sodium butyrate, and Nocodazole.<br><br>Results: Although ZFN editing activity in yeast based MEL-I assay was high, it yielded very low activity in tumor cell lines; only 6% editing in CaSki and negligible activity in SiHa cell lines. Though editing efficiency was better in CaSki, no significant reduction in E6 protein levels was observed in immunocytochemical analysis. Further, in silico analysis of DNA binding prediction revealed that some of the ZFN modules bound to sequence that did not match the target sequence. Hence, alternate ZFN pairs for E6 and E7 were not synthesized since no further active sites could be identified by in silico analyses. Then we designed TALENs to target E6 and E7 gene. TALENs designed to target E7 gene led to reduction of E7 levels in CaSki and SiHa cervical cancer cell lines. However, TALEN designed to target E6 gene did not yield any editing activity.<br><br>Conclusions: Our study highlights that designed nucleases intended to obtain bulk effect should have a reasonable editing activity which reflects phenotypically as well. Nucleases with low editing efficiency, intended for generation of knockout cell lines nucleases could be obtained by single cell cloning. This could serve as a criterion for designing ZFNs and TALENs.},
}
@article {pmid30262503,
year = {2018},
author = {He, S and Del Viso, F and Chen, CY and Ikmi, A and Kroesen, AE and Gibson, MC},
title = {An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6409},
pages = {1377-1380},
doi = {10.1126/science.aar8384},
pmid = {30262503},
issn = {1095-9203},
mesh = {Animals ; Bacterial Proteins ; Body Patterning/*genetics ; CRISPR-Cas Systems ; Endoderm/cytology/growth &amp; development ; Endonucleases ; *Gene Expression Regulation, Developmental ; Gene Knockdown Techniques/methods ; Genes, Homeobox/genetics/*physiology ; Larva/cytology/genetics/growth &amp; development ; Mutagenesis ; RNA, Small Interfering/genetics ; Sea Anemones/cytology/genetics/*growth &amp; development ; Transcription Factors/genetics/*physiology ; },
abstract = {Hox genes encode conserved developmental transcription factors that govern anterior-posterior (A-P) pattering in diverse bilaterian animals, which display bilateral symmetry. Although Hox genes are also present within Cnidaria, these simple animals lack a definitive A-P axis, leaving it unclear how and when a functionally integrated Hox code arose during evolution. We used short hairpin RNA (shRNA)-mediated knockdown and CRISPR-Cas9 mutagenesis to demonstrate that a Hox-Gbx network controls radial segmentation of the larval endoderm during development of the sea anemone Nematostella vectensis. Loss of Hox-Gbx activity also elicits marked defects in tentacle patterning along the directive (orthogonal) axis of primary polyps. On the basis of our results, we propose that an axial Hox code may have controlled body patterning and tissue segmentation before the evolution of the bilaterian A-P axis.},
}
@article {pmid30167805,
year = {2018},
author = {Kroth, PG and Bones, AM and Daboussi, F and Ferrante, MI and Jaubert, M and Kolot, M and Nymark, M and Río Bártulos, C and Ritter, A and Russo, MT and Serif, M and Winge, P and Falciatore, A},
title = {Genome editing in diatoms: achievements and goals.},
journal = {Plant cell reports},
volume = {37},
number = {10},
pages = {1401-1408},
doi = {10.1007/s00299-018-2334-1},
pmid = {30167805},
issn = {1432-203X},
support = {GBMF4966//Gordon and Betty Moore Foundation/ ; },
mesh = {CRISPR-Cas Systems ; Diatoms/*genetics ; Gene Editing/*methods ; Genome ; Transcription Activator-Like Effector Nucleases/genetics/metabolism ; },
abstract = {Diatoms are major components of phytoplankton and play a key role in the ecology of aquatic ecosystems. These algae are of great scientific importance for a wide variety of research areas, ranging from marine ecology and oceanography to biotechnology. During the last 20 years, the availability of genomic information on selected diatom species and a substantial progress in genetic manipulation, strongly contributed to establishing diatoms as molecular model organisms for marine biology research. Recently, tailored TALEN endonucleases and the CRISPR/Cas9 system were utilized in diatoms, allowing targeted genetic modifications and the generation of knockout strains. These approaches are extremely valuable for diatom research because breeding, forward genetic screens by random insertion, and chemical mutagenesis are not applicable to the available model species Phaeodactylum tricornutum and Thalassiosira pseudonana, which do not cross sexually in the lab. Here, we provide an overview of the genetic toolbox that is currently available for performing stable genetic modifications in diatoms. We also discuss novel challenges that need to be addressed to fully exploit the potential of these technologies for the characterization of diatom biology and for metabolic engineering.},
}
@article {pmid30074178,
year = {2018},
author = {Cheng, YX and Chen, GT and Yang, X and Wang, YQ and Hong, L},
title = {Effects of HPV Pseudotype Virus in Cutting E6 Gene Selectively in SiHa Cells.},
journal = {Current medical science},
volume = {38},
number = {2},
pages = {212-221},
doi = {10.1007/s11596-018-1868-3},
pmid = {30074178},
issn = {2523-899X},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Carcinogenesis/pathology ; Cell Line, Tumor ; Cell Proliferation ; Human papillomavirus 16/*metabolism ; Humans ; Mice, Inbred BALB C ; Mice, Nude ; Neoplasm Invasiveness ; Oncogene Proteins, Viral/*genetics/metabolism ; Plasmids/metabolism ; RNA, Guide/metabolism ; RNA, Messenger/genetics/metabolism ; Repressor Proteins/*genetics/metabolism ; },
abstract = {The objectives of this study were to investigate the effects of the CRISPR/Cas9 system mediated by the HPV pseudotype virus on SiHa cytobiology behavior by cutting the HPV16 E6 gene selectively and to explore the role of this system in the treatment of cervical cancer. After designing specific gRNA sequences targeting HPV16 E6, generating hCas9-EGFP and E6-gRNA-RFP plasmids, and preparing the pseudovirus of HPV16 carrying E6-gRNA and Cas9 plasmids, we determined the titer of the pseudotype virus using the TCID50 method. We obtained the pseudotype virus of HPV16 carrying E6-gRNA and Cas9 plasmids to transfect cervical cancer SiHa cells. Experimental subjects were divided into control group, empty virus group, E6-gRNA transfected group, Cas9 transfected group and Cas9+E6-gRNA transfected group. The molecular size of the cutting sequence was detected using the T7E1 enzyme digestion method and agarose gel electrophoresis, and the cleavage function of CRISPR/Cas9 on the E6 gene was determined at the same time. RT-PCR and Western blotting were performed to detect the mRNA and protein expression levels of E6 in all the groups; the Transwell cell migration assay was performed to detect the cell migration ability and metastasis in all groups. Heterotopic transplantation tumors were incorporated into mice and were used to investigate the effects of the CRISPR/Cas9 system mediated by the HPV pseudovirus on the tumorigenic ability of SiHa cells by selectively cutting HPV16 E6. The HPV16 pseudotype virus carrying E6-gRNA and Cas9 plasmids could successfully infect SiHa cells, and there were two cutting zones in the Cas9+E6-gRNA transfected group. However, the empty virus group, E6-gRNA transfected group and Cas9 transfected group had no corresponding zone. Compared with those in the control group, the empty virus group, E6-gRNA transfected group and Cas9 transfected group, the mRNA and protein expression levels of E6 in SiHa cells were downregulated in the Cas9+E6-gRNA transfected group (P<0.01). In addition, the proliferation and migration abilities of SiHa cells were significantly inhibited (P<0.01). There were no significant differences among the other groups. In contrast to the control group, the HPV pseudotype virus carrying E6-gRNA and Cas9 plasmids could significantly delay the growth of tumor cells of the ectopic tumor transplantation model (P<0.01). The CRISPR/Cas9 system mediated by the HPV pseudotype virus to knockout E6 gene expression exhibited a clear inhibitory effect on the biological function of SiHa cells, which indicated that knocking out the E6 gene using the CRISPR/Cas9 system mediated by the HPV pseudotype virus had a potential effect of eliminating HPV infection and inhibiting the growth of HPV-related tumors. Taken together, these findings provide insight into a new treatment strategy for the prevention and treatment of hr-HPV infected disease, particularly in HPV-related tumors.},
}
@article {pmid29511025,
year = {2018},
author = {Bertier, LD and Ron, M and Huo, H and Bradford, KJ and Britt, AB and Michelmore, RW},
title = {High-Resolution Analysis of the Efficiency, Heritability, and Editing Outcomes of CRISPR/Cas9-Induced Modifications of NCED4 in Lettuce (Lactuca sativa).},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {5},
pages = {1513-1521},
doi = {10.1534/g3.117.300396},
pmid = {29511025},
issn = {2160-1836},
mesh = {Alleles ; CRISPR-Cas Systems/*genetics ; *Gene Editing ; Gene Knockout Techniques ; Genetic Markers ; Germ Cells/metabolism ; Germination/genetics ; Hot Temperature ; Inheritance Patterns/*genetics ; Lettuce/*genetics ; Mutation/genetics ; Phenotype ; Plant Proteins/*genetics/metabolism ; Plants, Genetically Modified ; RNA, Guide/genetics ; Sequence Analysis, DNA ; Transformation, Genetic ; },
abstract = {CRISPR/Cas9 is a transformative tool for making targeted genetic alterations. In plants, high mutation efficiencies have been reported in primary transformants. However, many of the mutations analyzed were somatic and therefore not heritable. To provide more insights into the efficiency of creating stable homozygous mutants using CRISPR/Cas9, we targeted LsNCED4 (9-cis-EPOXYCAROTENOID DIOXYGENASE4), a gene conditioning thermoinhibition of seed germination in lettuce. Three constructs, each capable of expressing Cas9 and a single gRNA targeting different sites in LsNCED4, were stably transformed into lettuce (Lactuca sativa) cvs. Salinas and Cobham Green. Analysis of 47 primary transformants (T1) and 368 T2 plants by deep amplicon sequencing revealed that 57% of T1 plants contained events at the target site: 28% of plants had germline mutations in one allele indicative of an early editing event (mono-allelic), 8% of plants had germline mutations in both alleles indicative of two early editing events (bi-allelic), and the remaining 21% of plants had multiple low frequency mutations indicative of late events (chimeric plants). Editing efficiency was similar in both genotypes, while the different gRNAs varied in efficiency. Amplicon sequencing of 20 T1 and more than 100 T2 plants for each of the three gRNAs showed that repair outcomes were not random, but reproducible and characteristic for each gRNA. Knockouts of NCED4 resulted in large increases in the maximum temperature for seed germination, with seeds of both cultivars capable of germinating >70% at 37°. Knockouts of NCED4 provide a whole-plant selectable phenotype that has minimal pleiotropic consequences. Targeting NCED4 in a co-editing strategy could therefore be used to enrich for germline-edited events simply by germinating seeds at high temperature.},
}
@article {pmid27436552,
year = {2016},
author = {Reid, W and O'Brochta, DA},
title = {Applications of genome editing in insects.},
journal = {Current opinion in insect science},
volume = {13},
number = {},
pages = {43-54},
doi = {10.1016/j.cois.2015.11.001},
pmid = {27436552},
issn = {2214-5753},
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems/genetics ; Endonucleases/metabolism ; *Gene Editing ; Genome, Insect/*genetics ; Insecta/*genetics ; },
abstract = {Insect genome editing was first reported 1991 in Drosophila melanogaster but the technology used was not portable to other species. Not until the recent development of facile, engineered DNA endonuclease systems has gene editing become widely available to insect scientists. Most applications in insects to date have been technical in nature but this is rapidly changing. Functional genomics and genetics-based insect control efforts will be major beneficiaries of the application of contemporary gene editing technologies. Engineered endonucleases like Cas9 make it possible to create powerful and effective gene drive systems that could be used to reduce or even eradicate specific insect populations. 'Best practices' for using Cas9-based editing are beginning to emerge making it easier and more effective to design and use but gene editing technologies still require traditional means of delivery in order to introduce them into somatic and germ cells of insects-microinjection of developing embryos. This constrains the use of these technologies by insect scientists. Insects created using editing technologies challenge existing governmental regulatory structures designed to manage genetically modified organisms.},
}
@article {pmid30382180,
year = {2018},
author = {Wang, HC and Wang, P and Chen, YW and Zhang, Y},
title = {Bevacizumab or fibronectin gene editing inhibits the osteoclastogenic effects of fibroblasts derived from human radicular cysts.},
journal = {Acta pharmacologica Sinica},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41401-018-0172-x},
pmid = {30382180},
issn = {1745-7254},
abstract = {Fibronectin (FN) is a main component of extracellular matrix (ECM) in most adult tissues. Under pathological conditions, particularly inflammation, wound healing and tumors, an alternatively spliced exon extra domain A (EDA) is included in the FN protein (EDA+FN), which facilitates cellular proliferation, motility, and aggressiveness in different lesions. In this study we investigated the effects of EDA+FN on bone destruction in human radicular cysts and explored the possibility of editing FN gene or blocking the related paracrine signaling pathway to inhibit the osteoclastogenesis. The specimens of radicular cysts were obtained from 20 patients. We showed that the vessel density was positively associated with both the lesion size (R = 0.49, P = 0.001) and EDA+FN staining (R = 0.26, P = 0.022) in the specimens. We isolated fibroblasts from surgical specimens, and used the CRISPR/Cas system to knockout the EDA exon, or used IST-9 antibody and bevacizumab to block EDA+FN and VEGF, respectively. Compared to control fibroblasts, the fibroblasts from radicular cysts exhibited significantly more Trap+MNCs, the relative expression level of VEGF was positively associated with both the ratio of EDA+FN/total FN (R = 0.271, P = 0.019) and with the number of Trap+MNCs (R = 0.331, P = 0.008). The knockout of the EDA exon significantly decreased VEGF expression in the fibroblasts derived from radicular cysts, leading to significantly decreased osteoclastogenesis; similar results were observed using bevacizumab to block VEGF, but block of EDA+FN with IST-9 antibody had no effect. Furthermore, the inhibitory effects of gene editing on Trap+MNC development were restored by exogenous VEGF. These results suggest that EDA+FN facilitates osteoclastogenesis in the fibrous capsule of radicular cysts, through a mechanism mediated by VEGF via an autocrine effect on the fibroblasts. Bevacizumab inhibits osteoclastogenesis in radicular cysts as effectively as the exclusion of the EDA exon by gene editing.},
}
@article {pmid29180469,
year = {2018},
author = {Yang, X and Wang, Z and Li, X and Liu, B and Liu, M and Liu, L and Chen, S and Ren, M and Wang, Y and Yu, M and Wang, B and Zou, J and Zhu, WG and Yin, Y and Gu, W and Luo, J},
title = {SHMT2 Desuccinylation by SIRT5 Drives Cancer Cell Proliferation.},
journal = {Cancer research},
volume = {78},
number = {2},
pages = {372-386},
doi = {10.1158/0008-5472.CAN-17-1912},
pmid = {29180469},
issn = {1538-7445},
mesh = {Animals ; Apoptosis ; Biomarkers, Tumor/genetics/*metabolism ; CRISPR-Cas Systems ; *Cell Proliferation ; Colonic Neoplasms/genetics/metabolism/*pathology ; Gene Expression Regulation, Neoplastic ; Glycine Hydroxymethyltransferase/antagonists &amp; inhibitors/genetics/*metabolism ; Humans ; Male ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; *Protein Processing, Post-Translational ; Serine/metabolism ; Sirtuins/genetics/*metabolism ; Succinates/chemistry/*metabolism ; Tumor Cells, Cultured ; Xenograft Model Antitumor Assays ; },
abstract = {The mitochondrial serine hydroxymethyltransferase SHMT2, which catalyzes the rate-limiting step in serine catabolism, drives cancer cell proliferation, but how this role is regulated is undefined. Here, we report that the sirtuin SIRT5 desuccinylates SHMT2 to increase its activity and drive serine catabolism in tumor cells. SIRT5 interaction directly mediated desuccinylation of lysine 280 on SHMT2, which was crucial for activating its enzymatic activity. Conversely, hypersuccinylation of SHMT2 at lysine 280 was sufficient to inhibit its enzymatic activity and downregulate tumor cell growth in vitro and in vivo Notably, SIRT5 inactivation led to SHMT2 enzymatic downregulation and to abrogated cell growth under metabolic stress. Our results reveal that SHMT2 desuccinylation is a pivotal signal in cancer cells to adapt serine metabolic processes for rapid growth, and they highlight SIRT5 as a candidate target for suppressing serine catabolism as a strategy to block tumor growth.Significance: These findings reveal a novel mechanism for controlling cancer cell proliferation by blocking serine catabolism, as a general strategy to impede tumor growth. Cancer Res; 78(2); 372-86. ©2017 AACR.},
}
@article {pmid29126790,
year = {2018},
author = {Jacob, P and Avni, A and Bendahmane, A},
title = {Translational Research: Exploring and Creating Genetic Diversity.},
journal = {Trends in plant science},
volume = {23},
number = {1},
pages = {42-52},
doi = {10.1016/j.tplants.2017.10.002},
pmid = {29126790},
issn = {1878-4372},
mesh = {CRISPR-Cas Systems ; Crops, Agricultural/*genetics ; Evolution, Molecular ; *Genetic Variation ; Plant Breeding/*methods ; Plants, Genetically Modified ; },
abstract = {The crop selection process has created a genetic bottleneck ultimately restricting breeding output. Wild relatives of major crops as well as the so-called 'neglected plant' species represent a reservoir of genetic diversity that remains underutilized. These species could be used as a tool to discover new alleles of agronomic interest or could be the target of breeding programs. Targeted induced local lesions in the genome (TILLING) can be used to translate in neglected crops what has been discovered in major crops and reciprocally. However, random mutagenesis, used in TILLING approaches, provides only a limited density of mutational events at a defined target locus. Alternatively, clustered regularly interspaced short palindromic repeats (CRISPR) associated 9 (Cas9) fused to a cytidine deaminase could serve as a localized mutagenic agent to produce high-density mutant populations. Artificial evolution is at hand.},
}
@article {pmid28256553,
year = {2017},
author = {Li, B and Cui, G and Shen, G and Zhan, Z and Huang, L and Chen, J and Qi, X},
title = {Targeted mutagenesis in the medicinal plant Salvia miltiorrhiza.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {43320},
doi = {10.1038/srep43320},
pmid = {28256553},
issn = {2045-2322},
mesh = {Agrobacterium/genetics/metabolism ; Base Sequence ; *CRISPR-Cas Systems ; Diterpenes/metabolism ; Diterpenes, Abietane ; Gene Editing/methods ; Gene Expression Regulation, Plant ; Gene Knockout Techniques ; *Genome, Plant ; Hydroxybenzoates/metabolism ; Ligases/deficiency/*genetics ; Mutagenesis ; Phenanthrenes ; Plant Proteins/*genetics/metabolism ; Plant Roots/*genetics/metabolism ; Plants, Medicinal ; Salvia miltiorrhiza/*genetics/metabolism ; Sequence Alignment ; },
abstract = {CRISPR/Cas9 is a powerful genome editing tool that has been extensively used in model plants and crops, such as Arabidopsis thaliana, rice, wheat, and soybean. Here, we report the use of CRISPR/Cas9 to precisely knock out the committed diterpene synthase gene (SmCPS1) involved in tanshinone biosynthesis in Salvia miltiorrhiza, a traditional Chinese medicinal herb with significant pharmacological activities, such as vasorelaxation, protection against ischemia-reperfusion injury, and antiarrhythmic effects. Three homozygous and eight chimeric mutants were obtained from 26 independent transgenic hairy root lines by Agrobacterium rhizogenes-mediated transformation. The metabolomic analysis based on LC-qTOF-MS and Q-TRAP-LC-MS/MS revealed that tanshinones, especially cryptotanshinone, tanshinone IIA and tanshinone I, are completely missing in homozygous mutants, without influencing other phenolic acid metabolites. By contrast, tanshinones are decreased but still detectable in chimeric mutants, which is similar to a previously-reported an RNAi study of SmCPS1. These results demonstrate that Agrobacterium rhizogenes- mediated transformation using CRISPR/Cas9 is a simple and efficient genome editing tool in S. miltiorrhiza, thus paving the way for large-scale genome editing in S. miltiorrhiza, which is important for pathway elucidation of secondary metabolites, quality improvement, and yield increases for this valuable traditional Chinese medicinal herb.},
}
@article {pmid30375719,
year = {2018},
author = {Pickett, CJ and Zeller, RW},
title = {Efficient genome editing using CRISPR-Cas-mediated homology directed repair in the ascidian Ciona robusta.},
journal = {Genesis (New York, N.Y. : 2000)},
volume = {},
number = {},
pages = {},
doi = {10.1002/dvg.23260},
pmid = {30375719},
issn = {1526-968X},
abstract = {Eliminating or silencing a gene's level of activity is one of the classic approaches developmental biologists employ to determine a gene's function. A recently developed method of gene perturbation called CRISPR-Cas, which was derived from a prokaryotic adaptive immune system, has been adapted for use in eukaryotic cells. This technology has been established in several model organisms as a powerful and efficient tool for knocking out or knocking down the function of a gene of interest. It has been recently shown that CRISPR-Cas functions with fidelity and efficiency in Ciona robusta. Here, we show that in C. robusta CRISPR-Cas mediated genomic knock-ins can be efficiently generated. Electroporating a tissue-specific transgene driving Cas9 and a U6-driven gRNA transgene together with a fluorescent protein-containing homology directed repair (FP-HDR) template results in gene-specific patterns of fluorescence consistent with a targeted genomic insertion. Using the Tyrosinase locus to optimize reagents, we first characterize a new Pol III promoter for expressing gRNAs from the C. savignyi H1 gene, and then adapt technology that flanks gRNAs by ribozymes allowing cell-specific expression from Pol II promoters. Next, we examine homology arm-length efficiencies of FP-HDR templates. Reagents were then developed for targeting Brachyury and Pou4 that resulted in expected patterns of fluorescence, and sequenced PCR amplicons derived from single embryos validated predicted genomic insertions. Finally, using two differentially colored FP-HDR templates, we show that biallelic FP-HDR template insertion can be detected in live embryos of the F0 generation. This article is protected by copyright. All rights reserved.},
}
@article {pmid30374457,
year = {2018},
author = {England, WE and Kim, T and Whitaker, RJ},
title = {Metapopulation Structure of CRISPR-Cas Immunity in Pseudomonas aeruginosa and Its Viruses.},
journal = {mSystems},
volume = {3},
number = {5},
pages = {},
doi = {10.1128/mSystems.00075-18},
pmid = {30374457},
issn = {2379-5077},
abstract = {Viruses that infect the widespread opportunistic pathogen Pseudomonas aeruginosa have been shown to influence physiology and critical clinical outcomes in cystic fibrosis (CF) patients. To understand how CRISPR-Cas immune interactions may contribute to the distribution and coevolution of P. aeruginosa and its viruses, we reconstructed CRISPR arrays from a highly sampled longitudinal data set from CF patients attending the Copenhagen Cystic Fibrosis Clinic in Copenhagen, Denmark (R. L. Marvig, L. M. Sommer, S. Molin, and H. K. Johansen, Nat Genet 47:57-64, 2015, https://doi.org/10.1038/ng.3148). We show that new spacers are not added to or deleted from CRISPR arrays over time within a single patient but do vary among patients in this data set. We compared assembled CRISPR arrays from this data set to CRISPR arrays extracted from 726 additional publicly available P. aeruginosa sequences to show that local diversity in this population encompasses global diversity and that there is no evidence for population structure associated with location or environment sampled. We compare over 3,000 spacers from our global data set to 98 lytic and temperate viruses and proviruses and find a subset of related temperate virus clusters frequently targeted by CRISPR spacers. Highly targeted viruses are matched by different spacers in different arrays, resulting in a pattern of distributed immunity within the global population. Understanding the multiple immune contexts that P. aeruginosa viruses face can be applied to study of P. aeruginosa gene transfer, the spread of epidemic strains in cystic fibrosis patients, and viral control of P. aeruginosa infection. IMPORTANCE Pseudomonas aeruginosa is a widespread opportunistic pathogen and a major cause of morbidity and mortality in cystic fibrosis patients. Microbe-virus interactions play a critical role in shaping microbial populations, as viral infections can kill microbial populations or contribute to gene flow among microbes. Investigating how P. aeruginosa uses its CRISPR immune system to evade viral infection aids our understanding of how this organism spreads and evolves alongside its viruses in humans and the environment. Here, we identify patterns of CRISPR targeting and immunity that indicate P. aeruginosa and its viruses evolve in both a broad global population and in isolated human &quot;islands.&quot; These data set the stage for exploring metapopulation dynamics occurring within and between isolated &quot;island&quot; populations associated with CF patients, an essential step to inform future work predicting the specificity and efficacy of virus therapy and the spread of invasive viral elements and pathogenic epidemic bacterial strains.},
}
@article {pmid30253789,
year = {2018},
author = {Gaj, T and Perez-Pinera, P},
title = {The continuously evolving CRISPR barcoding toolbox.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {143},
doi = {10.1186/s13059-018-1541-y},
pmid = {30253789},
issn = {1474-760X},
mesh = {Animals ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; },
abstract = {Two articles recently described the development of CRISPR technologies that have the potential to fundamentally transform the barcoding and tracing of mammalian cells.},
}
@article {pmid30093604,
year = {2018},
author = {Kalhor, R and Kalhor, K and Mejia, L and Leeper, K and Graveline, A and Mali, P and Church, GM},
title = {Developmental barcoding of whole mouse via homing CRISPR.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6405},
pages = {},
doi = {10.1126/science.aat9804},
pmid = {30093604},
issn = {1095-9203},
support = {P50 HG005550/HG/NHGRI NIH HHS/United States ; R01 GM123313/GM/NIGMS NIH HHS/United States ; R01 MH103910/MH/NIMH NIH HHS/United States ; R01 CA222826/CA/NCI NIH HHS/United States ; R01 HG009285/HG/NHGRI NIH HHS/United States ; },
mesh = {Alleles ; Animals ; *CRISPR-Cas Systems ; Cell Lineage ; Embryonic Development/*genetics ; Embryonic Stem Cells ; Gene Expression Profiling/*methods ; Mice ; Mutation ; RNA, Guide/genetics ; },
abstract = {In vivo barcoding using nuclease-induced mutations is a powerful approach for recording biological information, including developmental lineages; however, its application in mammalian systems has been limited. We present in vivo barcoding in the mouse with multiple homing guide RNAs that each generate hundreds of mutant alleles and combine to produce an exponential diversity of barcodes. Activation upon conception and continued mutagenesis through gestation resulted in developmentally barcoded mice wherein information is recorded in lineage-specific mutations. We used these recordings for reliable post hoc reconstruction of the earliest lineages and investigation of axis development in the brain. Our results provide an enabling and versatile platform for in vivo barcoding and lineage tracing in a mammalian model system.},
}
@article {pmid29973285,
year = {2018},
author = {Tang, X and Liu, G and Zhou, J and Ren, Q and You, Q and Tian, L and Xin, X and Zhong, Z and Liu, B and Zheng, X and Zhang, D and Malzahn, A and Gong, Z and Qi, Y and Zhang, T and Zhang, Y},
title = {A large-scale whole-genome sequencing analysis reveals highly specific genome editing by both Cas9 and Cpf1 (Cas12a) nucleases in rice.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {84},
doi = {10.1186/s13059-018-1458-5},
pmid = {29973285},
issn = {1474-760X},
support = {31330017//National Natural Science Foundation of China (CN)/International ; 31771486//National Natural Science Foundation of China/International ; 2018ZX08022001-003//National Transgenic Major Project/International ; },
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Endonucleases/*genetics ; Gene Editing/methods ; Genome, Plant/*genetics ; High-Throughput Nucleotide Sequencing/methods ; Mutation/genetics ; Oryza/*genetics ; RNA, Guide/genetics ; Whole Genome Sequencing/methods ; },
abstract = {BACKGROUND: Targeting specificity has been a barrier to applying genome editing systems in functional genomics, precise medicine and plant breeding. In plants, only limited studies have used whole-genome sequencing (WGS) to test off-target effects of Cas9. The cause of numerous discovered mutations is still controversial. Furthermore, WGS-based off-target analysis of Cpf1 (Cas12a) has not been reported in any higher organism to date.<br><br>RESULTS: We conduct a WGS analysis of 34 plants edited by Cas9 and 15 plants edited by Cpf1 in T0 and T1 generations along with 20 diverse control plants in rice. The sequencing depths range from 45× to 105× with read mapping rates above 96%. Our results clearly show that most mutations in edited plants are created by the tissue culture process, which causes approximately 102 to 148 single nucleotide variations (SNVs) and approximately 32 to 83 insertions/deletions (indels) per plant. Among 12 Cas9 single guide RNAs (sgRNAs) and three Cpf1 CRISPR RNAs (crRNAs) assessed by WGS, only one Cas9 sgRNA resulted in off-target mutations in T0 lines at sites predicted by computer programs. Moreover, we cannot find evidence for bona fide off-target mutations due to continued expression of Cas9 or Cpf1 with guide RNAs in T1 generation.<br><br>CONCLUSIONS: Our comprehensive and rigorous analysis of WGS data across multiple sample types suggests both Cas9 and Cpf1 nucleases are very specific in generating targeted DNA modifications and off-targeting can be avoided by designing guide RNAs with high specificity.},
}
@article {pmid29945655,
year = {2018},
author = {Chuai, G and Ma, H and Yan, J and Chen, M and Hong, N and Xue, D and Zhou, C and Zhu, C and Chen, K and Duan, B and Gu, F and Qu, S and Huang, D and Wei, J and Liu, Q},
title = {DeepCRISPR: optimized CRISPR guide RNA design by deep learning.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {80},
doi = {10.1186/s13059-018-1459-4},
pmid = {29945655},
issn = {1474-760X},
mesh = {CRISPR-Cas Systems/*genetics ; Cell Line ; Cell Line, Tumor ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Computational Biology/methods ; Computer Simulation ; HCT116 Cells ; HEK293 Cells ; HL-60 Cells ; HeLa Cells ; Humans ; Machine Learning ; RNA Editing/genetics ; RNA, Guide/*genetics ; },
abstract = {A major challenge for effective application of CRISPR systems is to accurately predict the single guide RNA (sgRNA) on-target knockout efficacy and off-target profile, which would facilitate the optimized design of sgRNAs with high sensitivity and specificity. Here we present DeepCRISPR, a comprehensive computational platform to unify sgRNA on-target and off-target site prediction into one framework with deep learning, surpassing available state-of-the-art in silico tools. In addition, DeepCRISPR fully automates the identification of sequence and epigenetic features that may affect sgRNA knockout efficacy in a data-driven manner. DeepCRISPR is available at http://www.deepcrispr.net/ .},
}
@article {pmid29845243,
year = {2018},
author = {Zhao, X and Zhou, H and Cheng, Y and Yu, W and Luo, G and Duan, C and Yao, F and Xiao, B and Feng, C and Xia, X and Wei, M and Wang, Y and Li, J and Dai, R},
title = {Reduction in activating transcription factor 4 promotes carbon tetrachloride and lipopolysaccharide/D‑galactosamine‑mediated liver injury in mice.},
journal = {Molecular medicine reports},
volume = {18},
number = {2},
pages = {1718-1725},
doi = {10.3892/mmr.2018.9080},
pmid = {29845243},
issn = {1791-3004},
mesh = {Activating Transcription Factor 4/*genetics/metabolism ; Alanine Transaminase/blood ; Animals ; Aspartate Aminotransferases/blood ; CRISPR-Cas Systems ; Carbon Tetrachloride/*administration &amp; dosage ; Chemical and Drug Induced Liver Injury/*genetics/metabolism/pathology ; Endoplasmic Reticulum Stress/drug effects ; Eukaryotic Initiation Factor-2/genetics/metabolism ; Galactosamine/*administration &amp; dosage ; Gene Editing ; Gene Expression Regulation ; JNK Mitogen-Activated Protein Kinases/genetics/metabolism ; Lipopolysaccharides/*administration &amp; dosage ; Liver/drug effects/*metabolism/pathology ; Male ; Mice ; Mice, Inbred C57BL ; Phosphorylation ; Plasmids/chemistry/metabolism ; Protective Factors ; Tunicamycin/pharmacology ; },
abstract = {Although activating transcription factor 4 (ATF4) is involved in the regulation of numerous biological functions, whether ATF4 has a direct role in liver injury is unknown. The aim of the present study was to investigate the role of ATF4 in liver injury using mouse models. The results revealed that ATF4 protein is expressed markedly higher in the mouse liver when in comparison with other tissues. Notably, tunicamycin treatment, an endoplasmic reticulum (ER) stress inducer, induced the phosphorylation of eukaryotic translation initiation factor 2α (eIF2α), but decreased ATF4 protein levels in the mouse liver. This suggested an unconventional regulation pattern of ATF4 protein not associated with ER stress or eIF2α. In addition, it was also observed that the liver levels of ATF4 protein were significantly reduced upon chronic liver injury induced by carbon tetrachloride (CCl4). ATF4 protein was also decreased in acute liver injury induced by lipopolysaccharide (LPS) plus D‑galactosamine (D‑GalN). Furthermore, the results revealed that knockdown of ATF4 by injecting ATF4‑targeting Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)‑CRISPR associated protein 9 plasmids exacerbated CCl4 and LPS/D‑GalN‑induced liver injury as demonstrated by elevated serum aspartate transaminase and alanine aminotransferase levels. ATF4 suppression also enhanced CCl4 and LPS/D‑GalN mediated c‑Jun N‑terminal kinase activation. By contrast, ATF4 overexpression alleviated CCl4 and LPS/D‑GalN‑induced liver injury. Taken together, these observations suggested that ATF4 may serve a protective role in the mouse liver.},
}
@article {pmid29657233,
year = {2018},
author = {Kaneko, T},
title = {Reproductive technologies for the generation and maintenance of valuable animal strains.},
journal = {The Journal of reproduction and development},
volume = {64},
number = {3},
pages = {209-215},
doi = {10.1262/jrd.2018-035},
pmid = {29657233},
issn = {1348-4400},
mesh = {Animals ; CRISPR-Cas Systems ; Electroporation/veterinary ; Gene Editing/*veterinary ; Gene Knockdown Techniques/*veterinary ; Genetic Engineering/methods ; Mice ; Organisms, Genetically Modified ; Rats ; Semen Preservation/*veterinary ; },
abstract = {Many types of mutant and genetically engineered strains have been produced in various animal species. Their numbers have dramatically increased in recent years, with new strains being rapidly produced using genome editing techniques. In the rat, it has been difficult to produce knockout and knock-in strains because the establishment of stem cells has been insufficient. However, a large number of knockout and knock-in strains can currently be produced using genome editing techniques, including zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) system. Microinjection technique has also contributed widely to the production of various kinds of genome edited animal strains. A novel electroporation method, the &quot;Technique for Animal Knockout system by Electroporation (TAKE)&quot; method, is a simple and highly efficient tool that has accelerated the production of new strains. Gamete preservation is extremely useful for maintaining large numbers of these valuable strains as genetic resources in the long term. These reproductive technologies, including microinjection, TAKE method, and gamete preservation, strongly support biomedical research and the bio-resource banking of animal models. In this review, we introduce the latest reproductive technologies used for the production of genetically engineered animals, especially rats, using genome editing techniques and the efficient maintenance of valuable strains as genetic resources. These technologies can also be applied to other laboratory animals, including mice, and domestic and wild animal species.},
}
@article {pmid29657232,
year = {2018},
author = {Imaimatsu, K and Fujii, W and Hiramatsu, R and Miura, K and Kurohmaru, M and Kanai, Y},
title = {CRISPR/Cas9-mediated knock-in of the murine Y chromosomal Sry gene.},
journal = {The Journal of reproduction and development},
volume = {64},
number = {3},
pages = {283-287},
doi = {10.1262/jrd.2017-161},
pmid = {29657232},
issn = {1348-4400},
mesh = {Animals ; *CRISPR-Cas Systems ; Gene Editing ; *Genes, sry ; Male ; Mice ; Sex-Determining Region Y Protein/*genetics ; Testis/metabolism ; },
abstract = {Mammalian zygote-mediated genome editing via the clustered regularly interspaced short palindromic repeats/CRISPR-associated endonuclease 9 (CRISPR/Cas9) system is widely used to generate genome-modified animals. This system allows for the production of loss-of-function mutations in various Y chromosome genes, including Sry, in mice. Here, we report the establishment of a CRISPR-Cas9-mediated knock-in line of Flag-tag sequences into the Sry locus at the C-terminal coding end of the Y chromosome (YSry-flag). In the F1 and successive generations, all male pups carrying the YSry-flag chromosome had normal testis differentiation and proper spermatogenesis at maturity, enabling complete fertility and the production of viable offspring. To our knowledge, this study is the first to produce a stable Sry knock-in line at the C-terminal region, highlighting a novel approach for examining the significance of amino acid changes at the naive Sry locus in mammals.},
}
@article {pmid29423804,
year = {2018},
author = {Everman, JL and Rios, C and Seibold, MA},
title = {Primary Airway Epithelial Cell Gene Editing Using CRISPR-Cas9.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1706},
number = {},
pages = {267-292},
doi = {10.1007/978-1-4939-7471-9_15},
pmid = {29423804},
issn = {1940-6029},
mesh = {Animals ; *CRISPR-Cas Systems ; Epithelial Cells/*metabolism ; *Gene Deletion ; Gene Editing/*methods ; *Genome, Human ; Humans ; Respiratory Mucosa/*metabolism ; },
abstract = {The adaptation of the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated endonuclease 9 (CRISPR-Cas9) machinery from prokaryotic organisms has resulted in a gene editing system that is highly versatile, easily constructed, and can be leveraged to generate human cells knocked out (KO) for a specific gene. While standard transfection techniques can be used for the introduction of CRISPR-Cas9 expression cassettes to many cell types, delivery by this method is not efficient in many primary cell types, including primary human airway epithelial cells (AECs). More efficient delivery in AECs can be achieved through lentiviral-mediated transduction, allowing the CRISPR-Cas9 system to be integrated into the genome of the cell, resulting in stable expression of the nuclease machinery and increasing editing rates. In parallel, advancements have been made in the culture, expansion, selection, and differentiation of AECs, which allow the robust generation of a bulk edited AEC population from transduced cells. Applying these methods, we detail here our latest protocol to generate mucociliary epithelial cultures knocked out for a specific gene from donor-isolated primary human basal airway epithelial cells. This protocol includes methods to: (1) design and generate lentivirus which targets a specific gene for KO with CRISPR-Cas9 machinery, (2) efficiently transduce AECs, (3) culture and select for a bulk edited AEC population, (4) molecularly screen AECs for Cas9 cutting and specific sequence edits, and (5) further expand and differentiate edited cells to a mucociliary airway epithelial culture. The AEC knockouts generated using this protocol provide an excellent primary cell model system with which to characterize the function of genes involved in airway dysfunction and disease.},
}
@article {pmid29321167,
year = {2018},
author = {Zhao, Y and Boeke, JD},
title = {Construction of Designer Selectable Marker Deletions with a CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and New Design of Common Entry Vectors.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {3},
pages = {789-796},
doi = {10.1534/g3.117.300363},
pmid = {29321167},
issn = {2160-1836},
mesh = {*CRISPR-Cas Systems ; Cloning, Molecular ; Gene Order ; Gene Targeting/methods ; Genes, Fungal ; *Genetic Markers ; Genetic Vectors/*genetics ; Plasmids/genetics ; Schizosaccharomyces/*genetics ; *Sequence Deletion ; },
abstract = {Vectors encoding selectable markers have been widely used in yeast to maintain or express exogenous DNA fragments. In the fission yeast Schizosaccharomyces pombe, several engineered markers have been reported and widely used, such as ura4+ and ScLEU2 from Saccharomyces cerevisiae, which complement ura4 and leu1 mutations, respectively. These two auxotrophic markers share no homology with the S. pombe genome; however, most others can recombine with the genome due to sequence homology shared between the genomic and plasmid-borne copies of the markers. Here, we describe a CRISPR-Cas9 toolbox that can be used to quickly introduce &quot;designer&quot; auxotrophic marker deletions into host strains, including leu1-Δ0, his3-Δ0, and lys9-Δ0 Together with ura4-D18, this brings the total number of available designer deletion auxotrophic markers to four. The toolbox consists of a Cas9-gRNA expression vector and a donor DNA plasmid pair for each designer deletion. Using this toolbox, a set of auxotrophic S. pombe strains was constructed. Further, we reorganized essential components in the commonly used pREP series of plasmids and assembled the corresponding auxotrophic marker gene onto these plasmids. This toolbox for producing designer deletions, together with the newly developed strains and plasmids, will benefit the whole yeast community.},
}
@article {pmid29295818,
year = {2018},
author = {Hu, P and Zhao, X and Zhang, Q and Li, W and Zu, Y},
title = {Comparison of Various Nuclear Localization Signal-Fused Cas9 Proteins and Cas9 mRNA for Genome Editing in Zebrafish.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {3},
pages = {823-831},
doi = {10.1534/g3.117.300359},
pmid = {29295818},
issn = {2160-1836},
mesh = {Animals ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Endonucleases/*genetics ; *Gene Editing ; Gene Knockout Techniques ; Gene Targeting ; Genome ; Microinjections ; Mutagenesis ; Mutation ; *Nuclear Localization Signals ; Phenotype ; RNA, Guide ; *RNA, Messenger ; Recombinant Fusion Proteins ; Zebrafish/*genetics ; },
abstract = {The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system has been proven to be an efficient and precise genome editing technology in various organisms. However, the gene editing efficiencies of Cas9 proteins with a nuclear localization signal (NLS) fused to different termini and Cas9 mRNA have not been systematically compared. Here, we compared the ability of Cas9 proteins with NLS fused to the N-, C-, or both the N- and C-termini and N-NLS-Cas9-NLS-C mRNA to target two sites in the tyr gene and two sites in the gol gene related to pigmentation in zebrafish. Phenotypic analysis revealed that all types of Cas9 led to hypopigmentation in similar proportions of injected embryos. Genome analysis by T7 Endonuclease I (T7E1) assays demonstrated that all types of Cas9 similarly induced mutagenesis in four target sites. Sequencing results further confirmed that a high frequency of indels occurred in the target sites (tyr1 > 66%, tyr2 > 73%, gol1 > 50%, and gol2 > 35%), as well as various types (more than six) of indel mutations observed in all four types of Cas9-injected embryos. Furthermore, all types of Cas9 showed efficient targeted mutagenesis on multiplex genome editing, resulting in multiple phenotypes simultaneously. Collectively, we conclude that various NLS-fused Cas9 proteins and Cas9 mRNAs have similar genome editing efficiencies on targeting single or multiple genes, suggesting that the efficiency of CRISPR/Cas9 genome editing is highly dependent on guide RNAs (gRNAs) and gene loci. These findings may help to simplify the selection of Cas9 for gene editing using the CRISPR/Cas9 system.},
}
@article {pmid28211892,
year = {2017},
author = {Bian, S and Zhou, Y and Hu, Y and Cheng, J and Chen, X and Xu, Y and Liu, P},
title = {High-throughput in situ cell electroporation microsystem for parallel delivery of single guide RNAs into mammalian cells.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42512},
doi = {10.1038/srep42512},
pmid = {28211892},
issn = {2045-2322},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Line ; *Electroporation/instrumentation/methods ; Gene Editing ; Gene Expression ; *Gene Transfer Techniques ; Humans ; RNA, Guide/*genetics ; },
abstract = {Arrayed genetic screens mediated by the CRISPR/Cas9 technology with single guide RNA (sgRNA) libraries demand a high-throughput platform capable of transfecting diverse cell types at a high efficiency in a genome-wide scale for detection and analysis of sophisticated cellular phenotypes. Here we developed a high-throughput in situ cell electroporation (HiCEP) microsystem which leveraged the superhydrophobic feature of the microwell array to achieve individually controlled conditions in each microwell and coupled an interdigital electrode array chip with the microwells in a modular-based scheme for highly efficient delivery of exogenous molecules into cells. Two plasmids encoding enhanced green and red fluorescent proteins (EGFP and ERFP), respectively, were successfully electroporated into attached HeLa cells on a 169-microwell array chip with transfection efficiencies of 71.6 ± 11.4% and 62.9 ± 2.7%, and a cell viability above 95%. We also successfully conducted selective electroporation of sgRNA into 293T cells expressing the Cas9 nuclease in a high-throughput manner and observed the four-fold increase of the GFP intensities due to the repair of the protein coding sequences mediated by the CRISPR/Cas9 system. This study proved that this HiCEP system has the great potential to be used for arrayed functional screens with genome-wide CRISPR libraries on hard-to-transfect cells in the future.},
}
@article {pmid28209983,
year = {2017},
author = {Borgo, C and Franchin, C and Scalco, S and Bosello-Travain, V and Donella-Deana, A and Arrigoni, G and Salvi, M and Pinna, LA},
title = {Generation and quantitative proteomics analysis of CK2α/α'(-/-) cells.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42409},
doi = {10.1038/srep42409},
pmid = {28209983},
issn = {2045-2322},
mesh = {Animals ; CRISPR-Cas Systems ; Casein Kinase II/chemistry/genetics/*metabolism ; Catalysis ; Catalytic Domain ; Cell Line ; Chromatography, Liquid ; Gene Editing ; Gene Expression ; Gene Knockout Techniques ; Mice ; Protein Subunits ; Protein Transport ; *Proteome ; *Proteomics/methods ; Tandem Mass Spectrometry ; },
abstract = {CK2 is a ubiquitous, constitutively active, highly pleiotropic, acidophilic Ser/Thr protein kinase whose holoenzyme is composed of two catalytic (α and/or α') subunits and a dimer of a non-catalytic β subunit. Abnormally high CK2 level/activity is often associated with malignancy and a variety of cancer cells have been shown to rely on it to escape apoptosis. To gain information about the actual &quot;druggability&quot; of CK2 and to dissect CK2 dependent cellular processes that are instrumental to the establishment and progression of neoplasia we have exploited the CRISPR/Cas9 genome editing technology to generate viable clones of C2C12 myoblasts devoid of either both the CK2 catalytic subunits or its regulatory β-subunit. Suppression of both CK2 catalytic subunits promotes the disappearance of the β-subunit as well, through its accelerated proteasomal degradation. A quantitative proteomics analysis of CK2α/α'(-/-) versus wild type cells shows that knocking out both CK2 catalytic subunits causes a rearrangement of the proteomics profile, with substantially altered level (> 50%) of 240 proteins, 126 of which are up-regulated, while the other are down-regulated. A functional analysis reveals that up- and down-regulated proteins tend to be segregated into distinct sub-cellular compartments and play different biological roles, consistent with a global rewiring underwent by the cell to cope with the lack of CK2.},
}
@article {pmid28209967,
year = {2017},
author = {Raveux, A and Vandormael-Pournin, S and Cohen-Tannoudji, M},
title = {Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42661},
doi = {10.1038/srep42661},
pmid = {28209967},
issn = {2045-2322},
mesh = {Animals ; Bacterial Proteins/genetics/metabolism ; *CRISPR-Cas Systems ; Cell Nucleus/genetics/metabolism ; Clustered Regularly Interspaced Short Palindromic Repeats ; Cytosol/metabolism ; Embryo, Mammalian ; Endonucleases/genetics/metabolism ; Exons ; Female ; Gene Editing/*methods ; Gene Knock-In Techniques/*methods ; Green Fluorescent Proteins/*genetics/metabolism ; Male ; Membrane Proteins/deficiency/*genetics ; Mice ; Mice, Transgenic ; Microinjections ; Mutation ; Oligodeoxyribonucleotides/genetics/metabolism ; Plasmids/administration &amp; dosage/chemistry/*metabolism ; RNA, Guide/genetics/metabolism ; Zygote/cytology/metabolism ; },
abstract = {Microinjection of the CRISPR/Cas9 system in zygotes is an efficient and comparatively fast method to generate genetically modified mice. So far, only few knock-in mice have been generated using this approach, and because no systematic study has been performed, parameters controlling the efficacy of CRISPR/Cas9-mediated targeted insertion are not fully established. Here, we evaluated the effect of several parameters on knock-in efficiency changing only one variable at a time. We found that knock-in efficiency was dependent on injected Cas9 mRNA and single-guide RNA concentrations and that cytoplasmic injection resulted in more genotypic complexity compared to pronuclear injection. Our results also indicated that injection into the pronucleus compared to the cytoplasm is preferable to generate knock-in alleles with an oligonucleotide or a circular plasmid. Finally, we showed that Cas9D10A nickase variant was less efficient than wild-type Cas9 for generating knock-in alleles and caused a higher rate of mosaicism. Thus, our study provides valuable information that will help to improve the future production of precise genetic modifications in mice.},
}
@article {pmid28198371,
year = {2017},
author = {Gong, H and Liu, M and Klomp, J and Merrill, BJ and Rehman, J and Malik, AB},
title = {Method for Dual Viral Vector Mediated CRISPR-Cas9 Gene Disruption in Primary Human Endothelial Cells.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42127},
doi = {10.1038/srep42127},
pmid = {28198371},
issn = {2045-2322},
support = {R01 HL090152/HL/NHLBI NIH HHS/United States ; R01 HL125350/HL/NHLBI NIH HHS/United States ; T32 HL007829/HL/NHLBI NIH HHS/United States ; R01 GM094220/GM/NIGMS NIH HHS/United States ; R01 HL118068/HL/NHLBI NIH HHS/United States ; P01 HL060678/HL/NHLBI NIH HHS/United States ; },
mesh = {Adenoviridae/*genetics/metabolism ; *CRISPR-Cas Systems ; Cell Membrane Permeability ; Endonucleases/genetics/metabolism ; Endothelial Cells/cytology/drug effects/*metabolism ; Gene Editing/*methods ; Gene Expression ; Genes, Reporter ; Genetic Vectors/chemistry/metabolism ; Green Fluorescent Proteins/genetics/metabolism ; High-Throughput Nucleotide Sequencing ; Humans ; Lentivirus/*genetics/metabolism ; Lung/cytology/metabolism ; Mutagenesis, Site-Directed/*methods ; Mutation ; Primary Cell Culture ; RNA, Guide/genetics/metabolism ; Receptor, TIE-2/deficiency/*genetics ; Signal Transduction ; Thrombin/pharmacology ; },
abstract = {Human endothelial cells (ECs) are widely used to study mechanisms of angiogenesis, inflammation, and endothelial permeability. Targeted gene disruption induced by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-Associated Protein 9 (Cas9) nuclease gene editing is potentially an important tool for definitively establishing the functional roles of individual genes in ECs. We showed that co-delivery of adenovirus encoding EGFP-tagged Cas9 and lentivirus encoding a single guide RNA (sgRNA) in primary human lung microvascular ECs (HLMVECs) disrupted the expression of the Tie2 gene and protein. Tie2 disruption increased basal endothelial permeability and prevented permeability recovery following injury induced by the inflammatory stimulus thrombin. Thus, gene deletion via viral co-delivery of CRISPR-Cas9 in primary human ECs provides a novel platform to investigate signaling mechanisms of normal and perturbed EC function without the need for clonal expansion.},
}
@article {pmid28195201,
year = {2017},
author = {Hirose, M and Hasegawa, A and Mochida, K and Matoba, S and Hatanaka, Y and Inoue, K and Goto, T and Kaneda, H and Yamada, I and Furuse, T and Abe, K and Uenoyama, Y and Tsukamura, H and Wakana, S and Honda, A and Ogura, A},
title = {CRISPR/Cas9-mediated genome editing in wild-derived mice: generation of tamed wild-derived strains by mutation of the a (nonagouti) gene.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42476},
doi = {10.1038/srep42476},
pmid = {28195201},
issn = {2045-2322},
mesh = {Agouti Signaling Protein/genetics ; Alleles ; Animals ; Animals, Wild ; *CRISPR-Cas Systems ; DNA Mutational Analysis ; Dopamine/metabolism ; *Gene Editing ; Gene Expression ; Humans ; Mesencephalon/metabolism ; Mice ; Mice, Knockout ; Mutation ; Phenotype ; },
abstract = {Wild-derived mice have contributed to experimental mouse genetics by virtue of their genetic diversity, which may help increase the chance of identifying novel modifier genes responsible for specific phenotypes and diseases. However, gene targeting using wild-derived mice has been unsuccessful because of the unavailability of stable embryonic stem cells. Here, we report that CRISPR/Cas9-mediated gene targeting can be applied to the Japanese wild-derived MSM/Ms strain (Mus musculus molossinus). We targeted the nonagouti (a) gene encoding the agouti protein that is localized in hair and the brain. We obtained three homozygous knockout mice as founders, all showing black coat colour. While homozygous knockout offspring were physiologically indistinguishable from wild-type litter-mates, they showed specific domesticated behaviours: hypoactivity in the dark phase and a decline in the avoidance of a human hand. These phenotypes were consistent over subsequent generations. Our findings support the empirical hypothesis that nonagouti is a domestication-linked gene, the loss of which might repress aggressive behaviour.},
}
@article {pmid30029480,
year = {2018},
author = {Bothwell, PJ and Kron, CD and Wittke, EF and Czerniak, BN and Bode, BP},
title = {Targeted Suppression and Knockout of ASCT2 or LAT1 in Epithelial and Mesenchymal Human Liver Cancer Cells Fail to Inhibit Growth.},
journal = {International journal of molecular sciences},
volume = {19},
number = {7},
pages = {},
doi = {10.3390/ijms19072093},
pmid = {30029480},
issn = {1422-0067},
mesh = {Amino Acid Transport System ASC/*metabolism ; Amino Acids/metabolism ; Biological Transport/drug effects ; CRISPR-Cas Systems/genetics ; Cell Death/drug effects ; Cell Proliferation/drug effects ; Epithelium/*pathology ; *Gene Knockout Techniques ; Humans ; Large Neutral Amino Acid-Transporter 1/*metabolism ; Liver Neoplasms/*metabolism/*pathology ; Mechanistic Target of Rapamycin Complex 1/metabolism ; Mesoderm/*pathology ; Mifepristone/pharmacology ; Minor Histocompatibility Antigens/*metabolism ; RNA, Antisense/metabolism ; RNA, Small Interfering/metabolism ; Signal Transduction/drug effects ; Sodium/metabolism ; },
abstract = {Amino acid transporters alanine-serine-cysteine transporter 2 (ASCT2) and L-Type Amino Acid Transporter 1 (LAT1) are coordinately enhanced in human cancers where among other roles, they are thought to drive mechanistic target-of-rapamycin (mTOR) growth signaling. To assess ASCT2 and LAT1 as therapeutic targets, nine unique short hairpin RNA (shRNA) vectors were used to stably suppress transporter expression in human epithelial (Hep3B) and mesenchymal (SK-Hep1) hepatocellular carcinoma (HCC) cell lines. In addition, six unique CRISPR-Cas9 vectors were used to edit the ASCT2 (SLC1A5) and LAT1 (SLC7A5) genes in epithelial (HUH7) and mesenchymal (SK-Hep1) HCC cells. Both approaches successfully diminished glutamine (ASCT2) and leucine (LAT1) initial-rate transport proportional to transporter protein suppression. In spite of profoundly reduced glutamine or leucine transport (up to 90%), transporter suppression or knockout failed to substantially affect cellular proliferation or basal and amino acid-stimulated mTORC1 growth signaling in either HCC cell type. Only LAT1 knockout in HUH7 slightly reduced growth rate. However, intracellular accumulation of radiolabeled glutamine and leucine over longer time periods largely recovered to control levels in ASCT2 and LAT1 knockout cells, respectively, which partially explains the lack of an impaired growth phenotype. These data collectively establish that in an in vitro context, human epithelial and mesenchymal HCC cell lines adapt to ASCT2 or LAT1 knockout. These results comport with an emerging model of amino acid exchangers like ASCT2 and LAT1 as &quot;harmonizers&quot;, not drivers, of amino acid accumulation and signaling, despite their long-established dominant role in initial-rate amino acid transport.},
}
@article {pmid29901119,
year = {2018},
author = {Baliou, S and Adamaki, M and Kyriakopoulos, AM and Spandidos, DA and Panayiotidis, M and Christodoulou, I and Zoumpourlis, V},
title = {CRISPR therapeutic tools for complex genetic disorders and cancer (Review).},
journal = {International journal of oncology},
volume = {53},
number = {2},
pages = {443-468},
doi = {10.3892/ijo.2018.4434},
pmid = {29901119},
issn = {1791-2423},
mesh = {Animals ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Gene Editing ; Genetic Predisposition to Disease ; Genetic Therapy/*methods ; Humans ; Mice ; Neoplasms/genetics/*therapy ; Precision Medicine ; },
abstract = {One of the fundamental discoveries in the field of biology is the ability to modulate the genome and to monitor the functional outputs derived from genomic alterations. In order to unravel new therapeutic options, scientists had initially focused on inducing genetic alterations in primary cells, in established cancer cell lines and mouse models using either RNA interference or cDNA overexpression or various programmable nucleases [zinc finger nucleases (ZNF), transcription activator-like effector nucleases (TALEN)]. Even though a huge volume of data was produced, its use was neither cheap nor accurate. Therefore, the clustered regularly interspaced short palindromic repeats (CRISPR) system was evidenced to be the next step in genome engineering tools. CRISPR-associated protein 9 (Cas9)-mediated genetic perturbation is simple, precise and highly efficient, empowering researchers to apply this method to immortalized cancerous cell lines, primary cells derived from mouse and human origins, xenografts, induced pluripotent stem cells, organoid cultures, as well as the generation of genetically engineered animal models. In this review, we assess the development of the CRISPR system and its therapeutic applications to a wide range of complex diseases (particularly distinct tumors), aiming at personalized therapy. Special emphasis is given to organoids and CRISPR screens in the design of innovative therapeutic approaches. Overall, the CRISPR system is regarded as an eminent genome engineering tool in therapeutics. We envision a new era in cancer biology during which the CRISPR-based genome engineering toolbox will serve as the fundamental conduit between the bench and the bedside; nonetheless, certain obstacles need to be addressed, such as the eradication of side-effects, maximization of efficiency, the assurance of delivery and the elimination of immunogenicity.},
}
@article {pmid29117363,
year = {2017},
author = {Jenks, S},
title = {New Gene-Editing Tool Slowly Advances Into the Clinic.},
journal = {Journal of the National Cancer Institute},
volume = {109},
number = {10},
pages = {},
doi = {10.1093/jnci/djx220},
pmid = {29117363},
issn = {1460-2105},
mesh = {*CRISPR-Cas Systems ; Gene Editing/*methods ; Genetic Therapy/*methods ; Humans ; Metabolism, Inborn Errors/*genetics/*therapy ; },
}
@article {pmid28218310,
year = {2017},
author = {Lu, J and Shao, Y and Qin, X and Liu, D and Chen, A and Li, D and Liu, M and Wang, X},
title = {CRISPR knockout rat cytochrome P450 3A1/2 model for advancing drug metabolism and pharmacokinetics research.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42922},
doi = {10.1038/srep42922},
pmid = {28218310},
issn = {2045-2322},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Cytochrome P-450 CYP3A/deficiency/*genetics ; Female ; Genotype ; Half-Life ; Intestine, Small/metabolism/pathology ; Liver/metabolism/pathology ; Male ; Microsomes, Liver/metabolism ; Nifedipine/analysis/metabolism/pharmacokinetics ; Phenotype ; Protein Isoforms/metabolism ; Rats ; Rats, Sprague-Dawley ; },
abstract = {Cytochrome P450 (CYP) 3A accounts for nearly 30% of the total CYP enzymes in the human liver and participates in the metabolism of over 50% of clinical drugs. Moreover, CYP3A plays an important role in chemical metabolism, toxicity, and carcinogenicity. New animal models are needed to investigate CYP3A functions, especially for drug metabolism. In this report, Cyp3a1/2 double knockout (KO) rats were generated by CRISPR-Cas9 technology, and then were characterized for viability and physiological status. The Cyp3a1/2 double KO rats were viable and fertile, and had no obvious physiological abnormities. Compared with the wild-type (WT) rat, Cyp3a1/2 expression was completely absent in the liver of the KO rat. In vitro and in vivo metabolic studies of the CYP3A1/2 substrates indicated that CYP3A1/2 was functionally inactive in double KO rats. The Cyp3a1/2 double KO rat model was successfully generated and characterized. The Cyp3a1/2 KO rats are a novel rodent animal model that will be a powerful tool for the study of the physiological and pharmacological roles of CYP3A, especially in drug and chemical metabolism in vivo.},
}
@article {pmid28179149,
year = {2017},
author = {Liu, C and Li, X and Meng, D and Zhong, Y and Chen, C and Dong, X and Xu, X and Chen, B and Li, W and Li, L and Tian, X and Zhao, H and Song, W and Luo, H and Zhang, Q and Lai, J and Jin, W and Yan, J and Chen, S},
title = {A 4-bp Insertion at ZmPLA1 Encoding a Putative Phospholipase A Generates Haploid Induction in Maize.},
journal = {Molecular plant},
volume = {10},
number = {3},
pages = {520-522},
doi = {10.1016/j.molp.2017.01.011},
pmid = {28179149},
issn = {1752-9867},
mesh = {Base Pairing/*genetics ; Base Sequence ; CRISPR-Cas Systems/genetics ; *Genes, Plant ; *Haploidy ; Mutagenesis, Insertional/*genetics ; Mutation/genetics ; Phospholipases A/*genetics/metabolism ; Plant Proteins/*genetics/metabolism ; Zea mays/*enzymology/*genetics ; },
}
@article {pmid28176880,
year = {2017},
author = {Ma, X and Chen, C and Veevers, J and Zhou, X and Ross, RS and Feng, W and Chen, J},
title = {CRISPR/Cas9-mediated gene manipulation to create single-amino-acid-substituted and floxed mice with a cloning-free method.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42244},
doi = {10.1038/srep42244},
pmid = {28176880},
issn = {2045-2322},
support = {P01 HL080101/HL/NHLBI NIH HHS/United States ; R01 HL123626/HL/NHLBI NIH HHS/United States ; R01 HL130295/HL/NHLBI NIH HHS/United States ; R01 HL130452/HL/NHLBI NIH HHS/United States ; },
mesh = {Amino Acid Substitution/*genetics ; Animals ; Base Sequence ; CRISPR-Cas Systems/*genetics ; Cloning, Molecular ; Gene Knockout Techniques ; Genome ; Mice, Knockout ; Mice, Mutant Strains ; Protein Kinases/genetics/metabolism ; },
abstract = {Clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology is a powerful tool to manipulate the genome with extraordinary simplicity and speed. To generate genetically modified animals, CRISPR/Cas9-mediated genome editing is typically accomplished by microinjection of a mixture of Cas9 DNA/mRNA and single-guide RNA (sgRNA) into zygotes. However, sgRNAs used for this approach require manipulation via molecular cloning as well as in vitro transcription. Beyond these complexities, most mutants obtained with this traditional approach are genetically mosaic, yielding several types of cells with different genetic mutations. Recently, a growing body of studies has utilized commercially available Cas9 protein together with sgRNA and a targeting construct to introduce desired mutations. Here, we report a cloning-free method to target the mouse genome by pronuclear injection of a commercial Cas9 protein:crRNA:tracrRNA:single-strand oligodeoxynucleotide (ssODN) complex into mouse zygotes. As illustration of this method, we report the successful generation of global gene-knockout, single-amino-acid-substituted, as well as floxed mice that can be used for conditional gene-targeting. These models were produced with high efficiency to generate non-mosaic mutant mice with a high germline transmission rate.},
}
@article {pmid28089950,
year = {2017},
author = {Liu, H and Ding, Y and Zhou, Y and Jin, W and Xie, K and Chen, LL},
title = {CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants.},
journal = {Molecular plant},
volume = {10},
number = {3},
pages = {530-532},
doi = {10.1016/j.molp.2017.01.003},
pmid = {28089950},
issn = {1752-9867},
mesh = {Base Sequence ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; *Gene Editing ; *Genome, Plant ; Plants/*genetics ; RNA, Guide/genetics ; },
}
@article {pmid27940306,
year = {2017},
author = {Li, J and Sun, Y and Du, J and Zhao, Y and Xia, L},
title = {Generation of Targeted Point Mutations in Rice by a Modified CRISPR/Cas9 System.},
journal = {Molecular plant},
volume = {10},
number = {3},
pages = {526-529},
doi = {10.1016/j.molp.2016.12.001},
pmid = {27940306},
issn = {1752-9867},
mesh = {Base Sequence ; CRISPR-Cas Systems/*genetics ; Gene Editing ; *Gene Targeting ; Genes, Plant ; Genetic Vectors/metabolism ; Oryza/*genetics ; Point Mutation/*genetics ; },
}
@article {pmid27932049,
year = {2017},
author = {Lu, Y and Zhu, JK},
title = {Precise Editing of a Target Base in the Rice Genome Using a Modified CRISPR/Cas9 System.},
journal = {Molecular plant},
volume = {10},
number = {3},
pages = {523-525},
doi = {10.1016/j.molp.2016.11.013},
pmid = {27932049},
issn = {1752-9867},
mesh = {Amino Acid Sequence ; Base Sequence ; CRISPR-Cas Systems/*genetics ; *Gene Editing ; *Genome, Plant ; INDEL Mutation/genetics ; Oryza/*genetics ; },
}
@article {pmid30367000,
year = {2018},
author = {Šulčius, S and Šimoliūnas, E and Alzbutas, G and Gasiūnas, G and Jauniškis, V and Kuznecova, J and Miettinen, S and Nilsson, E and Meškys, R and Roine, E and Paškauskas, R and Holmfeldt, K},
title = {Genomic characterization of cyanophage vB_AphaS-CL131 infecting filamentous diazotrophic cyanobacterium Aphanizomenon flos-aquae reveals novel insights into virus-bacterium interactions.},
journal = {Applied and environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1128/AEM.01311-18},
pmid = {30367000},
issn = {1098-5336},
abstract = {While filamentous cyanobacteria play a crucial role in food web dynamics and biogeochemical cycling of many aquatic ecosystems around the globe, the knowledge regarding phages infecting them is limited. Here we describe the complete genome of the virulent cyanophage vB_AphaS-CL131 (CL 131), a Siphoviridae phage that infects filamentous diazotrophic bloom forming cyanobacterium Aphanizomenon flos-aquae in the brackish Baltic Sea. CL 131 features a 112793 bp dsDNA genome, encompassing 149 putative open reading frames (ORFs), of which the majority (86%) lack sequence homology to genes with known functions in other bacteriophages or bacteria. Phylogenetic analysis revealed that CL 131 possibly represents a new evolutionary lineage within the group of cyanophages infecting filamentous cyanobacteria, which form a separate cluster compared to phages infecting unicellular cyanobacteria. CL 131 encodes a putative type V-U2 CRISPR-Cas system with one spacer (out of 10) targeting a DNA primase pseudogene in a cyanobacterium and a putative type II toxin-antitoxin system, consisting of GNAT family N-acetyltransferase and a protein of unknown function containing the PRK09726 domain (characteristic of HipB antitoxins). Comparison of CL 131 proteins to reads from Baltic Sea and other available fresh- and brackish-water metagenomes and analysis of CRISPR-Cas arrays in publicly available A. flos-aquae genomes demonstrated that phages similar to CL 131 are present and dynamic in the Baltic Sea and share common history with their hosts dating back at least several decades. In addition, different CRISPR-Cas systems within individual A. flos-aquae genomes targeted several sequences in the CL 131 genome, including genes related to virion structure and morphogenesis. Altogether, these findings revealed new genomic information for exploring viral diversity and provide a model system for investigation of virus-host interactions in filamentous cyanobacteria.Importance The genomic characterization of novel cyanophage vB_AphaS-CL131 and the analysis of its genomic features in the context of other viruses, metagenomic data and host CRISPR-Cas systems contribute toward better understanding of aquatic viral diversity and distribution in general and brackish water cyanophages infecting filamentous diazotrophic cyanobacteria in the Baltic Sea in particular. The results of this study revealed previously undescribed features of cyanophage genomes (e.g. self-excising intein-containing putative dCTP deaminase, putative cyanophage-encoded CRISPR-Cas and toxin-antitoxin systems) and can therefore be used to predict potential interactions between bloom-forming cyanobacteria and their cyanophages.},
}
@article {pmid30363939,
year = {2018},
author = {Donà, V and Perreten, V},
title = {Comparative Genomics of the First and Complete Genome of &quot;Actinobacillus porcitonsillarum&quot; Supports the Novel Species Hypothesis.},
journal = {International journal of genomics},
volume = {2018},
number = {},
pages = {5261719},
doi = {10.1155/2018/5261719},
pmid = {30363939},
issn = {2314-436X},
abstract = {&quot;Actinobacillus porcitonsillarum&quot; is considered a nonpathogenic member of the Pasteurellaceae family, which phenotypically resembles the pathogen Actinobacillus pleuropneumoniae. Previous studies suggested that &quot;A. porcitonsillarum&quot; may represent a new species closely related to Actinobacillus minor, yet no full genome has been sequenced so far. We implemented the Oxford Nanopore and Illumina sequencing technologies to obtain the highly accurate and complete genome sequence of the &quot;A. porcitonsillarum&quot; strain 9953L55. After validating our de novo assembly strategy by comparing the A. pleuropneumoniae S4074T genome sequence obtained by Oxford Nanopore Technology combined with Illumina reads with a PacBio-sequenced S4074T genome from the NCBI database, we performed comparative analyses of the 9953L55 genome with the A. minor type strain NM305T, A. minor strain 202, and A. pleuropneumoniae S4074T. The 2,263,191 bp circular genome of 9953L55 consisted of 2168 and 2033 predicted genes and proteins, respectively. The lipopolysaccharide cluster resembled the genetic organization of A. pleuropneumoniae serotypes 1, 9, and 11, possibly explaining the positive reactions observed previously in serotyping tests. In contrast to NM305T, we confirmed the presence of a complete apxIICABD operon in 9953L55 and 202 accounting for their hemolytic phenotype and Christie-Atkins-Munch-Petersen (CAMP) reaction positivity. Orthologous gene cluster analysis provided insight into the differential ability of strains of the A. minor/&quot;porcitonsillarum&quot; complex and A. pleuropneumoniae to ferment lactose, raffinose, trehalose, and mannitol. The four strains showed distinct and shared transposable elements, CRISPR/Cas systems, and integrated prophages. Genome comparisons based on average nucleotide identity and in silico DNA-DNA hybridization confirmed the close relationship among strains belonging to the A. minor/&quot;porcitonsillarum&quot; complex compared to other Actinobacillus spp., but also suggested that 9953L55 and 202 belong to the same novel species closely related to A. minor, namely, &quot;A. porcitonsillarum.&quot; Recognition of the taxon as a separate species would improve diagnostics and control strategies of pig pleuropneumonia.},
}
@article {pmid30362590,
year = {2018},
author = {Khambhati, K and Bhattacharjee, G and Singh, V},
title = {Current progress in CRISPR-based diagnostic platforms.},
journal = {Journal of cellular biochemistry},
volume = {},
number = {},
pages = {},
doi = {10.1002/jcb.27690},
pmid = {30362590},
issn = {1097-4644},
support = {//The Puri Foundation for Education in India/ ; },
abstract = {The CRISPR-Cas system is a key technology for genome editing and regulation in a wide range of organisms and cell types. Recently, CRISPR-Cas-based diagnostic platform has shown idealistic properties for pathogen detection. Integrating the CRISPR-Cas platform along with lateral flow system allows rapid, sensitive, specific, cheap, and reliable diagnostic. It has the potential to be in frontline for not only pathogen detection during the epidemic outbreak, but also cancer, and genetic diseases.},
}
@article {pmid30166441,
year = {2018},
author = {Nishimasu, H and Shi, X and Ishiguro, S and Gao, L and Hirano, S and Okazaki, S and Noda, T and Abudayyeh, OO and Gootenberg, JS and Mori, H and Oura, S and Holmes, B and Tanaka, M and Seki, M and Hirano, H and Aburatani, H and Ishitani, R and Ikawa, M and Yachie, N and Zhang, F and Nureki, O},
title = {Engineered CRISPR-Cas9 nuclease with expanded targeting space.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6408},
pages = {1259-1262},
doi = {10.1126/science.aas9129},
pmid = {30166441},
issn = {1095-9203},
support = {P01 HD087157/HD/NICHD NIH HHS/United States ; R01 HD088412/HD/NICHD NIH HHS/United States ; DP1 MH100706/MH/NIMH NIH HHS/United States ; R01 MH110049/MH/NIMH NIH HHS/United States ; R01 DK097768/DK/NIDDK NIH HHS/United States ; },
mesh = {Bacterial Proteins/*chemistry/*genetics ; *CRISPR-Cas Systems ; Crystallography, X-Ray ; Endonucleases/*chemistry/*genetics ; *Gene Editing ; HEK293 Cells ; Humans ; Protein Engineering ; },
abstract = {The RNA-guided endonuclease Cas9 cleaves its target DNA and is a powerful genome-editing tool. However, the widely used Streptococcus pyogenes Cas9 enzyme (SpCas9) requires an NGG protospacer adjacent motif (PAM) for target recognition, thereby restricting the targetable genomic loci. Here, we report a rationally engineered SpCas9 variant (SpCas9-NG) that can recognize relaxed NG PAMs. The crystal structure revealed that the loss of the base-specific interaction with the third nucleobase is compensated by newly introduced non-base-specific interactions, thereby enabling the NG PAM recognition. We showed that SpCas9-NG induces indels at endogenous target sites bearing NG PAMs in human cells. Furthermore, we found that the fusion of SpCas9-NG and the activation-induced cytidine deaminase (AID) mediates the C-to-T conversion at target sites with NG PAMs in human cells.},
}
@article {pmid29797048,
year = {2018},
author = {Tian, S and Jiang, L and Cui, X and Zhang, J and Guo, S and Li, M and Zhang, H and Ren, Y and Gong, G and Zong, M and Liu, F and Chen, Q and Xu, Y},
title = {Engineering herbicide-resistant watermelon variety through CRISPR/Cas9-mediated base-editing.},
journal = {Plant cell reports},
volume = {37},
number = {9},
pages = {1353-1356},
doi = {10.1007/s00299-018-2299-0},
pmid = {29797048},
issn = {1432-203X},
support = {31471785//National Natural Science Foundation of China/International ; 31701943//National Natural Science Foundation of China/International ; BSP026//Beijing Scholar Program/International ; },
mesh = {CRISPR-Cas Systems/drug effects/genetics ; Citrullus/drug effects/*genetics ; Gene Editing ; Herbicides/*pharmacology ; },
}
@article {pmid29762900,
year = {2018},
author = {Wang, M and Mao, Y and Lu, Y and Wang, Z and Tao, X and Zhu, JK},
title = {Multiplex gene editing in rice with simplified CRISPR-Cpf1 and CRISPR-Cas9 systems.},
journal = {Journal of integrative plant biology},
volume = {60},
number = {8},
pages = {626-631},
doi = {10.1111/jipb.12667},
pmid = {29762900},
issn = {1744-7909},
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; *Gene Editing ; Oryza/*genetics ; Plant Proteins/genetics/metabolism ; },
abstract = {We developed simplified single transcriptional unit (SSTU) CRISPR systems for multiplex gene editing in rice using FnCpf1, LbCpf1 or Cas9, in which the nuclease and its crRNA array are co-expressed from a single Pol II promoter, without any additional processing machinery. Our SSTU systems are easy to construct and effective in mediating multiplex genome editing.},
}
@article {pmid29337139,
year = {2018},
author = {Chen, X and Cao, Y and Zhan, S and Zhang, Y and Tan, A and Huang, Y},
title = {Identification of yellow gene family in Agrotis ipsilon and functional analysis of Aiyellow-y by CRISPR/Cas9.},
journal = {Insect biochemistry and molecular biology},
volume = {94},
number = {},
pages = {1-9},
doi = {10.1016/j.ibmb.2018.01.002},
pmid = {29337139},
issn = {1879-0240},
mesh = {Animals ; Base Sequence ; *CRISPR-Cas Systems ; Genes, Insect/*genetics ; Larva/genetics/growth &amp; development/physiology ; Moths/genetics/growth &amp; development/*physiology ; Multigene Family/*genetics ; Mutagenesis ; Phylogeny ; Pigmentation/*genetics ; },
abstract = {The yellow gene family has been identified in several model insects, but yellow genes were poorly identified in non-model insects and the functions of yellow genes are largely unknown. In this study, we identified seven yellow genes in an important agricultural pest Agrotis ipsilon. Each gene encodes a protein containing a major royal jelly domain. Phylogenetic analysis defined these genes as yellow-y, -b, -b2, -c, -d, -e, and -h, respectively. The A. ipsilon yellow genes yellow-b, -b2, and -c were stably expressed in all developmental stages and tissues analyzed, whereas the other four yellow genes had unique expression patterns, suggesting distinct physiological roles of each gene. Using the CRISPR/Cas9 system, we successfully disrupted yellow-y in A. ipsilon and obtained G0 insects with somatic mutations. Unlike the black of wild-type newly hatched larvae and of adults, the mutants were yellow, although in the pupal stage mutant coloration did not differ from wild-type coloration. This phenotype was inherited by G1 offspring. The G0 mutants did not show any growth deficiency compared with control insects; however, a dehydration-like phenotype was observed in newly hatched G1 larvae from sibling crossed mutants. Our results indicate that A. ipsilon yellow-y gene plays a role in body pigmentation and also might function in waterproofing.},
}
@article {pmid28176813,
year = {2017},
author = {Lebbink, RJ and de Jong, DC and Wolters, F and Kruse, EM and van Ham, PM and Wiertz, EJ and Nijhuis, M},
title = {A combinational CRISPR/Cas9 gene-editing approach can halt HIV replication and prevent viral escape.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {41968},
doi = {10.1038/srep41968},
pmid = {28176813},
issn = {2045-2322},
mesh = {*CRISPR-Cas Systems ; Gene Editing/*methods ; Gene Targeting ; *Genome, Viral ; HEK293 Cells ; HIV Infections/*therapy/virology ; HIV-1/*genetics ; Humans ; Jurkat Cells ; RNA, Guide/*genetics ; Virus Replication/*genetics ; },
abstract = {HIV presents one of the highest evolutionary rates ever detected and combination antiretroviral therapy is needed to overcome the plasticity of the virus population and control viral replication. Conventional treatments lack the ability to clear the latent reservoir, which remains the major obstacle towards a cure. Novel strategies, such as CRISPR/Cas9 gRNA-based genome-editing, can permanently disrupt the HIV genome. However, HIV genome-editing may accelerate viral escape, questioning the feasibility of the approach. Here, we demonstrate that CRISPR/Cas9 targeting of single HIV loci, only partially inhibits HIV replication and facilitates rapid viral escape at the target site. A combinatorial approach of two strong gRNAs targeting different regions of the HIV genome can completely abrogate viral replication and prevent viral escape. Our data shows that the accelerating effect of gene-editing on viral escape can be overcome and as such gene-editing may provide a future alternative for control of HIV-infection.},
}
@article {pmid30357987,
year = {2018},
author = {Binder, WH},
title = {The Past 40 Years of Macromolecular Sciences: Reflections on Challenges in Synthetic Polymer and Material Science.},
journal = {Macromolecular rapid communications},
volume = {},
number = {},
pages = {e1800610},
doi = {10.1002/marc.201800610},
pmid = {30357987},
issn = {1521-3927},
support = {//DFG/ ; //EU/ ; //FWF/ ; //MLU-Halle-Wittenberg/ ; },
abstract = {Technology and science are often successful in discontinuities (&quot;disruptive innovations&quot; or &quot;leapfrogging&quot;), in turn allowing true, big societal development by entire changes in technology rather than by minuscule stepwise improvements. Examples are the emergence of modern computer science by inventing the field-effect transistor rather than further fine-tuning the &quot;Röhrentransistor&quot;; the development of (organic) light-emitting diodes in advance of the &quot;Gasglühstrumpf&quot;; CRISPR/Cas exceeding any previous genetic method or Ziegler-Natta polymerization enabling stereoregular polypropylene (PP) and high-density polyethylene (HDPE) in advance of free-radical polymerization. Where may the frogs in polymer science in the future &quot;jump&quot; to? Contemplating past achievements in (synthetic) polymer science, such as living polymerization, &quot;click&quot; chemistry, supramolecular chemistry, the potentially &quot;leaping&quot; areas of self-healing and (bio)degradable materials, amyloids, and biomaterials are reflected upon.},
}
@article {pmid30357478,
year = {2018},
author = {Baliga, P and Shekar, M and Venugopal, MN},
title = {Investigation of direct repeats, spacers and proteins associated with clustered regularly interspaced short palindromic repeat (CRISPR) system of Vibrio parahaemolyticus.},
journal = {Molecular genetics and genomics : MGG},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00438-018-1504-8},
pmid = {30357478},
issn = {1617-4623},
support = {BT/BI/04/049/99//Department of Biotechnology, Ministry of Science and Technology/ ; },
abstract = {Vibrio parahaemolyticus, a ubiquitous bacterium of the marine environment is an important food-borne pathogen responsible for gastroenteritis worldwide. In this study, we aimed to investigate the occurrence and diversity of the CRISPR-Cas system in V. parahaemolyticus genomes using a bioinformatics approach. The CRISPR-Cas system functions as an adaptive immune system in prokaryotes that provides immunity against foreign genetic elements. In total, 570 genomes V. parahaemolyticus genomes were analyzed of which 200 confirmed for the presence of CRISPR-Cas system. The CRISPR-Cas loci were further analyzed for their repeats, spacers and associated Cas proteins. Among the 200 V. parahaemolyticus strains analyzed, 16 (8%) strains possessed the CRISPR-Cas system of complete subtype I-F, while the remaining 184 (92%) harbored the minimalistic type, a subtype I-F variant. Orphan CRISPR repeats and Cas genes were found in one strain each. The CRISPR-associated direct repeat had an unit length of 28 bases. The number of repeat units in each array ranged from 3 to 5 or 5-41 depending on whether they belonged to the minimalistic or complete subtype-IF CRISPR-Cas system, respectively. Of the 768 spacers analyzed in this study, 295 were found to be unique to V. parahaemolyticus. Homology analysis of the conserved spacers revealed matches to plasmids, phages and gut viruses and self chromosomes. Among the CRISPR-associated proteins, Cas5 and Cas7 proteins were found to be conserved. However, variations were seen in the Cas6 protein, which could be grouped into four different types based on their protein length as well as amino acid composition. We present here the diversity and main features of the CRISPR-Cas system in V. parahaemolyticus, which could provide valuable insights in elucidating the role and mechanism of CRISPR/Cas elements in this pathogen.},
}
@article {pmid30356064,
year = {2018},
author = {Wang, X and Li, X and Wang, T and Wu, SP and Jeong, JW and Kim, TH and Young, SL and Lessey, BA and Lanz, RB and Lydon, JP and DeMayo, FJ},
title = {SOX17 regulates uterine epithelial-stromal cross-talk acting via a distal enhancer upstream of Ihh.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4421},
doi = {10.1038/s41467-018-06652-w},
pmid = {30356064},
issn = {2041-1723},
support = {HD-042311//U.S. Department of Health &amp; Human Services | NIH | Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD)/ ; Z1AES103311-01//U.S. Department of Health &amp; Human Services | NIH | National Institute of Environmental Health Sciences (NIEHS)/ ; },
abstract = {Mammalian pregnancy depends on the ability of the uterus to support embryo implantation. Previous studies reveal the Sox17 gene as a downstream target of the Pgr-Gata2-dependent transcription network that directs genomic actions in the uterine endometrium receptive for embryo implantation. Here, we report that ablating Sox17 in the uterine epithelium impairs leukemia inhibitory factor (LIF) and Indian hedgehog homolog (IHH) signaling, leading to failure of embryo implantation. In vivo deletion of the SOX17-binding region 19 kb upstream of the Ihh locus by CRISPR-Cas technology reduces Ihh expression specifically in the uterus and alters proper endometrial epithelial-stromal interactions, thereby impairing pregnancy. This SOX17-binding interval is also bound by GATA2, FOXA2, and PGR. This cluster of transcription factor binding is common in 737 uterine genes and may represent a key regulatory element essential for uterine epithelial gene expression.},
}
@article {pmid30354846,
year = {2018},
author = {Yu, N and Yang, J and Mishina, Y and Giannobile, WV},
title = {Genome Editing: A New Horizon for Oral and Craniofacial Research.},
journal = {Journal of dental research},
volume = {},
number = {},
pages = {22034518805978},
doi = {10.1177/0022034518805978},
pmid = {30354846},
issn = {1544-0591},
abstract = {Precise and efficient genetic manipulations have enabled researchers to understand gene functions in disease and development, providing a platform to search for molecular cures. Over the past decade, the unprecedented advancement of genome editing techniques has revolutionized the biological research fields. Early genome editing strategies involved many naturally occurring nucleases, including meganucleases, zinc finger nucleases, and transcription activator-like effector-based nucleases. More recently, the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated nucleases (CRISPR/Cas) system has greatly enriched genetic manipulation methods in conducting research. Those nucleases generate double-strand breaks in the target gene sequences and then utilize DNA repair mechanisms to permit precise yet versatile genetic manipulations. The oral and craniofacial field harbors a plethora of diseases and developmental defects that require genetic models that can exploit these genome editing techniques. This review provides an overview of the genome editing techniques, particularly the CRISPR/Cas9 technique, for the oral and craniofacial research community. We also discuss the details about the emerging applications of genome editing in oral and craniofacial biology.},
}
@article {pmid30354811,
year = {2018},
author = {Waghulde, H and Cheng, X and Galla, S and Mell, B and Cai, J and Pruett-Miller, SM and Vazquez, G and Patterson, A and Vijay Kumar, M and Joe, B},
title = {Attenuation of Microbiotal Dysbiosis and Hypertension in a CRISPR/Cas9 Gene Ablation Rat Model of GPER1.},
journal = {Hypertension (Dallas, Tex. : 1979)},
volume = {72},
number = {5},
pages = {1125-1132},
doi = {10.1161/HYPERTENSIONAHA.118.11175},
pmid = {30354811},
issn = {1524-4563},
abstract = {G-protein-coupled estrogen receptor, Gper1, has been implicated in cardiovascular disease, but its mechanistic role in blood pressure control is poorly understood. Here, we demonstrate that genetically salt-sensitive hypertensive rats with complete genomic excision of Gper1 by a multiplexed guide RNA CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR associated proteins) approach present with lower blood pressure, which was accompanied by altered microbiota, different levels of circulating short chain fatty acids, and improved vascular relaxation. Microbiotal transplantation from hypertensive Gper1+/+ rats reversed the cardiovascular protective effect exerted by the genomic deletion of Gper1. Thus, this study reveals a role for Gper1 in promoting microbiotal alterations that contribute to cardiovascular pathology. However, the exact mechanism by which Gper1 regulates blood pressure is still unknown. Our results indicate that the function of Gper1 is contextually dependent on the microbiome, whereby, contemplation of using Gper1 as a target for therapy of cardiovascular disease requires caution.},
}
@article {pmid30352492,
year = {2018},
author = {Lee, HW},
title = {Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript.},
journal = {Molecules and cells},
volume = {41},
number = {10},
pages = {917-922},
doi = {10.14348/molcells.2018.0209},
pmid = {30352492},
issn = {0219-1032},
abstract = {The CRISPR-Cas system is a well-established RNA-guided DNA editing technique widely used to modify genomic DNA sequences. I used the CRISPR-Cas9 system to change the second and third nucleotides of the triplet TCT of human TNSFSF9 in HepG2 cells to TAG to create an amber stop codon. The TCT triplet is the codon for Ser at the 172nd position of TNSFSF9. The two substituted nucleotides, AG, were confirmed by DNA sequencing of the PCR product followed by PCR amplification of the genomic TNFSF9 gene. Interestingly, sequencing of the cDNA of transcripts of the edited TNFSF9 gene revealed that the TAG had been re-edited to the wild type triplet TCT, and 1 or 2 bases just before the triplet had been deleted. These observations indicate that CRISPR-Cas9-mediated editing of bases in target genomic DNA can be followed by spontaneous re-editing (correcting) of the bases during transcription.},
}
@article {pmid30146478,
year = {2018},
author = {Mochizuki, Y and Chiba, T and Kataoka, K and Yamashita, S and Sato, T and Kato, T and Takahashi, K and Miyamoto, T and Kitazawa, M and Hatta, T and Natsume, T and Takai, S and Asahara, H},
title = {Combinatorial CRISPR/Cas9 Approach to Elucidate a Far-Upstream Enhancer Complex for Tissue-Specific Sox9 Expression.},
journal = {Developmental cell},
volume = {46},
number = {6},
pages = {794-806.e6},
doi = {10.1016/j.devcel.2018.07.024},
pmid = {30146478},
issn = {1878-1551},
support = {R01 AR050631/AR/NIAMS NIH HHS/United States ; R01 AR065379/AR/NIAMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Cartilage/cytology/*metabolism ; Cells, Cultured ; Chondrocytes/cytology/*metabolism ; Chromatin/metabolism ; *Enhancer Elements, Genetic ; Female ; *Gene Expression Regulation ; Mice ; Mice, Inbred C57BL ; Organ Specificity ; SOX9 Transcription Factor/genetics/*metabolism ; STAT3 Transcription Factor/metabolism ; Sequence Deletion ; },
abstract = {SRY-box 9 (SOX9) is a master transcription factor that regulates cartilage development. SOX9 haploinsufficiency resulting from breakpoints in a ∼1-Mb region upstream of SOX9 was reported in acampomelic campomelic dysplasia (ACD) patients, suggesting that essential enhancer regions of SOX9 for cartilage development are located in this long non-coding sequence. However, the cis-acting enhancer region regulating cartilage-specific SOX9 expression remains to be identified. To identify distant cartilage Sox9 enhancers, we utilized the combination of multiple CRISPR/Cas9 technologies including enrichment of the promoter-enhancer complex followed by next-generation sequencing and mass spectrometry (MS), SIN3A-dCas9-mediated epigenetic silencing, and generation of enhancer deletion mice. As a result, we could identify a critical far-upstream cis-element and Stat3 as a trans-acting factor, regulating cartilage-specific Sox9 expression and subsequent skeletal development. Our strategy could facilitate definitive ACD diagnosis and should be useful to reveal the detailed chromatin conformation and regulation.},
}
@article {pmid30103702,
year = {2018},
author = {Iorio, F and Behan, FM and Gonçalves, E and Bhosle, SG and Chen, E and Shepherd, R and Beaver, C and Ansari, R and Pooley, R and Wilkinson, P and Harper, S and Butler, AP and Stronach, EA and Saez-Rodriguez, J and Yusa, K and Garnett, MJ},
title = {Unsupervised correction of gene-independent cell responses to CRISPR-Cas9 targeting.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {604},
doi = {10.1186/s12864-018-4989-y},
pmid = {30103702},
issn = {1471-2164},
support = {015//Open Targets/ ; C44943/A22536//Cancer Research UK/United Kingdom ; SU2C-AACR-DT1213//Cancer Research UK/United Kingdom ; 102696//Wellcome Trust (GB)/ ; },
mesh = {*CRISPR-Cas Systems ; Cell Line, Tumor ; DNA Copy Number Variations ; Gene Amplification ; Gene Knockout Techniques/methods ; Gene Targeting/*methods ; Genes, Essential ; *Genome, Human ; High-Throughput Screening Assays ; Humans ; Neoplasms/*genetics ; Sequence Analysis, DNA ; Software ; },
abstract = {BACKGROUND: Genome editing by CRISPR-Cas9 technology allows large-scale screening of gene essentiality in cancer. A confounding factor when interpreting CRISPR-Cas9 screens is the high false-positive rate in detecting essential genes within copy number amplified regions of the genome. We have developed the computational tool CRISPRcleanR which is capable of identifying and correcting gene-independent responses to CRISPR-Cas9 targeting. CRISPRcleanR uses an unsupervised approach based on the segmentation of single-guide RNA fold change values across the genome, without making any assumption about the copy number status of the targeted genes.<br><br>RESULTS: Applying our method to existing and newly generated genome-wide essentiality profiles from 15 cancer cell lines, we demonstrate that CRISPRcleanR reduces false positives when calling essential genes, correcting biases within and outside of amplified regions, while maintaining true positive rates. Established cancer dependencies and essentiality signals of amplified cancer driver genes are detectable post-correction. CRISPRcleanR reports sgRNA fold changes and normalised read counts, is therefore compatible with downstream analysis tools, and works with multiple sgRNA libraries.<br><br>CONCLUSIONS: CRISPRcleanR is a versatile open-source tool for the analysis of CRISPR-Cas9 knockout screens to identify essential genes.},
}
@article {pmid30026278,
year = {2018},
author = {Jarrett, KE and Lee, C and De Giorgi, M and Hurley, A and Gillard, BK and Doerfler, AM and Li, A and Pownall, HJ and Bao, G and Lagor, WR},
title = {Somatic Editing of Ldlr With Adeno-Associated Viral-CRISPR Is an Efficient Tool for Atherosclerosis Research.},
journal = {Arteriosclerosis, thrombosis, and vascular biology},
volume = {38},
number = {9},
pages = {1997-2006},
doi = {10.1161/ATVBAHA.118.311221},
pmid = {30026278},
issn = {1524-4636},
support = {P30 DK056338/DK/NIDDK NIH HHS/United States ; R01 HL129767/HL/NHLBI NIH HHS/United States ; R01 HL132840/HL/NHLBI NIH HHS/United States ; T32 HL007676/HL/NHLBI NIH HHS/United States ; },
abstract = {Objective- Atherosclerosis studies in Ldlr knockout mice require breeding to homozygosity and congenic status on C57BL6/J background, a process that is both time and resource intensive. We aimed to develop a new method for generating atherosclerosis through somatic deletion of Ldlr in livers of adult mice. Approach and Results- Overexpression of PCSK9 (proprotein convertase subtilisin/kexin type 9) is currently used to study atherosclerosis, which promotes degradation of LDLR (low-density lipoprotein receptor) in the liver. We sought to determine whether CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) could also be used to generate atherosclerosis through genetic disruption of Ldlr in adult mice. We engineered adeno-associated viral (AAV) vectors expressing Staphylococcus aureus Cas9 and a guide RNA targeting the Ldlr gene (AAV-CRISPR). Both male and female mice received either (1) saline, (2) AAV-CRISPR, or (3) AAV-hPCSK9 (human PCSK9)-D374Y. A fourth group of germline Ldlr-KO mice was included for comparison. Mice were placed on a Western diet and followed for 20 weeks to assess plasma lipids, PCSK9 protein levels, atherosclerosis, and editing efficiency. Disruption of Ldlr with AAV-CRISPR was robust, resulting in severe hypercholesterolemia and atherosclerotic lesions in the aorta. AAV-hPCSK9 also produced hypercholesterolemia and atherosclerosis as expected. Notable sexual dimorphism was observed, wherein AAV-CRISPR was superior for Ldlr removal in male mice, while AAV-hPCSK9 was more effective in female mice. Conclusions- This all-in-one AAV-CRISPR vector targeting Ldlr is an effective and versatile tool to model atherosclerosis with a single injection and provides a useful alternative to the use of germline Ldlr-KO mice.},
}
@article {pmid29962404,
year = {2018},
author = {Tsukamoto, T and Sakai, E and Iizuka, S and Taracena-Gándara, M and Sakurai, F and Mizuguchi, H},
title = {Generation of the Adenovirus Vector-Mediated CRISPR/Cpf1 System and the Application for Primary Human Hepatocytes Prepared from Humanized Mice with Chimeric Liver.},
journal = {Biological &amp; pharmaceutical bulletin},
volume = {41},
number = {7},
pages = {1089-1095},
doi = {10.1248/bpb.b18-00222},
pmid = {29962404},
issn = {1347-5215},
mesh = {Adenoviridae/*genetics ; Animals ; Bacterial Proteins/*genetics ; CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Endonucleases/*genetics ; Genetic Vectors/*genetics ; HEK293 Cells ; Hepatocytes/metabolism ; Humans ; Liver/cytology ; Mice ; Primary Cell Culture ; RNA, Guide/genetics ; Transplantation Chimera ; },
abstract = {The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) 9 system is now widely used as a genome editing tool. CRISPR-associated endonuclease in Prevotella and Francisella 1 (Cpf1) is a recently discovered Cas endonuclease that is designable and highly specific with efficiencies comparable to those of Cas9. Here we generated the adenovirus (Ad) vector carrying an Acidaminococcus sp. Cpf1 (AsCpf1) expression cassette (Ad-AsCpf1) for the first time. Ad-AsCpf1 was applied to primary human hepatocytes prepared from humanized mice with chimeric liver in combination with the Ad vector expressing the guide RNA (gRNA) directed to the Adeno-associated virus integration site 1 (AAVS1) region. The mutation rates were estimated by T7 endonuclease I assay around 12% of insertion/deletion (indel). Furthermore, the transduced human hepatocytes were viable (ca. 60%) at two weeks post transduction. These observations suggest that the Ad vector-mediated delivery of the CRISPR/AsCpf1 system provides a useful tool for genome manipulation of human hepatocytes.},
}
@article {pmid29700742,
year = {2018},
author = {},
title = {Plenary Symposia.},
journal = {In vitro cellular &amp; developmental biology. Animal},
volume = {54},
number = {Suppl 1},
pages = {2-5},
doi = {10.1007/s11626-018-0254-6},
pmid = {29700742},
issn = {1543-706X},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Editing/*trends ; Humans ; },
}
@article {pmid29700739,
year = {2018},
author = {},
title = {Keynote Symposium.},
journal = {In vitro cellular &amp; developmental biology. Animal},
volume = {54},
number = {Suppl 1},
pages = {1},
doi = {10.1007/s11626-018-0250-x},
pmid = {29700739},
issn = {1543-706X},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*trends ; Humans ; Precision Medicine/*trends ; },
}
@article {pmid29619162,
year = {2018},
author = {Liu, CX and Li, CY and Hu, CC and Wang, Y and Lin, J and Jiang, YH and Li, Q and Xu, X},
title = {CRISPR/Cas9-induced shank3b mutant zebrafish display autism-like behaviors.},
journal = {Molecular autism},
volume = {9},
number = {},
pages = {23},
doi = {10.1186/s13229-018-0204-x},
pmid = {29619162},
issn = {2040-2392},
mesh = {Animals ; Autistic Disorder/*genetics/physiopathology ; *CRISPR-Cas Systems ; *Disease Models, Animal ; Homer Scaffolding Proteins/genetics/metabolism ; Locomotion ; Mutation ; Nerve Tissue Proteins/*genetics/metabolism ; Social Behavior ; Synaptophysin/genetics/metabolism ; Zebrafish/*genetics/physiology ; Zebrafish Proteins/*genetics/metabolism ; },
abstract = {Background: Human genetic and genomic studies have supported a strong causal role of SHANK3 deficiency in autism spectrum disorder (ASD). However, the molecular mechanism underlying SHANK3 deficiency resulting in ASD is not fully understood. Recently, the zebrafish has become an attractive organism to model ASD because of its high efficiency of genetic manipulation and robust behavioral phenotypes. The orthologous gene to human SHANK3 is duplicated in the zebrafish genome and has two homologs, shank3a and shank3b. Previous studies have reported shank3 morphants in zebrafish using the morpholino method. Here, we report the generation and characterization of shank3b mutant zebrafish in larval and adult stages using the CRISPR/Cas9 genome editing technique.<br><br>Methods: CRISPR/Cas9 was applied to generate a shank3b loss-of-function mutation (shank3b-/-) in zebrafish. A series of morphological measurements, behavioral tests, and molecular analyses were performed to systematically characterize the behavioral and molecular changes in shank3b mutant zebrafish.<br><br>Results: shank3b-/- zebrafish exhibited abnormal morphology in early development. They showed reduced locomotor activity both as larvae and adults, reduced social interaction and time spent near conspecifics, and significant repetitive swimming behaviors. Additionally, the levels of both postsynaptic homer1 and presynaptic synaptophysin were significantly reduced in the adult brain of shank3b-deficient zebrafish.<br><br>Conclusions: We generated the first inheritable shank3b mutant zebrafish model using CRISPR/Cas9 gene editing approach. shank3b-/- zebrafish displayed robust autism-like behaviors and altered levels of the synaptic proteins homer1 and synaptophysin. The versatility of zebrafish as a model for studying neurodevelopment and conducting drug screening will likely have a significant contribution to future studies of human SHANK3 function and ASD.},
}
@article {pmid29091307,
year = {2018},
author = {Weninger, A and Fischer, JE and Raschmanová, H and Kniely, C and Vogl, T and Glieder, A},
title = {Expanding the CRISPR/Cas9 toolkit for Pichia pastoris with efficient donor integration and alternative resistance markers.},
journal = {Journal of cellular biochemistry},
volume = {119},
number = {4},
pages = {3183-3198},
doi = {10.1002/jcb.26474},
pmid = {29091307},
issn = {1097-4644},
mesh = {CRISPR-Cas Systems ; DNA End-Joining Repair ; Gene Knockout Techniques/*methods ; Genetic Engineering ; Genetic Markers ; INDEL Mutation ; Pichia/*genetics/growth &amp; development ; },
abstract = {Komagataella phaffii (syn. Pichia pastoris) is one of the most commonly used host systems for recombinant protein expression. Achieving targeted genetic modifications had been hindered by low frequencies of homologous recombination (HR). Recently, a CRISPR/Cas9 genome editing system has been implemented for P. pastoris enabling gene knockouts based on indels (insertion, deletions) via non-homologous end joining (NHEJ) at near 100% efficiency. However, specifically integrating homologous donor cassettes via HR for replacement studies had proven difficult resulting at most in ∼20% correct integration using CRISPR/Cas9. Here, we demonstrate the CRISPR/Cas9 mediated integration of markerless donor cassettes at efficiencies approaching 100% using a ku70 deletion strain. The Ku70p is involved in NHEJ repair and lack of the protein appears to favor repair via HR near exclusively. While the absolute number of transformants in the Δku70 strain is reduced, virtually all surviving transformants showed correct integration. In the wildtype strain, markerless donor cassette integration was also improved up to 25-fold by placing an autonomously replicating sequence (ARS) on the donor cassette. Alternative strategies for improving donor cassette integration using a Cas9 nickase variant or reducing off targeting associated toxicity using a high fidelity Cas9 variant were so far not successful in our hands in P. pastoris. Furthermore we provide Cas9/gRNA expression plasmids with a Geneticin resistance marker which proved to be versatile tools for marker recycling. The reported CRSIPR-Cas9 tools can be applied for modifying existing production strains and also pave the way for markerless whole genome modification studies in P. pastoris.},
}
@article {pmid29028415,
year = {2018},
author = {Yang, J and Meng, X and Pan, J and Jiang, N and Zhou, C and Wu, Z and Gong, Z},
title = {CRISPR/Cas9-mediated noncoding RNA editing in human cancers.},
journal = {RNA biology},
volume = {15},
number = {1},
pages = {35-43},
doi = {10.1080/15476286.2017.1391443},
pmid = {29028415},
issn = {1555-8584},
mesh = {CRISPR-Cas Systems/*genetics ; Endonucleases/genetics ; Genetic Therapy ; Humans ; MicroRNAs/*genetics ; Neoplasms/genetics ; RNA/*genetics ; RNA Editing/genetics ; RNA, Untranslated/*genetics ; },
abstract = {Cancer is characterized by multiple genetic and epigenetic alterations, including a higher prevalence of mutations of oncogenes and/or tumor suppressors. Mounting evidences have shown that noncoding RNAs (ncRNAs) are involved in the epigenetic regulation of cancer genes and their associated pathways. The clustered regularly interspaced short palindromic repeats (CRISPR)-associated nuclease 9 (CRISPR/Cas9) system, a revolutionary genome-editing technology, has shed light on ncRNA-based cancer therapy. Here, we briefly introduce the classifications and mechanisms of CRISPR/Cas9 system. Importantly, we mainly focused on the applications of CRISPR/Cas9 system as a molecular tool for ncRNA (microRNA, long noncoding RNA and circular RNA, etc.) editing in human cancers, and the novel techniques that are based on CRISPR/Cas9 system. Additionally, the off-target effects and the corresponding solutions as well as the challenges toward CRISPR/Cas9 were also evaluated and discussed. Long- and short-ncRNAs have been employed as targets in precision oncology, and CRISPR/Cas9-mediated ncRNA editing may provide an excellent way to cure cancer.},
}
@article {pmid28205648,
year = {2017},
author = {Estoppey, D and Hewett, JW and Guy, CT and Harrington, E and Thomas, JR and Schirle, M and Cuttat, R and Waldt, A and Gerrits, B and Yang, Z and Schuierer, S and Pan, X and Xie, K and Carbone, W and Knehr, J and Lindeman, A and Russ, C and Frias, E and Hoffman, GR and Varadarajan, M and Ramadan, N and Reece-Hoyes, JS and Wang, Q and Chen, X and McAllister, G and Roma, G and Bouwmeester, T and Hoepfner, D},
title = {Identification of a novel NAMPT inhibitor by CRISPR/Cas9 chemogenomic profiling in mammalian cells.},
journal = {Scientific reports},
volume = {7},
number = {},
pages = {42728},
doi = {10.1038/srep42728},
pmid = {28205648},
issn = {2045-2322},
mesh = {*CRISPR-Cas Systems ; Cells, Cultured ; Drug Discovery/*methods ; Enzyme Inhibitors/chemistry/*pharmacology ; Gene Deletion ; Humans ; Induced Pluripotent Stem Cells/drug effects/metabolism ; Nicotinamide Phosphoribosyltransferase/*antagonists &amp; inhibitors/genetics ; Pharmacogenomic Testing/methods ; },
abstract = {Chemogenomic profiling is a powerful and unbiased approach to elucidate pharmacological targets and the mechanism of bioactive compounds. Until recently, genome-wide, high-resolution experiments of this nature have been limited to fungal systems due to lack of mammalian genome-wide deletion collections. With the example of a novel nicotinamide phosphoribosyltransferase (NAMPT) inhibitor, we demonstrate that the CRISPR/Cas9 system enables the generation of transient homo- and heterozygous deletion libraries and allows for the identification of efficacy targets and pathways mediating hypersensitivity and resistance relevant to the compound mechanism of action.},
}
@article {pmid27687572,
year = {2017},
author = {Goodman, MA and Moradi Manesh, D and Malik, P and Rothenberg, ME},
title = {CRISPR/Cas9 in allergic and immunologic diseases.},
journal = {Expert review of clinical immunology},
volume = {13},
number = {1},
pages = {5-9},
doi = {10.1080/1744666X.2017.1241711},
pmid = {27687572},
issn = {1744-8409},
support = {K12 HD000850/HD/NICHD NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Cytidine Deaminase ; Gene Editing ; Humans ; Hypersensitivity/genetics/*therapy ; Immune System Diseases/genetics/*therapy ; Translational Medical Research ; },
}
@article {pmid30296034,
year = {2018},
author = {Tomlinson, T},
title = {A Crispr Future for Gene-Editing Regulation: a Proposal for an Updated Biotechnology Regulatory System in an Era of Human Genomic Editing.},
journal = {Fordham law review},
volume = {87},
number = {1},
pages = {437-483},
pmid = {30296034},
issn = {0015-704X},
mesh = {Biotechnology/*ethics/legislation &amp; jurisprudence/*standards ; *CRISPR-Cas Systems ; Embryo Research/*ethics/history/legislation &amp; jurisprudence ; Gene Editing/*ethics/legislation &amp; jurisprudence/*standards ; *Government Regulation/history ; History, 20th Century ; Humans ; Stem Cell Research/ethics/history/legislation &amp; jurisprudence ; United States ; },
abstract = {Recent developments in gene-editing technology have enabled scientists to manipulate the human genome in unprecedented ways. One technology in particular, Clustered Regularly Interspaced Short Pallindromic Repeat (CRISPR), has made gene editing more precise and cost-effective than ever before. Indeed, scientists have already shown that CRISPR can eliminate genes linked to life-threatening diseases from an individual's genetic makeup and, when used on human embryos, CRISPR has the potential to permanently eliminate hereditary diseases from the human genome in its entirety. These developments have brought great hope to individuals and their families, who suffer from genetically linked diseases. But there is a dark side: in the wrong hands, CRISPR could negatively impact the course of human evolution or be used to create biological weaponry. Despite these possible consequences, CRISPR remains largely unregulated due to the United States's outdated regulatory scheme for biotechnology. Moreover, human embryo research, which is likely critical to maximizing the therapeutic applications of CRISPR, is not easily undertaken by scientists due to a number of federal and state restrictions aimed at preventing such research. This Note examines the possible benefits and consequences of CRISPR and discusses the current regulations in both the fields of biotechnology and human embryo research that hamper the government's ability to effectively regulate this technology. Ultimately, this Note proposes a new regulatory scheme for biotechnology that focuses on the processes used to create products using CRISPR, rather than the products themselves, with a focus on enabling ethical research using human embryos to maximize the potential benefits of CRISPR.},
}
@article {pmid29921414,
year = {2018},
author = {Jo, DH and Kim, JH},
title = {Application of genome engineering for treatment of retinal diseases.},
journal = {BMB reports},
volume = {51},
number = {7},
pages = {315-316},
pmid = {29921414},
issn = {1976-670X},
mesh = {Animals ; Bacterial Proteins/genetics/metabolism ; CRISPR-Cas Systems/genetics ; Endonucleases/genetics/metabolism ; *Gene Editing ; Humans ; Hypoxia-Inducible Factor 1, alpha Subunit/genetics/metabolism ; RNA, Guide/genetics/metabolism ; Retinal Diseases/genetics/*therapy ; Vascular Endothelial Growth Factor A/chemistry/metabolism ; },
abstract = {Genome engineering with clustered regularly interspaced short palindromic repeats (CRISPR) system can be used as a tool to correct pathological mutations or modulate gene expression levels associated with pathogenesis of human diseases. Owing to well-established local administration methods including intravitreal and subretinal injection, it is relatively easy to administer therapeutic genome engineering machinery to ocular tissues for treating retinal diseases. In this context, we have investigated the potential of in vivo genome engineering as a therapeutic approach in the form of ribonucleoprotein or CRISPR packaged in viral vectors. Major issues in therapeutic application of genome engineering include specificity and efficacy according to types of CRISPR system. In addition to previous platforms based on ribonucleoprotein and CRISPRassociated protein 9 derived from Campylobacter jejuni, we evaluated the therapeutic effects of a CRISPR RNA-guided endonuclease derived from Lachnospiraceae bacterium ND2006 (LbCpf1) in regulating pathological angiogenesis in an animal model of wet-type age-related macular degeneration. LbCpf1 targeting Vegfa or Hif1a effectively disrupted the expression of genes in ocular tissues, resulting in suppression of choroidal neovascularization. It was also notable that there were no significant off-target effects in vivo. [BMB Reports 2018; 51(7): 315-316].},
}
@article {pmid29898807,
year = {2018},
author = {Xu, Y and Li, R and Zhang, K and Wu, W and Wang, S and Zhang, P and Xu, H},
title = {The multifunctional RNA-binding protein hnRNPK is critical for the proliferation and differentiation of myoblasts.},
journal = {BMB reports},
volume = {51},
number = {7},
pages = {350-355},
pmid = {29898807},
issn = {1976-670X},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cell Cycle Checkpoints ; *Cell Differentiation ; Cell Line ; *Cell Proliferation ; Cyclin A2/genetics/metabolism ; Cyclin B1/genetics/metabolism ; Mice ; Muscle Development/genetics ; Mutagenesis ; Myoblasts/cytology/metabolism ; Myosin Heavy Chains/metabolism ; Protein Interaction Domains and Motifs ; RNA, Messenger/metabolism ; Ribonucleoproteins/genetics/*metabolism ; cdc25 Phosphatases/genetics/metabolism ; },
abstract = {HnRNPK is a multifunctional protein that participates in chromatin remodeling, transcription, RNA splicing, mRNA stability and translation. Here, we uncovered the function of hnRNPK in regulating the proliferation and differentiation of myoblasts. hnRNPK was mutated in the C2C12 myoblast cell line using the CRISPR/Cas9 system. A decreased proliferation rate was observed in hnRNPK-mutated cells, suggesting an impaired proliferation phenotype. Furthermore, increased G2/M phase, decreased S phase and increased sub-G1 phase cells were detected in the hnRNPK-mutated cell lines. The expression analysis of key cell cycle regulators indicated mRNA of Cyclin A2 was significantly increased in the mutant myoblasts compared to the control cells, while Cyclin B1, Cdc25b and Cdc25c were decreased sharply. In addition to the myoblast proliferation defect, the mutant cells exhibited defect in myotube formation. The myotube formation marker, myosin heavy chain (MHC), was decreased sharply in hnRNPK-mutated cells compared to control myoblasts during differentiation. The deficiency in hnRNPK also resulted in the repression of Myog expression, a key myogenic regulator during differentiation. Together, our data demonstrate that hnRNPK is required for myoblast proliferation and differentiation and may be an essential regulator of myoblast function. [BMB Reports 2018; 51(7): 350-355].},
}
@article {pmid29273779,
year = {2017},
author = {Elewa, A and Wang, H and Talavera-López, C and Joven, A and Brito, G and Kumar, A and Hameed, LS and Penrad-Mobayed, M and Yao, Z and Zamani, N and Abbas, Y and Abdullayev, I and Sandberg, R and Grabherr, M and Andersson, B and Simon, A},
title = {Reading and editing the Pleurodeles waltl genome reveals novel features of tetrapod regeneration.},
journal = {Nature communications},
volume = {8},
number = {1},
pages = {2286},
doi = {10.1038/s41467-017-01964-9},
pmid = {29273779},
issn = {2041-1723},
support = {F32 GM117806/GM/NIGMS NIH HHS/United States ; },
mesh = {Ambystoma mexicanum/genetics ; Animals ; CRISPR-Cas Systems ; DNA Transposable Elements/genetics ; Embryonic Stem Cells/metabolism ; Extremities/*physiology ; Gene Editing ; Gene Expression Profiling ; Genome/*genetics ; Genomics ; MicroRNAs/*genetics ; Muscle, Skeletal/physiology ; PAX3 Transcription Factor/genetics ; PAX7 Transcription Factor/genetics ; Pleurodeles/*genetics ; Proto-Oncogenes/genetics ; Regeneration/*genetics/physiology ; },
abstract = {Salamanders exhibit an extraordinary ability among vertebrates to regenerate complex body parts. However, scarce genomic resources have limited our understanding of regeneration in adult salamanders. Here, we present the ~20 Gb genome and transcriptome of the Iberian ribbed newt Pleurodeles waltl, a tractable species suitable for laboratory research. We find that embryonic stem cell-specific miRNAs mir-93b and mir-427/430/302, as well as Harbinger DNA transposons carrying the Myb-like proto-oncogene have expanded dramatically in the Pleurodeles waltl genome and are co-expressed during limb regeneration. Moreover, we find that a family of salamander methyltransferases is expressed specifically in adult appendages. Using CRISPR/Cas9 technology to perturb transcription factors, we demonstrate that, unlike the axolotl, Pax3 is present and necessary for development and that contrary to mammals, muscle regeneration is normal without functional Pax7 gene. Our data provide a foundation for comparative genomic studies that generate models for the uneven distribution of regenerative capacities among vertebrates.},
}
@article {pmid29046358,
year = {2018},
author = {Zheng, J and Chen, Y and Li, Z and Cao, S and Zhang, Z and Jia, H},
title = {Translationally controlled tumor protein is required for the fast growth of Toxoplasma gondii and maintenance of its intracellular development.},
journal = {FASEB journal : official publication of the Federation of American Societies for Experimental Biology},
volume = {32},
number = {2},
pages = {906-919},
doi = {10.1096/fj.201700994R},
pmid = {29046358},
issn = {1530-6860},
mesh = {Biomarkers, Tumor/*biosynthesis/genetics ; CRISPR-Cas Systems ; Gene Knockdown Techniques ; Humans ; Protozoan Proteins/*biosynthesis/genetics ; Toxoplasma/genetics/*growth &amp; development ; },
abstract = {Translationally controlled tumor protein (TCTP) is a highly conserved, multifunctional protein that has been implicated in a range of cell physiologic processes, especially cell growth and development. A TCTP-like gene has been identified in the Toxoplasma genome [ Toxoplasma gondii TCTP (TgTCTP)], although its function remains unknown. The sequence analysis of TgTCTP indicated that it is a highly conserved protein in eukaryotes. We found that the expression level of TgTCTP in the virulent RH strain was significantly higher than that in the avirulent PLK strain. Indirect immunofluorescence showed that TgTCTP was expressed in the parasite cytoplasm. The localization of TgTCTP was unchanged during the replication of the parasite. We expressed a functional recombinant TgTCTP (r TgTCTP) protein in Escherichia coli and found that the recombinant protein could form a multimer. We then evaluated the function of TgTCTP using the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 knockout (KO) system. Phenotypic analysis of the KO strain (Δ TgTCTP) revealed that TgTCTP is required for the robust growth of the parasites. TgTCTP deficiency also led to early egress of the parasites and subsequent impairment in their invasion and attachment abilities. We subsequently found that the multimer form of TgTCTP might not be necessary for the growth and replication of the parasite. Then the expression profiling of genes in the Δ TgTCTP and complement strains were analyzed. The results revealed that 988 genes were regulated in Δ TgTCTP compared with the complement strain. Overall, although not essential, TgTCTP is required for the fast growth of Tg and maintenance of its intracellular development.-Zheng, J., Chen, Y., Li, Z., Cao, S., Zhang, Z., Jia, H. Translationally controlled tumor protein is required for the fast growth of Toxoplasma gondii and maintenance of its intracellular development.},
}
@article {pmid30346516,
year = {2018},
author = {Markusková, B and Lichvariková, A and Szemes, T and Korenová, J and Kuchta, T and Drahovská, H},
title = {Genome analysis of lactic acid bacterial strains selected as potential starters for traditional Slovakian bryndza cheese.},
journal = {FEMS microbiology letters},
volume = {},
number = {},
pages = {},
doi = {10.1093/femsle/fny257},
pmid = {30346516},
issn = {1574-6968},
abstract = {Genomes of 21 strains of lactic acid bacteria isolated from Slovakian traditional cheeses were sequenced on an Illumina MiSeq platform. Subsequently, they were analysed regarding taxonomic classification, presence of genes encoding defence systems, antibiotic resistance and production of biogenic amines. Thirteen strains were found to carry genes encoding at least one bacteriocin, 18 carried genes encoding at least one restriction-modification system, all strains carried 1-6 prophages and 9 strains had CRISPR-Cas systems. CRISPR-Cas type II-A was the most common, containing 0-24 spacers. Only 10% spacers were found to be homological to known bacteriophage or plasmid sequences in databases. Two Enterococcus faecium strains and a Lactococcus lactis strain carried antibiotic resistance genes. Genes encoding for ornithine decarboxylase were detected in 4 strains and genes encoding for agmatine deiminase were detected in 4 strains. Lb. paraplantarum 251 L appeared to be the most interesting strain, as it contained genes encoding for two bacteriocins, a restriction-modification system, two CRISPR-Cas systems, four prophages and no genes connected with antibiotic resistance or production of biogenic amines.},
}
@article {pmid30345399,
year = {2018},
author = {Yao, R and Liu, D and Jia, X and Zheng, Y and Liu, W and Xiao, Y},
title = {CRISPR-Cas9/Cas12a biotechnology and application in bacteria.},
journal = {Synthetic and systems biotechnology},
volume = {3},
number = {3},
pages = {135-149},
doi = {10.1016/j.synbio.2018.09.004},
pmid = {30345399},
issn = {2405-805X},
abstract = {CRISPR-Cas technologies have greatly reshaped the biology field. In this review, we discuss the CRISPR-Cas with a particular focus on the associated technologies and applications of CRISPR-Cas9 and CRISPR-Cas12a, which have been most widely studied and used. We discuss the biological mechanisms of CRISPR-Cas as immune defense systems, recently-discovered anti-CRISPR-Cas systems, and the emerging Cas variants (such as xCas9 and Cas13) with unique characteristics. Then, we highlight various CRISPR-Cas biotechnologies, including nuclease-dependent genome editing, CRISPR gene regulation (including CRISPR interference/activation), DNA/RNA base editing, and nucleic acid detection. Last, we summarize up-to-date applications of the biotechnologies for synthetic biology and metabolic engineering in various bacterial species.},
}
@article {pmid30344094,
year = {2018},
author = {Mohr, G and Silas, S and Stamos, JL and Makarova, KS and Markham, LM and Yao, J and Lucas-Elío, P and Sanchez-Amat, A and Fire, AZ and Koonin, EV and Lambowitz, AM},
title = {A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition.},
journal = {Molecular cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.molcel.2018.09.013},
pmid = {30344094},
issn = {1097-4164},
abstract = {Prokaryotic CRISPR-Cas systems provide adaptive immunity by integrating portions of foreign nucleic acids (spacers) into genomic CRISPR arrays. Cas6 proteins then process CRISPR array transcripts into spacer-derived RNAs (CRISPR RNAs; crRNAs) that target Cas nucleases to matching invaders. We find that a Marinomonas mediterranea fusion protein combines three enzymatic domains (Cas6, reverse transcriptase [RT], and Cas1), which function in both crRNA biogenesis and spacer acquisition from RNA and DNA. We report a crystal structure of this divergent Cas6, identify amino acids required for Cas6 activity, show that the Cas6 domain is required for RT activity and RNA spacer acquisition, and demonstrate that CRISPR-repeat binding to Cas6 regulates RT activity. Co-evolution of putative interacting surfaces suggests a specific structural interaction between the Cas6 and RT domains, and phylogenetic analysis reveals repeated, stable association of free-standing Cas6s with CRISPR RTs in multiple microbial lineages, indicating that a functional interaction between these proteins preceded evolution of the fusion.},
}
@article {pmid30343903,
year = {2018},
author = {Dillard, KE and Brown, MW and Johnson, NV and Xiao, Y and Dolan, A and Hernandez, E and Dahlhauser, SD and Kim, Y and Myler, LR and Anslyn, EV and Ke, A and Finkelstein, IJ},
title = {Assembly and Translocation of a CRISPR-Cas Primed Acquisition Complex.},
journal = {Cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.cell.2018.09.039},
pmid = {30343903},
issn = {1097-4172},
abstract = {CRISPR-Cas systems confer an adaptive immunity against viruses. Following viral injection, Cas1-Cas2 integrates segments of the viral genome (spacers) into the CRISPR locus. In type I CRISPR-Cas systems, efficient &quot;primed&quot; spacer acquisition and viral degradation (interference) require both the Cascade complex and the Cas3 helicase/nuclease. Here, we present single-molecule characterization of the Thermobifida fusca (Tfu) primed acquisition complex (PAC). We show that TfuCascade rapidly samples non-specific DNA via facilitated one-dimensional diffusion. Cas3 loads at target-bound Cascade and the Cascade/Cas3 complex translocates via a looped DNA intermediate. Cascade/Cas3 complexes stall at diverse protein roadblocks, resulting in a double strand break at the stall site. In contrast, Cas1-Cas2 samples DNA transiently via 3D collisions. Moreover, Cas1-Cas2 associates with Cascade and translocates with Cascade/Cas3, forming the PAC. PACs can displace different protein roadblocks, suggesting a mechanism for long-range spacer acquisition. This work provides a molecular basis for the coordinated steps in CRISPR-based adaptive immunity.},
}
@article {pmid30276556,
year = {2018},
author = {Xue, T and Liu, K and Chen, D and Yuan, X and Fang, J and Yan, H and Huang, L and Chen, Y and He, W},
title = {Improved bioethanol production using CRISPR/Cas9 to disrupt the ADH2 gene in Saccharomyces cerevisiae.},
journal = {World journal of microbiology &amp; biotechnology},
volume = {34},
number = {10},
pages = {154},
doi = {10.1007/s11274-018-2518-4},
pmid = {30276556},
issn = {1573-0972},
support = {2017J01622//Natural Science Foundation of Fujian Province/ ; CARS-170501//National Sugar Crop Reserach System/ ; JAT160114//Education Department Project of Fujian Province/ ; },
mesh = {Alcohol Dehydrogenase/*genetics/*metabolism ; Analysis of Variance ; Base Sequence ; *CRISPR-Cas Systems/genetics ; Cloning, Molecular ; DNA, Fungal/analysis ; Escherichia coli/genetics ; Ethanol/*metabolism ; Fermentation ; Gene Deletion ; Gene Editing ; Gene Expression Regulation, Fungal ; Gene Knockout Techniques/methods ; Genetic Engineering/*methods ; Genome, Fungal/genetics ; Metabolic Engineering/*methods ; Metabolic Networks and Pathways/genetics ; Saccharomyces cerevisiae/*genetics/*metabolism ; Saccharomyces cerevisiae Proteins/*genetics/*metabolism ; Sequence Alignment ; Transformation, Genetic ; },
abstract = {Bioethanol, as a form of renewable and clean energy, has become increasingly important to the energy supply. One major obstacle in ethanol production is developing a high-capacity system. Existing approaches for regulating the ethanol production pathway are relatively insufficient, with nonspecific genetic manipulation. Here, we used CRISPR/Cas9 technology to disrupt the alcohol dehydrogenase (ADH) 2 gene via complete deletion of the gene and introduction of a frameshift mutation in the ADH2 locus. Sequencing demonstrated the accurate knockout of the target gene with 91.4% and near 100% targeting efficiency. We also utilized genome resequencing to validate the mutations in the ADH2 mutants targeted by various single-guide RNAs. This extensive analysis indicated the mutations in the CRISPR/Cas9-engineered strains were homozygous. We applied the engineered Saccharomyces cerevisiae strains for bioethanol production. Results showed that the ethanol yield improved by up to 74.7% compared with the yield obtained using the native strain. This work illustrates the applicability of this highly efficient and specific genome engineering approach to promote the improvement of bioethanol production in S. cerevisiae via metabolic engineering. Importantly, this study is the first report of the disruption of a target gene, ADH2, in S. cerevisiae using CRISPR/Cas9 technology to improve bioethanol yield.},
}
@article {pmid30136108,
year = {2018},
author = {Wang, W and Simmonds, J and Pan, Q and Davidson, D and He, F and Battal, A and Akhunova, A and Trick, HN and Uauy, C and Akhunov, E},
title = {Gene editing and mutagenesis reveal inter-cultivar differences and additivity in the contribution of TaGW2 homoeologues to grain size and weight in wheat.},
journal = {TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik},
volume = {131},
number = {11},
pages = {2463-2475},
doi = {10.1007/s00122-018-3166-7},
pmid = {30136108},
issn = {1432-2242},
support = {2017-67007-25932//USDA National Institute of Food and Agriculture/ ; IWYP76//International Wheat Yield Partnership grant/ ; 01511000146//Bill and Melinda Gates Foundation grant/ ; BB/P016855/1//UK Biotechnology and Biological Sciences Research Council/ ; BB/P013511/1//UK Biotechnology and Biological Sciences Research Council/ ; },
mesh = {CRISPR-Cas Systems ; Edible Grain/genetics/growth &amp; development ; *Gene Editing ; Gene Knockout Techniques ; *Mutagenesis ; Seeds/genetics/*growth &amp; development ; Triticum/*genetics/growth &amp; development ; },
abstract = {KEY MESSAGE: CRISPR-Cas9-based genome editing and EMS mutagenesis revealed inter-cultivar differences and additivity in the contribution of TaGW2 homoeologues to grain size and weight in wheat. The TaGW2 gene homoeologues have been reported to be negative regulators of grain size (GS) and thousand grain weight (TGW) in wheat. However, the contribution of each homoeologue to trait variation among different wheat cultivars is not well documented. We used the CRISPR-Cas9 system and TILLING to mutagenize each homoeologous gene copy in cultivars Bobwhite and Paragon, respectively. Plants carrying single-copy nonsense mutations in different genomes showed different levels of GS/TGW increase, with TGW increasing by an average of 5.5% (edited lines) and 5.3% (TILLING mutants). In any combination, the double homoeologue mutants showed higher phenotypic effects than the respective single-genome mutants. The double mutants had on average 12.1% (edited) and 10.5% (TILLING) higher TGW with respect to wild-type lines. The highest increase in GS and TGW was shown for triple mutants of both cultivars, with increases in 16.3% (edited) and 20.7% (TILLING) in TGW. The additive effects of the TaGW2 homoeologues were also demonstrated by the negative correlation between the functional gene copy number and GS/TGW in Bobwhite mutants and an F2 population. The highest single-genome increases in GS and TGW in Paragon and Bobwhite were obtained by mutations in the B and D genomes, respectively. These inter-cultivar differences in the phenotypic effects between the TaGW2 gene homoeologues coincide with inter-cultivar differences in the homoeologue expression levels. These results indicate that GS/TGW variation in wheat can be modulated by the dosage of homoeologous genes with inter-cultivar differences in the magnitude of the individual homoeologue effects.},
}
@article {pmid30081189,
year = {2018},
author = {de Carvalho, TG and Schuh, R and Pasqualim, G and Pellenz, FM and Filippi-Chiela, EC and Giugliani, R and Baldo, G and Matte, U},
title = {CRISPR-Cas9-mediated gene editing in human MPS I fibroblasts.},
journal = {Gene},
volume = {678},
number = {},
pages = {33-37},
doi = {10.1016/j.gene.2018.08.004},
pmid = {30081189},
issn = {1879-0038},
mesh = {CRISPR-Cas Systems ; Cells, Cultured ; Fibroblasts/*cytology/metabolism ; Gene Editing/*methods ; Genetic Therapy ; High-Throughput Nucleotide Sequencing ; Humans ; Iduronidase/*genetics ; Mucopolysaccharidosis I/*genetics/therapy ; Mutation ; Sequence Analysis, DNA ; },
abstract = {Mucopolysaccharidosis type I (MPS I) is a lysosomal storage disorder (LSD). It is caused by mutations in the IDUA gene, which lead to the accumulation of the glycosaminoglycans dermatan and heparan sulfate. The CRISPR-Cas9 system is a new and powerful tool that allows gene editing at precise points of the genome, resulting in gene correction through the introduction and genomic integration of a wildtype sequence. In this study, we used the CRISPR-Cas9 genome editing technology to correct in vitro the most common mutation causing MPS I. Human fibroblasts homozygous for p.Trp402* (legacy name W402X) were transfected and analyzed for up to one month after treatment. IDUA activity was significantly increased, lysosomal mass was decreased, and next generation sequencing confirmed that a percentage of cells carried the wildtype sequence. As a proof of concept, this study demonstrates that CRISPR-Cas9 genome editing may be used to correct causative mutations in MPS I. LIST OF ABBREVIATIONS.},
}
@article {pmid30040228,
year = {2018},
author = {Gertsenstein, M and Nutter, LMJ},
title = {Engineering Point Mutant and Epitope-Tagged Alleles in Mice Using Cas9 RNA-Guided Nuclease.},
journal = {Current protocols in mouse biology},
volume = {8},
number = {1},
pages = {28-53},
doi = {10.1002/cpmo.40},
pmid = {30040228},
issn = {2161-2617},
mesh = {Alleles ; Animals ; CRISPR-Cas Systems/*genetics ; Electroporation ; Endonucleases/genetics/*metabolism ; Gene Editing/methods ; Humans ; Mice ; RNA, Guide/genetics/*metabolism ; Zygote/metabolism ; },
abstract = {Mice carrying patient-associated point mutations are powerful tools to define the causality of single-nucleotide variants to disease states. Epitope tags enable immuno-based studies of genes for which no antibodies are available. These alleles enable detailed and precise developmental, mechanistic, and translational research. The first step in generating these alleles is to identify within the target sequence-the orthologous sequence for point mutations or the N or C terminus for epitope tags-appropriate Cas9 protospacer sequences. Subsequent steps include design and acquisition of a single-stranded oligonucleotide repair template, synthesis of a single guide RNA (sgRNA), collection of zygotes, and microinjection or electroporation of zygotes with Cas9 mRNA or protein, sgRNA, and repair template followed by screening of born mice for the presence of the desired sequence change. Quality control of mouse lines includes screening for random or multicopy insertions of the repair template and, depending on sgRNA sequence, off-target mutations introduced by Cas9. © 2018 by John Wiley &amp; Sons, Inc.},
}
@article {pmid29912402,
year = {2018},
author = {Soyars, CL and Peterson, BA and Burr, CA and Nimchuk, ZL},
title = {Cutting Edge Genetics: CRISPR/Cas9 Editing of Plant Genomes.},
journal = {Plant &amp; cell physiology},
volume = {59},
number = {8},
pages = {1608-1620},
doi = {10.1093/pcp/pcy079},
pmid = {29912402},
issn = {1471-9053},
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Gene Editing ; Genetic Engineering ; Genome, Plant/*genetics ; Plants, Genetically Modified/genetics ; },
abstract = {The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated nuclease 9 (Cas9) system is a genome editing technology transforming the field of plant biology by virtue of the system's efficiency and specificity. The system has quickly evolved for many diverse applications including multiplex gene mutation, gene replacement and transcriptional control. As CRISPR/Cas9 is increasingly applied to plants, it is becoming clear that each component of the system can be modified to improve editing results. This review aims to highlight common considerations and options when conducting CRISPR/Cas9 experiments.},
}
@article {pmid29790644,
year = {2018},
author = {Feng, X and Zhao, D and Zhang, X and Ding, X and Bi, C},
title = {CRISPR/Cas9 Assisted Multiplex Genome Editing Technique in Escherichia coli.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700604},
doi = {10.1002/biot.201700604},
pmid = {29790644},
issn = {1860-7314},
support = {2015AA020202//The National High Technology Research and Development Program of China/ ; ZDRW-ZS-2016-3//The Key deployment project of the Chinese Academy of Sciences/ ; 14ZCZDSY00067//Tianjin Key Technology R&amp;D program of Tianjin Municipal Science and Technology Commission/ ; ZDRW-ZS-2016-3//Key deployment project of the Chinese Academy of Sciences/ ; NNCAS-2015-2//Novo Nordisk - Chinese Academy of Sciences (NN-CAS) Research Fund/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Escherichia coli/*genetics ; Gene Editing/*methods ; Genome, Bacterial ; Microbial Viability/genetics ; },
abstract = {Genome editing for site-specific chromosome modification is one of the most significant techniques in biological research. While conventional techniques usually deal with one genomic locus at a time, multiple genomic targets are often required to be modified to develop microbial cell factories. Thus, it is necessary to develop techniques for simultaneous editing of multiple loci. In this work, the authors develop a CRISPR/Cas9 assisted multiplex genome editing (CMGE) technique in Escherichia coli. With this editing method, all functional parts are assembled into replicable plasmids, and stringent inducible expression systems are used to control Cas9 gene expression, which is to decouple transformation from editing process to increase editing efficiency. A modular assembly strategy is designed to enable construction of the complex multi-gRNA plasmid. With this technique, two and three loci are able to be modified with 100% and 88.3% efficiencies, while four loci can be edited with more than 30%, which are the best results reported. Although developed in model organism, the strategy of CMGE can be adapted to other prokaryotic cells. This is a well designed and illustrated technique with no special requirement, can be used by any biological lab easily.},
}
@article {pmid29778643,
year = {2018},
author = {Shimatani, Z and Fujikura, U and Ishii, H and Matsui, Y and Suzuki, M and Ueke, Y and Taoka, KI and Terada, R and Nishida, K and Kondo, A},
title = {Inheritance of co-edited genes by CRISPR-based targeted nucleotide substitutions in rice.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {78-83},
doi = {10.1016/j.plaphy.2018.04.028},
pmid = {29778643},
issn = {1873-2690},
mesh = {Acetolactate Synthase/genetics ; CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Gene Targeting/*methods ; Genes, Plant/*genetics ; Herbicide Resistance/genetics ; Oryza/*genetics ; Plants, Genetically Modified/*genetics ; },
abstract = {The CRISPR/Cas9 system is a revolutionary genome-editing tool for directed gene editing in various organisms. Cas9 variants can be applied as molecular homing devices when combined with various functional effectors such as transcriptional activators or DNA modification enzymes. Target-AID is a synthetic complex of nuclease deficient Cas9 fused to an activation-induced cytidine deaminase (AID) that enables targeted nucleotide substitution (C to T or G to A). We previously demonstrated that the introduction of desired point mutations into target genes by Target-AID confers herbicide tolerance to rice callus. Inheritance of the introduced mutations, as well as the removal of transgenes, are key issues that must be addressed in order to fully develop Target-AID as a plant breeding technique. Here we report the transmission of such mutations from the callus to regenerants and their progenies, leading to a generation of selectable marker-free (SMF) herbicide tolerant rice plants with simultaneous multiplex nucleotide substitutions. These findings demonstrate that Target-AID can be developed into novel plant breeding technology which enables improvement of multiplex traits at one time in combination with sophisticated targeted base editing with the simplicity and versatility of CRISPR/Cas9 system.},
}
@article {pmid29754773,
year = {2018},
author = {Shah, T and Andleeb, T and Lateef, S and Noor, MA},
title = {Genome editing in plants: Advancing crop transformation and overview of tools.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {12-21},
doi = {10.1016/j.plaphy.2018.05.009},
pmid = {29754773},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/genetics ; Crops, Agricultural/*genetics ; Gene Editing/*methods ; Genome, Plant/genetics ; Mutagenesis, Site-Directed/methods ; Plants/*genetics ; Transcription Activator-Like Effector Nucleases/genetics ; Zinc Finger Nucleases/genetics ; },
abstract = {Genome manipulation technology is one of emerging field which brings real revolution in genetic engineering and biotechnology. Targeted editing of genomes pave path to address a wide range of goals not only to improve quality and productivity of crops but also permit to investigate the fundamental roots of biological systems. These goals includes creation of plants with valued compositional properties and with characters that confer resistance to numerous biotic and abiotic stresses. Numerous novel genome editing systems have been introduced during the past few years; these comprise zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats/Cas9 (CRISPR/Cas9). Genome editing technique is consistent for improving average yield to achieve the growing demands of the world's existing food famine and to launch a feasible and environmentally safe agriculture scheme, to more specific, productive, cost-effective and eco-friendly. These exciting novel methods, concisely reviewed herein, have verified themselves as efficient and reliable tools for the genetic improvement of plants.},
}
@article {pmid29753601,
year = {2018},
author = {Okuzaki, A and Ogawa, T and Koizuka, C and Kaneko, K and Inaba, M and Imamura, J and Koizuka, N},
title = {CRISPR/Cas9-mediated genome editing of the fatty acid desaturase 2 gene in Brassica napus.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {63-69},
doi = {10.1016/j.plaphy.2018.04.025},
pmid = {29753601},
issn = {1873-2690},
mesh = {Brassica napus/enzymology/*genetics ; CRISPR-Cas Systems/*genetics ; Fatty Acid Desaturases/*genetics/metabolism ; Fatty Acids/metabolism ; Gene Editing/*methods ; Genes, Plant/*genetics ; Genotyping Techniques ; Plants, Genetically Modified/enzymology/genetics ; },
abstract = {The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9-mediated genome editing system has been widely applied as a powerful tool for modifying preferable endogenous genes. This system is highly expected to be further applied for the breeding of various agronomically important plant species. Here we report the modification of a fatty acid desaturase 2 gene (FAD2), which encodes an enzyme that catalyzes the desaturation of oleic acid, in Brassica napus cv. Westar using the CRISPR/Cas9 system. Two guide RNAs were designed for BnaA.FAD2.a (FAD2_Aa). Of 22 regenerated shoots with FAD2_Aa editing vectors, three contained mutant alleles. Further analysis revealed that two of three mature plants (Aa1#13 and Aa2#2) contained the mutant alleles. The mutant fad2_Aa allele had a 4-bp deletion, which was inherited by backcross progenies (BC1) in the Aa1#13 line. Furthermore, plants with the fad2_Aa allele without transgenes were selected from the BC1 progenies and plants homozygous for fad2_Aa were then produced by self-crossing these BC1 progenies (BC1S1). Fatty acid composition analysis of their seeds revealed a statistically significant increase in the content of oleic acid compared with that in wild-type seeds. These results showed that the application of the CRISPR/Cas9 system is useful to produce desirable mutant plants with an agronomically suitable phenotype by modifying the metabolic pathway in B. napus.},
}
@article {pmid29739710,
year = {2018},
author = {Shibuya, K and Watanabe, K and Ono, M},
title = {CRISPR/Cas9-mediated mutagenesis of the EPHEMERAL1 locus that regulates petal senescence in Japanese morning glory.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {53-57},
doi = {10.1016/j.plaphy.2018.04.036},
pmid = {29739710},
issn = {1873-2690},
mesh = {*CRISPR-Cas Systems/genetics ; Convolvulaceae/*genetics/growth &amp; development ; Flowers/*genetics/growth &amp; development ; Gene Expression Regulation, Plant/genetics ; Gene Knockdown Techniques/methods ; Genes, Plant/*genetics/physiology ; Mutagenesis, Site-Directed/*methods ; Plants, Genetically Modified/genetics/growth &amp; development ; },
abstract = {Flower longevity is one of the most important traits in ornamental plants. In Japanese morning glory (Ipomoea nil), EPHEMERAL1 (EPH1), a NAC transcription factor, is reportedly a key regulator of petal senescence. CRISPR/Cas9-mediated targeted mutagenesis is a powerful tool for crop breeding as well as for biological research. Here we report the application of CRISPR/Cas9 technology to targeted mutagenesis of the EPH1 gene in I. nil. Three regions within the EPH1 gene were simultaneously targeted by a single binary vector containing three single-guide RNA cassettes. We selected eight T0 transgenic plants containing the transferred DNA (T-DNA). Cleaved amplified polymorphic sequence (CAPS) analysis revealed that mutations occurred at single or multiple target sites in all eight plants. These plants harbored various mutations consisting of single base insertions and/or deletions of a single or more than two bases at the target sites. Several mutations generated at target sites were inherited in the T1 progeny with or without T-DNA insertions. Mutant plants in the T1 generations exhibited a clear delay in petal senescence. These results confirm that CRISPR/Cas9 technology can efficiently induce mutations in a target I. nil gene and that EPH1 plays a crucial role in the regulation of petal senescence. The eph1 mutants obtained in this study will be a useful tool for the elucidation of regulatory mechanisms in petal senescence.},
}
@article {pmid29735370,
year = {2018},
author = {Nakayasu, M and Akiyama, R and Lee, HJ and Osakabe, K and Osakabe, Y and Watanabe, B and Sugimoto, Y and Umemoto, N and Saito, K and Muranaka, T and Mizutani, M},
title = {Generation of α-solanine-free hairy roots of potato by CRISPR/Cas9 mediated genome editing of the St16DOX gene.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {70-77},
doi = {10.1016/j.plaphy.2018.04.026},
pmid = {29735370},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Gene Knockout Techniques/methods ; Genes, Plant/*genetics ; Plant Roots/*genetics/metabolism ; Plants, Genetically Modified/genetics/metabolism ; Sequence Analysis, DNA ; Solanine/*metabolism ; Solanum tuberosum/*genetics/metabolism ; Steroid 16-alpha-Hydroxylase/*genetics/metabolism ; },
abstract = {Potato (Solanum tuberosum) is a major food crop, while the most tissues of potato accumulates steroidal glycoalkaloids (SGAs) α-solanine and α-chaconine. Since SGAs confer a bitter taste on human and show the toxicity against various organisms, reducing the SGA content in the tubers is requisite for potato breeding. However, generation of SGA-free potato has not been achieved yet, although silencing of several SGA biosynthetic genes led a decrease in SGAs. Here, we show that the knockout of St16DOX encoding a steroid 16α-hydroxylase in SGA biosynthesis causes the complete abolition of the SGA accumulation in potato hairy roots. Nine candidate guide RNA (gRNA) target sequences were selected from St16DOX by in silico analysis, and the two or three gRNAs were introduced into a CRISPR/Cas9 vector designated as pMgP237-2A-GFP that can express multiplex gRNAs based on the pre-tRNA processing system. To establish rapid screening of the candidate gRNAs that can efficiently mutate the St16DOX gene, we used a potato hairy root culture system for the introduction of the pMgP237 vectors. Among the transgenic hairy roots, two independent lines showed no detectable SGAs but accumulated the glycosides of 22,26-dihydroxycholesterol, which is the substrate of St16DOX. Analysis of the two lines with sequencing exhibited the mutated sequences of St16DOX with no wild-type sequences. Thus, generation of SGA-free hairy roots of tetraploid potato was achieved by the combination of the hairy root culture and the pMgP237-2A-GFP vector. This experimental system is useful to evaluate the efficacy of candidate gRNA target sequences in the short-term.},
}
@article {pmid29735369,
year = {2018},
author = {Abe, K and Araki, E and Suzuki, Y and Toki, S and Saika, H},
title = {Production of high oleic/low linoleic rice by genome editing.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {58-62},
doi = {10.1016/j.plaphy.2018.04.033},
pmid = {29735369},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/genetics ; Fatty Acid Desaturases/genetics/metabolism ; Fatty Acids/metabolism ; Gene Editing/methods ; Gene Knockout Techniques/methods ; Linoleic Acid/*biosynthesis/genetics ; Metabolic Engineering/methods ; Oleic Acid/*biosynthesis/genetics ; Oryza/*genetics/metabolism ; Plants, Genetically Modified/genetics/metabolism ; },
abstract = {Rice bran oil (RBO) contains many valuable healthy constituents, including oleic acid. Improvement of the fatty acid composition in RBO, including an increase in the content of oleic acid, which helps suppress lifestyle disease, would increase health benefits. The enzyme fatty acid desaturase 2 (FAD2) catalyzes the conversion of oleic acid to linoleic acid in plants, and FAD2 mutants exhibit altered oleic and linoleic acid content in many crops. There are three functional FAD2 genes in the genome of rice (Oryza sativa L.), and, of these, expression of the OsFAD2-1 gene is highest in rice seeds. In order to produce high oleic/low linoleic RBO, we attempted to disrupt the OsFAD2-1 gene by CRISPR/Cas9-mediated targeted mutagenesis. We succeeded in the production of homozygous OsFAD2-1 knockout rice plants. The content of oleic acid increased to more than twice that of wild type, and, surprisingly, linoleic acid, a catabolite of oleic acid by FAD2, decreased dramatically to undetectable levels in fad2-1 mutant brown rice seeds. In this study, by genome editing based on genome information, we succeeded in the production of rice whose fatty acid composition is greatly improved. We suggest that CRISPR/Cas9-mediated mutagenesis of a major gene that shows dominant expression in the target tissue could be a powerful tool to improve target traits in a tissue-specific manner.},
}
@article {pmid29729131,
year = {2018},
author = {Schwartz, C and Curtis, N and Löbs, AK and Wheeldon, I},
title = {Multiplexed CRISPR Activation of Cryptic Sugar Metabolism Enables Yarrowia Lipolytica Growth on Cellobiose.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700584},
doi = {10.1002/biot.201700584},
pmid = {29729131},
issn = {1860-7314},
support = {NSF CBET 1706545//National Science Foundation/ ; },
mesh = {Bacterial Proteins/genetics/metabolism ; CRISPR-Cas Systems/*genetics ; Cellobiose/*metabolism ; Escherichia coli/genetics ; Metabolic Engineering/*methods ; Promoter Regions, Genetic/genetics ; Recombinant Proteins/genetics/metabolism ; Synthetic Biology/methods ; *Yarrowia/genetics/metabolism ; beta-Glucosidase/genetics ; },
abstract = {The yeast Yarrowia lipolytica has been widely studied for its ability to synthesize and accumulate intracellular lipids to high levels. Recent studies have identified native genes that enable growth on biomass-derived sugars, but these genes are not sufficiently expressed to facilitate robust metabolism. In this work, a CRISPR-dCas9 activation (CRISPRa) system in Y. lipolytica is developed and is used it to activate native β-glucosidase expression to support growth on cellobiose. A series of different transcriptional activators are compared for their effectiveness in Y. lipolytica, with the synthetic tripartite activator VPR yielding the highest activation. A VPR-dCas9 fusion is then targeted to various locations in a synthetic promoter driving hrGFP expression, and activation is achieved. Subsequently, the CRISPRa system is used to activate transcription of two different native β-glucosidase genes, facilitating enhanced growth on cellobiose as the sole carbon source. This work expands the synthetic biology toolbox for metabolic engineering in Y. lipolytica and demonstrates how the programmability of the CRISPR-Cas9 system can enable facile investigation of transcriptionally silent regions of the genome.},
}
@article {pmid29714047,
year = {2018},
author = {Jang, S and Jang, S and Jung, GY},
title = {Toward tunable dynamic repression using CRISPRi.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1800152},
doi = {10.1002/biot.201800152},
pmid = {29714047},
issn = {1860-7314},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Expression Regulation/*genetics ; Genetic Engineering/*methods ; Models, Genetic ; Promoter Regions, Genetic/*genetics ; RNA, Guide/genetics/metabolism ; },
abstract = {CRISPR interference (CRISPRi) is widely utilized for regulation of target gene expression by repressing transcription. Simple design rules for the single guide RNA (sgRNA) and multiplexity won this method immense popularity. However, quantitative control of the expression levels at varying degrees in a dynamic manner using CRISPRi has been regarded difficult. To deal with this limitation, Fontana et al. modulated the expression levels of the components of CRISPRi, the deactivated Cas9 (dCas9), and the sgRNAs, using various constitutive or inducible promoters (Fontana et al., Biotechnol. J. 2018, 13, 1800069). They found that the expression level of sgRNA is the key to controlling CRISPRi. Modulation of sgRNA expression levels enabled quantitative tuning of the CRISPRi-regulated gene expression level. This approach is expected to be easily applied to diverse applications owing to its simplicity compared to the conventional approaches that modified target sequence or changed the expression level of dCas9.},
}
@article {pmid29709514,
year = {2018},
author = {Kishi-Kaboshi, M and Aida, R and Sasaki, K},
title = {Genome engineering in ornamental plants: Current status and future prospects.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {47-52},
doi = {10.1016/j.plaphy.2018.03.015},
pmid = {29709514},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/genetics ; Forecasting ; Genetic Engineering/*methods/trends ; Genome, Plant/genetics ; Plant Breeding/methods ; Plants/*genetics ; Plants, Genetically Modified/genetics ; },
abstract = {Ornamental plants, like roses, carnations, and chrysanthemums, are economically important and are sold all over the world. In addition, numerous cut and garden flowers add colors to homes and gardens. Various strategies of plant breeding have been employed to improve traits of many ornamental plants. These approaches span from conventional techniques, such as crossbreeding and mutation breeding, to genetically modified plants. Recently, genome editing has become available as an efficient means for modifying traits in plant species. Genome editing technology is useful for genetic analysis and is poised to become a common breeding method for ornamental plants. In this review, we summarize the benefits and limitations of conventional breeding techniques and genome editing methods and discuss their future potential to accelerate the rate breeding programs in ornamental plants.},
}
@article {pmid29653762,
year = {2018},
author = {Kadam, US and Shelake, RM and Chavhan, RL and Suprasanna, P},
title = {Concerns regarding 'off-target' activity of genome editing endonucleases.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {22-30},
doi = {10.1016/j.plaphy.2018.03.027},
pmid = {29653762},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/genetics ; Endonucleases/*genetics ; *Gene Editing/methods ; Genetic Engineering/*adverse effects ; Genome, Plant/genetics ; Plants/genetics ; Transcription Activator-Like Effector Nucleases/genetics ; },
abstract = {Genome editing (GE) tools ensure targeted mutagenesis and sequence-specific modification in plants using a wide resource of customized endonucleases; namely, zinc-finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs), and the CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated protein) system. Among these, in recent times CRISPR/Cas9 has been widely used in functional genomics and plant genetic modification. A significant concern in the application of GE tools is the occurrence of 'off-target' activity and induced mutations, which may impede functional analysis and gene activity studies. Moreover, the 'off-target' activity results in either not reported or unknown, difficult to detect, produce non-quantifiable cellular signaling and physiological effects. In the past few years, several experimental methods have been developed to identify undesired mutations and to curtail 'off-target' cleavage. Improvement in target specificity and minimizing 'off-target' activity will offer better applications of GE technology in plant biology and crop improvement.},
}
@article {pmid29628199,
year = {2018},
author = {Abdelrahman, M and Al-Sadi, AM and Pour-Aboughadareh, A and Burritt, DJ and Tran, LP},
title = {Genome editing using CRISPR/Cas9-targeted mutagenesis: An opportunity for yield improvements of crop plants grown under environmental stresses.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {31-36},
doi = {10.1016/j.plaphy.2018.03.012},
pmid = {29628199},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/*genetics ; Crops, Agricultural/*genetics/growth &amp; development ; Disease Resistance/genetics ; Gene Editing/*methods ; Gene Targeting/*methods ; Plant Diseases/genetics ; Plants, Genetically Modified/genetics/growth &amp; development ; Stress, Physiological/genetics ; },
abstract = {Developing more crops able to sustainably produce high yields when grown under biotic/abiotic stresses is an important goal, if crop production and food security are to be guaranteed in the face of ever-increasing human population and unpredictable global climatic conditions. However, conventional crop improvement, through random mutagenesis or genetic recombination, is time-consuming and cannot keep pace with increasing food demands. Targeted genome editing (GE) technologies, especially clustered regularly interspaced short palindromic repeats (CRISPR)/(CRISPR)-associated protein 9 (Cas9), have great potential to aid in the breeding of crops that are able to produce high yields under conditions of biotic/abiotic stress. This is due to their high efficiency, accuracy and low risk of off-target effects, compared with conventional random mutagenesis methods. The use of CRISPR/Cas9 system has grown very rapidly in recent years with numerous examples of targeted mutagenesis in crop plants, including gene knockouts, modifications, and the activation and repression of target genes. The potential of the GE approach for crop improvement has been clearly demonstrated. However, the regulation and social acceptance of GE crops still remain a challenge. In this review, we evaluate the recent applications of the CRISPR/Cas9-mediated GE, as a means to produce crop plants with greater resilience to the stressors they encounter when grown under increasing stressful environmental conditions.},
}
@article {pmid29575650,
year = {2018},
author = {Li, J and Zhang, X and Sun, Y and Zhang, J and Du, W and Guo, X and Li, S and Zhao, Y and Xia, L},
title = {Efficient allelic replacement in rice by gene editing: A case study of the NRT1.1B gene.},
journal = {Journal of integrative plant biology},
volume = {60},
number = {7},
pages = {536-540},
doi = {10.1111/jipb.12650},
pmid = {29575650},
issn = {1744-7909},
mesh = {*Alleles ; Base Sequence ; CRISPR-Cas Systems/genetics ; DNA Repair/genetics ; *Gene Editing ; *Genes, Plant ; Oryza/*genetics ; RNA, Guide/metabolism ; },
abstract = {Precise replacement of an existing allele in commercial cultivars with an elite allele is a major goal in crop breeding. A single nucleotide polymorphism in the NRT1.1B gene between japonica and indica rice is responsible for the improved nitrogen use efficiency in indica rice. Herein, we precisely replaced the japonica NRT1.1B allele with the indica allele, in just one generation, using CRISPR/Cas9 gene-editing technology. No additional selective pressure was needed to enrich the precise replacement events. This work demonstrates the feasibility of replacing any genes with elite alleles within one generation, greatly expanding our ability to improve agriculturally important traits.},
}
@article {pmid29523384,
year = {2018},
author = {Yamamoto, T and Kashojiya, S and Kamimura, S and Kameyama, T and Ariizumi, T and Ezura, H and Miura, K},
title = {Application and development of genome editing technologies to the Solanaceae plants.},
journal = {Plant physiology and biochemistry : PPB},
volume = {131},
number = {},
pages = {37-46},
doi = {10.1016/j.plaphy.2018.02.019},
pmid = {29523384},
issn = {1873-2690},
mesh = {CRISPR-Cas Systems/genetics ; Gene Editing/*methods ; Genome, Plant/genetics ; Lycopersicon esculentum/genetics ; Petunia/genetics ; Plants, Genetically Modified/genetics ; Solanaceae/*genetics ; Solanum tuberosum/genetics ; Tobacco/genetics ; Transcription Activator-Like Effector Nucleases/genetics ; Zinc Finger Nucleases/genetics ; },
abstract = {Genome editing technology using artificial nucleases, including zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and clustered regulatory interspaced short palindromic repeats (CRISPR)-Cas9, can mutagenize the target sites of genes of interest. This technology has been successfully applied in several crops, including the Solanaceae plants, such as tomato, potato, tobacco, and petunia. Among the three nucleases, CRISPR-Cas9 is the best for breeding, crop improvement, and the functional analysis of genes of interest, because of its simplicity and high efficiency. Although the technology is useful for reverse genetics, its use in plants is limited due to a lack of regeneration protocols and sequence information. In this review, the present status of genome editing technology in Solanaceae plants is described, and techniques that may improve genome editing technologies are discussed.},
}
@article {pmid29377615,
year = {2018},
author = {Holkenbrink, C and Dam, MI and Kildegaard, KR and Beder, J and Dahlin, J and Doménech Belda, D and Borodina, I},
title = {EasyCloneYALI: CRISPR/Cas9-Based Synthetic Toolbox for Engineering of the Yeast Yarrowia lipolytica.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700543},
doi = {10.1002/biot.201700543},
pmid = {29377615},
issn = {1860-7314},
support = {NNF15OC0016592//Novo Nordisk Foundation/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Cloning, Molecular/*methods ; Escherichia coli/genetics ; Gene Editing/*methods ; Metabolic Engineering/*methods ; *Yarrowia/genetics/metabolism ; },
abstract = {The oleaginous yeast Yarrowia lipolytica is an emerging host for production of fatty acid-derived chemicals. To enable rapid iterative metabolic engineering of this yeast, there is a need for well-characterized genetic parts and convenient and reliable methods for their incorporation into yeast. Here, the EasyCloneYALI genetic toolbox, which allows streamlined strain construction with high genome editing efficiencies in Y. lipolytica via the CRISPR/Cas9 technology is presented. The toolbox allows marker-free integration of gene expression vectors into characterized genome sites as well as marker-free deletion of genes with the help of CRISPR/Cas9. Genome editing efficiencies above 80% were achieved with transformation protocols using non-replicating DNA repair fragments (such as DNA oligos). Furthermore, the toolbox includes a set of integrative gene expression vectors with prototrophic markers conferring resistance to hygromycin and nourseothricin.},
}
@article {pmid30340417,
year = {2018},
author = {Van Houdt, R and Provoost, A and Van Assche, A and Leys, N and Lievens, B and Mijnendonckx, K and Monsieurs, P},
title = {Cupriavidus metallidurans Strains with Different Mobilomes and from Distinct Environments Have Comparable Phenomes.},
journal = {Genes},
volume = {9},
number = {10},
pages = {},
doi = {10.3390/genes9100507},
pmid = {30340417},
issn = {2073-4425},
support = {C90356//Federaal Wetenschapsbeleid/ ; },
abstract = {Cupriavidus metallidurans has been mostly studied because of its resistance to numerous heavy metals and is increasingly being recovered from other environments not typified by metal contamination. They host a large and diverse mobile gene pool, next to their native megaplasmids. Here, we used comparative genomics and global metabolic comparison to assess the impact of the mobilome on growth capabilities, nutrient utilization, and sensitivity to chemicals of type strain CH34 and three isolates (NA1, NA4 and H1130). The latter were isolated from water sources aboard the International Space Station (NA1 and NA4) and from an invasive human infection (H1130). The mobilome was expanded as prophages were predicted in NA4 and H1130, and a genomic island putatively involved in abietane diterpenoids metabolism was identified in H1130. An active CRISPR-Cas system was identified in strain NA4, providing immunity to a plasmid that integrated in CH34 and NA1. No correlation between the mobilome and isolation environment was found. In addition, our comparison indicated that the metal resistance determinants and properties are conserved among these strains and thus maintained in these environments. Furthermore, all strains were highly resistant to a wide variety of chemicals, much broader than metals. Only minor differences were observed in the phenomes (measured by phenotype microarrays), despite the large difference in mobilomes and the variable (shared by two or three strains) and strain-specific genomes.},
}
@article {pmid30338908,
year = {2018},
author = {Zhou, L and Peng, R and Zhang, R and Li, J},
title = {The applications of CRISPR/Cas system in molecular detection.},
journal = {Journal of cellular and molecular medicine},
volume = {},
number = {},
pages = {},
doi = {10.1111/jcmm.13925},
pmid = {30338908},
issn = {1582-4934},
support = {81871721//National Natural Science Foundation of China/ ; 81772273//National Natural Science Foundation of China/ ; 7174345//Natural Science Foundation of Beijing Municipality/ ; BJ-2018-136//Beijing Hospital Nova Project/ ; },
abstract = {The Streptococcus pyogenes CRISPR/Cas system has found widespread applications as a gene-editing and regulatory tool for the simultaneous delivery of the Cas9 protein and guide RNAs into the cell, thus making the recognition of specific DNA sequences possible. The recent study that shows that Cas9 can also bind to and cleave RNA in an RNA-programmable manner is suggestive of potential utility of this system as a universal nucleic-acid recognition tool. To increase the signal intensity of the CRISPR/Cas system, a signal amplification technique has to be exploited appropriately; this requirement is also a challenge for the detection of DNA or RNA. Furthermore, the CRISPR/Cas system may be used to detect point mutations or single-nucleotide variants because of the specificity of the recognition between the target sequence and the CRISPR/Cas system. These lines of evidence make this technique capable of detecting pathogens during infection via analysis of their DNA or RNA. Thus, here we summarize applications of the CRISPR/Cas system to the recognition and detection of DNA and RNA molecules as well as the signal amplification. We also describe its potential ability to detect mutations and single-nucleotide variants. Finally, we sum up its applications to testing for pathogens and potential barriers for its implementation.},
}
@article {pmid30338024,
year = {2018},
author = {Parise, D and Parise, MTD and Viana, MVC and Muñoz-Bucio, AV and Cortés-Pérez, YA and Arellano-Reynoso, B and Díaz-Aparicio, E and Dorella, FA and Pereira, FL and Carvalho, AF and Figueiredo, HCP and Ghosh, P and Barh, D and Gomide, ACP and Azevedo, VAC},
title = {First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico.},
journal = {Standards in genomic sciences},
volume = {13},
number = {},
pages = {21},
doi = {10.1186/s40793-018-0325-z},
pmid = {30338024},
issn = {1944-3277},
abstract = {Corynebacterium pseudotuberculosis is a pathogenic bacterium which has been rapidly spreading all over the world, causing economic losses in the agricultural sector and sporadically infecting humans. Six C. pseudotuberculosis strains were isolated from goats, sheep, and horses with distinct abscess locations. For the first time, Mexican genomes of this bacterium were sequenced and studied in silico. All strains were sequenced using Ion Personal Genome Machine sequencer, assembled using Newbler and SPAdes software. The automatic genome annotation was done using the software RAST and in-house scripts for transference, followed by manual curation using Artemis software and BLAST against NCBI and UniProt databases. The six genomes are publicly available in NCBI database. The analysis of nucleotide sequence similarity and the generated phylogenetic tree led to the observation that the Mexican strains are more similar between strains from the same host, but the genetic structure is probably more influenced by transportation of animals between farms than host preference. Also, a putative drug target was predicted and in silico analysis of 46 strains showed two gene clusters capable of differentiating the biovars equi and ovis: Restriction Modification system and CRISPR-Cas cluster.},
}
@article {pmid30337455,
year = {2018},
author = {Harrington, LB and Burstein, D and Chen, JS and Paez-Espino, D and Ma, E and Witte, IP and Cofsky, JC and Kyrpides, NC and Banfield, JF and Doudna, JA},
title = {Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.},
journal = {Science (New York, N.Y.)},
volume = {},
number = {},
pages = {},
doi = {10.1126/science.aav4294},
pmid = {30337455},
issn = {1095-9203},
abstract = {CRISPR-Cas systems provide microbes with adaptive immunity to infectious nucleic acids and are widely employed as genome editing tools. These tools utilize RNA-guided Cas proteins whose large size (950-1400 amino acids) has been considered essential to their specific DNA- or RNA-targeting activities. Here we present a set of CRISPR-Cas systems from uncultivated archaea that contain Cas14, a family of exceptionally compact RNA-guided nucleases (400-700 amino acids). Despite their small size, Cas14 proteins are capable of targeted single-stranded DNA (ssDNA) cleavage without restrictive sequence requirements. Moreover, target recognition by Cas14 triggers non-specific cutting of ssDNA molecules, an activity that enables high-fidelity SNP genotyping (Cas14-DETECTR). Metagenomic data show that multiple CRISPR-Cas14 systems evolved independently and suggest a potential evolutionary origin of single-effector CRISPR-based adaptive immunity.},
}
@article {pmid30114543,
year = {2018},
author = {Mattei, TA},
title = {The CRISPR-Cas9 Genome Editing System: Not as Precise as Previously Believed.},
journal = {World neurosurgery},
volume = {118},
number = {},
pages = {377-378},
doi = {10.1016/j.wneu.2018.08.042},
pmid = {30114543},
issn = {1878-8769},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Editing/*methods/*standards ; Humans ; Reproducibility of Results ; },
}
@article {pmid29694447,
year = {2018},
author = {Mucha, O and Podkalicka, P and Czarnek, M and Biela, A and Mieczkowski, M and Kachamakova-Trojanowska, N and Stepniewski, J and Jozkowicz, A and Dulak, J and Loboda, A},
title = {Pharmacological versus genetic inhibition of heme oxygenase-1 - the comparison of metalloporphyrins, shRNA and CRISPR/Cas9 system.},
journal = {Acta biochimica Polonica},
volume = {65},
number = {2},
pages = {277-286},
doi = {10.18388/abp.2017_2542},
pmid = {29694447},
issn = {1734-154X},
mesh = {*CRISPR-Cas Systems/genetics ; Enzyme Inhibitors ; Gene Silencing ; Genetic Techniques/standards ; HEK293 Cells ; Heme Oxygenase-1/*antagonists &amp; inhibitors ; Humans ; Metalloporphyrins/pharmacology ; Methods ; RNA, Small Interfering ; },
abstract = {Inhibition of heme oxygenase-1 (HO-1, encoded by HMOX1), a cytoprotective, anti-apoptotic and anti-inflammatory enzyme, may serve as a valuable therapy in various pathophysiological processes, including tumorigenesis. We compared the effect of chemical inhibitors - metalloporphyrins, with genetic tools - shRNA and CRISPR/Cas9 systems, to knock-down (KD)/knock-out (KO) HO-1 expression/activity. 293T cells were incubated with metalloporphyrins, tin and zinc protoporphyrins (SnPPIX and ZnPPIX, respectively) or were either transduced with lentiviral vectors encoding different shRNA sequences against HO-1 or were modified by CRISPR/Cas9 system targeting HMOX1. Metalloporphyrins decreased HO activity but concomitantly strongly induced HO-1 mRNA and protein in 293T cells. On the other hand, only slight basal HO-1 inhibition in shRNA KD 293T cell lines was confirmed on mRNA and protein level with no significant effect on enzyme activity. Nevertheless, silencing effect was much stronger when CRISPR/Cas9-mediated knock-out was performed. Most of the clones harboring mutations within HMOX1 locus did not express HO-1 protein and failed to increase bilirubin concentration after hemin stimulation. Furthermore, CRISPR/Cas9-mediated HO-1 depletion decreased 293T viability, growth, clonogenic potential and increased sensitivity to H2O2 treatment. In summary, we have shown that not all technologies can be used for inhibition of HO activity in vitro with the same efficiency. In our hands, the most potent and comprehensible results can be obtained using genetic tools, especially CRISPR/Cas9 approach.},
}
@article {pmid30329221,
year = {2018},
author = {Gong, T and Tang, B and Zhou, X and Zeng, J and Lu, M and Guo, X and Peng, X and Lei, L and Gong, B and Li, Y},
title = {Genome editing in Streptococcus mutans through self-targeting CRISPR arrays.},
journal = {Molecular oral microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/omi.12247},
pmid = {30329221},
issn = {2041-1014},
abstract = {Streptococcus mutans is the primary aetiological agent of human dental caries. Its major virulence factors, glucosyltransferases (Gtfs), utilize sucrose to synthesize extracellular polysaccharides (EPS), leading to the formation of dental plaque biofilm. The current study was designed to develop a novel self-targeting gene editing technology that targeted gtfs to inhibit biofilms formation. The CRISPR-Cas system (i.e., clustered regularly interspaced short palindromic repeat, with CRISPR-associated proteins) provides sequence-specific protection against foreign genetic materials in archaea and bacteria,and has been widely developed for genomic engineering. The first aim of this study was to test whether components of the CRISPR-Cas9 system from S. mutans UA159 is necessary to defend against foreign DNA. The data showed that a suitable PAM site, tracrRNA, Cas9, and RNase III are indispensable elements to perform normal function of S. mutans CRISPR-Cas9 system. Based on these results, we designed self-targeting CRISPR arrays (containing spacer sequences identifying with gtfB) and cloned them onto plasmids. Afterwards, we transformed the plasmids and editing templates into UA159 (self-targeting) to acquire desired mutants. Our data showed that this technology performed well and was able to successfully edit gtfB or gtfBgtfC genes. This resulted in high reduction of EPS synthesis and was able to breakdown biofilm formation, which is also a promising tool for dental clinics in order to prevent the formation of S. mutans biofilms in the future. This article is protected by copyright. All rights reserved.},
}
@article {pmid30323295,
year = {2018},
author = {Dong, C and Fontana, J and Patel, A and Carothers, JM and Zalatan, JG},
title = {Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4318},
doi = {10.1038/s41467-018-06909-4},
pmid = {30323295},
issn = {2041-1723},
abstract = {In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.},
}
@article {pmid30319822,
year = {2018},
author = {Lone, BA and Karna, SKL and Ahmad, F and Shahi, N and Pokharel, YR},
title = {CRISPR/Cas9 System: A Bacterial Tailor for Genomic Engineering.},
journal = {Genetics research international},
volume = {2018},
number = {},
pages = {3797214},
doi = {10.1155/2018/3797214},
pmid = {30319822},
issn = {2090-3154},
abstract = {Microbes use diverse defence strategies that allow them to withstand exposure to a variety of genome invaders such as bacteriophages and plasmids. One such defence strategy is the use of RNA guided endonuclease called CRISPR-associated (Cas) 9 protein. The Cas9 protein, derived from type II CRISPR/Cas system, has been adapted as a versatile tool for genome targeting and engineering due to its simplicity and high efficiency over the earlier tools such as ZFNs and TALENs. With recent advancements, CRISPR/Cas9 technology has emerged as a revolutionary tool for modulating the genome in living cells and inspires innovative translational applications in different fields. In this paper we review the developments and its potential uses in the CRISPR/Cas9 technology as well as recent advancements in genome engineering using CRISPR/Cas9.},
}
@article {pmid30317145,
year = {2018},
author = {Bron, PA and Marcelli, B and Mulder, J and van der Els, S and Morawska, LP and Kuipers, OP and Kok, J and Kleerebezem, M},
title = {Renaissance of traditional DNA transfer strategies for improvement of industrial lactic acid bacteria.},
journal = {Current opinion in biotechnology},
volume = {56},
number = {},
pages = {61-68},
doi = {10.1016/j.copbio.2018.09.004},
pmid = {30317145},
issn = {1879-0429},
abstract = {The ever-expanding genomic insight in natural diversity of lactic acid bacteria (LAB) has revived the industrial interest in traditional and natural genetic mobilization methodologies. Here, we review recent advances in horizontal gene transfer processes in LAB, including natural competence, conjugation, and phage transduction. In addition, we envision the possibilities for industrial strain improvement arising from the recent discoveries of molecular exchanges between bacteria through nanotubes and extracellular vesicles, as well as the constantly expanding genome editing possibilities using the CRISPR-Cas technology.},
}
@article {pmid30297904,
year = {2018},
author = {Villiger, L and Grisch-Chan, HM and Lindsay, H and Ringnalda, F and Pogliano, CB and Allegri, G and Fingerhut, R and Häberle, J and Matos, J and Robinson, MD and Thöny, B and Schwank, G},
title = {Treatment of a metabolic liver disease by in vivo genome base editing in adult mice.},
journal = {Nature medicine},
volume = {24},
number = {10},
pages = {1519-1525},
doi = {10.1038/s41591-018-0209-1},
pmid = {30297904},
issn = {1546-170X},
abstract = {CRISPR-Cas-based genome editing holds great promise for targeting genetic disorders, including inborn errors of hepatocyte metabolism. Precise correction of disease-causing mutations in adult tissues in vivo, however, is challenging. It requires repair of Cas9-induced double-stranded DNA (dsDNA) breaks by homology-directed mechanisms, which are highly inefficient in nondividing cells. Here we corrected the disease phenotype of adult phenylalanine hydroxylase (Pah)enu2 mice, a model for the human autosomal recessive liver disease phenylketonuria (PKU)1, using recently developed CRISPR-Cas-associated base editors2-4. These systems enable conversion of C∙G to T∙A base pairs and vice versa, independent of dsDNA break formation and homology-directed repair (HDR). We engineered and validated an intein-split base editor, which allows splitting of the fusion protein into two parts, thereby circumventing the limited cargo capacity of adeno-associated virus (AAV) vectors. Intravenous injection of AAV-base editor systems resulted in Pahenu2 gene correction rates that restored physiological blood phenylalanine (L-Phe) levels below 120 µmol/l [5]. We observed mRNA correction rates up to 63%, restoration of phenylalanine hydroxylase (PAH) enzyme activity, and reversion of the light fur phenotype in Pahenu2 mice. Our findings suggest that targeting genetic diseases in vivo using AAV-mediated delivery of base-editing agents is feasible, demonstrating potential for therapeutic application.},
}
@article {pmid30295654,
year = {2018},
author = {Du, L and Zhou, A and Sohr, A and Roy, S},
title = {An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {139},
pages = {},
doi = {10.3791/58268},
pmid = {30295654},
issn = {1940-087X},
support = {R00 HL114867/HL/NHLBI NIH HHS/United States ; R35 GM124878/GM/NIGMS NIH HHS/United States ; },
abstract = {Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a &quot;Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated&quot; (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.},
}
@article {pmid30295162,
year = {2018},
author = {Ali, Q},
title = {Non-conventional therapeutic technique to replace CRISPR bacteria from biofilm by inducible lysogen.},
journal = {Journal of biological dynamics},
volume = {},
number = {},
pages = {1-28},
doi = {10.1080/17513758.2018.1527958},
pmid = {30295162},
issn = {1751-3766},
abstract = {Bacteriophage can be an effective means of regulating bacterial populations when conditions allow phage invasion of bacterial colonies. Phage can either infect and lyse a host cell, or insert their DNA into the host cell genome; the latter process is called lysogeny. The clustered regularly interspaced short palindromic repeat (CRISPR) system, linked with CRISPR-associated (Cas) genes, is a regulatory system present in a variety of bacteria which confers immunity against bacteriophage. Studies of the group behaviour of bacteria with CRISPR/Cas systems have provided evidence that CRISPR in lysogenized bacteria can cause an inability to form biofilm. This allows CRISPR-immune bacteria in biofilms to effectively resist phage therapy. Our recent work has described a potential therapeutic technique to eradicate CRISPR-immune bacteria from a biofilm by a continuous influx of lysogens carrying an identical phage sequence. However, this model predicted that the CRISPR-immune population could persist for long times before eradication. Our current focus is on the use of diverse lysogens against CRISPR-capable bacterial populations. The goal of this work is to find a suitable strategy which can eradicate bacteria with a CRISPR system through the influx of finite amounts of distinct lysogens over fixed intervals.},
}
@article {pmid30290202,
year = {2018},
author = {Chen, S and Liu, H and Liang, W and Hong, L and Zhang, B and Huang, L and Guo, X and Duan, G},
title = {Insert sequences of CRISPR/Cas system regulate horizontal antibiotic gene transfer in Shigella.},
journal = {International journal of antimicrobial agents},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.ijantimicag.2018.09.020},
pmid = {30290202},
issn = {1872-7913},
abstract = {Multidrug resistances Shigella is an enormous threat of public health. The resistance genes always located in plasmids, phages and integrons, which get into bacteria cells by horizontal gene transfer (HGT). CRISPR-Cas systems are adaptive immune systems in bacteria that are beneficial to resist phage infection and other mobile genetic elements. But this can come at a cost of inhibiting the acquisition of other beneficial genes through HGT. Here, we investigate how Shigella regulate the activity of the CRISPR/Cas system spontaneously, when it wants acquire exogenous gene that is necessary for its survival. We found that IS elements were identified in cas genes, such as IS600 in cse2, ISSfl2 in cas6e, IS629 in cse1- cas3. The number of spacers in CRISPR/Cas which strain containing IS was fewer compare with none IS. Interestingly, fewer spacers were also found in multi-drug resistance Shigella strains. Furthermore, we have constructed the genetic transferred antibiotic resistant strain by resistance plasmid transfer, to detect the CRISPR/Cas system changes in this two group strains. We found that cse2 gene had a new IS elements (IS600) in the antibiotic-resistant strain. The bioinformatics analyses showed that the IS600 insert hotspots in the cse2 gene were the TGC-GGC gene motifs and the tertiary structure of the Cse2 protein was different with IS600 or not. IS600 could bring a 5-order of magnitude (105) decrease in the relative expression of cse2 gene. This study has significant implication for further revealing the mechanism underlying the CRISPR/Cas-mediated antibiotic resistance gene horizontal transfer in Shigella.},
}
@article {pmid30289378,
year = {2018},
author = {Tashkandi, M and Ali, Z and Aljedaani, F and Shami, A and Mahfouz, MM},
title = {Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato.},
journal = {Plant signaling &amp; behavior},
volume = {},
number = {},
pages = {1-7},
doi = {10.1080/15592324.2018.1525996},
pmid = {30289378},
issn = {1559-2324},
abstract = {CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.},
}
@article {pmid30285540,
year = {2018},
author = {Smith, CIE and Zain, R},
title = {Therapeutic Oligonucleotides: State of the Art.},
journal = {Annual review of pharmacology and toxicology},
volume = {},
number = {},
pages = {},
doi = {10.1146/annurev-pharmtox-010818-021050},
pmid = {30285540},
issn = {1545-4304},
abstract = {Oligonucleotides (ONs) can interfere with biomolecules representing the entire extended central dogma. Antisense gapmer, steric block, spliceswitching ONs, and short interfering RNA drugs have been successfully developed. Moreover, antagomirs (antimicroRNAs), microRNA mimics, aptamers, DNAdecoys, DNAzymes, synthetic guide strands for CRISPR/Cas, and innate immunity-stimulating ONs are all in clinical trials. DNAtargeting, triplex-forming ONs and strand-invading ONs have made their mark on drug development research, but not yet as medicines. Both design and synthetic nucleic acid chemistry are crucial for achieving biologically active ONs. The dominating modifications are phosphorothioate linkages, base methylation, and numerous 2'-substitutions in the furanose ring, such as 2'-fluoro, O-methyl, or methoxyethyl. Locked nucleic acid and constrained ethyl, a related variant, are bridged forms where the 2'-oxygen connects to the 4'-carbon in the sugar. Phosphorodiamidate morpholino oligomers, carrying a modified heterocyclic backbone ring, have also been commercialized. Delivery remains a major obstacle, but systemic administration and intrathecal infusion are used for treatment of the liver and brain, respectively. Expected final online publication date for the Annual Review of Pharmacology and Toxicology Volume 59 is January 6, 2019. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.},
}
@article {pmid30284045,
year = {2018},
author = {Majumdar, S and Terns, MP},
title = {CRISPR RNA-guided DNA cleavage by reconstituted Type I-A immune effector complexes.},
journal = {Extremophiles : life under extreme conditions},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00792-018-1057-0},
pmid = {30284045},
issn = {1433-4909},
support = {R35GM118160//National Institutes of Health/ ; },
abstract = {Diverse CRISPR-Cas immune systems protect archaea and bacteria from viruses and other mobile genetic elements. All CRISPR-Cas systems ultimately function by sequence-specific destruction of invading complementary nucleic acids. However, each CRISPR system uses compositionally distinct crRNP [CRISPR (cr) RNA/Cas protein] immune effector complexes to recognize and destroy invasive nucleic acids by unique molecular mechanisms. Previously, we found that Type I-A (Csa) effector crRNPs from Pyrococcus furiosus function in vivo to eliminate invader DNA. Here, we reconstituted functional Type I-A effector crRNPs in vitro with recombinant Csa proteins and synthetic crRNA and characterized properties of crRNP assembly, target DNA recognition and cleavage. Six proteins (Csa 4-1, Cas3″, Cas3', Cas5a, Csa2, Csa5) are essential for selective target DNA binding and cleavage. Native gel shift analysis and UV-induced RNA-protein crosslinking demonstrate that Cas5a and Csa2 directly interact with crRNA 5' tag and guide sequences, respectively. Mutational analysis revealed that Cas3″ is the effector nuclease of the complex. Together, our results indicate that DNA cleavage by Type I-A crRNPs requires crRNA-guided and protospacer adjacent motif-dependent target DNA binding to unwind double-stranded DNA and expose single strands for progressive ATP-dependent 3'-5' cleavage catalyzed by integral Cas3' helicase and Cas3″ nuclease crRNP components.},
}
@article {pmid30283411,
year = {2018},
author = {Terceti, MS and Vences, A and Matanza, XM and Dalsgaard, I and Pedersen, K and Osorio, CR},
title = {Molecular Epidemiology of Photobacterium damselae subsp. damselae Outbreaks in Marine Rainbow Trout Farms Reveals Extensive Horizontal Gene Transfer and High Genetic Diversity.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {2155},
doi = {10.3389/fmicb.2018.02155},
pmid = {30283411},
issn = {1664-302X},
abstract = {The marine bacterium Photobacterium damselae subsp. damselae is a pathogen for a variety of marine animals, as well as for humans, and is nowadays considered an emerging pathogen for fish of importance in marine aquaculture. Recent studies have suggested that outbreaks in fish farms are caused by multiclonal populations of this subspecies that exist in the environment. Here, we report the study of a collection of 31 strains isolated during the course of disease outbreaks in marine rainbow trout farms in Denmark in 1994, 1995, and 2006, respectively. A phylogenetic analysis based on the toxR gene sequence, and the screening of virulence-related genes uncovered a high genetic heterogeneity, even among strains isolated from the same fish farm at the same time. Moreover, comparative analysis of the whole genome sequences of four selected strains revealed a large number of differentially occurring genes, which included virulence genes, pPHDD1 plasmid, polysaccharide synthesis gene clusters, CRISPR-Cas systems and putative new mobile genetic elements. This study provides sound evidence that P. damselae subsp. damselae outbreaks in Danish rainbow trout farms were caused by multiclonal populations and that horizontal gene transfer constitutes a strong driving force in the generation of intraspecific diversity in this pathogen.},
}
@article {pmid30282704,
year = {2018},
author = {Hasan, MH and Davis, LE and Bollavarapu, RK and Mitra, D and Parmar, R and Tandon, R},
title = {Dynamin is required for efficient cytomegalovirus maturation and envelopment.},
journal = {Journal of virology},
volume = {},
number = {},
pages = {},
doi = {10.1128/JVI.01418-18},
pmid = {30282704},
issn = {1098-5514},
abstract = {Cytomegalovirus secondary envelopment occurs in a virus-induced cytoplasmic assembly compartment (vAC) generated via a drastic reorganization of the membranes of the secretory and endocytic systems. Dynamin is a eukaryotic GTPase that is implicated in membrane remodeling and endocytic membrane fission events; however, the role of dynamin in cellular trafficking of viruses beyond virus entry is only partially understood. Mouse embryonic fibroblasts (MEF) engineered to excise all three isoforms of dynamin were infected with mouse cytomegalovirus (MCMV-K181). Immediate early (IE1; m123) viral protein was detected in these triple dynamin knockout (TKO) cells as well as in mock-induced parental MEF at early times post infection although levels were reduced in TKO cells, indicating that virus entry was affected but not eliminated. Levels of IE1 protein and another viral early protein (m04) were normalized by 48 hours post infection; however, late protein (m55; gB) expression was reduced in infected TKO cells compared to parental MEF. Ultrastructural analysis revealed intact stages of nuclear virus maturation in both cases with equivalent numbers of nucleocapsids containing packaged viral DNA (C-capsids) indicating successful viral DNA replication, capsid assembly and genome packaging. Most importantly, severe defects in virus envelopment were visualized in TKO cells but not in parental cells. Dynamin inhibitor (dynasore) treated MEF showed a phenotype similar to TKO cells upon MCMV infection confirming the role of dynamin in late maturation processes. In summary, dynamin-mediated endocytic pathways are critical for the completion of cytoplasmic stages of cytomegalovirus maturation.ImportanceViruses are known to exploit specific cellular functions at different stages of their life cycle in order to replicate, avoid immune recognition by the host and to establish a successful infection. Cytomegalovirus (CMV) infected cells are characterized by a prominent cytoplasmic inclusion (virus assembly compartment; vAC) that is the site of virus maturation and envelopment. While endocytic membranes are known to be the functional components of vAC, knowledge of specific endocytic pathways implicated in CMV maturation and envelopment is lacking. Here we show that dynamin, which is an integral part of host endocytic machinery, is largely dispensable for early stages of CMV infection but is required at a late stage of CMV maturation. Studies on dynamin function in CMV infection will help us understand the host-virus interaction pathways amenable to targeting by conventional small molecules as well as by newer generation nucleotide-based therapeutics (e.g. siRNA, CRISPR/CAS gRNA, etc.).},
}
@article {pmid30278987,
year = {2018},
author = {Rui, Y and Wilson, DR and Green, JJ},
title = {Non-Viral Delivery To Enable Genome Editing.},
journal = {Trends in biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tibtech.2018.08.010},
pmid = {30278987},
issn = {1879-3096},
abstract = {Genome-editing technologies such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENS), and the clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein system have revolutionized biological research. Each biotechnology consists of a DNA-binding protein that can be programmed to recognize and initiate double-strand breaks (DSBs) for site-specific gene modification. These technologies have the potential to be harnessed to cure diseases caused by aberrant gene expression. To be successful therapeutically, their functionality depends on their safe and efficient delivery into the cell nucleus. This review discusses the challenges in the delivery of genome-editing tools, and highlights recent innovations in non-viral delivery that have potential to overcome these limitations and advance the translation of genome editing towards patient care.},
}
@article {pmid30277308,
year = {2018},
author = {Buerger, P and Weynberg, KD and Wood-Charlson, EM and Sato, Y and Willis, BL and van Oppen, MJH},
title = {Novel T4 bacteriophages associated with black band disease in corals.},
journal = {Environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1462-2920.14432},
pmid = {30277308},
issn = {1462-2920},
abstract = {Research into causative agents underlying coral disease have focused primarily on bacteria, whereas potential roles of viruses have been largely unaddressed. Bacteriophages may contribute to diseases through the lysogenic introduction of virulence genes into bacteria, or prevent diseases through lysis of bacterial pathogens. To identify candidate phages that may influence the pathogenicity of black band disease (BBD), communities of bacteria (16S rRNA) and T4-bacteriophages (gp23) were simultaneously profiled with amplicon sequencing among BBD-lesions and healthy-coral-tissue of Montipora hispida, as well as seawater (study site: the central Great Barrier Reef). Bacterial community compositions were distinct among BBD-lesions, healthy-coral-tissue, and seawater samples, as observed in previous studies. Surprisingly, however, viral beta diversities based on both operational taxonomic unit (OTU)-compositions and overall viral community compositions did not differ statistically between the BBD-lesions and healthy-coral-tissue. Nonetheless, relative abundances of three bacteriophage OTUs, affiliated to Cyanophage PRSM6 and Prochlorococcus phages P-SSM2, were significantly higher in BBD-lesions than in healthy tissue. In addition, 32 gp23 OTUs showed nucleotide similarities to existing CRISPR-Cas spacers in BBD associated cyanobacterial genomes. These OTUs associated with our BBD samples suggest the presence of bacteriophages that infect members of the cyanobacteria-dominated BBD community, and thus have potential roles in BBD pathogenicity. This article is protected by copyright. All rights reserved.},
}
@article {pmid30269229,
year = {2018},
author = {Hong, KQ and Liu, DY and Chen, T and Wang, ZW},
title = {Recent advances in CRISPR/Cas9 mediated genome editing in Bacillus subtilis.},
journal = {World journal of microbiology &amp; biotechnology},
volume = {34},
number = {10},
pages = {153},
doi = {10.1007/s11274-018-2537-1},
pmid = {30269229},
issn = {1573-0972},
support = {21576200//National Natural Science Foundation of China/ ; 21776209//National Natural Science Foundation of China/ ; 21621004//National Natural Science Foundation of China/ ; },
mesh = {Bacillus subtilis/*genetics ; Bacterial Proteins/genetics ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Endonucleases ; Gene Editing/*methods ; Genes, Bacterial/genetics ; Molecular Biology/methods ; },
abstract = {Genome editing using engineered nucleases has rapidly transformed from a niche technology to a mainstream method used in various host cells. Its widespread adoption has been largely developed by the emergence of the clustered regularly interspaced short palindromic repeats (CRISPR) system, which uses an easily customizable specificity RNA-guided DNA endonuclease, such as Cas9. Recently, CRISPR/Cas9 mediated genome engineering has been widely applied to model organisms, including Bacillus subtilis, enabling facile, rapid high-fidelity modification of endogenous native genes. Here, we reviewed the recent progress in B. subtilis gene editing using CRISPR/Cas9 based tools, and highlighted state-of-the-art strategies for design of CRISPR/Cas9 system. Finally, future perspectives on the use of CRISPR/Cas9 genome engineering for sequence-specific genome editing in B. subtilis are provided.},
}
@article {pmid30266728,
year = {2018},
author = {Morovic, W and Roos, P and Zabel, B and Hidalgo-Cantabrana, C and Kiefer, A and Barrangou, R},
title = {Transcriptional and functional analysis of Bifidobacterium animalis subsp. lactis exposure to tetracycline.},
journal = {Applied and environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1128/AEM.01999-18},
pmid = {30266728},
issn = {1098-5336},
abstract = {Commercial probiotic bacteria must be tested for acquired antibiotic resistance elements to avoid potential transfer to pathogens. The European Food Safety Authority recommends testing resistance using microdilution culture techniques previously used to establish inhibitory thresholds for the Bifidobacterium genus. Many Bifidobacterium animalis subsp. lactis strains exhibit increased resistance to tetracycline, historically attributed to the ribosomal protection gene tet(W). However, some strains that harbor genetically identical tet(W) genes show various inhibition levels suggesting that other genetic elements also contribute to observed differences. Here, we adapted several molecular assays to confirm the inhibition of B. animalis subsp. lactis strains Bl-04 and HN019, and employed RNA-seq to assess the transcriptional differences related to genomic polymorphisms. We detected specific stress responses to the antibiotic by correlating ATP concentration to viable genome copies from droplet digital PCR, and found that the bacteria were still metabolically active in high drug concentrations. Transcriptional analyses revealed that several polymorphic regions, particularly a novel multi-drug efflux transporter, were differentially expressed between the strains in each experimental condition, likely having phenotypic effects. We also found that the tet(W) gene was up-regulated only during sub-inhibitory tetracycline concentrations, while two novel tetracycline resistance genes were up-regulated at high concentrations. Furthermore, many genes involved in amino acid metabolism and transporter function were up-regulated while genes for complex carbohydrate utilization, protein metabolism, and CRISPR-Cas systems were down-regulated. These results provide high-throughput means for assessing antibiotic resistance and determine the genetic network that contributes to the global tetracycline response between two highly related probiotic strains.IMPORTANCEBifidobacterium animalis subsp. lactis is widely used in human food and dietary supplements. Although well documented to be safe, B. animalis subsp. lactis strains must not contain transferable antibiotic resistance elements. Many B. animalis subsp. lactis strains have different resistance measurements despite being genetically similar, and the reasons for this are not well understood. In the current study, we sought to examine how genomic differences between two closely related industrial B. animalis subsp. lactis strains contribute to different resistance levels. This will lead to a better understanding of resistance, identify future targets for analysis of transferability, and expand our understanding of tetracycline resistance in bacteria.},
}
@article {pmid30261908,
year = {2018},
author = {Dank, A and Smid, EJ and Notebaart, RA},
title = {CRISPR-Cas genome engineering of esterase activity in Saccharomyces cerevisiae steers aroma formation.},
journal = {BMC research notes},
volume = {11},
number = {1},
pages = {682},
doi = {10.1186/s13104-018-3788-5},
pmid = {30261908},
issn = {1756-0500},
abstract = {OBJECTIVE: Saccharomyces cerevisiae is used worldwide for the production of ale-type beers. This yeast is responsible for the production of the characteristic fruity aroma compounds. Esters constitute an important group of aroma active secondary metabolites produced by S. cerevisiae. Previous work suggests that esterase activity, which results in ester degradation, may be the key factor determining the abundance of fruity aroma compounds. Here, we test this hypothesis by deletion of two S. cerevisiae esterases, IAH1 and TIP1, using CRISPR-Cas9 genome editing and by studying the effect of these deletions on esterase activity and extracellular ester pools.<br><br>RESULTS: Saccharomyces cerevisiae mutants were constructed lacking esterase IAH1 and/or TIP1 using CRISPR-Cas9 genome editing. Esterase activity using 5-(6)-carboxyfluorescein diacetate (cFDA) as substrate was found to be significantly lower for ΔIAH1 and ΔIAH1ΔTIP1 mutants compared to wild type (WT) activity (P < 0.05 and P < 0.001, respectively). As expected, we observed an increase in relative abundance of acetate and ethyl esters and an increase in ethyl esters in ΔIAH1 and ΔTIP1, respectively. Interestingly, the double gene disruption mutant ΔIAH1ΔTIP1 showed an aroma profile comparable to WT levels, suggesting the existence and activation of a complex regulatory mechanism to compensate multiple genomic alterations in aroma metabolism.},
}
@article {pmid30261168,
year = {2018},
author = {Hidalgo-Cantabrana, C and Goh, YJ and Barrangou, R},
title = {Characterization and Repurposing of Type I and Type II CRISPR-Cas Systems in Bacteria.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.09.013},
pmid = {30261168},
issn = {1089-8638},
abstract = {CRISPR-Cas systems constitute the adaptive immune system of bacteria and archaea, as a sequence-specific nucleic acid targeting defense mechanism. The sequence-specific recognition and cleavage of Cas effector complexes has been harnessed to developed CRISPR-based technologies and drive the genome editing revolution underway, due to their efficacy, efficiency, and ease of implementation in a broad range of organisms. CRISPR-based technologies offer a wide variety of opportunities in genome remodeling and transcriptional regulation, opening new avenues for therapeutic and biotechnological applications. To repurpose CRISPR-Cas systems for these applications, the various elements of the system need to be first identified and functionally characterized in their native host. Bioinformatic tools are first used to identify putative CRISPR arrays and their associated genes, followed by a comprehensive characterization of the CRISPR-Cas system, encompassing predictions for guide and target sequences. Subsequently, interference assays and transcriptomic analyses should be performed to probe the functionality of the CRISPR-Cas system. Once an endogenous CRISPR-Cas system is characterized as functional, they can be readily repurposed by delivering an engineered synthetic CRISPR array or a small RNA guide for targeted gene manipulation. Alternatively, developing a plasmid-based system for heterologous expression of the necessary CRISPR components can enable exploitation in other organisms. Altogether, there is a wide diversity of native CRISPR-Cas systems in many bacteria and most archaea that await functional characterization and repurposing for genome editing applications in prokaryotes.},
}
@article {pmid30260068,
year = {2018},
author = {Ebrahimi, S and Teimoori, A and Khanbabaei, H and Tabasi, M},
title = {Harnessing CRISPR/Cas 9 System for manipulation of DNA virus genome.},
journal = {Reviews in medical virology},
volume = {},
number = {},
pages = {e2009},
doi = {10.1002/rmv.2009},
pmid = {30260068},
issn = {1099-1654},
abstract = {The recent development of the Clustered Regularly Interspaced Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system, a genome editing system, has many potential applications in virology. The possibility of introducing site specific breaks has provided new possibilities to precisely manipulate viral genomics. Here, we provide diagrams to summarize the steps involved in the process. We also systematically review recent applications of the CRISPR/Cas9 system for manipulation of DNA virus genomics and discuss the therapeutic potential of the system to treat viral diseases.},
}
@article {pmid30258941,
year = {2018},
author = {Karlapudi, AP and T C, V and Tammineedi, J and Srirama, K and Kanumuri, L and Prabhakar Kodali, V},
title = {In silico sgRNA tool design for CRISPR control of quorum sensing in Acinetobacter species.},
journal = {Genes &amp; diseases},
volume = {5},
number = {2},
pages = {123-129},
doi = {10.1016/j.gendis.2018.03.004},
pmid = {30258941},
issn = {2352-3042},
abstract = {CRISPR genome editing utilizes Cas9 nuclease and single guide RNA (sgRNA), which directs the nuclease to a specific site in the genome and makes a double-stranded break (DSB). Design of sgRNA for CRISPR-Cas targeting, and to promote CRISPR adaptation, uses a regulatory mechanism that ensures maximum CRISPR-Cas9 system functions when a bacterial population is at highest risk of phage infection. Acinetobacter baumannii is the most regularly identified gram-negative bacterium infecting patients. Recent reports have demonstrated that the extent of diseases caused by A. baumannii is expanding and, in a few cases, now surpasses the quantity of infections caused by P. aeruginosa. Most Acinetobacter strains possess biofilm-forming ability, which plays a major role in virulence and drug resistance. Biofilm bacteria use quorum sensing, a cell-to-cell communication process, to activate gene expression. Many genes are involved in biofilm formation and the mechanism to disrupt the biofilm network is still not clearly understood. In this study, we performed in silico gene editing to exploit the AbaI gene, responsible for biofilm formation. The study explored different tools available for genome editing to create gene knockouts, selecting the A. baumannii AbaI gene as a target.},
}
@article {pmid30255296,
year = {2018},
author = {Adames, NR and Gallegos, JE and Peccoud, J},
title = {Yeast genetic interaction screens in the age of CRISPR/Cas.},
journal = {Current genetics},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00294-018-0887-8},
pmid = {30255296},
issn = {1432-0983},
support = {R01GM078989//National Institute of General Medical Sciences/ ; 1759900//Directorate for Biological Sciences/ ; 1832320//Directorate for Engineering/ ; },
abstract = {The ease of performing both forward and reverse genetics in Saccharomyces cerevisiae, along with its stable haploid state and short generation times, has made this budding yeast the consummate model eukaryote for genetics. The major advantage of using budding yeast for reverse genetics is this organism's highly efficient homology-directed repair, allowing for precise genome editing simply by introducing DNA with homology to the chromosomal target. Although plasmid- and PCR-based genome editing tools are quite efficient, they depend on rare spontaneous DNA breaks near the target sequence. Consequently, they can generate only one genomic edit at a time, and the edit must be associated with a selectable marker. However, CRISPR/Cas technology is efficient enough to permit markerless and multiplexed edits in a single step. These features have made CRISPR/Cas popular for yeast strain engineering in synthetic biology and metabolic engineering applications, but it has not been widely employed for genetic screens. In this review, we critically examine different methods to generate multi-mutant strains in systematic genetic interaction screens and discuss the potential of CRISPR/Cas to supplement or improve on these methods.},
}
@article {pmid30251378,
year = {2018},
author = {da Silva Xavier, A and de Almeida, JCF and de Melo, AG and Rousseau, GM and Tremblay, DM and de Rezende, RR and Moineau, S and Alfenas-Zerbini, P},
title = {Characterization of CRISPR-Cas systems in the Ralstonia solanacearum Species Complex.},
journal = {Molecular plant pathology},
volume = {},
number = {},
pages = {},
doi = {10.1111/mpp.12750},
pmid = {30251378},
issn = {1364-3703},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPRs) is an array of short DNA repeat sequences separated by unique spacer sequences that is flanked by associated (Cas) genes. CRISPR-Cas systems are found in the genome of several microbes and they can act as an adaptive immune mechanism against invading foreign nucleic acids such as phage genomes. Here, we studied the CRISPR-Cas systems in plant pathogenic bacteria of the Ralstonia solanacearum species complex (RSSC). A CRISPR-Cas system was found in 31% of RSSC genomes present in public databases. Specifically, CRISPR-Cas types I-E and II-C were found, with I-E being the most common. The presence of the same CRISPR-Cas types in distinct Ralstonia phylotypes and species suggests the acquisition of the system by a common ancestor before Ralstonia species segregation. Additionally, a Cas1 phylogeny (I-E type) showed a perfect geographical segregation of phylotypes, supporting an ancient acquisition. Ralstonia solanacearum strains CFBP2957 and K60T were challenged with a virulent phage, and the CRISPR arrays of bacteriophage-insensitive mutants (BIMs) were analyzed. No new spacer acquisition was detected in the analyzed BIMs. The functionality of the CRISPR-Cas interference step was also tested in R. solanacearum CFBP2957 using a spacer-PAM delivery system and no resistance was observed against phage phiAP1. Our results showed that the CRISPR-Cas system in R. solanacearum CFBP2957 is not its primary antiviral strategy. This article is protected by copyright. All rights reserved.},
}
@article {pmid30251319,
year = {2018},
author = {Martin, RM and Moniruzzaman, M and Mucci, NC and Willis, A and Woodhouse, JN and Xian, Y and Xiao, C and Brussaard, CPD and Wilhelm, SW},
title = {Cylindrospermopsis raciborskii Virus and host: Genomic characterization and ecological relevance.},
journal = {Environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1462-2920.14425},
pmid = {30251319},
issn = {1462-2920},
abstract = {Cylindrospermopsis (Raphidiopsis) raciborskii is an invasive, filamentous, nitrogen-fixing cyanobacterium that forms frequent blooms in freshwater habitats. While viruses play key roles in regulating the abundance, production, and diversity of their hosts in aquatic ecosystems, the role(s) of viruses in the ecology of C. raciborskii is almost unexplored. Progress in this field has been hindered by the absence of a characterized virus-host system in C. raciborskii. To bridge this gap, we sequenced the genome of CrV-01T, a previously isolated cyanosiphovirus, and its host C. raciborskii strain Cr2010. Analyses suggest that CrV-01T represents a distinct clade of siphoviruses infecting, and perhaps lysogenizing, filamentous cyanobacteria. Its genome contains unique features that include an intact CRISPR array and a 12-kb inverted duplication. Evidence suggests CrV-01T recently gained the ability to infect Cr2010 and recently lost the ability to form lysogens. The cyanobacterial host contains a CRISPR-Cas system with CRISPR spacers matching protospacers within the inverted duplication of the CrV-01T genome. Examination of metagenomes demonstrates that viruses with high genetic identity to CrV-01T, but lacking the inverted duplication, are present in C. raciborskii blooms in Australia. The unique genomic features of the CrV/Cr2010 system offers opportunities to investigate in more detail virus-host interactions in an ecologically important bloom-forming cyanobacterium. This article is protected by copyright. All rights reserved.},
}
@article {pmid30248089,
year = {2018},
author = {Chabas, H and Lion, S and Nicot, A and Meaden, S and van Houte, S and Moineau, S and Wahl, LM and Westra, ER and Gandon, S},
title = {Evolutionary emergence of infectious diseases in heterogeneous host populations.},
journal = {PLoS biology},
volume = {16},
number = {9},
pages = {e2006738},
doi = {10.1371/journal.pbio.2006738},
pmid = {30248089},
issn = {1545-7885},
abstract = {The emergence and re-emergence of pathogens remains a major public health concern. Unfortunately, when and where pathogens will (re-)emerge is notoriously difficult to predict, as the erratic nature of those events is reinforced by the stochastic nature of pathogen evolution during the early phase of an epidemic. For instance, mutations allowing pathogens to escape host resistance may boost pathogen spread and promote emergence. Yet, the ecological factors that govern such evolutionary emergence remain elusive because of the lack of ecological realism of current theoretical frameworks and the difficulty of experimentally testing their predictions. Here, we develop a theoretical model to explore the effects of the heterogeneity of the host population on the probability of pathogen emergence, with or without pathogen evolution. We show that evolutionary emergence and the spread of escape mutations in the pathogen population is more likely to occur when the host population contains an intermediate proportion of resistant hosts. We also show that the probability of pathogen emergence rapidly declines with the diversity of resistance in the host population. Experimental tests using lytic bacteriophages infecting their bacterial hosts containing Clustered Regularly Interspaced Short Palindromic Repeat and CRISPR-associated (CRISPR-Cas) immune defenses confirm these theoretical predictions. These results suggest effective strategies for cross-species spillover and for the management of emerging infectious diseases.},
}
@article {pmid30245733,
year = {2018},
author = {Hsu, DS and Kornepati, AV and Glover, W and Kennedy, EM and Cullen, BR},
title = {Targeting HPV16 DNA using CRISPR/Cas inhibits anal cancer growth in vivo.},
journal = {Future virology},
volume = {13},
number = {7},
pages = {475-482},
doi = {10.2217/fvl-2018-0010},
pmid = {30245733},
issn = {1746-0794},
support = {R21 CA198050/CA/NCI NIH HHS/United States ; },
abstract = {Aim: The goal of this study was to determine if a single AAV vector, encoding Cas9 and guide RNAs specific for the HPV16 E6 and E7 genes, could inhibit the growth of an HPV16-induced tumor in vivo.<br><br>Materials &amp; methods: We grew HPV16+, patient-derived anal cancer explants in immunodeficient mice and then challenged these by injection of AAV-based vectors encoding Cas9 and control or HPV16-specific guide RNAs.<br><br>Results &amp; conclusion: We observed a significant and selective reduction in tumor growth when the HPV16 E6 and E7 genes were targeted using Cas9. These studies provide proof of principle for the hypothesis that CRISPR/Cas has the potential to be used to selectively treat HPV-induced tumors in humans.},
}
@article {pmid30244670,
year = {2018},
author = {Koonin, EV},
title = {Open questions: CRISPR biology.},
journal = {BMC biology},
volume = {16},
number = {1},
pages = {95},
doi = {10.1186/s12915-018-0565-9},
pmid = {30244670},
issn = {1741-7007},
abstract = {CRISPR-Cas systems, the purveyors of adaptive immunity in archaea and bacteria and sources of the new generation of genome engineering tools, have been studied in exquisite molecular detail. However, when it comes to biological functions, ecology, and evolution of CRISPR-Cas, many more intriguing questions remain than there are answers.},
}
@article {pmid30241607,
year = {2018},
author = {Zhang, C and Konermann, S and Brideau, NJ and Lotfy, P and Wu, X and Novick, SJ and Strutzenberg, T and Griffin, PR and Hsu, PD and Lyumkis, D},
title = {Structural Basis for the RNA-Guided Ribonuclease Activity of CRISPR-Cas13d.},
journal = {Cell},
volume = {175},
number = {1},
pages = {212-223.e17},
doi = {10.1016/j.cell.2018.09.001},
pmid = {30241607},
issn = {1097-4172},
support = {DP5 OD021369/OD/NIH HHS/United States ; DP5 OD021396/OD/NIH HHS/United States ; U54 GM103368/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas endonucleases directed against foreign nucleic acids mediate prokaryotic adaptive immunity and have been tailored for broad genetic engineering applications. Type VI-D CRISPR systems contain the smallest known family of single effector Cas enzymes, and their signature Cas13d ribonuclease employs guide RNAs to cleave matching target RNAs. To understand the molecular basis for Cas13d function and explain its compact molecular architecture, we resolved cryoelectron microscopy structures of Cas13d-guide RNA binary complex and Cas13d-guide-target RNA ternary complex to 3.4 and 3.3 Å resolution, respectively. Furthermore, a 6.5 Å reconstruction of apo Cas13d combined with hydrogen-deuterium exchange revealed conformational dynamics that have implications for RNA scanning. These structures, together with biochemical and cellular characterization, provide insights into its RNA-guided, RNA-targeting mechanism and delineate a blueprint for the rational design of improved transcriptome engineering technologies.},
}
@article {pmid30239876,
year = {2018},
author = {Han, W and Stella, S and Zhang, Y and Guo, T and Sulek, K and Peng-Lundgren, L and Montoya, G and She, Q},
title = {A Type III-B Cmr effector complex catalyzes the synthesis of cyclic oligoadenylate second messengers by cooperative substrate binding.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gky844},
pmid = {30239876},
issn = {1362-4962},
abstract = {Recently, Type III-A CRISPR-Cas systems were found to catalyze the synthesis of cyclic oligoadenylates (cOAs), a second messenger that specifically activates Csm6, a Cas accessory RNase and confers antiviral defense in bacteria. To test if III-B CRISPR-Cas systems could mediate a similar CRISPR signaling pathway, the Sulfolobus islandicus Cmr-α ribonucleoprotein complex (Cmr-α-RNP) was purified from the native host and tested for cOA synthesis. We found that the system showed a robust production of cyclic tetra-adenylate (c-A4), and that c-A4 functions as a second messenger to activate the III-B-associated RNase Csx1 by binding to its CRISPR-associated Rossmann Fold domain. Investigation of the kinetics of cOA synthesis revealed that Cmr-α-RNP displayed positively cooperative binding to the adenosine triphosphate (ATP) substrate. Furthermore, mutagenesis of conserved domains in Cmr2α confirmed that, while Palm 2 hosts the active site of cOA synthesis, Palm 1 domain serves as the primary site in the enzyme-substrate interaction. Together, our data suggest that the two Palm domains cooperatively interact with ATP molecules to achieve a robust cOA synthesis by the III-B CRISPR-Cas system.},
}
@article {pmid30239713,
year = {2018},
author = {Haverkamp, THA and Geslin, C and Lossouarn, J and Podosokorskaya, OA and Kublanov, I and Nesbø, CL},
title = {Thermosipho spp. immune system differences affect variation in genome size and geographical distributions.},
journal = {Genome biology and evolution},
volume = {},
number = {},
pages = {},
doi = {10.1093/gbe/evy202},
pmid = {30239713},
issn = {1759-6653},
abstract = {Thermosipho species inhabit thermal environments such as marine hydrothermal vents, petroleum reservoirs and terrestrial hot springs. A 16S rRNA phylogeny of available Thermosipho spp. sequences suggested habitat specialists adapted to living in hydrothermal vents only, and habitat generalists inhabiting oil reservoirs, hydrothermal vents and hotsprings. Comparative genomics of 15 Thermosipho genomes separated them into three distinct species with different habitat distributions: the widely distributed T. africanus and the more specialized, T. melanesiensis and T. affectus. Moreover, the species can be differentiated on the basis of genome size, genome content and immune system composition. For instance, the T. africanus genomes are largest and contained the most carbohydrate metabolism genes, which could explain why these isolates were obtained from ecologically more divergent habitats. Nonetheless, all the Thermosipho genomes, like other Thermotogae genomes, show evidence of genome streamlining. Genome size differences between the species could further be correlated to differences in defense capacities against foreign DNA, which influence recombination via HGT. The smallest genomes are found in T. affectus that contain both CRISPR-cas Type I and III systems, but no RM system genes. We suggest that this has caused these genomes to be almost devoid of mobile elements, contrasting the two other species genomes that contain a higher abundance of mobile elements combined with different immune system configurations. Taken together, the comparative genomic analyses of Thermosipho spp. revealed genetic variation allowing habitat differentiation within the genus as well as differentiation with respect to invading mobile DNA.},
}
@article {pmid30238143,
year = {2018},
author = {Shi, TQ and Huang, H and Kerkhoven, EJ and Ji, XJ},
title = {Advancing metabolic engineering of Yarrowia lipolytica using the CRISPR/Cas system.},
journal = {Applied microbiology and biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00253-018-9366-x},
pmid = {30238143},
issn = {1432-0614},
support = {21776131//National Natural Science Foundation of China/ ; 21476111//National Natural Science Foundation of China/ ; XTD1814//the Jiangsu Synergetic Innovation Center for Advanced Bio-Manufacture/ ; },
abstract = {The oleaginous yeast Yarrowia lipolytica is widely used for the production of both bulk and fine chemicals, including organic acids, fatty acid-derived biofuels and chemicals, polyunsaturated fatty acids, single-cell proteins, terpenoids, and other valuable products. Consequently, it is becoming increasingly popular for metabolic engineering applications. Multiple gene manipulation tools including URA blast, Cre/LoxP, and transcription activator-like effector nucleases (TALENs) have been developed for metabolic engineering in Y. lipolytica. However, the low efficiency and time-consuming procedures involved in these methods hamper further research. The emergence of the CRISPR/Cas system offers a potential solution for these problems due to its high efficiency, ease of operation, and time savings, which can significantly accelerate the genomic engineering of Y. lipolytica. In this review, we summarize the research progress on the development of CRISPR/Cas systems for Y. lipolytica, including Cas9 proteins and sgRNA expression strategies, as well as gene knock-out/knock-in and repression/activation applications. Finally, the most promising and tantalizing future prospects in this area are highlighted.},
}
@article {pmid30232153,
year = {2018},
author = {Lander, N and Chiurillo, MA and Bertolini, MS and Storey, M and Vercesi, AE and Docampo, R},
title = {Calcium-sensitive pyruvate dehydrogenase phosphatase is required for energy metabolism, growth, differentiation, and infectivity of Trypanosoma cruzi.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.004498},
pmid = {30232153},
issn = {1083-351X},
abstract = {In vertebrate cells, mitochondrial Ca2+ uptake by the mitochondrial calcium uniporter (MCU) leads to Ca2+-mediated stimulation of an intramitochondrial pyruvate dehydrogenase phosphatase (PDP). This enzyme dephosphorylates serine residues in the E1α subunit of pyruvate dehydrogenase (PDH), thereby activating PDH and resulting in increased ATP production. Although a phosphorylation-dephosphorylation cycle for the E1α subunit of PDH from non-vertebrate organisms has been described, the Ca2+-mediated PDP activation has not been studied. In this work we investigated the Ca2+ sensitivity of two recombinant PDPs from the protozoan human parasites Trypanosoma cruzi (TcPDP) and Trypanosoma brucei (TbPDP) and generated a TcPDP-KO cell line to establish TcPDP's role in cell bioenergetics and survival. Moreover, the mitochondrial localization of the TcPDP was studied by CRISPR/Cas9-mediated endogenous tagging. Our results indicate that TcPDP and TbPDP both are Ca2+-sensitive phosphatases. Of note, TcPDP-KO epimastigotes exhibited increased levels of phosphorylated TcPDH, slower growth and lower oxygen consumption rates than control cells, an increased AMP:ATP ratio and autophagy under starvation conditions, and reduced differentiation into infective metacyclic forms. Furthermore, TcPDP-KO trypomastigotes were impaired in infecting culture host cells. We conclude that TcPDP is a Ca2+-stimulated mitochondrial phosphatase that dephosphorylates TcPDH and is required for normal growth, differentiation, infectivity and energy metabolism in T. cruzi. Our results support the view that one of the main roles of the MCU is linked to the regulation of intramitochondrial dehydrogenases.},
}
@article {pmid30228869,
year = {2018},
author = {Reimer, KA and Neugebauer, KM},
title = {Blood Relatives: Splicing Mechanisms underlying Erythropoiesis in Health and Disease.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
doi = {10.12688/f1000research.15442.1},
pmid = {30228869},
issn = {2046-1402},
abstract = {During erythropoiesis, hematopoietic stem and progenitor cells transition to erythroblasts en route to terminal differentiation into enucleated red blood cells. Transcriptome-wide changes underlie distinct morphological and functional characteristics at each cell division during this process. Many studies of gene expression have historically been carried out in erythroblasts, and the biogenesis of β-globin mRNA-the most highly expressed transcript in erythroblasts-was the focus of many seminal studies on the mechanisms of pre-mRNA splicing. We now understand that pre-mRNA splicing plays an important role in shaping the transcriptome of developing erythroblasts. Recent advances have provided insight into the role of alternative splicing and intron retention as important regulatory mechanisms of erythropoiesis. However, dysregulation of splicing during erythropoiesis is also a cause of several hematological diseases, including β-thalassemia and myelodysplastic syndromes. With a growing understanding of the role that splicing plays in these diseases, we are well poised to develop gene-editing treatments. In this review, we focus on changes in the developing erythroblast transcriptome caused by alternative splicing, the molecular basis of splicing-related blood diseases, and therapeutic advances in disease treatment using CRISPR/Cas9 gene editing.},
}
@article {pmid30226584,
year = {2018},
author = {Liu, Q and Fan, D and Adah, D and Wu, Z and Liu, R and Yan, QT and Zhang, Y and Du, ZY and Wang, D and Li, Y and Bao, SY and Liu, LP},
title = {CRISPR/Cas9‑mediated hypoxia inducible factor‑1α knockout enhances the antitumor effect of transarterial embolization in hepatocellular carcinoma.},
journal = {Oncology reports},
volume = {40},
number = {5},
pages = {2547-2557},
doi = {10.3892/or.2018.6667},
pmid = {30226584},
issn = {1791-2431},
abstract = {Transarterial embolization (TAE) is a palliative option commonly used for the treatment of advanced, unresectable hepatocellular carcinoma (HCC). However, patient prognosis in regards to overall survival has not improved with this method, mainly due to hypoxia‑inducible factor‑1α (HIF‑1α)‑induced angiogenesis and invasiveness. Thus, it is hypothesized that HIF‑1α may be an ideal knockout target for the treatment of HCC in combination with TAE. Thus, in the present study, HIF‑1α knockout was conducted in human liver cancer SMMC‑7721 cells and a xenograft HCC model was established using a lentivirus‑mediated CRISPR/Cas system (LV‑Cas) with small guide RNA‑721 (LV‑H721). Furthermore, hepatic artery ligation (HAL) was used to mimic human transarterial chemoembolization in mice. The results revealed that HIF‑1α was highly expressed in both HCC patient tissues and SMMC‑7721‑induced tumor tissues. The HIF‑1α knockout in SMMC‑7721 cells significantly suppressed cell invasiveness and migration, and induced cell apoptosis under CoCl2‑mimicking hypoxic conditions. Compared with the control groups, HAL + LV‑H721 inhibited SMMC‑7721 tumor growth in orthotopic HCC and markedly prolonged the survival of HCC‑bearing mice, which was accompanied by a lower CD31 expression (tumor angiogenesis) and increased apoptosis in the tumor cells. These findings demonstrated a valuable antitumor synergism in combining CRISPR/Cas9‑mediated HIF‑1α knockout with TAE in mice and highlighted the possibility that HIF‑1α may be an effective therapeutic knockout target in combination with TAE for HCC treatment.},
}
@article {pmid30224454,
year = {2018},
author = {Oberhofer, G and Ivy, T and Hay, BA},
title = {Behavior of homing endonuclease gene drives targeting genes required for viability or female fertility with multiplexed guide RNAs.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {40},
pages = {E9343-E9352},
doi = {10.1073/pnas.1805278115},
pmid = {30224454},
issn = {1091-6490},
support = {T32 GM007616/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Drosophila melanogaster ; Female ; Fertility/genetics ; *Gene Targeting ; },
abstract = {A gene drive method of particular interest for population suppression utilizes homing endonuclease genes (HEGs), wherein a site-specific, nuclease-encoding cassette is copied, in the germline, into a target gene whose loss of function results in loss of viability or fertility in homozygous, but not heterozygous, progeny. Earlier work in Drosophila and mosquitoes utilized HEGs consisting of Cas9 and a single guide RNA (gRNA) that together target a specific gene for cleavage. Homing was observed, but resistant alleles immune to cleavage, while retaining wild-type gene function, were also created through nonhomologous end joining. Such alleles prevent drive and population suppression. Targeting a gene for cleavage at multiple positions has been suggested as a strategy to prevent the appearance of resistant alleles. To test this hypothesis, we generated two suppression HEGs in Drosophila melanogaster targeting genes required for embryonic viability or fertility, using a HEG consisting of CRISPR/Cas9 and gRNAs designed to cleave each gene at four positions. Rates of target locus cleavage were very high, and multiplexing of gRNAs prevented resistant allele formation. However, germline homing rates were modest, and the HEG cassette was unstable during homing events, resulting in frequent partial copying of HEGs that lacked gRNAs, a dominant marker gene, or Cas9. Finally, in drive experiments, the HEGs failed to spread due to the high fitness load induced in offspring as a result of maternal carryover of Cas9/gRNA complex activity. Alternative design principles are proposed that may mitigate these problems in future gene drive engineering.},
}
@article {pmid30224156,
year = {2018},
author = {Marzec, M and Hensel, G},
title = {Targeted Base Editing Systems Are Available for Plants.},
journal = {Trends in plant science},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tplants.2018.08.011},
pmid = {30224156},
issn = {1878-4372},
abstract = {Use of RNA-guided endonucleases for targeted genome editing is one of the most important breakthrough discoveries of the 21st century. Recent studies have described modifications of this precise base editing technique that open up a new dimension to plant genome editing.},
}
@article {pmid30222730,
year = {2018},
author = {Dorn, A and Röhrig, S and Papp, K and Schröpfer, S and Hartung, F and Knoll, A and Puchta, H},
title = {The topoisomerase 3α zinc-finger domain T1 of Arabidopsis thaliana is required for targeting the enzyme activity to Holliday junction-like DNA repair intermediates.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007674},
doi = {10.1371/journal.pgen.1007674},
pmid = {30222730},
issn = {1553-7404},
abstract = {Topoisomerase 3α, a class I topoisomerase, consists of a TOPRIM domain, an active centre and a variable number of zinc-finger domains (ZFDs) at the C-terminus, in multicellular organisms. Whereas the functions of the TOPRIM domain and the active centre are known, the specific role of the ZFDs is still obscure. In contrast to mammals where a knockout of TOP3α leads to lethality, we found that CRISPR/Cas induced mutants in Arabidopsis are viable but show growth retardation and meiotic defects, which can be reversed by the expression of the complete protein. However, complementation with AtTOP3α missing either the TOPRIM-domain or carrying a mutation of the catalytic tyrosine of the active centre leads to embryo lethality. Surprisingly, this phenotype can be overcome by the simultaneous removal of the ZFDs from the protein. In combination with a mutation of the nuclease AtMUS81, the TOP3α knockout proved to be also embryo lethal. Here, expression of TOP3α without ZFDs, and in particular without the conserved ZFD T1, leads to only a partly complementation in root growth-in contrast to the complete protein, that restores root length to mus81-1 mutant level. Expressing the E. coli resolvase RusA in this background, which is able to process Holliday junction (HJ)-like recombination intermediates, we could rescue this root growth defect. Considering all these results, we conclude that the ZFD T1 is specifically required for targeting the topoisomerase activity to HJ like recombination intermediates to enable their processing. In the case of an inactivated enzyme, this leads to cell death due to the masking of these intermediates, hindering their resolution by MUS81.},
}
@article {pmid30209390,
year = {2018},
author = {Akcakaya, P and Bobbin, ML and Guo, JA and Malagon-Lopez, J and Clement, K and Garcia, SP and Fellows, MD and Porritt, MJ and Firth, MA and Carreras, A and Baccega, T and Seeliger, F and Bjursell, M and Tsai, SQ and Nguyen, NT and Nitsch, R and Mayr, LM and Pinello, L and Bohlooly-Y, M and Aryee, MJ and Maresca, M and Joung, JK},
title = {In vivo CRISPR editing with no detectable genome-wide off-target mutations.},
journal = {Nature},
volume = {561},
number = {7723},
pages = {416-419},
doi = {10.1038/s41586-018-0500-9},
pmid = {30209390},
issn = {1476-4687},
support = {R00 HG008399/HG/NHGRI NIH HHS/United States ; R35 GM118158/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas genome-editing nucleases hold substantial promise for developing human therapeutic applications1-6 but identifying unwanted off-target mutations is important for clinical translation7. A well-validated method that can reliably identify off-targets in vivo has not been described to date, which means it is currently unclear whether and how frequently these mutations occur. Here we describe 'verification of in vivo off-targets' (VIVO), a highly sensitive strategy that can robustly identify the genome-wide off-target effects of CRISPR-Cas nucleases in vivo. We use VIVO and a guide RNA deliberately designed to be promiscuous to show that CRISPR-Cas nucleases can induce substantial off-target mutations in mouse livers in vivo. More importantly, we also use VIVO to show that appropriately designed guide RNAs can direct efficient in vivo editing in mouse livers with no detectable off-target mutations. VIVO provides a general strategy for defining and quantifying the off-target effects of gene-editing nucleases in whole organisms, thereby providing a blueprint to foster the development of therapeutic strategies that use in vivo gene editing.},
}
@article {pmid30209206,
year = {2018},
author = {Cubbon, A and Ivancic-Bace, I and Bolt, EL},
title = {CRISPR-Cas immunity, DNA repair and genome stability.},
journal = {Bioscience reports},
volume = {38},
number = {5},
pages = {},
doi = {10.1042/BSR20180457},
pmid = {30209206},
issn = {1573-4935},
abstract = {Co-opting of CRISPR-Cas 'Interference' reactions for editing the genomes of eukaryotic and prokaryotic cells has highlighted crucial support roles for DNA repair systems that strive to maintain genome stability. As front-runners in genome editing that targets DNA, the class 2 CRISPR-Cas enzymes Cas9 and Cas12a rely on repair of DNA double-strand breaks (DDSBs) by host DNA repair enzymes, using mechanisms that vary in how well they are understood. Data are emerging about the identities of DNA repair enzymes that support genome editing in human cells. At the same time, it is becoming apparent that CRISPR-Cas systems functioning in their native environment, bacteria or archaea, also need DNA repair enzymes. In this short review, we survey how DNA repair and CRISPR-Cas systems are intertwined. We consider how understanding DNA repair and CRISPR-Cas interference reactions in nature might help improve the efficacy of genome editing procedures that utilise homologous or analogous systems in human and other cells.},
}
@article {pmid30208287,
year = {2018},
author = {Stanley, SY and Maxwell, KL},
title = {Phage-Encoded Anti-CRISPR Defenses.},
journal = {Annual review of genetics},
volume = {},
number = {},
pages = {},
doi = {10.1146/annurev-genet-120417-031321},
pmid = {30208287},
issn = {1545-2948},
abstract = {The battle for survival between bacteria and bacteriophages (phages) is an arms race where bacteria develop defenses to protect themselves from phages and phages evolve counterstrategies to bypass these defenses. CRISPR-Cas adaptive immune systems represent a widespread mechanism by which bacteria protect themselves from phage infection. In response to CRISPR-Cas, phages have evolved protein inhibitors known as anti-CRISPRs. Here, we describe the discovery and mechanisms of action of anti-CRISPR proteins. We discuss the potential impact of anti-CRISPRs on bacterial evolution, speculate on their evolutionary origins, and contemplate the possible next steps in the CRISPR-Cas evolutionary arms race. We also touch on the impact of anti-CRISPRs on the development of CRISPR-Cas-based biotechnological tools. Expected final online publication date for the Annual Review of Genetics Volume 52 is November 23, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.},
}
@article {pmid30205462,
year = {2018},
author = {Hidalgo-Cantabrana, C and Sanozky-Dawes, R and Barrangou, R},
title = {Insights into the Human Virome Using CRISPR Spacers from Microbiomes.},
journal = {Viruses},
volume = {10},
number = {9},
pages = {},
doi = {10.3390/v10090479},
pmid = {30205462},
issn = {1999-4915},
support = {support//North Carolina Agricultural Foundation/International ; internal support//North Carolina State University/International ; },
abstract = {Due to recent advances in next-generation sequencing over the past decade, our understanding of the human microbiome and its relationship to health and disease has increased dramatically. Yet, our insights into the human virome, and its interplay with important microbes that impact human health, is relatively limited. Prokaryotic and eukaryotic viruses are present throughout the human body, comprising a large and diverse population which influences several niches and impacts our health at various body sites. The presence of prokaryotic viruses like phages, has been documented at many different body sites, with the human gut being the richest ecological niche. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and associated proteins constitute the adaptive immune system of bacteria, which prevents attack by invasive nucleic acid. CRISPR-Cas systems function by uptake and integration of foreign genetic element sequences into the CRISPR array, which constitutes a genomic archive of iterative vaccination events. Consequently, CRISPR spacers can be investigated to reconstruct interplay between viruses and bacteria, and metagenomic sequencing data can be exploited to provide insights into host-phage interactions within a niche. Here, we show how the CRISPR spacer content of commensal and pathogenic bacteria can be used to determine the evidence of their phage exposure. This framework opens new opportunities for investigating host-virus dynamics in metagenomic data, and highlights the need to dedicate more efforts for virome sampling and sequencing.},
}
@article {pmid30203114,
year = {2018},
author = {Cai, B and Sun, S and Li, Z and Zhang, X and Ke, Y and Yang, J and Li, X},
title = {Application of CRISPR/Cas9 technologies combined with iPSCs in the study and treatment of retinal degenerative diseases.},
journal = {Human genetics},
volume = {137},
number = {9},
pages = {679-688},
doi = {10.1007/s00439-018-1933-9},
pmid = {30203114},
issn = {1432-1203},
support = {81670875//National Natural Science Foundation of China/ ; 81500745//National Natural Science Foundation of China/ ; 18JCQNJC10700//Natural Science Foundation of Tianjin City/ ; 17JCYBJC27200//Natural Science Foundation of Tianjin City/ ; BJ-LM2015008L//the Dr. Henry Norman Bethune: LangMu Young Scientist scholarship/ ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Combined Modality Therapy ; Gene Editing ; *Genetic Therapy ; Humans ; Induced Pluripotent Stem Cells/*cytology ; Retinal Degeneration/genetics/*therapy ; Stem Cell Transplantation/*methods ; },
abstract = {Retinal degeneration diseases, such as age-related macular degeneration and retinitis pigmentosa, affect millions of people worldwide and are major causes of irreversible blindness. Effective treatments for retinal degeneration, including drug therapy, gene augmentation or transplantation approaches, have been widely investigated. Nevertheless, more research should be dedicated to therapeutic methods to improve future clinical treatments. Recently, with the rapid development of genome-editing technology, gene therapy has become a potentially effective treatment for retinal degeneration diseases. A clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system has been developed as a powerful genome-editing tool in ophthalmic studies. The CRISPR/Cas9 system has been widely applied in basic research to develop animal models and gene therapies in vivo. With the ability to self-renew and the potential to differentiate into different types of cells, induced pluripotent stem cells (iPSCs) have already been used as a promising tool for understanding disease pathophysiology and evaluating the effect of drug and gene therapeutics. iPSCs are also a cell source for autologous transplantation. In this review, we compared genome-editing strategies and highlighted the advantages and concerns of the CRISPR/Cas9 system. Moreover, the latest progress and applications of the CRISPR/Cas9 system and its combination with iPSCs for the treatment of retinal degenerative diseases are summarized.},
}
@article {pmid30201719,
year = {2018},
author = {Viegas, J},
title = {Profile of Dana Carroll.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {38},
pages = {9331-9333},
doi = {10.1073/pnas.1813829115},
pmid = {30201719},
issn = {1091-6490},
mesh = {CRISPR-Cas Systems ; Gene Editing/*history/*methods ; History, 20th Century ; History, 21st Century ; Homologous Recombination ; Transcription Activator-Like Effector Nucleases/metabolism ; United States ; Zinc Finger Nucleases/metabolism ; },
}
@article {pmid30201707,
year = {2018},
author = {Yarrington, RM and Verma, S and Schwartz, S and Trautman, JK and Carroll, D},
title = {Nucleosomes inhibit target cleavage by CRISPR-Cas9 in vivo.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {38},
pages = {9351-9358},
doi = {10.1073/pnas.1810062115},
pmid = {30201707},
issn = {1091-6490},
support = {R01 GM078571/GM/NIGMS NIH HHS/United States ; },
mesh = {Bacterial Proteins/metabolism ; Base Sequence ; Binding Sites/genetics ; *CRISPR-Cas Systems ; Chromatin/genetics/metabolism ; DNA, Fungal/genetics/metabolism ; Deoxyribonucleases, Type II Site-Specific/genetics ; Endonucleases/metabolism ; Gene Editing/*methods ; Genomics/*methods ; Nucleosomes/*genetics/metabolism ; Promoter Regions, Genetic/genetics ; Saccharomyces cerevisiae Proteins/genetics ; Zinc Finger Nucleases/metabolism ; },
abstract = {Genome editing with CRISPR-Cas nucleases has been applied successfully to a wide range of cells and organisms. There is, however, considerable variation in the efficiency of cleavage and outcomes at different genomic targets, even within the same cell type. Some of this variability is likely due to the inherent quality of the interaction between the guide RNA and the target sequence, but some may also reflect the relative accessibility of the target. We investigated the influence of chromatin structure, particularly the presence or absence of nucleosomes, on cleavage by the Streptococcus pyogenes Cas9 protein. At multiple target sequences in two promoters in the yeast genome, we find that Cas9 cleavage is strongly inhibited when the DNA target is within a nucleosome. This inhibition is relieved when nucleosomes are depleted. Remarkably, the same is not true of zinc-finger nucleases (ZFNs), which cleave equally well at nucleosome-occupied and nucleosome-depleted sites. These results have implications for the choice of specific targets for genome editing, both in research and in clinical and other practical applications.},
}
@article {pmid30198342,
year = {2018},
author = {Dangi, AK and Sharma, B and Hill, RT and Shukla, P},
title = {Bioremediation through microbes: systems biology and metabolic engineering approach.},
journal = {Critical reviews in biotechnology},
volume = {},
number = {},
pages = {1-20},
doi = {10.1080/07388551.2018.1500997},
pmid = {30198342},
issn = {1549-7801},
abstract = {Today, environmental pollution is a serious problem, and bioremediation can play an important role in cleaning contaminated sites. Remediation strategies, such as chemical and physical approaches, are not enough to mitigate pollution problems because of the continuous generation of novel recalcitrant pollutants due to anthropogenic activities. Bioremediation using microbes is an eco-friendly and socially acceptable alternative to conventional remediation approaches. Many microbes with a bioremediation potential have been isolated and characterized but, in many cases, cannot completely degrade the targeted pollutant or are ineffective in situations with mixed wastes. This review envisages advances in systems biology (SB), which enables the analysis of microbial behavior at a community level under different environmental stresses. By applying a SB approach, crucial preliminary information can be obtained for metabolic engineering (ME) of microbes for their enhanced bioremediation capabilities. This review also highlights the integrated SB and ME tools and techniques for bioremediation purposes.},
}
@article {pmid30195930,
year = {2018},
author = {St John, E and Liu, Y and Podar, M and Stott, MB and Meneghin, J and Chen, Z and Lagutin, K and Mitchell, K and Reysenbach, AL},
title = {A new symbiotic nanoarchaeote (Candidatus Nanoclepta minutus) and its host (Zestosphaera tikiterensis gen. nov., sp. nov.) from a New Zealand hot spring.},
journal = {Systematic and applied microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.syapm.2018.08.005},
pmid = {30195930},
issn = {1618-0984},
abstract = {Three thermophilic Nanoarchaeota-Crenarchaeota symbiotic systems have been described. We obtained another stable anaerobic enrichment culture at 80°C, pH 6.0 from a New Zealand hot spring. The nanoarchaeote (Ncl-1) and its host (NZ3T) were isolated in co-culture and their genomes assembled. The small (∼200nm) flagellated cocci were often attached to larger cocci. Based on 16S rRNA gene similarity (88.4%) and average amino acid identity (52%), Ncl-1 is closely related to Candidatus Nanopusillus acidilobi. Their genomes both encode for archaeal flagella and partial glycolysis and gluconeogenesis pathways, but lack ATP synthase genes. Like Nanoarchaeum equitans, Ncl-1 has a CRISPR-Cas system. Ncl-1 also relies on its crenarchaeotal host for most of its biosynthetic needs. The host NZ3T was isolated and grows on proteinaceous substrates but not on sugars, alcohols, or fatty acids. NZ3T requires thiosulfate and grows best at 82°C, pH 6.0. NZ3T is most closely related to the Desulfurococcaceae, Ignisphaera aggregans (∼92% 16S rRNA gene sequence similarity, 45% AAI). Based on phylogenetic, physiological and genomic data, Ncl-1 and NZ3T represent novel genera in the Nanoarchaeota and the Desulfurococcaceae, respectively, with the proposed names Candidatus Nanoclepta minutus and Zestosphaera tikiterensis gen. nov., sp. nov., type strain NZ3T (=DSMZ 107634T=OCM 1213T).},
}
@article {pmid30195753,
year = {2018},
author = {Gao, Z and Herrera-Carrillo, E and Berkhout, B},
title = {RNA Polymerase II Activity of Type 3 Pol III Promoters.},
journal = {Molecular therapy. Nucleic acids},
volume = {12},
number = {},
pages = {135-145},
doi = {10.1016/j.omtn.2018.05.001},
pmid = {30195753},
issn = {2162-2531},
abstract = {In eukaryotes, three RNA polymerases (Pol I, II, and III) are responsible for the transcription of distinct subsets of genes. Gene-external type 3 Pol III promoters use defined transcription start and termination sites, and they are, therefore, widely used for small RNA expression, including short hairpin RNAs in RNAi applications and guide RNAs in CRISPR-Cas systems. We report that all three commonly used human Pol III promoters (7SK, U6, and H1) mediate luciferase reporter gene expression, which indicates Pol II activity, but to a different extent (H1 ≫ U6 > 7SK). We demonstrate that these promoters can recruit Pol II for transcribing extended messenger transcripts. Intriguingly, selective inhibition of Pol II stimulates the Pol III activity and vice versa, suggesting that two polymerase complexes compete for promoter usage. Pol II initiates transcription at the regular Pol III start site on the 7SK and U6 promoters, but Pol II transcription on the most active H1 promoter starts 8 nt upstream of the Pol III start site. This study provides functional evidence for the close relationship of Pol II and Pol III transcription. These mechanistic insights are important for optimal use of Pol III promoters, and they offer additional flexibility for biotechnology applications of these genetic elements.},
}
@article {pmid30195321,
year = {2018},
author = {Karagyaur, MN and Rubtsov, YP and Vasiliev, PA and Tkachuk, VA},
title = {Practical Recommendations for Improving Efficiency and Accuracy of the CRISPR/Cas9 Genome Editing System.},
journal = {Biochemistry. Biokhimiia},
volume = {83},
number = {6},
pages = {629-642},
doi = {10.1134/S0006297918060020},
pmid = {30195321},
issn = {1608-3040},
mesh = {CRISPR-Cas Systems/*genetics ; DNA Breaks ; DNA Repair ; Gene Editing/*methods ; Genetic Vectors/genetics/metabolism ; Humans ; RNA, Guide/chemistry/metabolism ; },
abstract = {CRISPR/Cas9 genome-editing system is a powerful, fairly accurate, and efficient tool for modifying genomic DNA. Despite obvious advantages, it is not devoid of certain drawbacks, such as propensity for introduction of additional nonspecific DNA breaks, insufficient activity against aneuploid genomes, and relative difficulty in delivering its components to cells. In this review, we focus on the difficulties that can limit the use of CRISPR/Cas9 and suggest a number of practical recommendations and information sources that will make it easier for the beginners to work with this outstanding technological achievement of the XXI century.},
}
@article {pmid30193985,
year = {2018},
author = {Faure, G and Makarova, KS and Koonin, EV},
title = {CRISPR-Cas: Complex Functional Networks and Multiple Roles beyond Adaptive Immunity.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.08.030},
pmid = {30193985},
issn = {1089-8638},
abstract = {CRISPR-Cas is a prokaryotic adaptive immune system that functions by incorporating fragments of foreign DNA into CRISPR arrays. The arrays containing spacers derived from foreign DNA are transcribed, and the transcripts are processed to generate spacer-containing mature CRISPR-RNAs that are employed as guides to specifically recognize and cleave the DNA or RNA of the cognate parasitic genetic elements. The CRISPR-Cas systems show remarkable complexity and diversity of molecular organization and appear to be involved in various cellular functions that are distinct from, even if connected to, adaptive immunity. In this review, we discuss some of such functional links of CRISPR-Cas systems including their effect on horizontal gene transfer that can be either inhibitory or stimulatory, connections between CRISPR-Cas and DNA repair systems as well as programmed cell death and signal transduction mechanisms, and potential role of CRISPR-Cas in transposon integration and plasmid maintenance. The interplay between the primary function of CRISPR-Cas as an adaptive immunity mechanism and these other roles defines the richness of the biological effects of these systems and affects their spread among bacteria and archaea.},
}
@article {pmid30193161,
year = {2018},
author = {Vogel, P and Stafforst, T},
title = {Critical review on engineering deaminases for site-directed RNA editing.},
journal = {Current opinion in biotechnology},
volume = {55},
number = {},
pages = {74-80},
doi = {10.1016/j.copbio.2018.08.006},
pmid = {30193161},
issn = {1879-0429},
abstract = {The game-changing role of CRISPR/Cas for genome editing draw interest to programmable RNA-guided tools in general. Currently, we see a wave of papers pioneering the CRISPR/Cas system for RNA targeting, and applying them for site-directed RNA editing. Here, we exemplarily compare three recent RNA editing strategies that rely on three distinct RNA targeting mechanisms. We conclude that the CRISPR/Cas system seems not generally superior to other RNA targeting strategies in solving the most pressing problem in the RNA editing field, which is to obtain high efficiency in combination with high specificity. However, once achieved, RNA editing promises to complement or even outcompete DNA editing approaches in therapy, and also in some fields of basic research.},
}
@article {pmid30190322,
year = {2018},
author = {Shen, Y and Cohen, JL and Nicoloro, SM and Kelly, M and Yenilmez, B and Henriques, F and Tsagkaraki, E and Edwards, YJK and Hu, X and Friedline, RH and Kim, JK and Czech, MP},
title = {CRISPR delivery particles targeting nuclear receptor-interacting protein 1 (Nrip1) in adipose cells to enhance energy expenditure.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.004554},
pmid = {30190322},
issn = {1083-351X},
abstract = {RNA-guided, engineered nucleases derived from the prokaryotic adaptive immune system CRISPR-Cas represent a powerful platform for gene deletion and editing. When used as a therapeutic approach, direct delivery of Cas9 protein and single-guide (sg)RNA could circumvent the safety issues associated with plasmid delivery and therefore represents an attractive tool for precision genome engineering. Gene deletion or editing in adipose tissue to enhance its energy expenditure, fatty acid oxidation, and secretion of bioactive factors through a &quot;browning&quot; process presents a potential therapeutic strategy to alleviate metabolic disease. Here, we developed &quot;CRISPR-delivery particles,&quot; denoted CriPs, composed of nano-size complexes of Cas9 protein and sgRNA that are coated with an amphipathic peptide called Endo-Porter that mediates entry into cells. Efficient CRISPR-Cas9-mediated gene deletion of ectopically expressed GFP by CriPs was achieved in multiple cell types, including a macrophage cell line, primary macrophages, and primary preadipocytes. Significant GFP loss was also observed in peritoneal exudate cells with minimum systemic toxicity in GFP-expressing mice following intraperitoneal injection of CriPs containing Gfp-targeting sgRNA. Furthermore, disruption of a nuclear co-repressor of catabolism, the Nrip1 gene, in white adipocytes by CriPs enhanced adipocyte &quot;browning&quot; with a marked increase of uncoupling protein 1 (UCP1) expression. Of note, the CriP-mediated Nrip1 deletion did not produce detectable off-target effects. We conclude that CriPs offer an effective Cas9 and sgRNA delivery system for ablating targeted gene products in cultured cells and in vivo, providing a potential therapeutic strategy for metabolic disease.},
}
@article {pmid30190308,
year = {2018},
author = {Marino, ND and Zhang, JY and Borges, AL and Sousa, AA and Leon, LM and Rauch, BJ and Walton, RT and Berry, JD and Joung, JK and Kleinstiver, BP and Bondy-Denomy, J},
title = {Discovery of widespread type I and type V CRISPR-Cas inhibitors.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6411},
pages = {240-242},
doi = {10.1126/science.aau5174},
pmid = {30190308},
issn = {1095-9203},
support = {DP5 OD021344/OD/NIH HHS/United States ; K99 CA218870/CA/NCI NIH HHS/United States ; R35 GM118158/GM/NIGMS NIH HHS/United States ; },
abstract = {Bacterial CRISPR-Cas systems protect their host from bacteriophages and other mobile genetic elements. Mobile elements, in turn, encode various anti-CRISPR (Acr) proteins to inhibit the immune function of CRISPR-Cas. To date, Acr proteins have been discovered for type I (subtypes I-D, I-E, and I-F) and type II (II-A and II-C) but not other CRISPR systems. Here, we report the discovery of 12 acr genes, including inhibitors of type V-A and I-C CRISPR systems. AcrVA1 inhibits a broad spectrum of Cas12a (Cpf1) orthologs-including MbCas12a, Mb3Cas12a, AsCas12a, and LbCas12a-when assayed in human cells. The acr genes reported here provide useful biotechnological tools and mark the discovery of acr loci in many bacteria and phages.},
}
@article {pmid30189348,
year = {2018},
author = {Verkuijl, SA and Rots, MG},
title = {The influence of eukaryotic chromatin state on CRISPR-Cas9 editing efficiencies.},
journal = {Current opinion in biotechnology},
volume = {55},
number = {},
pages = {68-73},
doi = {10.1016/j.copbio.2018.07.005},
pmid = {30189348},
issn = {1879-0429},
abstract = {CRISPR/Cas technologies have rapidly become in routine use for site-directed genetic or transcriptional manipulation. Despite this, the efficiency of CRISPR/Cas9 functioning cannot entirely be predicted, and it is not fully understood which factors contribute to this variability. Recent studies indicate that heterochromatin can negatively affect Cas9 binding and functioning. Investigating chromatin factors indicates that DNA cytosine-5 methylation does not directly block Cas9 binding. Nucleosomes, however, can completely block Cas9 access to DNA in cell-free assays and present a substantial hurdle in vivo. In addition to being associated with an open chromatin state, active transcription can directly stimulate DNA cleavage by influencing Cas9 release rates in a strand-specific manner. With these insights and a better understanding of genome-wide chromatin and transcription states, CRISPR/Cas9 effectiveness and reliability can be improved.},
}
@article {pmid30189098,
year = {2018},
author = {Radovcic, M and Killelea, T and Savitskaya, E and Wettstein, L and Bolt, EL and Ivancic-Bace, I},
title = {CRISPR-Cas adaptation in Escherichia coli requires RecBCD helicase but not nuclease activity, is independent of homologous recombination, and is antagonized by 5' ssDNA exonucleases.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gky799},
pmid = {30189098},
issn = {1362-4962},
abstract = {Prokaryotic adaptive immunity is established against mobile genetic elements (MGEs) by 'naïve adaptation' when DNA fragments from a newly encountered MGE are integrated into CRISPR-Cas systems. In Escherichia coli, DNA integration catalyzed by Cas1-Cas2 integrase is well understood in mechanistic and structural detail but much less is known about events prior to integration that generate DNA for capture by Cas1-Cas2. Naïve adaptation in E. coli is thought to depend on the DNA helicase-nuclease RecBCD for generating DNA fragments for capture by Cas1-Cas2. The genetics presented here show that naïve adaptation does not require RecBCD nuclease activity but that helicase activity may be important. RecA loading by RecBCD inhibits adaptation explaining previously observed adaptation phenotypes that implicated RecBCD nuclease activity. Genetic analysis of other E. coli nucleases and naïve adaptation revealed that 5' ssDNA tailed DNA molecules promote new spacer acquisition. We show that purified E. coli Cas1-Cas2 complex binds to and nicks 5' ssDNA tailed duplexes and propose that E. coli Cas1-Cas2 nuclease activity on such DNA structures supports naïve adaptation.},
}
@article {pmid30185555,
year = {2018},
author = {Wall, RJ and Rico, E and Lukac, I and Zuccotto, F and Elg, S and Gilbert, IH and Freund, Y and Alley, MRK and Field, MC and Wyllie, S and Horn, D},
title = {Clinical and veterinary trypanocidal benzoxaboroles target CPSF3.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {38},
pages = {9616-9621},
doi = {10.1073/pnas.1807915115},
pmid = {30185555},
issn = {1091-6490},
support = {105021/Z/14/Z//Wellcome Trust/United Kingdom ; MR/K008749/1//Medical Research Council/United Kingdom ; //Wellcome Trust/United Kingdom ; 100320/Z/12/Z//Wellcome Trust/United Kingdom ; 203134/Z/16/Z//Wellcome Trust/United Kingdom ; },
mesh = {Animals ; Benzamides/pharmacology/therapeutic use ; Boron Compounds/pharmacology/therapeutic use ; CRISPR-Cas Systems ; Cell Nucleus/genetics/metabolism ; Cleavage And Polyadenylation Specificity Factor/*antagonists &amp; inhibitors/genetics/metabolism ; Drug Resistance/drug effects/genetics ; Gene Knockdown Techniques ; Gene Library ; High-Throughput Screening Assays/methods ; Humans ; Molecular Docking Simulation ; Protozoan Proteins/*antagonists &amp; inhibitors/genetics/metabolism ; RNA Processing, Post-Transcriptional/drug effects ; RNA, Messenger/metabolism ; RNA, Protozoan/metabolism ; Trypanocidal Agents/*pharmacology/therapeutic use ; Trypanosoma brucei brucei/drug effects/*physiology ; Trypanosomiasis, African/*prevention &amp; control/transmission/veterinary ; Valine/analogs &amp; derivatives/pharmacology/therapeutic use ; },
abstract = {African trypanosomes cause lethal and neglected tropical diseases, known as sleeping sickness in humans and nagana in animals. Current therapies are limited, but fortunately, promising therapies are in advanced clinical and veterinary development, including acoziborole (AN5568 or SCYX-7158) and AN11736, respectively. These benzoxaboroles will likely be key to the World Health Organization's target of disease control by 2030. Their mode of action was previously unknown. We have developed a high-coverage overexpression library and use it here to explore drug mode of action in Trypanosoma brucei Initially, an inhibitor with a known target was used to select for drug resistance and to test massive parallel library screening and genome-wide mapping; this effectively identified the known target and validated the approach. Subsequently, the overexpression screening approach was used to identify the target of the benzoxaboroles, Cleavage and Polyadenylation Specificity Factor 3 (CPSF3, Tb927.4.1340). We validated the CPSF3 endonuclease as the target, using independent overexpression strains. Knockdown provided genetic validation of CPSF3 as essential, and GFP tagging confirmed the expected nuclear localization. Molecular docking and CRISPR-Cas9-based editing demonstrated how acoziborole can specifically block the active site and mRNA processing by parasite, but not host CPSF3. Thus, our findings provide both genetic and chemical validation for CPSF3 as an important drug target in trypanosomes and reveal inhibition of mRNA maturation as the mode of action of the trypanocidal benzoxaboroles. Understanding the mechanism of action of benzoxaborole-based therapies can assist development of improved therapies, as well as the prediction and monitoring of resistance, if or when it arises.},
}
@article {pmid30183125,
year = {2018},
author = {Ortigosa, A and Gimenez-Ibanez, S and Leonhardt, N and Solano, R},
title = {Design of a bacterial speck resistant tomato by CRISPR/Cas9-mediated editing of SlJAZ2.},
journal = {Plant biotechnology journal},
volume = {},
number = {},
pages = {},
doi = {10.1111/pbi.13006},
pmid = {30183125},
issn = {1467-7652},
support = {//Severo Ochoa/ ; BIO2014-55884-JIN//Spanish Ministry for Science and Innovation/ ; BIO2016-77216-R (AEI/FEDER, UE)//Spanish Ministry for Science and Innovation/ ; 2015007//ANR program/ ; },
abstract = {Due to their different lifestyles, effective defence against biotrophic pathogens normally leads to increased susceptibility to necrotrophs, and vice versa. Solving this trade-off is a major challenge for obtaining broad-spectrum resistance in crops and requires uncoupling the antagonism between the jasmonate (JA) and salicylate (SA) defence pathways. Pseudomonas syringae pv. tomato (Pto) DC3000, the causal agent of tomato bacterial speck disease, produces coronatine (COR) that stimulates stomata opening and facilitates bacterial leaf colonization. In Arabidopsis, stomata response to COR requires the COR co-receptor AtJAZ2, and dominant AtJAZ2Δjas repressors resistant to proteasomal degradation prevent stomatal opening by COR. Here, we report the generation of a tomato variety resistant to the bacterial speck disease caused by PtoDC3000 without compromising resistance to necrotrophs. We identified the functional ortholog of AtJAZ2 in tomato, found that preferentially accumulates in stomata and proved that SlJAZ2 is a major co-receptor of COR in stomatal guard cells. SlJAZ2 was edited using CRISPR/Cas9 to generate dominant JAZ2 repressors lacking the C-terminal Jas domain (SlJAZ2Δjas). SlJAZ2Δjas prevented stomatal reopening by COR and provided resistance to PtoDC3000. Water transpiration rate and resistance to the necrotrophic fungal pathogen Botrytis cinerea, causal agent of the tomato gray mold, remained unaltered in Sljaz2Δjas plants. Our results solve the defence trade-off in a crop, by spatially uncoupling the SA-JA hormonal antagonism at the stomata, entry gates of specific microbes such as PtoDC3000. Moreover, our results also constitute a novel CRISPR/Cas-based strategy for crop protection that could be readily implemented in the field.},
}
@article {pmid30180552,
year = {2018},
author = {Tian, H and Luo, J and Zhang, Z and Wu, J and Zhang, T and Busato, S and Huang, L and Song, N and Bionaz, M},
title = {CRISPR/Cas9-mediated Stearoyl-CoA Desaturase 1 (SCD1) Deficiency Affects Fatty Acid Metabolism in Goat Mammary Epithelial Cells.},
journal = {Journal of agricultural and food chemistry},
volume = {66},
number = {38},
pages = {10041-10052},
doi = {10.1021/acs.jafc.8b03545},
pmid = {30180552},
issn = {1520-5118},
mesh = {Animals ; Animals, Genetically Modified/*genetics/metabolism ; CRISPR-Cas Systems ; Epithelial Cells/*enzymology/metabolism ; Fatty Acids/*metabolism ; Female ; Gene Deletion ; Gene Knockout Techniques/*methods ; Goats/*genetics/metabolism ; Lipogenesis ; Mammary Glands, Animal/cytology/*enzymology/metabolism ; Milk/chemistry/metabolism ; Stearoyl-CoA Desaturase/*deficiency/genetics ; Sterol Regulatory Element Binding Protein 1/genetics/metabolism ; Triglycerides/metabolism ; },
abstract = {Stearoyl-CoA desaturase 1 (SCD1) is a fatty acid desaturase catalyzing cis-double-bond formation in the Δ9 position to produce monounsaturated fatty acids essential for the synthesis of milk fat. Previous studies using RNAi methods have provided support for a role of SCD1 in goat mammary epithelial cells (GMEC); however, RNAi presents several limitations that might preclude a truthful understanding of the biological function of SCD1. To explore the function of SCD1 on fatty acid metabolism in GMEC, we used CRISPR-Cas9-mediated SCD1 knockout through non-homologous end-joining (NHEJ) and homology-directed repair (HDR) pathways in GMEC. We successfully introduced nucleotide deletions and mutations in the SCD1 gene locus through the NHEJ pathway and disrupted its second exon via insertion of an EGFP-PuroR segment using the HDR pathway. In clones derived from the latter, gene- and protein-expression data indicated that we obtained a monoallelic SCD1 knockout. A T7EN1-mediated assay revealed no off-targets in the surveyed sites. The contents of triacylglycerol and cholesterol and the desaturase index were significantly decreased as a consequence of SCD1 knockout. The deletion of SCD1 decreased the expression of other genes involved in de novo fatty acid synthesis, including SREBF1 and FASN, as well the fatty acid transporters FABP3 and FABP4. The downregulation of these genes partly explains the decrease of intracellular triacylglycerols. Our results indicate a successful SCD1 knockout in goat mammary cells using CRISPR-Cas9. The demonstration of the successful use of CRISPR-Cas9 in GMEC is an important step to producing transgenic goats to study mammary biology in vivo.},
}
@article {pmid30174653,
year = {2018},
author = {Tagini, F and Pillonel, T and Croxatto, A and Bertelli, C and Koutsokera, A and Lovis, A and Greub, G},
title = {Distinct Genomic Features Characterize Two Clades of Corynebacterium diphtheriae: Proposal of Corynebacterium diphtheriae Subsp. diphtheriae Subsp. nov. and Corynebacterium diphtheriae Subsp. lausannense Subsp. nov.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1743},
doi = {10.3389/fmicb.2018.01743},
pmid = {30174653},
issn = {1664-302X},
abstract = {Corynebacterium diphtheriae is the etiological agent of diphtheria, a disease caused by the presence of the diphtheria toxin. However, an increasing number of records report non-toxigenic C. diphtheriae infections. Here, a C. diphtheriae strain was recovered from a patient with a past history of bronchiectasis who developed a severe tracheo-bronchitis with multiple whitish lesions of the distal trachea and the mainstem bronchi. Whole-genome sequencing (WGS), performed in parallel with PCR targeting the toxin gene and the Elek test, provided clinically relevant results in a short turnaround time, showing that the isolate was non-toxigenic. A comparative genomic analysis of the new strain (CHUV2995) with 56 other publicly available genomes of C. diphtheriae revealed that the strains CHUV2995, CCUG 5865 and CMCNS703 share a lower average nucleotide identity (ANI) (95.24 to 95.39%) with the C. diphtheriae NCTC 11397T reference genome than all other C. diphtheriae genomes (>98.15%). Core genome phylogeny confirmed the presence of two monophyletic clades. Based on these findings, we propose here two new C. diphtheriae subspecies to replace the lineage denomination used in previous multilocus sequence typing studies: C. diphtheriae subsp. lausannense subsp. nov. (instead of lineage-2), regrouping strains CHUV2995, CCUG 5865, and CMCNS703, and C. diphtheriae subsp. diphtheriae subsp. nov, regrouping all other C. diphtheriae in the dataset (instead of lineage-1). Interestingly, members of subspecies lausannense displayed a larger genome size than subspecies diphtheriae and were enriched in COG categories related to transport and metabolism of lipids (I) and inorganic ion (P). Conversely, they lacked all genes involved in the synthesis of pili (SpaA-type, SpaD-type and SpaH-type), molybdenum cofactor and of the nitrate reductase. Finally, the CHUV2995 genome is particularly enriched in mobility genes and harbors several prophages. The genome encodes a type II-C CRISPR-Cas locus with 2 spacers that lacks csn2 or cas4, which could hamper the acquisition of new spacers and render strain CHUV2995 more susceptible to bacteriophage infections and gene acquisition through various mechanisms of horizontal gene transfer.},
}
@article {pmid30173772,
year = {2018},
author = {Liu, Q and Yu, T and Campbell, K and Nielsen, J and Chen, Y},
title = {Modular Pathway Rewiring of Yeast for Amino Acid Production.},
journal = {Methods in enzymology},
volume = {608},
number = {},
pages = {417-439},
doi = {10.1016/bs.mie.2018.06.009},
pmid = {30173772},
issn = {1557-7988},
abstract = {Amino acids find various applications in biotechnology in view of their importance in the food, feed, pharmaceutical, and personal care industries as nutrients, additives, and drugs, respectively. For the large-scale production of amino acids, microbial cell factories are widely used and the development of amino acid-producing strains has mainly focused on prokaryotes Corynebacterium glutamicum and Escherichia coli. However, the eukaryote Saccharomyces cerevisiae is becoming an even more appealing microbial host for production of amino acids and derivatives because of its superior molecular and physiological features, such as amenable to genetic engineering and high tolerance to harsh conditions. To transform S. cerevisiae into an industrial amino acid production platform, the highly coordinated and multiple layers regulation in its amino acid metabolism should be relieved and reconstituted to optimize the metabolic flux toward synthesis of target products. This chapter describes principles, strategies, and applications of modular pathway rewiring in yeast using the engineering of l-ornithine metabolism as a paradigm. Additionally, detailed protocols for in vitro module construction and CRISPR/Cas-mediated pathway assembly are provided.},
}
@article {pmid30173764,
year = {2018},
author = {Schultz, C and Lian, J and Zhao, H},
title = {Metabolic Engineering of Saccharomyces cerevisiae Using a Trifunctional CRISPR/Cas System for Simultaneous Gene Activation, Interference, and Deletion.},
journal = {Methods in enzymology},
volume = {608},
number = {},
pages = {265-276},
doi = {10.1016/bs.mie.2018.04.010},
pmid = {30173764},
issn = {1557-7988},
abstract = {Design and construction of an optimal microbial cell factory typically requires overexpression, knockdown, and knockout of multiple gene targets. In this chapter, we describe a combinatorial metabolic engineering strategy utilizing an orthogonal trifunctional CRISPR system that combines transcriptional activation, transcriptional interference, and gene deletion (CRISPR-AID) in the yeast Saccharomyces cerevisiae. This strategy enables multiplexed perturbation of the metabolic and regulatory networks in a modular, parallel, and high-throughput manner. To implement this system, three orthogonal Cas proteins were utilized: dLbCpf1 fused to a transcriptional activator, dSpCas9 fused to a transcriptional repressor, and SaCas9 for gene deletion. Deletion was accomplished by the introduction of a 28bp frame-shift mutation using a homology donor on the guide RNA expression vector. This approach enables the application of metabolic engineering to systematically optimize phenotypes of interest through a combination of gain-, reduction-, and loss-of-function mutations. Finally, we describe the construction of the CRISPR-AID system and its application toward engineering an example phenotype, surface display of recombinant Trichoderma reesei endoglucanase II.},
}
@article {pmid30171202,
year = {2018},
author = {McGinn, J and Marraffini, LA},
title = {Molecular mechanisms of CRISPR-Cas spacer acquisition.},
journal = {Nature reviews. Microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41579-018-0071-7},
pmid = {30171202},
issn = {1740-1534},
abstract = {Many bacteria and archaea have the unique ability to heritably alter their genomes by incorporating small fragments of foreign DNA, called spacers, into CRISPR loci. Once transcribed and processed into individual CRISPR RNAs, spacer sequences guide Cas effector nucleases to destroy complementary, invading nucleic acids. Collectively, these two processes are known as the CRISPR-Cas immune response. In this Progress article, we review recent studies that have advanced our understanding of the molecular mechanisms underlying spacer acquisition and that have revealed a fundamental link between the two phases of CRISPR immunity that ensures optimal immunity from newly acquired spacers. Finally, we highlight important open questions and discuss the potential basic and applied impact of spacer acquisition research.},
}
@article {pmid30170104,
year = {2018},
author = {Lee, JH and Wang, JH and Chen, J and Li, F and Edwards, TL and Hewitt, AW and Liu, GS},
title = {Gene therapy for visual loss: Opportunities and concerns.},
journal = {Progress in retinal and eye research},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.preteyeres.2018.08.003},
pmid = {30170104},
issn = {1873-1635},
abstract = {Many clinical trials using gene therapy have shown significant therapeutic benefits and exceptional safety records. Increasing evidence is verifying the long sought-after promise that gene therapy will genetically 'cure' some severely disabling diseases. In particular, the first gene therapy bioproduct for RPE65-associated Leber's congenital amaurosis, which was approved by the US Food and Drug Administration in 2017, has provided tremendous encouragement to the field of gene therapy. Recent developments in genome editing technologies have significantly advanced our capability to precisely engineer genomes in eukaryotic cells. Programmable nucleases, particularly the CRISPR/Cas system, have been widely adopted in studies applying genome engineering therapy to ocular diseases with the hope of managing these diseases. In this review article, we summarize the current approaches that have been developed in the area of gene therapy for ocular disease. We also discuss the challenges and opportunities facing gene therapy for ocular diseases, as well as its prospects.},
}
@article {pmid30170069,
year = {2018},
author = {Schuh, RS and Poletto, É and Pasqualim, G and Tavares, AMV and Meyer, FS and Gonzalez, EA and Giugliani, R and Matte, U and Teixeira, HF and Baldo, G},
title = {In vivo genome editing of mucopolysaccharidosis I mice using the CRISPR/Cas9 system.},
journal = {Journal of controlled release : official journal of the Controlled Release Society},
volume = {288},
number = {},
pages = {23-33},
doi = {10.1016/j.jconrel.2018.08.031},
pmid = {30170069},
issn = {1873-4995},
abstract = {Mucopolysaccharidosis type I (MPS I) is a multisystemic disorder caused by the deficiency of alpha-L-iduronidase (IDUA) that leads to intracellular accumulation of glycosaminoglycans (GAG). In the present study we aimed to use cationic liposomes carrying the CRISPR/Cas9 plasmid and a donor vector for in vitro and in vivo MPS I gene editing, and compare to treatment with naked plasmids. The liposomal formulation was prepared by microfluidization. Complexes were obtained by the addition of DNA at +4/-1 charge ratio. The overall results showed complexes of about 110 nm, with positive zeta potential of +30 mV. The incubation of the complexes with fibroblasts from MPS I patients led to a significant increase in IDUA activity and reduction of lysosomal abnormalities. Hydrodynamic injection of the liposomal complex in newborn MPS I mice led to a significant increase in serum IDUA levels for up to six months. The biodistribution of complexes after hydrodynamic injection was markedly detected in the lungs and heart, corroborating the results of increased IDUA activity and decreased GAG storage especially in these tissues, while the group that received the naked plasmids presented increased enzyme activity especially in the liver. Furthermore, animals treated with the liposomal formulation presented improvement in cardiovascular parameters, one of the main causes of death observed in MPS I patients. We conclude that the IDUA production in multiple organs had a significant beneficial effect on the characteristics of MPS I disease, which may bring hope to gene therapy of Hurler patients.},
}
@article {pmid30166482,
year = {2018},
author = {Knott, GJ and Doudna, JA},
title = {CRISPR-Cas guides the future of genetic engineering.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6405},
pages = {866-869},
doi = {10.1126/science.aat5011},
pmid = {30166482},
issn = {1095-9203},
abstract = {The diversity, modularity, and efficacy of CRISPR-Cas systems are driving a biotechnological revolution. RNA-guided Cas enzymes have been adopted as tools to manipulate the genomes of cultured cells, animals, and plants, accelerating the pace of fundamental research and enabling clinical and agricultural breakthroughs. We describe the basic mechanisms that set the CRISPR-Cas toolkit apart from other programmable gene-editing technologies, highlighting the diverse and naturally evolved systems now functionalized as biotechnologies. We discuss the rapidly evolving landscape of CRISPR-Cas applications, from gene editing to transcriptional regulation, imaging, and diagnostics. Continuing functional dissection and an expanding landscape of applications position CRISPR-Cas tools at the cutting edge of nucleic acid manipulation that is rewriting biology.},
}
@article {pmid30158244,
year = {2018},
author = {Ždralević, M and Brand, A and Di Ianni, L and Dettmer, K and Reinders, J and Singer, K and Peter, K and Schnell, A and Bruss, C and Decking, SM and Koehl, G and Felipe-Abrio, B and Durivault, J and Bayer, P and Evangelista, M and O'Brien, T and Oefner, PJ and Renner, K and Pouysségur, J and Kreutz, M},
title = {Double genetic disruption of lactate dehydrogenases A and B is required to ablate the &quot;Warburg effect&quot; restricting tumor growth to oxidative metabolism.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {41},
pages = {15947-15961},
doi = {10.1074/jbc.RA118.004180},
pmid = {30158244},
issn = {1083-351X},
abstract = {Increased glucose consumption distinguishes cancer cells from normal cells and is known as the &quot;Warburg effect&quot; because of increased glycolysis. Lactate dehydrogenase A (LDHA) is a key glycolytic enzyme, a hallmark of aggressive cancers, and believed to be the major enzyme responsible for pyruvate-to-lactate conversion. To elucidate its role in tumor growth, we disrupted both the LDHA and LDHB genes in two cancer cell lines (human colon adenocarcinoma and murine melanoma cells). Surprisingly, neither LDHA nor LDHB knockout strongly reduced lactate secretion. In contrast, double knockout (LDHA/B-DKO) fully suppressed LDH activity and lactate secretion. Furthermore, under normoxia, LDHA/B-DKO cells survived the genetic block by shifting their metabolism to oxidative phosphorylation (OXPHOS), entailing a 2-fold reduction in proliferation rates in vitro and in vivo compared with their WT counterparts. Under hypoxia (1% oxygen), however, LDHA/B suppression completely abolished in vitro growth, consistent with the reliance on OXPHOS. Interestingly, activation of the respiratory capacity operated by the LDHA/B-DKO genetic block as well as the resilient growth were not consequences of long-term adaptation. They could be reproduced pharmacologically by treating WT cells with an LDHA/B-specific inhibitor (GNE-140). These findings demonstrate that the Warburg effect is not only based on high LDHA expression, as both LDHA and LDHB need to be deleted to suppress fermentative glycolysis. Finally, we demonstrate that the Warburg effect is dispensable even in aggressive tumors and that the metabolic shift to OXPHOS caused by LDHA/B genetic disruptions is responsible for the tumors' escape and growth.},
}
@article {pmid30157762,
year = {2018},
author = {Butt, H and Jamil, M and Wang, JY and Al-Babili, S and Mahfouz, M},
title = {Engineering plant architecture via CRISPR/Cas9-mediated alteration of strigolactone biosynthesis.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {174},
doi = {10.1186/s12870-018-1387-1},
pmid = {30157762},
issn = {1471-2229},
support = {CRG4//King Abdullah University of Science and Technology/ ; },
mesh = {*CRISPR-Cas Systems ; Dioxygenases/*genetics/metabolism ; *Gene Expression Regulation, Plant ; Heterocyclic Compounds, 3-Ring/*metabolism ; Lactones/*metabolism ; Oryza/*genetics/metabolism ; Plant Growth Regulators/*metabolism ; Plant Proteins/*genetics/metabolism ; },
abstract = {BACKGROUND: Precision plant genome engineering holds much promise for targeted improvement of crop traits via unprecedented single-base level control over the genetic material. Strigolactones (SLs) are a key determinant of plant architecture, known for their role in inhibiting shoot branching (tillering).<br><br>RESULTS: We used CRISPR/Cas9 in rice (Oryza sativa) for targeted disruption of CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7), which controls a key step in SL biosynthesis. The ccd7 mutants exhibited a striking increase in tillering, combined with a reduced height, which could be rescued by application of the synthetic SL analog GR24. Striga germination assays and liquid chromatography-mass spectrometry analysis showed that root exudates of ccd7 mutants were also SL deficient.<br><br>CONCLUSIONS: Taken together, our results show the potential and feasibility of the use of the CRISPR/Cas9 system for targeted engineering of plant architecture and for elucidating the molecular underpinnings of architecture-related traits.},
}
@article {pmid30157725,
year = {2018},
author = {Nicholson, TJ and Jackson, SA and Croft, BI and Staals, RHJ and Fineran, PC and Brown, CM},
title = {Bioinformatic evidence of widespread priming in type I and II CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-11},
doi = {10.1080/15476286.2018.1509662},
pmid = {30157725},
issn = {1555-8584},
abstract = {CRISPR-Cas systems provide bacteria and archaea with adaptive immunity against invading genetic elements, such as plasmids, bacteriophages and archaeal viruses. They consist of cas genes and CRISPR loci, which store genetic memories of previously encountered invaders as short sequences termed spacers. Spacers determine the specificity of CRISPR-Cas defence and immunity can be gained or updated by the addition of new spacers into CRISPR loci. There are two main routes to spacer acquisition, which are known as naïve and primed CRISPR adaptation. Naïve CRISPR adaptation involves the de novo formation of immunity, independent of pre-existing spacers. In contrast, primed CRISPR adaptation (priming) uses existing spacers to enhance the acquisition of new spacers. Priming typically results in spacer acquisition from locations near the site of target recognition by the existing (priming) spacer. Primed CRISPR adaptation has been observed in several type I CRISPR-Cas systems and it is potentially widespread. However, experimental evidence is unavailable for some subtypes, and for most systems, priming has only been shown in a small number of hosts. There is also no current evidence of priming by other CRISPR-Cas types. Here, we used a bioinformatic approach to search for evidence of priming in diverse CRISPR-Cas systems. By analysing the clustering of spacers acquired from phages, prophages and archaeal viruses, including strand and directional biases between subsequently acquired spacers, we demonstrate that two patterns of primed CRISPR adaptation dominate in type I systems. In addition, we find evidence of a priming-like pathway in type II CRISPR-Cas systems.},
}
@article {pmid30157456,
year = {2018},
author = {Aumann, RA and Schetelig, MF and Häcker, I},
title = {Highly efficient genome editing by homology-directed repair using Cas9 protein in Ceratitis capitata.},
journal = {Insect biochemistry and molecular biology},
volume = {101},
number = {},
pages = {85-93},
doi = {10.1016/j.ibmb.2018.08.004},
pmid = {30157456},
issn = {1879-0240},
abstract = {The Mediterranean fruit fly Ceratitis capitata is a highly polyphagous and invasive insect pest, causing enormous economic damage in horticultural systems. A successful and environment-friendly control strategy is the sterile insect technique (SIT) that reduces pest populations through infertile matings with mass-released, sterilized insects. However, the SIT is not readily applicable to each pest species. While transgenic approaches hold great promise to improve critical aspects of the SIT to transfer it to new species, they are suspect to strict or even prohibitive legislation regarding the release of genetically modified (GM) organisms. In contrast, specific mutations created via CRISPR-Cas genome editing are not regulated as GM in the US, and might thus allow creating optimal strains for SIT. Here, we describe highly efficient homology-directed repair genome editing in C. capitata by injecting pre-assembled CRISPR-Cas9 ribonucleoprotein complexes using different guide RNAs and a short single-stranded oligodeoxynucleotide donor to convert an enhanced green fluorescent protein in C. capitata into a blue fluorescent protein. Six out of seven fertile and individually backcrossed G0 individuals generated 57-90% knock-in rate within their total offspring and 70-96% knock-in rate within their phenotypically mutant offspring. Based on the achieved efficiency, this approach could also be used to introduce mutations which do not produce a screenable phenotype and identify positive mutants with a reasonable workload. Furthermore, CRISPR-Cas HDR would allow to recreate mutations formerly identified in classical mutagenesis screens and to transfer them to related species to establish new (SIT-like) pest control systems. Considering the potential that CRISPR-induced alterations in organisms could be classified as non-GM in additional countries, such new strains could potentially be used for pest control applications without the need to struggle with GMO directives.},
}
@article {pmid30155813,
year = {2018},
author = {Maier, JAH and Jeltsch, A},
title = {Design and Application of 6mA-Specific Zinc-Finger Proteins for the Readout of DNA Methylation.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1867},
number = {},
pages = {29-41},
doi = {10.1007/978-1-4939-8799-3_3},
pmid = {30155813},
issn = {1940-6029},
abstract = {Designed zinc-finger (ZnF) proteins can recognize AT base pairs by H-bonds in the major groove, which are disrupted, if the adenine base is methylated at the N6 position. Based on this principle, we have recently designed a ZnF protein, which does not bind to DNA, if its recognition site is methylated. In this review, we summarize the principles of the recognition of methylated DNA by proteins and describe the design steps starting with the initial bacterial two-hybrid screening of three-domain ZnF proteins that do not bind to CcrM methylated target sites, followed by their di- and tetramerization to improve binding affinity and specificity. One of the 6mA-specific ZnF proteins was used as repressor to generate a methylation-sensitive promoter/repressor system. This artificial promoter/repressor system was employed to regulate the expression of a CcrM DNA methyltransferase gene, thereby generating an epigenetic system with positive feedback, which can exist in two stable states, an off-state with unmethylated promoter, bound ZnF and repressed gene expression, and an on-state with methylated promoter and active gene expression. This system can memorize transient signals approaching bacterial cells and store the input in the form of DNA methylation patterns. More generally, the ability to bind to DNA in a methylation-dependent manner gives ZnF and TAL proteins an advantage over CRISPR/Cas as DNA-targeting device by allowing methylation-dependent genome or epigenome editing.},
}
@article {pmid30153081,
year = {2018},
author = {Nickel, L and Ulbricht, A and Alkhnbashi, OS and Förstner, KU and Cassidy, L and Weidenbach, K and Backofen, R and Schmitz, RA},
title = {Cross-cleavage activity of Cas6b in crRNA processing of two different CRISPR-Cas systems in Methanosarcina mazei Gö1.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1514234},
pmid = {30153081},
issn = {1555-8584},
abstract = {The clustered regularly interspaced short palindromic repeat (CRISPR) system is a prokaryotic adaptive defense system against foreign nucleic acids. In the methanoarchaeon Methanosarcina mazei Gö1, two types of CRISPR-Cas systems are present (type I-B and type III-C). Both loci encode a Cas6 endonuclease, Cas6b-IB and Cas6b-IIIC, typically responsible for maturation of functional short CRISPR RNAs (crRNAs). To evaluate potential cross cleavage activity, we biochemically characterized both Cas6b proteins regarding their crRNA binding behavior and their ability to process pre-crRNA from the respective CRISPR array in vivo. Maturation of crRNA was studied in the respective single deletion mutants by northern blot and RNA-Seq analysis demonstrating that in vivo primarily Cas6b-IB is responsible for crRNA processing of both CRISPR arrays. Tentative protein level evidence for the translation of both Cas6b proteins under standard growth conditions was detected, arguing for different activities or a potential non-redundant role of Cas6b-IIIC within the cell. Conservation of both Cas6 endonucleases was observed in several other M. mazei isolates, though a wide variety was displayed. In general, repeat and leader sequence conservation revealed a close correlation in the M. mazei strains. The repeat sequences from both CRISPR arrays from M. mazei Gö1 contain the same sequence motif with differences only in two nucleotides. These data stand in contrast to all other analyzed M. mazei isolates, which have at least one additional CRISPR array with repeats belonging to another sequence motif. This conforms to the finding that Cas6b-IB is the crucial and functional endonuclease in M. mazei Gö1.<br><br>ABBREVIATIONS: sRNA: small RNA; crRNA: CRISPR RNA; pre-crRNAs: Precursor CRISPR RNA; CRISPR: clustered regularly interspaced short palindromic repeats; Cas: CRISPR associated; nt: nucleotide; RNP: ribonucleoprotein; RBS: ribosome binding site.},
}
@article {pmid30150735,
year = {2018},
author = {Shaw, WR and Catteruccia, F},
title = {Vector biology meets disease control: using basic research to fight vector-borne diseases.},
journal = {Nature microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41564-018-0214-7},
pmid = {30150735},
issn = {2058-5276},
abstract = {Human pathogens that are transmitted by insects are a global problem, particularly those vectored by mosquitoes; for example, malaria parasites transmitted by Anopheles species, and viruses such as dengue, Zika and chikungunya that are carried by Aedes mosquitoes. Over the past 15 years, the prevalence of malaria has been substantially reduced and virus outbreaks have been contained by controlling mosquito vectors using insecticide-based approaches. However, disease control is now threatened by alarming rates of insecticide resistance in insect populations, prompting the need to develop a new generation of specific strategies that can reduce vector-mediated transmission. Here, we review how increased knowledge in insect biology and insect-pathogen interactions is stimulating new concepts and tools for vector control. We focus on strategies that either interfere with the development of pathogens within their vectors or directly impact insect survival, including enhancement of vector-mediated immune control, manipulation of the insect microbiome, or use of powerful new genetic tools such as CRISPR-Cas systems to edit vector genomes. Finally, we offer a perspective on the implementation hurdles as well as the knowledge gaps that must be filled in the coming years to safely realize the potential of these novel strategies to eliminate the scourge of vector-borne disease.},
}
@article {pmid30150396,
year = {2018},
author = {Zhu, F and Feng, M and Sinha, R and Seita, J and Mori, Y and Weissman, IL},
title = {Screening for genes that regulate the differentiation of human megakaryocytic lineage cells.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {40},
pages = {E9308-E9316},
doi = {10.1073/pnas.1805434115},
pmid = {30150396},
issn = {1091-6490},
support = {R00 CA201075/CA/NCI NIH HHS/United States ; R01 CA086065/CA/NCI NIH HHS/United States ; U01 HL099999/HL/NHLBI NIH HHS/United States ; },
mesh = {Blood Platelets/cytology/*metabolism ; CRISPR-Cas Systems ; Cell Differentiation/*physiology ; Cell Line ; Humans ; Megakaryocyte Progenitor Cells/cytology ; },
abstract = {Different combinations of transcription factors (TFs) function at each stage of hematopoiesis, leading to distinct expression patterns of lineage-specific genes. The identification of such regulators and their functions in hematopoiesis remain largely unresolved. In this study, we utilized screening approaches to study the transcriptional regulators of megakaryocyte progenitor (MkP) generation, a key step before platelet production. Promising candidate genes were generated from a microarray platform gene expression commons and individually manipulated in human hematopoietic stem and progenitor cells (HSPCs). Deletion of some of the candidate genes (the hit genes) by CRISPR/Cas9 led to decreased MkP generation during HSPC differentiation, while more MkPs were produced when some hit genes were overexpressed in HSPCs. We then demonstrated that overexpression of these genes can increase the frequency of mature megakaryocytic colonies by functional colony forming unit-megakaryocyte (CFU-Mk) assay and the release of platelets after in vitro maturation. Finally, we showed that the histone deacetylase inhibitors could also increase MkP differentiation, possibly by regulating some of the newly identified TFs. Therefore, identification of such regulators will advance the understanding of basic mechanisms of HSPC differentiation and conceivably enable the generation and maturation of megakaryocytes and platelets in vitro.},
}
@article {pmid30150254,
year = {2018},
author = {Wang, Z and Hardcastle, TJ and Canto Pastor, A and Yip, WH and Tang, S and Baulcombe, DC},
title = {A novel DCL2-dependent miRNA pathway in tomato affects susceptibility to RNA viruses.},
journal = {Genes &amp; development},
volume = {32},
number = {17-18},
pages = {1155-1160},
doi = {10.1101/gad.313601.118},
pmid = {30150254},
issn = {1549-5477},
mesh = {CRISPR-Cas Systems ; Disease Susceptibility ; Lycopersicon esculentum/enzymology/*genetics/*virology ; MicroRNAs/*metabolism ; Mutation ; Plant Diseases/virology ; RNA Viruses/*physiology ; RNA, Small Untranslated/metabolism ; Ribonuclease III/genetics/*metabolism ; },
abstract = {Tomato Dicer-like2 (slDCL2) is a key component of resistance pathways against potato virus X (PVX) and tobacco mosaic virus (TMV). It is also required for production of endogenous small RNAs, including miR6026 and other noncanonical microRNAs (miRNAs). The slDCL2 mRNAs are targets of these slDCL2-dependent RNAs in a feedback loop that was disrupted by target mimic RNAs of miR6026. In lines expressing these RNAs, there was correspondingly enhanced resistance against PVX and TMV. These findings illustrate a novel miRNA pathway in plants and a crop protection strategy in which miRNA target mimicry elevates expression of defense-related mRNAs.},
}
@article {pmid30146918,
year = {2018},
author = {Auster, O and Globus, R and Yosef, I and Qimron, U},
title = {Optimizing DNA transduction by selection of mutations that evade bacterial defense systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-5},
doi = {10.1080/15476286.2018.1514235},
pmid = {30146918},
issn = {1555-8584},
abstract = {We recently developed a platform where phage-transducing particles optimize DNA delivery to a wide range of hosts. Here, we use this platform to optimize DNA transduction into hosts that naturally restrict specific DNA sequences. We first show that a specific plasmid is restricted for transduction into a particular Salmonella strain. Using the platform, we select for a mutated plasmid that overcomes the restriction barrier. Insertion of the non-mutated sequence into a permissive plasmid restricts transduction. We further show that epigenetic modification enables the DNA to evade restriction by the putative defense system. Our results validate this straightforward genetic approach for optimization of DNA transduction into new hosts.},
}
@article {pmid30146914,
year = {2018},
author = {Papathanasiou, P and Erdmann, S and Leon-Sobrino, C and Sharma, K and Urlaub, H and Garrett, RA and Peng, X},
title = {Stable maintenance of the rudivirus SIRV3 in a carrier state in Sulfolobus islandicus despite activation of the CRISPR-Cas immune response by a second virus SMV1.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-9},
doi = {10.1080/15476286.2018.1511674},
pmid = {30146914},
issn = {1555-8584},
abstract = {Carrier state viral infection constitutes an equilibrium state in which a limited fraction of a cellular population is infected while the remaining cells are transiently resistant to infection. This type of infection has been characterized for several bacteriophages but not, to date, for archaeal viruses. Here we demonstrate that the rudivirus SIRV3 can produce a host-dependent carrier state infection in the model crenarchaeon Sulfolobus. SIRV3 only infected a fraction of a Sulfolobus islandicus REY15A culture over several days during which host growth was unimpaired and no chromosomal DNA degradation was observed. CRISPR spacer acquisition from SIRV3 DNA was induced by coinfecting with the monocaudavirus SMV1 and it was coincident with increased transcript levels from subtype I-A adaptation and interference cas genes. However, this response did not significantly affect the carrier state infection of SIRV3 and both viruses were maintained in the culture over 12 days during which SIRV3 anti-CRISPR genes were shown to be expressed. Transcriptome and proteome analyses demonstrated that most SIRV3 genes were expressed at varying levels over time whereas SMV1 gene expression was generally low. The study yields insights into the basis for the stable infection of SIRV3 and the resistance to the different host CRISPR-Cas interference mechanisms. It also provides a rationale for the commonly observed coinfection of archaeal cells by different viruses in natural environments.},
}
@article {pmid30139026,
year = {2018},
author = {Zuo, CX and Bian, XC and Yang, ZL and Feng, HL and Zhou, FY and Liu, YQ},
title = {[Establishment of Cas9 stably expressed human hepatocellular carcinoma and cholangiocarcinoma cell lines].},
journal = {Zhonghua zhong liu za zhi [Chinese journal of oncology]},
volume = {40},
number = {8},
pages = {572-579},
pmid = {30139026},
issn = {0253-3766},
support = {NSTI-CR17//National Science and Technology Infrastructure Program/ ; 2016-12M-3-005//CAMS Innovative Fund for Medical Science/ ; },
mesh = {Bile Duct Neoplasms/*genetics/pathology/virology ; CRISPR-Associated Proteins/metabolism ; CRISPR-Cas Systems/*genetics ; Carcinoma, Hepatocellular/*genetics/pathology/virology ; *Cell Line, Tumor/pathology/virology ; Cholangiocarcinoma/*genetics/pathology/virology ; Gallbladder Neoplasms/*genetics/pathology/virology ; Genetic Vectors ; Genome ; Humans ; Lentivirus ; Liver Neoplasms/*genetics/pathology/virology ; RNA, Guide ; },
abstract = {Objective: To facilitate using the CRISPR/Cas9 gene editing system in human liver and gallbladder cancer cells, we established Cas9 stably expressed human liver and gallbladder cancer cell lines, and validated the gene editing activity of Cas9. Methods: Human liver cancer cell lines (Huh7, PLC/PRF/5, HepG2, Hep3b, SK-HEP-1 and Li-7), human cholangiocarcinoma cells (RBE) and human gallbladder cancer cells (GBC-SD) were infected with 3 Cas9-expressing lentivirus vectors (pLv-EF1α-Cas9-Flag-Neo, pLv-EF1α-Cas9-Flag-Puro, Cas9m1.1), respectively, and Cas9 stably expressed colonies were screened and selected. We extracted the genomic DNA and protein, validated the stable expression of Cas9 by using genomic polymerase chain reaction (PCR) and western blot. Three of cell lines were further infected with Lv-EF1α-mCherry. Then mCherry positive cells were sorted by flow cytometry and infected with designed guide RNA (gRNA) vectors which targeted mCherry gene. Subsequently the gene editing activity of Cas9 was detected by genomic PCR, fluorescence microscopic observation and flow cytometry analysis. Results: One hundred Cas9-expressing human liver and gallbladder cancer cell lines were selected. Among them, 35 cell lines expressed Cas9-Neo, 25 expressed Cas9-puro, and 40 expressed mutant Cas9 (mCas9). We also established 3 cell lines with stable expression of mCherry (Huh7-mCas9-M, PLC/PRF/5-Cas9-M and SK-HEP-1-Cas9-M). The results of genomic PCR and sequencing showed that by lentiviral infection with 2 types of designed gRNA, the long fragment deletion of mCherry gene was found in these 3 cell lines. Moreover, mCherry(-)EGFP(+) cells infected with 2 types of gRNA were observed by fluorescence microscope. The results of flow cytometry showed that mCherry(-)EGFP(+) cells accounted from 0.3% to 93.6%. Conclusion: We successfully establish 100 human liver and gallbladder cancer cell lines with stable expression of Cas9 protein and validate their activities of gene editing.},
}
@article {pmid30135027,
year = {2018},
author = {Ren, C and Xu, K and Segal, DJ and Zhang, Z},
title = {Strategies for the Enrichment and Selection of Genetically Modified Cells.},
journal = {Trends in biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tibtech.2018.07.017},
pmid = {30135027},
issn = {1879-3096},
abstract = {Programmable artificial nucleases have transitioned over the past decade from ZFNs and TALENs to CRISPR/Cas systems, which have been ubiquitously used with great success to modify genomes. The efficiencies of knockout and knockin vary widely among distinct cell types and genomic loci and depend on the nuclease delivery and cleavage efficiencies. Moreover, genetically modified cells are almost phenotypically indistinguishable from normal counterparts, making screening and isolating positive cells rather challenging and time-consuming. To address this issue, we review several strategies for the enrichment and selection of genetically modified cells, including transfection-positive selection, nuclease-positive selection, genome-targeted positive selection, and knockin-positive selection, to provide a reference for future genome research and gene therapy studies.},
}
@article {pmid30130453,
year = {2018},
author = {Nethery, MA and Barrangou, R},
title = {CRISPR Visualizer: rapid identification and visualization of CRISPR loci via an automated high-throughput processing pipeline.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-8},
doi = {10.1080/15476286.2018.1493332},
pmid = {30130453},
issn = {1555-8584},
abstract = {A CRISPR locus, defined by an array of repeat and spacer elements, constitutes a genetic record of the ceaseless battle between bacteria and viruses, showcasing the genomic integration of spacers acquired from invasive DNA. In particular, iterative spacer acquisitions represent unique evolutionary histories and are often useful for high-resolution bacterial genotyping, including comparative analysis of closely related organisms, clonal lineages, and clinical isolates. Current spacer visualization methods are typically tedious and can require manual data manipulation and curation, including spacer extraction at each CRISPR locus from genomes of interest. Here, we constructed a high-throughput extraction pipeline coupled with a local web-based visualization tool which enables CRISPR spacer and repeat extraction, rapid visualization, graphical comparison, and progressive multiple sequence alignment. We present the bioinformatic pipeline and investigate the loci of reference CRISPR-Cas systems and model organisms in 4 well-characterized subtypes. We illustrate how this analysis uncovers the evolutionary tracks and homology shared between various organisms through visual comparison of CRISPR spacers and repeats, driven through progressive alignments. Due to the ability to process unannotated genome files with minimal preparation and curation, this pipeline can be implemented promptly. Overall, this efficient high-throughput solution supports accelerated analysis of genomic data sets and enables and expedites genotyping efforts based on CRISPR loci.},
}
@article {pmid30126372,
year = {2018},
author = {Bachas, C and Hodzic, J and van der Mijn, JC and Stoepker, C and Verheul, HMW and Wolthuis, RMF and Felley-Bosco, E and van Wieringen, WN and van Beusechem, VW and Brakenhoff, RH and de Menezes, RX},
title = {Rscreenorm: normalization of CRISPR and siRNA screen data for more reproducible hit selection.},
journal = {BMC bioinformatics},
volume = {19},
number = {1},
pages = {301},
doi = {10.1186/s12859-018-2306-z},
pmid = {30126372},
issn = {1471-2105},
support = {CCA2014-5-19//Stichting VUmc Cancer Center Amsterdam/ ; 10701//KWF Kankerbestrijding/ ; },
mesh = {Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Genetic Testing/*methods ; Genomics/*methods ; Humans ; RNA, Small Interfering/*genetics ; Reproducibility of Results ; },
abstract = {BACKGROUND: Reproducibility of hits from independent CRISPR or siRNA screens is poor. This is partly due to data normalization primarily addressing technical variability within independent screens, and not the technical differences between them.<br><br>RESULTS: We present &quot;rscreenorm&quot;, a method that standardizes the functional data ranges between screens using assay controls, and subsequently performs a piecewise-linear normalization to make data distributions across all screens comparable. In simulation studies, rscreenorm reduces false positives. Using two multiple-cell lines siRNA screens, rscreenorm increased reproducibility between 27 and 62% for hits, and up to 5-fold for non-hits. Using publicly available CRISPR-Cas screen data, application of commonly used median centering yields merely 34% of overlapping hits, in contrast with rscreenorm yielding 84% of overlapping hits. Furthermore, rscreenorm yielded at most 8% discordant results, whilst median-centering yielded as much as 55%.<br><br>CONCLUSIONS: Rscreenorm yields more consistent results and keeps false positive rates under control, improving reproducibility of genetic screens data analysis from multiple cell lines.},
}
@article {pmid30126366,
year = {2018},
author = {Argemi, X and Matelska, D and Ginalski, K and Riegel, P and Hansmann, Y and Bloom, J and Pestel-Caron, M and Dahyot, S and Lebeurre, J and Prévost, G},
title = {Comparative genomic analysis of Staphylococcus lugdunensis shows a closed pan-genome and multiple barriers to horizontal gene transfer.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {621},
doi = {10.1186/s12864-018-4978-1},
pmid = {30126366},
issn = {1471-2164},
support = {2014/15/B/NZ1/03357//Polish National Science Centre/ ; },
abstract = {BACKGROUND: Coagulase negative staphylococci (CoNS) are commensal bacteria on human skin. Staphylococcus lugdunensis is a unique CoNS which produces various virulence factors and may, like S. aureus, cause severe infections, particularly in hospital settings. Unlike other staphylococci, it remains highly susceptible to antimicrobials, and genome-based phylogenetic studies have evidenced a highly conserved genome that distinguishes it from all other staphylococci.<br><br>RESULTS: We demonstrate that S. lugdunensis possesses a closed pan-genome with a very limited number of new genes, in contrast to other staphylococci that have an open pan-genome. Whole-genome nucleotide and amino acid identity levels are also higher than in other staphylococci. We identified numerous genetic barriers to horizontal gene transfer that might explain this result. The S. lugdunensis genome has multiple operons encoding for restriction-modification, CRISPR/Cas and toxin/antitoxin systems. We also identified a new PIN-like domain-associated protein that might belong to a larger operon, comprising a metalloprotease, that could function as a new toxin/antitoxin or detoxification system.<br><br>CONCLUSION: We show that S. lugdunensis has a unique genome profile within staphylococci, with a closed pan-genome and several systems to prevent horizontal gene transfer. Its virulence in clinical settings does not rely on its ability to acquire and exchange antibiotic resistance genes or other virulence factors as shown for other staphylococci.},
}
@article {pmid30124643,
year = {2018},
author = {Xu, L and Gao, Y and Lau, YS and Han, R},
title = {Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {138},
pages = {},
doi = {10.3791/57560},
pmid = {30124643},
issn = {1940-087X},
support = {R01 HL116546/HL/NHLBI NIH HHS/United States ; R01 AR064241/AR/NIAMS NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Dystrophin/*metabolism ; Gene Editing/*methods ; Humans ; Mice ; Muscular Dystrophy, Duchenne/*genetics/*metabolism ; },
abstract = {The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.},
}
@article {pmid30123320,
year = {2018},
author = {Li, J and Xu, Z and Chupalov, A and Marchisio, MA},
title = {Anti-CRISPR-based biosensors in the yeast S. cerevisiae.},
journal = {Journal of biological engineering},
volume = {12},
number = {},
pages = {11},
doi = {10.1186/s13036-018-0101-z},
pmid = {30123320},
issn = {1754-1611},
abstract = {Background: Anti-CRISPR proteins are expressed by phages as a reaction to the bacterial CRISPR-Cas defense system. Recently, the structures of anti-CRISPR proteins have been determined, and their diverse functions have been clarified. Anti-CRISPR proteins such as LmAcrIIA2 and LmAcrIIA4 interact with the SpCas9:gRNA system and occlude the protospacer adjacent motif (PAM) recognition site, thereby preventing SpCas9:gRNA from binding to the DNA. Hence, anti-CRISPR proteins represent a powerful means to control and modulate the activity of SpCas9 and its nuclease-deficient version dSpCas9. LmAcrIIA2 and LmAcrIIA4 have been shown to be efficient inhibitors of SpCas9 in Escherichia coli, Saccharomyces cerevisiae, and mammalian cells. To date, there have been no reports of anti-CRISPR-based synthetic gene circuits engineered into yeast cells.<br><br>Results: We constructed in the yeast S. cerevisiae synthetic biosensors based on the anti-CRISPR-dSpCas9:gRNA interaction. Upon induction with galactose or β-estradiol, anti-CRISPR proteins (LmAcrIIA4, LmAcrIIA2, and StAcrIIA5) produced an enhancement in fluorescence expression by preventing the dSpCas9-Mxi1:gRNA complex from binding to the DNA. We found that LmAcrIIA2 performed as well as LmAcrIIA4 in S. cerevisiae, whereas StAcrIIA5, which had previously been tested in bacteria only, had non-negligible negative effects on yeast cell growth. The efficiency of anti-CRISPR-based biosensors was strongly dependent on the means by which the guide RNAs were produced. The best performance, as measured by the increase in fluorescence, was achieved using a &quot;ribozyme-gRNA-ribozyme&quot; expression cassette under the control of the yeast constitutive ADH1 promoter.<br><br>Conclusions: This work demonstrates that anti-CRISPR proteins are effective dSpCas9 suppressors in yeast cells. In particular, LmAcrIIA2 and LmAcrIIA4 could be employed as new components of yeast synthetic gene circuits.},
}
@article {pmid30122537,
year = {2018},
author = {Meeske, AJ and Marraffini, LA},
title = {RNA Guide Complementarity Prevents Self-Targeting in Type VI CRISPR Systems.},
journal = {Molecular cell},
volume = {71},
number = {5},
pages = {791-801.e3},
doi = {10.1016/j.molcel.2018.07.013},
pmid = {30122537},
issn = {1097-4164},
abstract = {All immune systems use precise target recognition to interrogate foreign invaders. During CRISPR-Cas immunity, prokaryotes capture short spacer sequences from infecting viruses and insert them into the CRISPR array. Transcription and processing of the CRISPR locus generate small RNAs containing the spacer and repeat sequences that guide Cas nucleases to cleave a complementary protospacer in the invading nucleic acids. In most CRISPR systems, sequences flanking the protospacer drastically affect cleavage. Here, we investigated the target requirements of the recently discovered RNA-targeting type VI-A CRISPR-Cas system in its natural host, Listeria seeligeri. We discovered that target RNAs with extended complementarity between the protospacer flanking sequence and the repeat sequence of the guide RNA are not cleaved by the type VI-A nuclease Cas13, neither in vivo nor in vitro. These findings establish fundamental rules for the design of Cas13-based technologies and provide a mechanism for preventing self-targeting in type VI-A systems.},
}
@article {pmid30120945,
year = {2018},
author = {Qi, X and Zhu, L and Yang, B and Luo, H and Xu, W and He, X and Huang, K},
title = {Mitigation of cell apoptosis induced by ochratoxin A (OTA) is possibly through organic cation transport 2 (OCT2) knockout.},
journal = {Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association},
volume = {121},
number = {},
pages = {15-23},
doi = {10.1016/j.fct.2018.08.026},
pmid = {30120945},
issn = {1873-6351},
abstract = {Ochratoxin A (OTA) is a secondary metabolite of fungi such as Aspergillus ochraceus, A. niger and A. carbonarius, Penicillium verrucosum, and various other Penicillium, Petromyces, and Neopetromyces species. Various foods can be contaminated with OTA, potentially causing several toxic effects such as nephrotoxicity, hepatotoxicity and neurotoxicity. Typically, OTA is excreted by organic anion transporters (OATs). There is no research indicating organic cation transporters (OCTs) are involved in OTA nephrotoxicity. In our study, NRK-52E cells and rats were treated with OTA. OTA changed the expression of OCT1, OCT2 and OCT3 in NRK-52E cells and rat kidneys. TEA alleviated OTA-induced cell death, apoptosis, and DNA damage, and increased ROS. The OCT2 knockout cell line was constructed by the CRISPR/Cas 9 system. OCT2 knockout did not change the gene expression of OCT1, OAT1 and OAT3. OCT2 knockout alleviated the increase of Caspase 3 and CDK1 induced by OTA, leading to a reduction of apoptosis. In addition, OCT2 overexpression increased cell toxicity and expression of Caspase 3. In short, our findings indicate that OCT2 knockout possibly mitigate OTA-induced apoptosis by preventing the increase of Caspase 3 and CDK1.},
}
@article {pmid30117419,
year = {2018},
author = {Huang, YQ and Li, GL and Yang, HQ and Wu, ZF},
title = {[Progress and application of genome-edited pigs in biomedical research].},
journal = {Yi chuan = Hereditas},
volume = {40},
number = {8},
pages = {632-646},
doi = {10.16288/j.yczz.18-026},
pmid = {30117419},
issn = {0253-9772},
abstract = {Genome editing technologies (GETs) can precisely alter the genomic sequences and modify the genetic information at the target site of an organism. Since the beginning of the 21st century, the GETs, including zinc finger nucleases (ZFN), transcription-activating-like receptor factor (TALEN), and clustered regularly interspaced short palindromic repeats/Cas endonucleases (CRISPR/Cas), have been successively developed. The GETs can easily engineer the targeted genomic site of animals to exhibit a desired phenotype(s), thereby providing valuable tools in biomedical research. The pigs are closely related to human, in terms of similarities in physiological properties and pathogenic characters. Thus, pigs have been used as important animal models in studies of human disease, xenotransplantation, and humanized organs regeneration. In this review, we summarize the development of the three GETs, research progress of genome-edited pigs as disease models and organ donors for xenotransplantation, and the prospects of their applications in future biomedical research.},
}
@article {pmid30117250,
year = {2018},
author = {Cabello-Yeves, PJ and Picazo, A and Camacho, A and Callieri, C and Rosselli, R and Roda-Garcia, JJ and Coutinho, FH and Rodriguez-Valera, F},
title = {Ecological and genomic features of two widespread freshwater picocyanobacteria.},
journal = {Environmental microbiology},
volume = {20},
number = {10},
pages = {3757-3771},
doi = {10.1111/1462-2920.14377},
pmid = {30117250},
issn = {1462-2920},
support = {//FEDER funds/ ; //Generalitat Valenciana/ ; CGL2015-69557-R'//CLIMAWET/ ; //Spanish Ministry of Economy and Competitiveness/ ; //European Fund for Regional Development/ ; },
abstract = {We present two genomes of widespread freshwater picocyanobacteria isolated by extinction dilution from a Spanish oligotrophic reservoir. Based on microscopy and genomic properties, both picocyanobacteria were tentatively designated Synechococcus lacustris Tous, formerly described as a metagenome assembled genome (MAG) from the same habitat, and Cyanobium usitatum Tous, described here for the first time. Both strains were purified in unicyanobacterial cultures, and their genomes were sequenced. They are broadly distributed in freshwater systems; the first seems to be a specialist on temperate reservoirs (Tous, Amadorio, Dexter, Lake Lanier, Sparkling), and the second appears to also be abundant in cold environments including ice-covered lakes such as Lake Baikal, Lake Erie or the brackish Baltic Sea. Having complete genomes provided access to the flexible genome that does not assemble in MAGs. We found several genomic islands in both genomes, within which there were genes for nitrogen acquisition, transporters for a wide set of compounds and biosynthesis of phycobilisomes in both strains. Some of these regions of low coverage in metagenomes also included antimicrobial compounds, transposases and phage defence systems, including a novel type III CRISPR-Cas phage defence system that was only detected in Synechococcus lacustris Tous.},
}
@article {pmid30112967,
year = {2018},
author = {Gordon-Lipkin, E and Fatemi, A},
title = {Current Therapeutic Approaches in Leukodystrophies: A Review.},
journal = {Journal of child neurology},
volume = {33},
number = {13},
pages = {861-868},
doi = {10.1177/0883073818792313},
pmid = {30112967},
issn = {1708-8283},
abstract = {Leukodystrophies are a heterogeneous class of genetic diseases affecting the white matter in the central nervous system with a broad range of clinical manifestations and a frequently progressive course. An interest in precision medicine has emerged over the last several decades, and biomedical research in leukodystrophies has made exciting advances along this front through therapeutic target discovery and novel disease model systems. In this review, we discuss current and emerging therapeutic approaches in leukodystrophies, including gene therapy, antisense oligonucleotide therapy, CRISPR/CAS-based gene editing, and cell and stem cell based therapies.},
}
@article {pmid30109815,
year = {2018},
author = {Gleditzsch, D and Pausch, P and Müller-Esparza, H and Özcan, A and Guo, X and Bange, G and Randau, L},
title = {PAM identification by CRISPR-Cas effector complexes: diversified mechanisms and structures.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-14},
doi = {10.1080/15476286.2018.1504546},
pmid = {30109815},
issn = {1555-8584},
abstract = {Adaptive immunity of prokaryotes is mediated by CRISPR-Cas systems that employ a large variety of Cas protein effectors to identify and destroy foreign genetic material. The different targeting mechanisms of Cas proteins rely on the proper protection of the host genome sequence while allowing for efficient detection of target sequences, termed protospacers. A short DNA sequence, the protospacer-adjacent motif (PAM), is frequently used to mark proper target sites. Cas proteins have evolved a multitude of PAM-interacting domains, which enables them to cope with viral anti-CRISPR measures that alter the sequence or accessibility of PAM elements. In this review, we summarize known PAM recognition strategies for all CRISPR-Cas types. Available structures of target bound Cas protein effector complexes highlight the diversity of mechanisms and domain architectures that are employed to guarantee target specificity.},
}
@article {pmid30108577,
year = {2018},
author = {Maikova, A and Severinov, K and Soutourina, O},
title = {New Insights Into Functions and Possible Applications of Clostridium difficile CRISPR-Cas System.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1740},
doi = {10.3389/fmicb.2018.01740},
pmid = {30108577},
issn = {1664-302X},
abstract = {Over the last decades the enteric bacterium Clostridium difficile (novel name Clostridioides difficile) - has emerged as an important human nosocomial pathogen. It is a leading cause of hospital-acquired diarrhea and represents a major challenge for healthcare providers. Many aspects of C. difficile pathogenesis and its evolution remain poorly understood. Efficient defense systems against phages and other genetic elements could have contributed to the success of this enteropathogen in the phage-rich gut communities. Recent studies demonstrated the presence of an active CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) subtype I-B system in C. difficile. In this mini-review, we will discuss the recent advances in characterization of original features of the C. difficile CRISPR-Cas system in laboratory and clinical strains, as well as interesting perspectives for our understanding of this defense system function and regulation in this important enteropathogen. This knowledge will pave the way for the development of promising biotechnological and therapeutic tools in the future. Possible applications for the C. difficile strain monitoring and genotyping, as well as for CRISPR-based genome editing and antimicrobials are also discussed.},
}
@article {pmid30107450,
year = {2018},
author = {Künne, T and Zhu, Y and da Silva, F and Konstantinides, N and McKenzie, RE and Jackson, RN and Brouns, SJ},
title = {Role of nucleotide identity in effective CRISPR target escape mutations.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gky687},
pmid = {30107450},
issn = {1362-4962},
abstract = {Prokaryotes use primed CRISPR adaptation to update their memory bank of spacers against invading genetic elements that have escaped CRISPR interference through mutations in their protospacer target site. We previously observed a trend that nucleotide-dependent mismatches between crRNA and the protospacer strongly influence the efficiency of primed CRISPR adaptation. Here we show that guanine-substitutions in the target strand of the protospacer are highly detrimental to CRISPR interference and interference-dependent priming, while cytosine-substitutions are more readily tolerated. Furthermore, we show that this effect is based on strongly decreased binding affinity of the effector complex Cascade for guanine-mismatched targets, while cytosine-mismatched targets only minimally affect target DNA binding. Structural modeling of Cascade-bound targets with mismatches shows that steric clashes of mismatched guanines lead to unfavorable conformations of the RNA-DNA duplex. This effect has strong implications for the natural selection of target site mutations that lead to effective escape from type I CRISPR-Cas systems.},
}
@article {pmid30104577,
year = {2018},
author = {Molenda, O and Tang, S and Lomheim, L and Gautam, VK and Lemak, S and Yakunin, AF and Maxwell, KL and Edwards, EA},
title = {Extrachromosomal circular elements targeted by CRISPR-Cas in Dehalococcoides mccartyi are linked to mobilization of reductive dehalogenase genes.},
journal = {The ISME journal},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41396-018-0254-2},
pmid = {30104577},
issn = {1751-7370},
support = {2009-OGI-ABC-1405//Ontario Genomics Institute (OGI)/ ; },
abstract = {Dehalococcoides mccartyi are obligate organohalide-respiring bacteria that play an important detoxifying role in the environment. They have small genomes (~1.4 Mb) with a core region interrupted by two high plasticity regions (HPRs) containing dozens of genes encoding reductive dehalogenases involved in organohalide respiration. The genomes of eight new strains of D. mccartyi were closed from metagenomic data from a related set of enrichment cultures, bringing the total number of genomes to 24. Two of the newly sequenced strains and three previously sequenced strains contain CRISPR-Cas systems. These D. mccartyi CRISPR-Cas systems were found to primarily target prophages and genomic islands. The genomic islands were identified either as integrated into D. mccartyi genomes or as circular extrachromosomal elements. We observed active circularization of the integrated genomic island containing vcrABC operon encoding the dehalogenase (VcrA) responsible for the transformation of vinyl chloride to non-toxic ethene. We interrogated archived DNA from established enrichment cultures and found that the CRISPR array acquired three new spacers in 11 years. These data provide a glimpse into dynamic processes operating on the genomes distinct to D. mccartyi strains found in enrichment cultures and provide the first insights into possible mechanisms of lateral DNA exchange in D. mccartyi.},
}
@article {pmid30104361,
year = {2018},
author = {Zhang, Z and Niu, B and Ji, D and Li, M and Li, K and James, AA and Tan, A and Huang, Y},
title = {Silkworm genetic sexing through W chromosome-linked, targeted gene integration.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {35},
pages = {8752-8756},
doi = {10.1073/pnas.1810945115},
pmid = {30104361},
issn = {1091-6490},
mesh = {Animals ; Bombyx/*genetics ; *CRISPR-Cas Systems ; Chromosomes, Insect/*genetics ; Female ; Gene Editing/*methods ; Male ; Sex Chromosomes/*genetics ; *Sex Determination Processes ; },
abstract = {Sex separation methods are critical for genetic sexing systems in commercial insect production and sterile insect techniques. Integration of selectable marker genes into a sex chromosome is particularly useful in insects with a heterogametic sex determination system. Here, we describe targeted gene integration of fluorescent marker expression cassettes into a randomly amplified polymorphic DNA (RAPD) marker region in the W chromosome of the lepidopteran model insect Bombyx mori using transcriptional activator-like effector nuclease (TALEN)-mediated genome editing. This silkworm strain shows ubiquitous female-specific red or green fluorescence from the embryonic to adult stages. Furthermore, we developed a binary, female-specific, embryonic lethality system combining the TALEN and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology. This system includes one strain with TALEN-mediated, W-specific Cas9 expression driven by the silkworm germ cell-specific nanos (nos) promoter and another strain with U6-derived single-guide RNA (sgRNA) expression targeting transformer 2 (tra2), an essential gene for silkworm embryonic development. Filial 1 (F1) hybrids exhibit complete female-specific lethality during embryonic stages. Our study provides a promising approach for B. mori genetic sexing and sheds light on developing sterile insect techniques in other insect species, especially in lepidopteran pests with WZ/ZZ sex chromosome systems.},
}
@article {pmid30103848,
year = {2018},
author = {Devkota, S},
title = {The road less traveled: strategies to enhance the frequency of homology-directed repair (HDR) for increased efficiency of CRISPR/Cas-mediated transgenesis.},
journal = {BMB reports},
volume = {51},
number = {9},
pages = {437-443},
pmid = {30103848},
issn = {1976-670X},
abstract = {Non-homologous end joining (NHEJ), and to a lesser extent, the error-free pathway known as homology-directed repair (HDR) are cellular mechanisms for recovery from double-strand DNA breaks (DSB) induced by RNA-guided programmable nuclease CRISPR/Cas. Since NHEJ is equivalent to using a duck tape to stick two pieces of metals together, the outcome of this repair mechanism is prone to error. Any out-of-frame mutations or premature stop codons resulting from NHEJ repair mechanism are extremely handy for loss-of-function studies. Substitution of a mutation on the genome with the correct exogenous repair DNA requires coordination via an error-free HDR, for targeted transgenesis. However, several practical limitations exist in harnessing the potential of HDR to replace a faulty mutation for therapeutic purposes in all cell types and more so in somatic cells. In germ cells after the DSB, copying occurs from the homologous chromosome, which increases the chances of incorporation of exogenous DNA with some degree of homology into the genome compared with somatic cells where copying from the identical sister chromatid is always preferred. This review summarizes several strategies that have been implemented to increase the frequency of HDR with a focus on somatic cells. It also highlights the limitations of this technology in gene therapy and suggests specific solutions to circumvent those barriers. [BMB Reports 2018; 51(9): 437-443].},
}
@article {pmid30103650,
year = {2018},
author = {Faure, G and Shmakov, SA and Makarova, KS and Wolf, YI and Crawley, AB and Barrangou, R and Koonin, EV},
title = {Comparative genomics and evolution of trans-activating RNAs in Class 2 CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-14},
doi = {10.1080/15476286.2018.1493331},
pmid = {30103650},
issn = {1555-8584},
abstract = {Trans-activating CRISPR (tracr) RNA is a distinct RNA species that interacts with the CRISPR (cr) RNA to form the dual guide (g) RNA in type II and subtype V-B CRISPR-Cas systems. The tracrRNA-crRNA interaction is essential for pre-crRNA processing as well as target recognition and cleavage. The tracrRNA consists of an antirepeat, which forms an imperfect hybrid with the repeat in the crRNA, and a distal region containing a Rho-independent terminator. Exhaustive comparative analysis of the sequences and predicted structures of the Class 2 CRISPR guide RNAs shows that all these guide RNAs share distinct structural features, in particular, the nexus stem-loop that separates the repeat-antirepeat hybrid from the distal portion of the tracrRNA and the conserved GU pair at that end of the hybrid. These structural constraints might ensure full exposure of the spacer for target recognition. Reconstruction of tracrRNA evolution for 4 tight bacterial groups demonstrates random drift of repeat-antirepeat complementarity within a window of hybrid stability that is, apparently, maintained by selection. An evolutionary scenario is proposed whereby tracrRNAs evolved on multiple occasions, via rearrangement of a CRISPR array to form the antirepeat in different locations with respect to the array. A functional tracrRNA would form if, in the new location, the antirepeat is flanked by sequences that meet the minimal requirements for a promoter and a Rho-independent terminator. Alternatively, or additionally, the antirepeat sequence could be occasionally 'reset' by recombination with a repeat, restoring the functionality of tracrRNAs that drift beyond the required minimal hybrid stability.},
}
@article {pmid30102386,
year = {2018},
author = {Ka, D and Jang, DM and Han, BW and Bae, E},
title = {Molecular organization of the type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2.},
journal = {Nucleic acids research},
volume = {46},
number = {18},
pages = {9805-9815},
doi = {10.1093/nar/gky702},
pmid = {30102386},
issn = {1362-4962},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) proteins provide microbial adaptive immunity against invading foreign nucleic acids. In type II-A CRISPR-Cas systems, the Cas1-Cas2 integrase complex and the subtype-specific Csn2 comprise the CRISPR adaptation module, which cooperates with the Cas9 nuclease effector for spacer selection. Here, we report the molecular organization of the Streptococcus pyogenes type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2. We determined the crystal structure of S. pyogenes type II-A Cas2. Chromatographic and calorimetric analyses revealed the stoichiometry and topology of the type II-A adaptation module composed of Cas1, Cas2 and Csn2. We also demonstrated that Cas9 interacts with Csn2 in a direct and stoichiometric manner. Our results reveal a network of molecular interactions among type II-A Cas proteins and highlight the role of Csn2 in coordinating Cas components involved in the adaptation and interference stages of CRISPR-mediated immunity.},
}
@article {pmid30096986,
year = {2018},
author = {Killelea, T and Hawkins, M and Howard, JL and McGlynn, P and Bolt, EL},
title = {DNA replication roadblocks caused by Cascade interference complexes are alleviated by RecG DNA repair helicase.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-6},
doi = {10.1080/15476286.2018.1496773},
pmid = {30096986},
issn = {1555-8584},
abstract = {Cascade complexes underpin E. coli CRISPR-Cas immunity systems by stimulating 'adaptation' reactions that update immunity and by initiating 'interference' reactions that destroy invader DNA. Recognition of invader DNA in Cascade catalysed R-loops provokes DNA capture and its subsequent integration into CRISPR loci by Cas1 and Cas2. DNA capture processes are unclear but may involve RecG helicase, which stimulates adaptation during its role responding to genome instability. We show that Cascade is a potential source of genome instability because it blocks DNA replication and that RecG helicase alleviates this by dissociating Cascade. This highlights how integrating in vitro CRISPR-Cas interference and adaptation reactions with DNA replication and repair reactions will help to determine precise mechanisms underpinning prokaryotic adaptive immunity.},
}
@article {pmid30096237,
year = {2018},
author = {Li, R and Zhang, L and Wang, L and Chen, L and Zhao, R and Sheng, J and Shen, L},
title = {Reduction of Tomato-Plant Chilling Tolerance by CRISPR-Cas9-Mediated SlCBF1 Mutagenesis.},
journal = {Journal of agricultural and food chemistry},
volume = {66},
number = {34},
pages = {9042-9051},
doi = {10.1021/acs.jafc.8b02177},
pmid = {30096237},
issn = {1520-5118},
mesh = {CRISPR-Cas Systems ; Cold Temperature ; Gene Knockout Techniques ; Lycopersicon esculentum/genetics/*physiology ; Mutagenesis ; Plant Proteins/*genetics/metabolism ; *Stress, Physiological ; },
abstract = {Chilling stress is the main constraint in tomato (Solanum lycopersicum) production, as this is a chilling-sensitive horticultural crop. The highly conserved C-repeat binding factors (CBFs) are cold-response-system components found in many species. In this study, we generated slcbf1 mutants using the CRISPR-Cas9 system and investigated the role of SlCBF1 in tomato-plant chilling tolerances. The slcbf1 mutants exhibited more severe chilling-injury symptoms with higher electrolyte leakage and malondialdehyde levels than wild-type (WT) plants. Additionally, slcbf1 mutants showed lower proline and protein contents and higher hydrogen peroxide contents and activities of antioxidant enzymes than WT plants. Knockout of SlCBF1 significantly increased indole acetic acid contents but decreased methyl jasmonate, abscisic acid, and zeatin riboside contents. The reduced chilling tolerance of the slcbf1 mutants was further reflected by the down-regulation of CBF-related genes. These results contribute to a better understanding of the molecular basis underlying SlCBF1 mediation of tomato chilling sensitivity.},
}
@article {pmid30094064,
year = {2018},
author = {Goodman, DA and Stedman, KM},
title = {Comparative genetic and genomic analysis of the novel fusellovirus Sulfolobus spindle-shaped virus 10.},
journal = {Virus evolution},
volume = {4},
number = {2},
pages = {vey022},
doi = {10.1093/ve/vey022},
pmid = {30094064},
issn = {2057-1577},
support = {R41 AI126940/AI/NIAID NIH HHS/United States ; },
abstract = {Viruses that infect thermophilic Archaea are unique in both their structure and genetic makeup. The lemon-shaped fuselloviruses-which infect members of the order Sulfolobales, growing optimally at 80 °C and pH 3-are some of the most ubiquitous and best studied viruses of the thermoacidophilic Archaea. Nonetheless, much remains to be learned about these viruses. In order to investigate fusellovirus evolution, we have isolated and characterized a novel fusellovirus, Sulfolobus spindle-shaped virus 10 (formerly SSV-L1). Comparative genomic analyses highlight significant similarity with both SSV8 and SSV9, as well as conservation of promoter elements within the Fuselloviridae. SSV10 encodes five ORFs with no homology within or outside of the Fuselloviridae, as well as a putatively functional Cas4-like ORF, which may play a role in evading CRISPR-mediated host defenses. Moreover, we demonstrate the ability of SSV10 to withstand mutation in a fashion consistent with mutagenesis in SSV1.},
}
@article {pmid30091101,
year = {2018},
author = {Immethun, CM and Moon, TS},
title = {Synthetic Gene Regulation in Cyanobacteria.},
journal = {Advances in experimental medicine and biology},
volume = {1080},
number = {},
pages = {317-355},
doi = {10.1007/978-981-13-0854-3_13},
pmid = {30091101},
issn = {0065-2598},
abstract = {Cyanobacteria are appealing hosts for green chemical synthesis due to their use of light and carbon dioxide. To optimize product yields and titers, specific and tunable regulation of the metabolic pathways is needed. Synthetic biology has increased and diversified the genetic tools available for biological process control. While early tool development focused on commonly used heterotrophs, there has been a recent expansion of tools for cyanobacteria. CRISPR-Cas9 has been used to edit the genome of cyanobacterial strains, while transcriptional regulation has been accomplished with CRISPR interference and RNA riboswitches. Promoter development has produced a significant number of transcriptional regulators, including those that respond to chemicals, environmental signals, and metabolic states. Trans-acting RNAs have been utilized for posttranscriptional and translational control. The regulation of translation initiation is beginning to be explored with ribosome binding sites and riboswitches, while protein degradation tags have been used to control expression levels. Devices built from multiple parts have also been developed to create more complex behaviors. These advances in development of synthetic cyanobacterial regulatory parts provide the groundwork for creation of new, even more sophisticated bioprocess control devices, bolstering the viability of cyanobacteria as sustainable biotechnology platforms.},
}
@article {pmid30090055,
year = {2018},
author = {Robbins, JP and Perfect, L and Ribe, EM and Maresca, M and Dangla-Valls, A and Foster, EM and Killick, R and Nowosiad, P and Reid, MJ and Polit, LD and Nevado, AJ and Ebner, D and Bohlooly-Y, M and Buckley, N and Pangalos, MN and Price, J and Lovestone, S},
title = {Clusterin Is Required for β-Amyloid Toxicity in Human iPSC-Derived Neurons.},
journal = {Frontiers in neuroscience},
volume = {12},
number = {},
pages = {504},
doi = {10.3389/fnins.2018.00504},
pmid = {30090055},
issn = {1662-4548},
abstract = {Our understanding of the molecular processes underlying Alzheimer's disease (AD) is still limited, hindering the development of effective treatments, and highlighting the need for human-specific models. Advances in identifying components of the amyloid cascade are progressing, including the role of the protein clusterin in mediating β-amyloid (Aβ) toxicity. Mutations in the clusterin gene (CLU), a major genetic AD risk factor, are known to have important roles in Aβ processing. Here we investigate how CLU mediates Aβ-driven neurodegeneration in human induced pluripotent stem cell (iPSC)-derived neurons. We generated a novel CLU-knockout iPSC line by CRISPR/Cas9-mediated gene editing to investigate Aβ-mediated neurodegeneration in cortical neurons differentiated from wild type and CLU knockout iPSCs. We measured response to Aβ using an imaging assay and measured changes in gene expression using qPCR and RNA sequencing. In wild type neurons imaging indicated that neuronal processes degenerate following treatment with Aβ25-35 peptides and Aβ1-42 oligomers, in a dose dependent manner, and that intracellular levels of clusterin are increased following Aβ treatment. However, in CLU knockout neurons Aβ exposure did not affect neurite length, suggesting that clusterin is an important component of the amyloid cascade. Transcriptomic data were analyzed to elucidate the pathways responsible for the altered response to Aβ in neurons with the CLU deletion. Four of the five genes previously identified as downstream to Aβ and Dickkopf-1 (DKK1) proteins in an Aβ-driven neurotoxic pathway in rodent cells were also dysregulated in human neurons with the CLU deletion. AD and lysosome pathways were the most significantly dysregulated pathways in the CLU knockout neurons, and pathways relating to cytoskeletal processes were most dysregulated in Aβ treated neurons. The absence of neurodegeneration in the CLU knockout neurons in response to Aβ compared to the wild type neurons supports the role of clusterin in Aβ-mediated AD pathogenesis.},
}
@article {pmid30085063,
year = {2018},
author = {Buckner, MMC and Ciusa, ML and Piddock, LJV},
title = {Strategies to combat antimicrobial resistance: anti-plasmid and plasmid curing.},
journal = {FEMS microbiology reviews},
volume = {},
number = {},
pages = {},
doi = {10.1093/femsre/fuy031},
pmid = {30085063},
issn = {1574-6976},
abstract = {Antimicrobial resistance (AMR) is a global problem hindering treatment of bacterial infections, rendering many aspects of modern medicine less effective. AMR genes (ARGs), are frequently located on plasmids, which are self-replicating elements of DNA. They are often transmissible between bacteria, and some have spread globally. Novel strategies to combat AMR are needed, and plasmid curing and anti-plasmid approaches could reduce ARG prevalence, and sensitize bacteria to antibiotics. We discuss the use of curing agents as laboratory tools including chemicals (e.g. detergents and intercalating agents), drugs used in medicine including ascorbic acid, psychotropic drugs (e.g. chlorpromazine), antibiotics (e.g. aminocoumarins, quinolones, and rifampicin), and plant-derived compounds. Novel strategies are examined; these include conjugation inhibitors (e.g. linoleic, oleic, 2-hexadecynoic and tanzawaic acids, and TraE inhibitors), systems designed around plasmid incompatibility, phages, and CRISPR/Cas based approaches. Currently there is a general lack of in vivo curing options. This review highlights this important shortfall, which if filled, could provide a promising mechanism to reduce ARG prevalence in humans and animals. Plasmid curing mechanisms which are not suitable for in vivo use could still prove important for reducing the global burden of AMR, as high levels of ARGs exist in the environment.},
}
@article {pmid30082270,
year = {2018},
author = {Jardin, N and Giudicelli, F and Ten Martín, D and Vitrac, A and De Gois, S and Allison, R and Houart, C and Reid, E and Hazan, J and Fassier, C},
title = {BMP- and neuropilin 1-mediated motor axon navigation relies on spastin alternative translation.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {17},
pages = {},
doi = {10.1242/dev.162701},
pmid = {30082270},
issn = {1477-9129},
support = {MR/M00046X/1//Medical Research Council/United Kingdom ; },
mesh = {Animals ; Axons/metabolism ; Bone Morphogenetic Proteins/*metabolism ; COS Cells ; CRISPR-Cas Systems/genetics ; Cell Line ; Cell Movement/genetics ; Cercopithecus aethiops ; GTP-Binding Proteins/metabolism ; Gene Knockout Techniques ; Humans ; Membrane Proteins/metabolism ; Motor Neurons/*cytology ; Neuropilin-1/*metabolism ; Protein Isoforms/genetics ; Spastic Paraplegia, Hereditary/genetics ; Spastin/biosynthesis/*genetics ; Zebrafish/*embryology ; Zebrafish Proteins/biosynthesis/*genetics ; },
abstract = {Functional analyses of genes responsible for neurodegenerative disorders have unveiled crucial links between neurodegenerative processes and key developmental signalling pathways. Mutations in SPG4-encoding spastin cause hereditary spastic paraplegia (HSP). Spastin is involved in diverse cellular processes that couple microtubule severing to membrane remodelling. Two main spastin isoforms are synthesised from alternative translational start sites (M1 and M87). However, their specific roles in neuronal development and homeostasis remain largely unknown. To selectively unravel their neuronal function, we blocked spastin synthesis from each initiation codon during zebrafish development and performed rescue analyses. The knockdown of each isoform led to different motor neuron and locomotion defects, which were not rescued by the selective expression of the other isoform. Notably, both morphant neuronal phenotypes were observed in a CRISPR/Cas9 spastin mutant. We next showed that M1 spastin, together with HSP proteins atlastin 1 and NIPA1, drives motor axon targeting by repressing BMP signalling, whereas M87 spastin acts downstream of neuropilin 1 to control motor neuron migration. Our data therefore suggest that defective BMP and neuropilin 1 signalling may contribute to the motor phenotype in a vertebrate model of spastin depletion.},
}
@article {pmid30081743,
year = {2018},
author = {Millen, AM and Samson, JE and Tremblay, DM and Magadán, AH and Rousseau, GM and Moineau, S and Romero, DA},
title = {Lactococcus lactis type III-A CRISPR-Cas system cleaves bacteriophage RNA.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-8},
doi = {10.1080/15476286.2018.1502589},
pmid = {30081743},
issn = {1555-8584},
abstract = {CRISPR-Cas defends microbial cells against invading nucleic acids including viral genomes. Recent studies have shown that type III-A CRISPR-Cas systems target both RNA and DNA in a transcription-dependent manner. We previously found a type III-A system on a conjugative plasmid in Lactococcus lactis which provided resistance against virulent phages of the Siphoviridae family. Its naturally occurring spacers are oriented to generate crRNAs complementary to target phage mRNA, suggesting transcription-dependent targeting. Here, we show that only constructs whose spacers produce crRNAs complementary to the phage mRNA confer phage resistance in L. lactis. In vivo nucleic acid cleavage assays showed that cleavage of phage dsDNA genome was not detected within phage-infected L. lactis cells. On the other hand, Northern blots indicated that the lactococcal CRISPR-Cas cleaves phage mRNA in vivo. These results cannot exclude that single-stranded phage DNA is not being targeted, but phage DNA replication has been shown to be impaired.},
}
@article {pmid30078724,
year = {2018},
author = {Strohkendl, I and Saifuddin, FA and Rybarski, JR and Finkelstein, IJ and Russell, R},
title = {Kinetic Basis for DNA Target Specificity of CRISPR-Cas12a.},
journal = {Molecular cell},
volume = {71},
number = {5},
pages = {816-824.e3},
doi = {10.1016/j.molcel.2018.06.043},
pmid = {30078724},
issn = {1097-4164},
abstract = {Class 2 CRISPR-Cas nucleases are programmable genome editing tools with promising applications in human health and disease. However, DNA cleavage at off-target sites that resemble the target sequence is a pervasive problem that remains poorly understood mechanistically. Here, we use quantitative kinetics to dissect the reaction steps of DNA targeting by Acidaminococcus sp Cas12a (also known as Cpf1). We show that Cas12a binds DNA tightly in two kinetically separable steps. Protospacer-adjacent motif (PAM) recognition is followed by rate-limiting R-loop propagation, leading to inevitable DNA cleavage of both strands. Despite functionally irreversible binding, Cas12a discriminates strongly against mismatches along most of the DNA target sequence. This result implies substantial reversibility during R-loop formation-a late transition state-and defies common descriptions of a &quot;seed&quot; region. Our results provide a quantitative basis for the DNA cleavage patterns measured in vivo and observations of greater reported target specificity for Cas12a than for the Cas9 nuclease.},
}
@article {pmid30078067,
year = {2018},
author = {Javed, MR and Sadaf, M and Ahmed, T and Jamil, A and Nawaz, M and Abbas, H and Ijaz, A},
title = {CRISPR-Cas System: History and Prospects as a Genome Editing Tool in Microorganisms.},
journal = {Current microbiology},
volume = {75},
number = {12},
pages = {1675-1683},
doi = {10.1007/s00284-018-1547-4},
pmid = {30078067},
issn = {1432-0991},
support = {NRPU Project # 5590//Higher Education Commission of Pakistan/ ; },
abstract = {Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR or more precisely CRISPR-Cas) system has proven to be a highly efficient and simple tool for achieving site-specific genome modifications in comparison to Zinc Finger Nucleases (ZFNs) and Transcription Activator-Like Effector Nucleases (TALENs). The discovery of bacterial defense system that uses RNA-guided DNA cleaving enzymes for producing double-strand breaks along CRISPR has provided an exciting alternative to ZFNs and TALENs for gene editing &amp; regulation, as the CRISPR-associated (Cas) proteins remain the same for different gene targets and only the short sequence of the guide RNA needs to be changed to redirect the site-specific cleavage. Therefore, in recent years the CRISPR-Cas system has emerged as a revolutionary engineering tool for carrying out precise and controlled genetic modifications in many microbes such as Escherichia coli, Staphylococcus aureus, Lactobacillus reuteri, Clostridium beijerinckii, Streptococcus pneumonia, and Saccharomyces cerevisiae. Though, concerns about CRISPR-Cas effectiveness in interlinked gene modifications and off-target effects need to be addressed. Nevertheless, it holds a great potential to speed up the pace of gene function discovery by interacting with previously intractable organisms and by raising the extent of genetic screens. Therefore, the potential applications of this system in microbial adaptive immune system, genome editing, gene regulations, functional genomics &amp; biosynthesis along ethical issues, and possible harmful effects have been reviewed.},
}
@article {pmid30076877,
year = {2018},
author = {Nishiyama, J},
title = {Genome editing in the mammalian brain using the CRISPR-Cas system.},
journal = {Neuroscience research},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.neures.2018.07.003},
pmid = {30076877},
issn = {1872-8111},
abstract = {Recent advances in genome editing technologies such as the clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease Cas9 have enabled the rapid and efficient modification of endogenous genomes in a variety of cell types, accelerating biomedical research. In particular, precise genome editing in somatic cells in vivo allows for the rapid generation of genetically modified cells in living animals and holds great promise for the possibility of directly correcting genetic defects associated with human diseases. However, because of the limited efficiency and suitability of these technologies in the brain, especially in postmitotic neurons, the practical application of genome editing technologies has been largely limited in the field of neuroscience. Recent technological advances overcome significant challenges facing genome editing in the brain and have enabled us to precisely edit the genome in both mitotic cells and mature postmitotic neurons in vitro and in vivo, providing powerful means for studying gene function and dysfunction in the brain. This review highlights the development of genome editing technologies for the brain and discusses their applications, limitations, and future challenges.},
}
@article {pmid30076736,
year = {2018},
author = {Mendoza, BJ and Trinh, CT},
title = {In Silico Processing of the Complete CRISPR-Cas Spacer Space for Identification of PAM Sequences.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700595},
doi = {10.1002/biot.201700595},
pmid = {30076736},
issn = {1860-7314},
support = {D17AP00023//Defense Advanced Research Projects Agency/ ; },
abstract = {Despite extensive exploration of the diversity of CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR associated) systems, biological applications have been mostly confined to Class 2 systems, specifically the Cas9 and Cas12 (formerly Cpf1) single effector proteins. A key limitation of exploring and utilizing other CRISPR-Cas systems with unique functionalities, particularly Class I types and their multi-protein effector complex, is the knowledge of the system's protospacer adjacent motif (PAM) sequence identity. In this work, the authors developed a systematic pipeline, named CASPERpam, that enables a comprehensive assessment of the PAM sequences of all the available CRISPR-Cas systems in the NCBI database of bacterial genomes. The CASPERpam analysis reveals that within the 30 389 assemblies previously screened for CRISPR arrays, there exists 26 364 spacers that match somewhere in the viral, bacterial, and plasmid databases of NCBI, using the constraints of 95% sequence identity and 95% sequence coverage for blast hits. When grouping these results by species, the authors identified putative PAM sequences for 1049 among 1493 unique species. The remaining species either have insufficient data or an undetermined result from the analysis. Finally, the authors assigned a confidence score to each species' PAM prediction and generate categories that largely cover the revealed diversity of PAM motifs, providing a baseline for further experimental studies including PAM assays. The authors envision CASPERpam is a useful bioinformatic tool for understanding and harnessing the diversity of CRISPR-Cas systems.},
}
@article {pmid30075125,
year = {2018},
author = {Plaza Reyes, A and Lanner, F},
title = {Time Matters: Gene Editing at the Mouse 2-Cell Embryo Stage Boosts Knockin Efficiency.},
journal = {Cell stem cell},
volume = {23},
number = {2},
pages = {155-157},
doi = {10.1016/j.stem.2018.07.008},
pmid = {30075125},
issn = {1875-9777},
abstract = {Although endonuclease-mediated genome editing techniques offer significant improvement over traditional methods, they are still ineffective for introduction of large DNA sequences. Recently in Nature Biotechnology, Gu et al. (2018) developed a CRISPR-Cas strategy termed 2C-HR-CRISPR that generates fluorescent reporter tagging of genes with up to 95% knockin efficiency in mouse embryos.},
}
@article {pmid30073181,
year = {2018},
author = {Simhadri, VL and McGill, J and McMahon, S and Wang, J and Jiang, H and Sauna, ZE},
title = {Prevalence of Pre-existing Antibodies to CRISPR-Associated Nuclease Cas9 in the USA Population.},
journal = {Molecular therapy. Methods &amp; clinical development},
volume = {10},
number = {},
pages = {105-112},
doi = {10.1016/j.omtm.2018.06.006},
pmid = {30073181},
issn = {2329-0501},
abstract = {The repurposing of the CRISPR/Cas microbial adaptive immune system for gene editing has resulted in an exponential rise in new technologies and promising approaches for treating numerous human diseases. While some of the approaches being currently developed involve ex vivo editing by CRISPR/Cas9, many more potential applications will require in vivo editing. The in vivo use of this technology comes with challenges, one of which is the immune response to Cas9, a protein of microbial origin. Thus, the prevalence of pre-existing antibodies to Cas9 could also be a relevant parameter. There are many avenues for how CRISPR/Cas9 technologies will be applied in vivo, including the mode of delivery. These may be expected to invoke different immunological pathways. Nonetheless, as with all protein therapeutics, it may be desirable to monitor for anti-Cas9 antibodies during clinical development. This will require the development of robust and reliable assays. Here, we describe ELISA-based assays that are capable of detecting antibodies to Cas9 from Staphylococcus aureus (SaCas9) and Streptococcs pyogenes (SpCas9) in human sera. Furthermore, using these assays to screen for pre-existing antibodies in 200 human serum samples, we found the prevalence of anti-SaCas9 and anti-SpCas9 antibodies to be 10% and 2.5%, respectively.},
}
@article {pmid30073121,
year = {2018},
author = {Aglawe, SB and Barbadikar, KM and Mangrauthia, SK and Madhav, MS},
title = {New breeding technique &quot;genome editing&quot; for crop improvement: applications, potentials and challenges.},
journal = {3 Biotech},
volume = {8},
number = {8},
pages = {336},
doi = {10.1007/s13205-018-1355-3},
pmid = {30073121},
issn = {2190-572X},
abstract = {Crop improvement is a continuous process in agriculture which ensures ample supply of food, fodder and fiber to burgeoning world population. Despite tremendous success in plant breeding and transgenesis to improve the yield-related traits, there have been several limitations primarily with the specificity in genetic modifications and incompatibility of host species. Because of this, new breeding techniques (NBTs) are gaining worldwide attention for crop improvement programs. Among the NBTs, genome editing (GE) using site-directed nucleases (SDNs) is an important and potential technique that overcomes limitations associated with classical breeding and transgenesis. These SDNs specifically target a compatible region in the gene/genome. The meganucleases (MgN), zinc finger nucleases (ZFN), transcription activator-like effectors nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated endonuclease (Cas) are being successfully employed for GE. These can be used for desired or targeted modifications of the native endogenous gene(s) or targeted insertion of cis/trans elements in the genomes of recipient organisms. Applications of these techniques appear to be endless ever since their discovery and several modifications in original technologies have further brought precision and accuracy in these methods. In this review, we present an overview of GE using SDNs with an emphasis on CRISPR/Cas system, their advantages, limitations and also practical considerations while designing experiments have been discussed. The review also emphasizes on the possible applications of CRISPR for improving economic traits in crop plants.},
}
@article {pmid30072959,
year = {2018},
author = {González-Torres, P and Gabaldón, T},
title = {Genome Variation in the Model Halophilic Bacterium Salinibacter ruber.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1499},
doi = {10.3389/fmicb.2018.01499},
pmid = {30072959},
issn = {1664-302X},
abstract = {The halophilic bacterium Salinibacter ruber is an abundant and ecologically important member of halophilic communities worldwide. Given its broad distribution and high intraspecific genetic diversity, S. ruber is considered one of the main models for ecological and evolutionary studies of bacterial adaptation to hypersaline environments. However, current insights on the genomic diversity of this species is limited to the comparison of the genomes of two co-isolated strains. Here, we present a comparative genomic analysis of eight S. ruber strains isolated at two different time points in each of two different Mediterranean solar salterns. Our results show an open pangenome with contrasting evolutionary patterns in the core and accessory genomes. We found that the core genome is shaped by extensive homologous recombination (HR), which results in limited sequence variation within population clusters. In contrast, the accessory genome is modulated by horizontal gene transfer (HGT), with genomic islands and plasmids acting as gateways to the rest of the genome. In addition, both types of genetic exchange are modulated by restriction and modification (RM) or CRISPR-Cas systems. Finally, genes differentially impacted by such processes reveal functional processes potentially relevant for environmental interactions and adaptation to extremophilic conditions. Altogether, our results support scenarios that conciliate &quot;Neutral&quot; and &quot;Constant Diversity&quot; models of bacterial evolution.},
}
@article {pmid30072518,
year = {2018},
author = {Kupferschmidt, K},
title = {EU verdict on CRISPR crops dismays scientists.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6401},
pages = {435-436},
doi = {10.1126/science.361.6401.435},
pmid = {30072518},
issn = {1095-9203},
mesh = {*CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Crops, Agricultural/*genetics ; European Union ; Gene Editing/*legislation &amp; jurisprudence ; Plants, Genetically Modified/*genetics ; },
}
@article {pmid30068963,
year = {2018},
author = {Crawley, AB and Henriksen, ED and Stout, E and Brandt, K and Barrangou, R},
title = {Characterizing the activity of abundant, diverse and active CRISPR-Cas systems in lactobacilli.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {11544},
doi = {10.1038/s41598-018-29746-3},
pmid = {30068963},
issn = {2045-2322},
abstract = {CRISPR-Cas systems provide immunity against phages and plasmids in bacteria and archaea. Despite the popularity of CRISPR-Cas9 based genome editing, few endogenous systems have been characterized to date. Here, we sampled 1,262 publically available lactobacilli genomes found them to be enriched with CRISPR-Cas adaptive immunity. While CRISPR-Cas is ubiquitous in some Lactobacillus species, CRISPR-Cas content varies at the strain level in most Lactobacillus species. We identified that Type II is the most abundant type across the genus, with II-A being the most dominant sub-type. We found that many Type II-A systems are actively transcribed, and encode spacers that efficiently provide resistance against plasmid uptake. Analysis of various CRISPR transcripts revealed that guide sequences are highly diverse in terms of crRNA and tracrRNA length and structure. Interference assays revealed highly diverse target PAM sequences. Lastly, we show that these systems can be readily repurposed for self-targeting by expressing an engineered single guide RNA. Our results reveal that Type II-A systems in lactobacilli are naturally active in their native host in terms of expression and efficiently targeting invasive and genomic DNA. Together, these systems increase the possible Cas9 targeting space and provide multiplexing potential in native hosts and heterologous genome editing purpose.},
}
@article {pmid30063480,
year = {2018},
author = {Sicard, A and Boardman, DA and Levings, MK},
title = {Taking regulatory T-cell therapy one step further.},
journal = {Current opinion in organ transplantation},
volume = {23},
number = {5},
pages = {509-515},
doi = {10.1097/MOT.0000000000000566},
pmid = {30063480},
issn = {1531-7013},
abstract = {PURPOSE OF REVIEW: Adoptive cell therapy using CD4FOXP3 regulatory T cells (Treg) has emerged as a promising therapeutic strategy to treat autoimmunity and alloimmunity. Preclinical studies suggest that the efficacy of Treg therapy can be improved by modifying the antigen specificity, stability and function of therapeutic Tregs. We review recent innovations that considerably enhance the possibilities of controlling these parameters.<br><br>RECENT FINDINGS: Antigen-specific Tregs can be generated by genetically modifying polyclonal Tregs to express designated T-cell receptors or single-chain chimeric antigen receptors. The benefits of this approach can be further extended by using novel strategies to fine-tune the antigen-specificity and affinity of Treg in vivo. CRISPR/Cas 9 technology now enables the modification of therapeutic Tregs so they are safer, more stable and long lived. The differentiation and homing properties of Tregs can also be modulated by gene editing or modifying ex-vivo stimulation conditions.<br><br>SUMMARY: A new wave of innovation has considerably increased the number of strategies that could be used to increase the therapeutic potential of Treg therapy. However, the increased complexity of these approaches may limit their wide accessibility. Third-party therapy with off-the-shelf Treg products could be a solution.},
}
@article {pmid30061876,
year = {2018},
author = {Li, HY and Kao, CY and Lin, WH and Zheng, PX and Yan, JJ and Wang, MC and Teng, CH and Tseng, CC and Wu, JJ},
title = {Characterization of CRISPR-Cas Systems in Clinical Klebsiella pneumoniae Isolates Uncovers Its Potential Association With Antibiotic Susceptibility.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1595},
doi = {10.3389/fmicb.2018.01595},
pmid = {30061876},
issn = {1664-302X},
abstract = {Prokaryotic CRISPR-Cas systems limit the acquisition of genetic elements and provide immunity against invasive bacteriophage. The characteristics of CRISPR-Cas systems in clinical Klebsiella pneumoniae isolates are still unknown. Here, 97 K. pneumoniae genomes retrieved from the Integrated Microbial Genomes &amp; Microbiomes genome database and 176 clinical isolates obtained from patients with bloodstream (BSI, n = 87) or urinary tract infections (UTI, n = 89) in Taiwan, were used for analysis. Forty out of ninety-seven genomes (41.2%) had CRISPR-Cas systems identified by the combination of CRISPRFinder and cas1 gene sequence alignment. The phylogenetic trees revealed that CRISPR-Cas systems in K. pneumoniae were divided into two types (type I-E, 23; subtype I-E∗, 17) based on the sequences of Cas1 and Cas3 proteins and their location in the chromosome. The distribution of type I-E and I-E∗ CRISPR-Cas systems was associated with the multilocus sequence typing and the pulsed-field gel electrophoresis results. Importantly, no CRISPR-Cas system was identified in published genomes of clonal complex 258 isolates (ST11 and ST258), which comprise the largest multi-drug resistant K. pneumoniae clonal group worldwide. PCR with cas-specific primers showed that 30.7% (54/176) of the clinical isolates had a CRISPR-Cas system. Among clinical isolates, more type I-E CRISPR-Cas systems were found in UTI isolates (BSI, 5.7%; UTI, 11.2%), and subtype I-E∗ CRISPR-Cas systems were dominant in BSI isolates (BSI, 28.7%; UTI, 15.7%) (p = 0.042). Isolates which had subtype I-E∗ CRISPR-Cas system were more susceptible to ampicillin-sulbactam (p = 0.009), cefazolin (p = 0.016), cefuroxime (p = 0.039), and gentamicin (p = 0.012), compared to the CRISPR-negative isolates. The strains containing subtype I-E∗ CRISPR-Cas systems had decreased numbers of plasmids, prophage regions, and acquired antibiotic resistance genes in their published genomes. Here, we first revealed subtype I-E∗ CRISPR-Cas system in K. pneumoniae potentially interfering with the acquisition of phages and plasmids harboring antibiotic resistance determinants, and thus maintained these isolates susceptible to antibiotics.},
}
@article {pmid30061218,
year = {2018},
author = {Lee, J and Yun, HH and Kim, S and Ji, SH and Kuh, HJ and Lee, JH},
title = {Implication of BIS in the Migration and Invasion of A549 Non-small Cell Lung Cancer Cells.},
journal = {Anticancer research},
volume = {38},
number = {8},
pages = {4525-4533},
doi = {10.21873/anticanres.12756},
pmid = {30061218},
issn = {1791-7530},
mesh = {A549 Cells ; Bcl-2-Like Protein 11/*metabolism ; CRISPR-Cas Systems/physiology ; Cadherins/metabolism ; Carcinoma, Non-Small-Cell Lung/metabolism/*pathology ; Cell Communication/physiology ; Cell Line, Tumor ; Cell Movement/*physiology ; Epithelial-Mesenchymal Transition/physiology ; Humans ; Lung Neoplasms/metabolism/*pathology ; Matrix Metalloproteinase 2/metabolism ; NF-kappa B/metabolism ; Neoplasm Invasiveness/*pathology ; RNA, Messenger/metabolism ; Signal Transduction/physiology ; Snail Family Transcription Factors/metabolism ; Wound Healing/physiology ; Zinc Finger E-box-Binding Homeobox 1/metabolism ; },
abstract = {BACKGROUND/AIM: High expression of the Bcl-2-interacting cell death suppressor (BIS), an anti-apoptotic protein, in various human cancers is linked to a poor outcome. The purpose of this study was to clarify whether BIS is associated with the migration and invasive characteristics of A549 cells.<br><br>MATERIALS AND METHODS: BIS-knockout (KO) cells were prepared by the CRISPR/Cas9 method. The aggressive behaviors of A549 cells were analyzed by wound healing and a transwell invasion assay as well as 3D spheroid culture.<br><br>RESULTS: BIS depletion resulted in significant inhibition of the migration and invasive potential of A549 cells which was accompanied by an increased ratio of E-cadherin/N-cadherin and a decrease in the mRNA levels of Zeb1, Snail, Slug and MMP-2. NF-κB activity was suppressed in BIS-KO A549 cells due to the decrease in p65 protein levels, but not in mRNA levels.<br><br>CONCLUSION: BIS regulates cell invasion and the induction of the epithelial-mesenchymal transition (EMT) phenotype in A549 cells probably via the NF-κB signaling pathway.},
}
@article {pmid30060765,
year = {2018},
author = {Seal, BS and Drider, D and Oakley, BB and Brüssow, H and Bikard, D and Rich, JO and Miller, S and Devillard, E and Kwan, J and Bertin, G and Reeves, S and Swift, SM and Raicek, M and Gay, CG},
title = {Microbial-derived products as potential new antimicrobials.},
journal = {Veterinary research},
volume = {49},
number = {1},
pages = {66},
doi = {10.1186/s13567-018-0563-5},
pmid = {30060765},
issn = {1297-9716},
abstract = {Due to the continuing global concerns involving antibiotic resistance, there is a need for scientific forums to assess advancements in the development of antimicrobials and their alternatives that might reduce development and spread of antibiotic resistance among bacterial pathogens. The objectives of the 2nd International Symposium on Alternatives to Antibiotics were to highlight promising research results and novel technologies that can provide alternatives to antibiotics for use in animal health and production, assess challenges associated with their authorization and commercialization for use, and provide actionable strategies to support their development. The session on microbial-derived products was directed at presenting novel technologies that included exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials, probiotics development via fecal microbiome transplants among monogastric production animals such as chickens and mining microbial sources such as bacteria or yeast to identify new antimicrobial compounds. Other research has included continuing development of antimicrobial peptides such as newly discovered bacteriocins as alternatives to antibiotics, use of bacteriophages accompanied by development of unique lytic proteins with specific cell-wall binding domains and novel approaches such as microbial-ecology guided discovery of anti-biofilm compounds discovered in marine environments. The symposium was held at the Headquarters of the World Organisation for Animal Health (OIE) in Paris, France during 12-15 December 2016.},
}
@article {pmid30059276,
year = {2018},
author = {Heidrich, N and Hagmann, A and Bauriedl, S and Vogel, J and Schoen, C},
title = {The CRISPR/Cas system in Neisseria meningitidis affects bacterial adhesion to human nasopharyngeal epithelial cells.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-7},
doi = {10.1080/15476286.2018.1486660},
pmid = {30059276},
issn = {1555-8584},
abstract = {Neisseria meningitidis, a commensal β-proteobacterium of the human nasopharynx, constitutes a worldwide leading cause of sepsis and epidemic meningitis. A recent genome-wide association study suggested an association of its type II-C CRISPR/Cas system with carriage and thus less invasive lineages. Here, we show that knock-out strains lacking the Cas9 protein are impaired in the adhesion to human nasopharyngeal cells which constitutes a central step in the pathogenesis of invasive meningococcal disease. Transcriptome sequencing data further suggest that meningococcal Cas9 does not affect the expression of surface adhesins but rather exerts its effect on cell adhesion in an indirect manner. Consequently, we speculate that the meningococcal CRISPR/Cas system exerts novel functions beyond its established role in defence against foreign DNA.},
}
@article {pmid30054595,
year = {2018},
author = {Richardson, CD and Kazane, KR and Feng, SJ and Zelin, E and Bray, NL and Schäfer, AJ and Floor, SN and Corn, JE},
title = {CRISPR-Cas9 genome editing in human cells occurs via the Fanconi anemia pathway.},
journal = {Nature genetics},
volume = {50},
number = {8},
pages = {1132-1139},
doi = {10.1038/s41588-018-0174-0},
pmid = {30054595},
issn = {1546-1718},
abstract = {CRISPR-Cas genome editing creates targeted DNA double-strand breaks (DSBs) that are processed by cellular repair pathways, including the incorporation of exogenous DNA via single-strand template repair (SSTR). To determine the genetic basis of SSTR in human cells, we developed a coupled inhibition-cutting system capable of interrogating multiple editing outcomes in the context of thousands of individual gene knockdowns. We found that human Cas9-induced SSTR requires the Fanconi anemia (FA) pathway, which is normally implicated in interstrand cross-link repair. The FA pathway does not directly impact error-prone, non-homologous end joining, but instead diverts repair toward SSTR. Furthermore, FANCD2 protein localizes to Cas9-induced DSBs, indicating a direct role in regulating genome editing. Since FA is itself a genetic disease, these data imply that patient genotype and/or transcriptome may impact the effectiveness of gene editing treatments and that treatments biased toward FA repair pathways could have therapeutic value.},
}
@article {pmid30053228,
year = {2018},
author = {Hupfeld, M and Trasanidou, D and Ramazzini, L and Klumpp, J and Loessner, MJ and Kilcher, S},
title = {A functional type II-A CRISPR-Cas system from Listeria enables efficient genome editing of large non-integrating bacteriophage.},
journal = {Nucleic acids research},
volume = {46},
number = {13},
pages = {6920-6933},
doi = {10.1093/nar/gky544},
pmid = {30053228},
issn = {1362-4962},
abstract = {CRISPR-Cas systems provide bacteria with adaptive immunity against invading DNA elements including bacteriophages and plasmids. While CRISPR technology has revolutionized eukaryotic genome engineering, its application to prokaryotes and their viruses remains less well established. Here we report the first functional CRISPR-Cas system from the genus Listeria and demonstrate its native role in phage defense. LivCRISPR-1 is a type II-A system from the genome of L. ivanovii subspecies londoniensis that uses a small, 1078 amino acid Cas9 variant and a unique NNACAC protospacer adjacent motif. We transferred LivCRISPR-1 cas9 and trans-activating crRNA into Listeria monocytogenes. Along with crRNA encoding plasmids, this programmable interference system enables efficient cleavage of bacterial DNA and incoming phage genomes. We used LivCRISPR-1 to develop an effective engineering platform for large, non-integrating Listeria phages based on allelic replacement and CRISPR-Cas-mediated counterselection. The broad host-range Listeria phage A511 was engineered to encode and express lysostaphin, a cell wall hydrolase that specifically targets Staphylococcus peptidoglycan. In bacterial co-culture, the armed phages not only killed Listeria hosts but also lysed Staphylococcus cells by enzymatic collateral damage. Simultaneous killing of unrelated bacteria by a single phage demonstrates the potential of CRISPR-Cas-assisted phage engineering, beyond single pathogen control.},
}
@article {pmid30052174,
year = {2018},
author = {Nguyen, SV and Harhay, DM and Bono, JL and Smith, TPL and Fields, PI and Dinsmore, BA and Santovenia, M and Wang, R and Bosilevac, JM and Harhay, GP},
title = {Comparative genomics of Salmonella enterica serovar Montevideo reveals lineage-specific gene differences that may influence ecological niche association.},
journal = {Microbial genomics},
volume = {4},
number = {8},
pages = {},
doi = {10.1099/mgen.0.000202},
pmid = {30052174},
issn = {2057-5858},
abstract = {Salmonella enterica serovar Montevideo has been linked to recent foodborne illness outbreaks resulting from contamination of products such as fruits, vegetables, seeds and spices. Studies have shown that Montevideo also is frequently associated with healthy cattle and can be isolated from ground beef, yet human salmonellosis outbreaks of Montevideo associated with ground beef contamination are rare. This disparity fuelled our interest in characterizing the genomic differences between Montevideo strains isolated from healthy cattle and beef products, and those isolated from human patients and outbreak sources. To that end, we sequenced 13 Montevideo strains to completion, producing high-quality genome assemblies of isolates from human patients (n=8) or from healthy cattle at slaughter (n=5). Comparative analysis of sequence data from this study and publicly available sequences (n=72) shows that Montevideo falls into four previously established clades, differentially occupied by cattle and human strains. The results of these analyses reveal differences in metabolic islands, environmental adhesion determinants and virulence factors within each clade, and suggest explanations for the infrequent association between bovine isolates and human illnesses.},
}
@article {pmid30051818,
year = {2018},
author = {Viswanatha, R and Li, Z and Hu, Y and Perrimon, N},
title = {Pooled genome-wide CRISPR screening for basal and context-specific fitness gene essentiality in Drosophila cells.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
doi = {10.7554/eLife.36333},
pmid = {30051818},
issn = {2050-084X},
support = {5T32GM007748-39/GM/NIGMS NIH HHS/United States ; W81XWH-16-1-0127//U.S. Department of Defense/International ; R01 GM067761/GM/NIGMS NIH HHS/United States ; R01GM067761/GM/NIGMS NIH HHS/United States ; LAM0122P01-17//LAM Foundation/International ; T32 GM007748/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
abstract = {Genome-wide screens in Drosophila cells have offered numerous insights into gene function, yet a major limitation has been the inability to stably deliver large multiplexed DNA libraries to cultured cells allowing barcoded pooled screens. Here, we developed a site-specific integration strategy for library delivery and performed a genome-wide CRISPR knockout screen in Drosophila S2R+ cells. Under basal growth conditions, 1235 genes were essential for cell fitness at a false-discovery rate of 5%, representing the highest-resolution fitness gene set yet assembled for Drosophila, including 407 genes which likely duplicated along the vertebrate lineage and whose orthologs were underrepresented in human CRISPR screens. We additionally performed context-specific fitness screens for resistance to or synergy with trametinib, a Ras/ERK/ETS inhibitor, or rapamycin, an mTOR inhibitor, and identified key regulators of each pathway. The results present a novel, scalable, and versatile platform for functional genomic screens in invertebrate cells.},
}
@article {pmid30048323,
year = {2018},
author = {Adams, AB and Kim, SC and Martens, GR and Ladowski, JM and Estrada, JL and Reyes, LM and Breeden, C and Stephenson, A and Eckhoff, DE and Tector, M and Tector, AJ},
title = {Xenoantigen Deletion and Chemical Immunosuppression Can Prolong Renal Xenograft Survival.},
journal = {Annals of surgery},
volume = {268},
number = {4},
pages = {564-573},
doi = {10.1097/SLA.0000000000002977},
pmid = {30048323},
issn = {1528-1140},
support = {R01 AI126322/AI/NIAID NIH HHS/United States ; },
abstract = {OBJECTIVE: Xenotransplantation using pig organs could end the donor organ shortage for transplantation, but humans have xenoreactive antibodies that cause early graft rejection. Genome editing can eliminate xenoantigens in donor pigs to minimize the impact of these xenoantibodies. Here we determine whether an improved cross-match and chemical immunosuppression could result in prolonged kidney xenograft survival in a pig-to-rhesus preclinical model.<br><br>METHODS: Double xenoantigen (Gal and Sda) knockout (DKO) pigs were created using CRISPR/Cas. Serum from rhesus monkeys (n = 43) was cross-matched with cells from the DKO pigs. Kidneys from the DKO pigs were transplanted into rhesus monkeys (n = 6) that had the least reactive cross-matches. The rhesus recipients were immunosuppressed with anti-CD4 and anti-CD8 T-cell depletion, anti-CD154, mycophenolic acid, and steroids.<br><br>RESULTS: Rhesus antibody binding to DKO cells is reduced, but all still have positive CDC and flow cross-match. Three grafts were rejected early at 5, 6, and 6 days. Longer survival was achieved in recipients with survival to 35, 100, and 435 days. Each of the 3 early graft losses was secondary to IgM antibody-mediated rejection. The 435-day graft loss occurred secondary to IgG antibody-mediated rejection.<br><br>CONCLUSIONS: Reducing xenoantigens in donor pigs and chemical immunosuppression can be used to achieve prolonged renal xenograft survival in a preclinical model, suggesting that if a negative cross-match can be obtained for humans then prolonged survival could be achieved.},
}
@article {pmid30046034,
year = {2018},
author = {Hynes, AP and Rousseau, GM and Agudelo, D and Goulet, A and Amigues, B and Loehr, J and Romero, DA and Fremaux, C and Horvath, P and Doyon, Y and Cambillau, C and Moineau, S},
title = {Widespread anti-CRISPR proteins in virulent bacteriophages inhibit a range of Cas9 proteins.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2919},
doi = {10.1038/s41467-018-05092-w},
pmid = {30046034},
issn = {2041-1723},
abstract = {CRISPR-Cas systems are bacterial anti-viral systems, and bacterial viruses (bacteriophages, phages) can carry anti-CRISPR (Acr) proteins to evade that immunity. Acrs can also fine-tune the activity of CRISPR-based genome-editing tools. While Acrs are prevalent in phages capable of lying dormant in a CRISPR-carrying host, their orthologs have been observed only infrequently in virulent phages. Here we identify AcrIIA6, an Acr encoded in 33% of virulent Streptococcus thermophilus phage genomes. The X-ray structure of AcrIIA6 displays some features unique to this Acr family. We compare the activity of AcrIIA6 to those of other Acrs, including AcrIIA5 (also from S. thermophilus phages), and characterize their effectiveness against a range of CRISPR-Cas systems. Finally, we demonstrate that both Acr families from S. thermophilus phages inhibit Cas9-mediated genome editing of human cells.},
}
@article {pmid30045985,
year = {2018},
author = {Pautasso, S and Galitska, G and Dell'Oste, V and Biolatti, M and Cagliani, R and Forni, D and De Andrea, M and Gariglio, M and Sironi, M and Landolfo, S},
title = {Strategy of Human Cytomegalovirus To Escape Interferon Beta-Induced APOBEC3G Editing Activity.},
journal = {Journal of virology},
volume = {92},
number = {19},
pages = {},
doi = {10.1128/JVI.01224-18},
pmid = {30045985},
issn = {1098-5514},
mesh = {APOBEC-3G Deaminase/*genetics/immunology ; CRISPR-Cas Systems ; Cell Line ; Computational Biology ; Cytomegalovirus/*genetics/immunology ; Epithelial Cells/immunology/virology ; Fibroblasts/immunology/virology ; Foreskin/cytology ; Gene Expression Regulation ; Gene Knockout Techniques ; *Genome, Viral ; HEK293 Cells ; Human Umbilical Vein Endothelial Cells/immunology/virology ; Humans ; *Immune Evasion ; Immunity, Innate ; Interferon-beta/*genetics/immunology ; Male ; Mutagenesis ; Open Reading Frames ; Primary Cell Culture ; Signal Transduction ; THP-1 Cells ; Virus Replication ; },
abstract = {The apolipoprotein B editing enzyme catalytic subunit 3 (APOBEC3) is a family of DNA cytosine deaminases that mutate and inactivate viral genomes by single-strand DNA editing, thus providing an innate immune response against a wide range of DNA and RNA viruses. In particular, APOBEC3A (A3A), a member of the APOBEC3 family, is induced by human cytomegalovirus (HCMV) in decidual tissues where it efficiently restricts HCMV replication, thereby acting as an intrinsic innate immune effector at the maternal-fetal interface. However, the widespread incidence of congenital HCMV infection implies that HCMV has evolved to counteract APOBEC3-induced mutagenesis through mechanisms that still remain to be fully established. Here, we have assessed gene expression and deaminase activity of various APOBEC3 gene family members in HCMV-infected primary human foreskin fibroblasts (HFFs). Specifically, we show that APOBEC3G (A3G) gene products and, to a lesser degree, those of A3F but not of A3A, are upregulated in HCMV-infected HFFs. We also show that HCMV-mediated induction of A3G expression is mediated by interferon beta (IFN-β), which is produced early during HCMV infection. However, knockout or overexpression of A3G does not affect HCMV replication, indicating that A3G is not a restriction factor for HCMV. Finally, through a bioinformatics approach, we show that HCMV has evolved mutational robustness against IFN-β by limiting the presence of A3G hot spots in essential open reading frames (ORFs) of its genome. Overall, our findings uncover a novel immune evasion strategy by HCMV with profound implications for HCMV infections.IMPORTANCE APOBEC3 family of proteins plays a pivotal role in intrinsic immunity defense mechanisms against multiple viral infections, including retroviruses, through the deamination activity. However, the currently available data on APOBEC3 editing mechanisms upon HCMV infection remain unclear. In the present study, we show that particularly the APOBEC3G (A3G) member of the deaminase family is strongly induced upon infection with HCMV in fibroblasts and that its upregulation is mediated by IFN-β. Furthermore, we were able to demonstrate that neither A3G knockout nor A3G overexpression appears to modulate HCMV replication, indicating that A3G does not inhibit HCMV replication. This may be explained by HCMV escape strategy from A3G activity through depletion of the preferred nucleotide motifs (hot spots) from its genome. The results may shed light on antiviral potential of APOBEC3 activity during HCMV infection, as well as the viral counteracting mechanisms under A3G-mediated selective pressure.},
}
@article {pmid30045910,
year = {2018},
author = {Rossant, J},
title = {Gene editing in human development: ethical concerns and practical applications.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {16},
pages = {},
doi = {10.1242/dev.150888},
pmid = {30045910},
issn = {1477-9129},
mesh = {CRISPR-Cas Systems/physiology ; Embryo Research/*ethics ; Embryo, Mammalian ; Embryonic Development/*genetics ; Gene Editing/*ethics/*methods/utilization ; Genome, Human ; Humans ; Pluripotent Stem Cells/physiology ; },
abstract = {The amazing power of CRISPR-Cas9 gene editing tools and other related technologies has impacted all areas of biology today. It has also raised ethical concerns, particularly with regard to the possibility of generating heritable changes in the human genome - so-called germline gene editing. Although technical and safety issues suggest that this approach is far from clinical application, gene editing as a research tool is moving forward in human embryos, non-human primates and in stem cell-derived embryoids. These studies are already providing new information relevant to our understanding of normal human development, infertility, early pregnancy loss and pluripotent stem cell origins.},
}
@article {pmid30044970,
year = {2018},
author = {Tambe, A and East-Seletsky, A and Knott, GJ and Doudna, JA and O'Connell, MR},
title = {RNA Binding and HEPN-Nuclease Activation Are Decoupled in CRISPR-Cas13a.},
journal = {Cell reports},
volume = {24},
number = {4},
pages = {1025-1036},
doi = {10.1016/j.celrep.2018.06.105},
pmid = {30044970},
issn = {2211-1247},
support = {P50 GM082250/GM/NIGMS NIH HHS/United States ; P50 GM102706/GM/NIGMS NIH HHS/United States ; S10 OD018174/OD/NIH HHS/United States ; S10 OD021489/OD/NIH HHS/United States ; },
abstract = {CRISPR-Cas13a enzymes are RNA-guided, RNA-activated RNases. Their properties have been exploited as powerful tools for RNA detection, RNA imaging, and RNA regulation. However, the relationship between target RNA binding and HEPN (higher eukaryotes and prokaryotes nucleotide binding) domain nuclease activation is poorly understood. Using sequencing experiments coupled with in vitro biochemistry, we find that Cas13a target RNA binding affinity and HEPN-nuclease activity are differentially affected by the number and the position of mismatches between the guide and the target. We identify a central binding seed for which perfect base pairing is required for target binding and a separate nuclease switch for which imperfect base pairing results in tight binding, but not HEPN-nuclease activation. These results demonstrate that the binding and cleavage activities of Cas13a are decoupled, highlighting a complex specificity landscape. Our findings underscore a need to consider the range of effects off-target recognition has on Cas13a RNA binding and cleavage behavior for RNA-targeting tool development.},
}
@article {pmid30043362,
year = {2018},
author = {Wolter, F and Puchta, H},
title = {Application of CRISPR/Cas to Understand Cis- and Trans-Regulatory Elements in Plants.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1830},
number = {},
pages = {23-40},
doi = {10.1007/978-1-4939-8657-6_2},
pmid = {30043362},
issn = {1940-6029},
abstract = {The recent emergence of the CRISPR/Cas system as a genome editing tool enables simple, fast, and efficient induction of DNA double-strand breaks at precise positions in the genome. This has proven extremely useful for analysis and modification of protein-coding sequences. Regulatory sequences have received much less attention, but can now be quickly and easily disrupted as well. Editing of cis-regulatory elements (CRE) offers considerable potential for crop improvement via fine-tuning of gene expression that cannot be achieved by simple KO mutations, but its widespread application is still hampered by a lack of precise knowledge about functional motifs in CRE. As demonstrated for mammalian cells, CRISPR/Cas is also extremely useful for the identification and analysis of CRE in their native environment on a large scale using tiling screens. Transcriptional complexes are another promising target for crop genome editing, as demonstrated for pathogen resistance and regulation of flowering. The development of more diverse and sophisticated CRISPR/Cas tools for genome editing will allow even more efficient and powerful approaches for editing of regulatory sequences in the future.},
}
@article {pmid30043343,
year = {2018},
author = {Sardesai, N and Subramanyam, S},
title = {Agrobacterium: A Genome-Editing Tool-Delivery System.},
journal = {Current topics in microbiology and immunology},
volume = {},
number = {},
pages = {},
doi = {10.1007/82_2018_101},
pmid = {30043343},
issn = {0070-217X},
abstract = {With the rapidly increasing global population, it will be extremely challenging to provide food to the world without increasing food production by at least 70% over the next 30 years. As we reach the limits of expanding arable land, the responsibility of meeting this production goal will rely on increasing yields. Traditional plant breeding practices will not be able to realistically meet these expectations, thrusting plant biotechnology into the limelight to fulfill these needs. Better varieties will need to be developed faster and with the least amount of regulatory hurdles. With the need to add, delete, and substitute genes into existing genomes, the field of genome editing and gene targeting is now rapidly developing with numerous new technologies coming to the forefront. Agrobacterium-mediated crop transformation has been the most utilized method to generate transgenic varieties that are better yielding, have new traits, and are disease and pathogen resistant. Genome-editing technologies rely on the creation of double-strand breaks (DSBs) in the genomic DNA of target species to facilitate gene disruption, addition, or replacement through either non-homologous end joining or homology-dependent repair mechanisms. DSBs can be introduced through the use of zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspersed short palindromic repeats (CRISPR)/Cas nucleases, among others. Agrobacterium strains have been employed to deliver the reagents for genome editing to the specific target cells. Understanding the biology of transformation from the perspective not only of Agrobacterium, but also of the host, from processing of T-DNA to its integration in the host genome, has resulted in a wealth of information that has been used to engineer Agrobacterium strains having increased virulence. As more technologies are being developed, that will help overcome issues of Agrobacterium host range and random integration of DNA, combined with highly sequence-specific nucleases, a robust crop genome-editing toolkit finally seems attainable.},
}
@article {pmid30040285,
year = {2018},
author = {van de Vrugt, HJ and Cornel, MC and Wolthuis, RMF},
title = {[CRISPR/Cas: technique to repair DNA errors: is a clinical breakthrough near?].},
journal = {Nederlands tijdschrift voor geneeskunde},
volume = {162},
number = {},
pages = {},
pmid = {30040285},
issn = {1876-8784},
abstract = {CRISPR/Cas gene editing makes it much easier to make targeted changes in the DNA of human cells than other forms of gene therapy. This revolutionary technology offers spectacular opportunities to study gene functions; the clinical consequences of gene variations in patients can be determined much faster. The efficacy and accuracy of CRISPR/Cas is so impressive that a breakthrough to therapeutic applications is approaching fast. CRISPR/Cas is already being used in immunotherapy against cancer, and trials for monogenetic blood disorders, such as beta-thalassemia, have been scheduled. However, broad clinical implementation of CRISPR/Cas is not feasible yet, due to off-target DNA changes that may occur as a by-product. Particularly in case of in-vivo applications there are therapeutic challenges. For gene editing in human embryos, technical shortcomings and open ethical issues need to be addressed. Gene-editing therapy for serious disorders with transplantable cell types, and therefore the option of verification of &quot;CRISPRed&quot; cells, is seen as a possible first application within the regular healthcare system.},
}
@article {pmid30039929,
year = {2018},
author = {Sun, B and Yang, J and Yang, S and Ye, RD and Chen, D and Jiang, Y},
title = {A CRISPR-Cpf1-Assisted Non-Homologous End Joining Genome Editing System of Mycobacterium smegmatis.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700588},
doi = {10.1002/biot.201700588},
pmid = {30039929},
issn = {1860-7314},
support = {2014CB745101//National Basic Research Program of China/ ; 2014CB745102//National Basic Research Program of China/ ; 31470209//National Natural Science Foundation of China/ ; 31500068//National Natural Science Foundation of China/ ; 31470685//National Natural Science Foundation of China/ ; 18ZR1446500//Natural Science Foundation of Shanghai/ ; 18ZR1446800//Natural Science Foundation of Shanghai/ ; },
abstract = {Mycobacterium smegmatis is an important model strain of Mycobacterium for scientific study because it is non-pathogenic and grows rapidly. However, research is limited by the low efficiency and time-consuming nature of existing genome editing tools. Although the Streptococcus pyogenes CRISPR-Cas9 system is widely used in bacterial genome editing, it cannot be introduced into M. smegmatis because of its toxicity. The authors test 14 different Cas effector proteins in M. smegmatis. Cas9 (TdCas9_m) from Treponema denticola, Cas9 (NmCas9) from Neisseria meningitidis, and Corynebacterium glutamicum codon-optimized Cpf1 (FnCpf1_cg) from Francisella tularensis do not affect cell growth. The numbers of transformant plasmids expressing TdCas9_m, NmCas9, or FnCpf1_cg, and guide RNAs (gRNA) targeting ku(MSMEG_5580), ligD(MSMEG_6301), pta(MSMEG_0783), or ackA(MSMEG_0784) decreases by about 10-, 10-, or 100-fold, respectively, compared with plasmids expressing only the Cas effector proteins. Non-homologous end joining (NHEJ) is detected only in the CRISPR-FnCpf1_cg system. The one-plasmid-based, CRISPR-FnCpf1-assisted NHEJ system enables N iterative rounds of genome editing in 7N + 2 days, with an editing efficiency up to 70%; thus, this system should greatly reduce the necessary genome manipulation time for M. smegmatis.},
}
@article {pmid30039577,
year = {2018},
author = {Espitia Jaimes, C and Fish, RJ and Neerman-Arbez, M},
title = {Local chromatin interactions contribute to expression of the fibrinogen gene cluster.},
journal = {Journal of thrombosis and haemostasis : JTH},
volume = {16},
number = {10},
pages = {2070-2082},
doi = {10.1111/jth.14248},
pmid = {30039577},
issn = {1538-7836},
support = {31003A_172864//Swiss National Science Foundation/ ; },
abstract = {Essentials The fibrinogen gene cluster is flanked by CCCTC-binding factor (CTCF) interaction sites. Chromatin looping of the fibrinogen cluster was demonstrated by chromosome conformation capture. Deleting a CTCF interaction site alters chromatin looping and halves fibrinogen expression. Looping of the human fibrinogen locus is functionally linked to fibrinogen gene expression.<br><br>SUMMARY: Background The coordinately regulated genes encoding human fibrinogen are clustered. This evolutionarily conserved configuration provides a possible mechanism for co-regulation whereby regulatory elements influence gene expression locally. The cluster is flanked by CCCTC-binding factor (CTCF) interaction sites that are candidate insulator regions mediating chromatin looping. Objectives To further our understanding of fibrinogen gene regulation, we aimed to investigate whether interactions exist between parts of the fibrinogen locus and how these contacts contribute to fibrinogen expression. Methods We used chromosome conformation capture in cultured cell lines to detect chromatin interactions at the fibrinogen gene cluster. We generated clonal cell lines where two CTCF interaction sites at one end of the locus were deleted using CRISPR-Cas9-mediated genome editing. Fibrinogen expression and protein production were measured using qRT-PCR and ELISA, respectively. Results We detected proximity between the ends of the fibrinogen locus, regardless of whether cells express fibrinogen. An interaction between the FGA promoter and the edge of the locus was more frequent in fibrinogen-expressing cells. Deletion of a CTCF site at one edge of the cluster altered chromatin interactions, reduced steady-state expression of FGB and FGG mRNA, and led to a halving of secreted fibrinogen. These phenotypes were completely restored by reintroduction of the CTCF interaction motif in previously motif-deleted clones. Conclusions Chromatin interactions are important for the coordinated regulation of the human fibrinogen genes. This finding furthers our comprehension of how fibrinogen is produced and identifies a possible source of variability in plasma fibrinogen levels seen in populations.},
}
@article {pmid30038015,
year = {2018},
author = {Bonsma-Fisher, M and Soutière, D and Goyal, S},
title = {How adaptive immunity constrains the composition and fate of large bacterial populations.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {32},
pages = {E7462-E7468},
doi = {10.1073/pnas.1802887115},
pmid = {30038015},
issn = {1091-6490},
mesh = {Adaptive Immunity/*physiology ; Bacteria/genetics/*immunology/virology ; Bacteriophages/genetics/*immunology ; CRISPR-Cas Systems/*immunology ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics/immunology ; DNA, Viral/genetics/immunology ; Evolution, Molecular ; Quorum Sensing/*immunology ; },
abstract = {Features of the CRISPR-Cas system, in which bacteria integrate small segments of phage genome (spacers) into their DNA to neutralize future attacks, suggest that its effect is not limited to individual bacteria but may control the fate and structure of whole populations. Emphasizing the population-level impact of the CRISPR-Cas system, recent experiments show that some bacteria regulate CRISPR-associated genes via the quorum sensing (QS) pathway. Here we present a model that shows that from the highly stochastic dynamics of individual spacers under QS control emerges a rank-abundance distribution of spacers that is time invariant, a surprising prediction that we test with dynamic spacer-tracking data from literature. This distribution depends on the state of the competing phage-bacteria population, which due to QS-based regulation may coexist in multiple stable states that vary significantly in their phage-to-bacterium ratio, a widely used ecological measure to characterize microbial systems.},
}
@article {pmid30037991,
year = {2018},
author = {Huang, J and Li, J and Zhou, J and Wang, L and Yang, S and Hurst, LD and Li, WH and Tian, D},
title = {Identifying a large number of high-yield genes in rice by pedigree analysis, whole-genome sequencing, and CRISPR-Cas9 gene knockout.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {32},
pages = {E7559-E7567},
doi = {10.1073/pnas.1806110115},
pmid = {30037991},
issn = {1091-6490},
mesh = {Agriculture/*methods ; CRISPR-Cas Systems/genetics ; Gene Knockout Techniques/methods ; Genome, Plant/*physiology ; Oryza/genetics/*physiology ; Pedigree ; Phenotype ; Plants, Genetically Modified/genetics/physiology ; *Quantitative Trait Loci ; *Quantitative Trait, Heritable ; Selection, Genetic/genetics ; Sequence Analysis, DNA/methods ; },
abstract = {Repeated artificial selection of a complex trait facilitates the identification of genes underlying the trait, especially if multiple selected descendant lines are available. Here we developed a pedigree-based approach to identify genes underlying the Green Revolution (GR) phenotype. From a pedigree analysis, we selected 30 cultivars including the &quot;miracle rice&quot; IR8, a GR landmark, its ancestors and descendants, and also other related cultivars for identifying high-yield genes. Through sequencing of these genomes, we identified 28 ancestral chromosomal blocks that were maintained in all the high-yield cultivars under study. In these blocks, we identified six genes of known function, including the GR gene sd1, and 123 loci with genes of unknown function. We randomly selected 57 genes from the 123 loci for knockout or knockdown studies and found that a high proportion of these genes are essential or have phenotypic effects related to rice production. Notably, knockout lines have significant changes in plant height (P < 0.003), a key GR trait, compared with wild-type lines. Some gene knockouts or knockdowns were especially interesting. For example, knockout of Os10g0555100, a putative glucosyltransferase gene, showed both reduced growth and altered panicle architecture. In addition, we found that in some retained chromosome blocks several GR-related genes were clustered, although they have unrelated sequences, suggesting clustering of genes with similar functions. In conclusion, we have identified many high-yield genes in rice. Our method provides a powerful means to identify genes associated with a specific trait.},
}
@article {pmid30036575,
year = {2018},
author = {Azam, MW and Khan, AU},
title = {Updates on the pathogenicity status of Pseudomonas aeruginosa.},
journal = {Drug discovery today},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.drudis.2018.07.003},
pmid = {30036575},
issn = {1878-5832},
abstract = {Pseudomonas aeruginosa is a pathogenic bacterial species that causes infections and diseases in both plants and animals, including several human diseases, especially in immune-compromised patients, and many hospital-acquired infections. Given that P. aeruginosa is an opportunistic pathogen, the occurrence of antimicrobial resistance makes it difficult to treat and eradicate. Antimicrobial resistance in P. aeruginosa is categorized as intrinsic, acquired, or adaptive. Here, we different aspects of resistance and pathogenicity in P. aeruginosa, such as the role of outer membrane proteins, transcriptional regulators, efflux pumps, enzymes, and biofilms in antimicrobial resistance. We also highlight quorum-sensing (QS) genes, their protein secretion, and role in pathogenicity; different QS inhibitors; and the influence of QS on the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system and virulence factor production.},
}
@article {pmid30036493,
year = {2018},
author = {García-León, JA and Cabrera-Socorro, A and Eggermont, K and Swijsen, A and Terryn, J and Fazal, R and Nami, F and Ordovás, L and Quiles, A and Lluis, F and Serneels, L and Wierda, K and Sierksma, A and Kreir, M and Pestana, F and Van Damme, P and De Strooper, B and Thorrez, L and Ebneth, A and Verfaillie, CM},
title = {Generation of a human induced pluripotent stem cell-based model for tauopathies combining three microtubule-associated protein TAU mutations which displays several phenotypes linked to neurodegeneration.},
journal = {Alzheimer's &amp; dementia : the journal of the Alzheimer's Association},
volume = {14},
number = {10},
pages = {1261-1280},
doi = {10.1016/j.jalz.2018.05.007},
pmid = {30036493},
issn = {1552-5279},
abstract = {INTRODUCTION: Tauopathies are neurodegenerative diseases characterized by TAU protein-related pathology, including frontotemporal dementia and Alzheimer's disease among others. Mutant TAU animal models are available, but none of them faithfully recapitulates human pathology and are not suitable for drug screening.<br><br>METHODS: To create a new in vitro tauopathy model, we generated a footprint-free triple MAPT-mutant human induced pluripotent stem cell line (N279K, P301L, and E10+16 mutations) using clustered regularly interspaced short palindromic repeats-FokI and piggyBac transposase technology.<br><br>RESULTS: Mutant neurons expressed pathogenic 4R and phosphorylated TAU, endogenously triggered TAU aggregation, and had increased electrophysiological activity. TAU-mutant cells presented deficiencies in neurite outgrowth, aberrant sequence of differentiation to cortical neurons, and a significant activation of stress response pathways. RNA sequencing confirmed stress activation, demonstrated a shift toward GABAergic identity, and an upregulation of neurodegenerative pathways.<br><br>DISCUSSION: In summary, we generated a novel in vitro human induced pluripotent stem cell TAU-mutant model displaying neurodegenerative disease phenotypes that could be used for disease modeling and drug screening.},
}
@article {pmid30033365,
year = {2018},
author = {Landsberger, M and Gandon, S and Meaden, S and Rollie, C and Chevallereau, A and Chabas, H and Buckling, A and Westra, ER and van Houte, S},
title = {Anti-CRISPR Phages Cooperate to Overcome CRISPR-Cas Immunity.},
journal = {Cell},
volume = {174},
number = {4},
pages = {908-916.e12},
doi = {10.1016/j.cell.2018.05.058},
pmid = {30033365},
issn = {1097-4172},
support = {//Wellcome Trust/United Kingdom ; },
abstract = {Some phages encode anti-CRISPR (acr) genes, which antagonize bacterial CRISPR-Cas immune systems by binding components of its machinery, but it is less clear how deployment of these acr genes impacts phage replication and epidemiology. Here, we demonstrate that bacteria with CRISPR-Cas resistance are still partially immune to Acr-encoding phage. As a consequence, Acr-phages often need to cooperate in order to overcome CRISPR resistance, with a first phage blocking the host CRISPR-Cas immune system to allow a second Acr-phage to successfully replicate. This cooperation leads to epidemiological tipping points in which the initial density of Acr-phage tips the balance from phage extinction to a phage epidemic. Furthermore, both higher levels of CRISPR-Cas immunity and weaker Acr activities shift the tipping points toward higher initial phage densities. Collectively, these data help elucidate how interactions between phage-encoded immune suppressors and the CRISPR systems they target shape bacteria-phage population dynamics.},
}
@article {pmid30033364,
year = {2018},
author = {Borges, AL and Zhang, JY and Rollins, MF and Osuna, BA and Wiedenheft, B and Bondy-Denomy, J},
title = {Bacteriophage Cooperation Suppresses CRISPR-Cas3 and Cas9 Immunity.},
journal = {Cell},
volume = {174},
number = {4},
pages = {917-925.e10},
doi = {10.1016/j.cell.2018.06.013},
pmid = {30033364},
issn = {1097-4172},
support = {R21 AI130670/AI/NIAID NIH HHS/United States ; DP5 OD021344/OD/NIH HHS/United States ; P30 GM110732/GM/NIGMS NIH HHS/United States ; R01 GM110270/GM/NIGMS NIH HHS/United States ; P20 GM103500/GM/NIGMS NIH HHS/United States ; R01 GM108888/GM/NIGMS NIH HHS/United States ; },
abstract = {Bacteria utilize CRISPR-Cas adaptive immune systems for protection from bacteriophages (phages), and some phages produce anti-CRISPR (Acr) proteins that inhibit immune function. Despite thorough mechanistic and structural information for some Acr proteins, how they are deployed and utilized by a phage during infection is unknown. Here, we show that Acr production does not guarantee phage replication when faced with CRISPR-Cas immunity, but instead, infections fail when phage population numbers fall below a critical threshold. Infections succeed only if a sufficient Acr dose is contributed to a single cell by multiple phage genomes. The production of Acr proteins by phage genomes that fail to replicate leave the cell immunosuppressed, which predisposes the cell for successful infection by other phages in the population. This altruistic mechanism for CRISPR-Cas inhibition demonstrates inter-virus cooperation that may also manifest in other host-parasite interactions.},
}
@article {pmid30031987,
year = {2018},
author = {Eisenbach, L and Janßen, D and Ehrmann, MA and Vogel, RF},
title = {Comparative genomics of Lactobacillus curvatus enables prediction of traits relating to adaptation and strategies of assertiveness in sausage fermentation.},
journal = {International journal of food microbiology},
volume = {286},
number = {},
pages = {37-47},
doi = {10.1016/j.ijfoodmicro.2018.06.025},
pmid = {30031987},
issn = {1879-3460},
abstract = {Lactobacillus (L.) curvatus reaches high numbers in a variety of habitats, which suggests a high (genomic) diversity within this species. Empirically selected strains are used as starter cultures in sausage fermentation. Determinants for the assertiveness of a strain in this environment are assumed to be multifactorial. We used comparative genomics and in silico proteomics of 10 L. curvatus strains, which were representative of its genetic and physiological biodiversity, to possibly derive genetic determinants for strain or group specific assertiveness in sausage fermentation. Their genome sizes ranged from 1.7 Mb up to 2.0 Mb. The estimated pan- and core genomes were 3.0 Mb and 1.4 Mb, respectively. The accessory genome, GC-content and coding density revealed a significant genomic diversity within this species. Plasmids were found, which were either closely related or unique in several strains. Putative assertiveness determinants including CRISPR/Cas systems, prophages, bacteriocin production, or specific metabolic settings were detected. Such traits of the accessory genome could not be correlated with the source of isolation. Pathways, which previously have been predicted for a relation with adaptation to meat of L. sakei, are part of the core genome of L curvatus. Intraspecies differences in the accessory genome of L. curvatus comprise ribose metabolism, enzymes involved in nucleotide metabolism (nucleoside phosphorylases, phosphopentomutase, adenosine deaminase, ribose transporters), and tyrosine decarboxylases, ornithine decarboxylases. One group of the strains encoded a phosphotransferase system (PTS) as ribose transporter, whereas the second group encoded an ATP binding cassette (ABC) transporter. Analysis of the ribose uptake by HPLC analysis revealed different efficiencies of both transporter systems. Except for bacteriocin formation, no strain specific traits were identified predicting assertiveness of single strains. This fits our previous observation that single strains of L. curvatus could not override others in a competitive setting. Rather, pairs or sets of strains, comprising metabolically synergistic or non-assertive partner strains were able to dominate the fermentation. Indeed, this work suggests that assertive partnerships can be predicted along their complementary accessory genomes.},
}
@article {pmid30029875,
year = {2018},
author = {Zhang, B and Lu, HY and Xia, YH and Jiang, AG and Lv, YX},
title = {Long non-coding RNA EPIC1 promotes human lung cancer cell growth.},
journal = {Biochemical and biophysical research communications},
volume = {503},
number = {3},
pages = {1342-1348},
doi = {10.1016/j.bbrc.2018.07.046},
pmid = {30029875},
issn = {1090-2104},
abstract = {Long non-coding RNA (LncRNA) EPIC1 (Lnc-EPIC1) is a MYC-interacting LncRNA. In the present study, the expression and potential function of Lnc-EPIC1 in human lung cancer cells are tested. We show that Lnc-EPIC1 expression is significantly higher in established/primary human lung cancer cells than that in human lung epithelial cells. Lnc-EPIC1 is also elevated in human lung cancer tissues. Silencing of Lnc-EPIC1 by targeted siRNA significantly inhibited human lung cancer cell growth, survival and proliferation, whiling inducing G1-S cell cycle arrest and cell apoptosis. MYC targets, including Cyclin A1, CDC20 and CDC45, were downregulated by Lnc-EPIC1 siRNA. MYC knockout by CRISPR/Cas-9 gene-editing method mimicked actions by Lnc-EPIC1 siRNA in A549 cells. Conversely, forced overexpression of Lnc-EPIC1 by a lentiviral construct increased expression of MYC targets to promote A549 cell growth. Lnc-EPIC1 directly associated with MYC protein in the nuclei of A549 cells. Significantly MYC knockout abolished Lnc-EPIC1 silencing- or overexpression-induced actions in human lung cancer cells. Together, our results show that Lnc-EPIC1 promotes human lung cancer cell growth possibly by targeting MYC.},
}
@article {pmid30029055,
year = {2018},
author = {Trillhaase, A and Haferkamp, U and Rangnau, A and Märtens, M and Schmidt, B and Trilck, M and Seibler, P and Aherrahrou, R and Erdmann, J and Aherrahrou, Z},
title = {Differentiation of human iPSCs into VSMCs and generation of VSMC-derived calcifying vascular cells.},
journal = {Stem cell research},
volume = {31},
number = {},
pages = {62-70},
doi = {10.1016/j.scr.2018.07.008},
pmid = {30029055},
issn = {1876-7753},
abstract = {Vascular calcification displays a major cause of death worldwide, which involve mainly vascular smooth muscle cells (VSMCs). Since 2007, there are increasing numbers of protocols to obtain different cell types from human induced-pluripotent stem cells (iPSCs), however a protocol for calcification is missing. Few protocols exist today for the differentiation of iPSCs towards VSMCs and none are known for their calcification. Here we present a protocol for the calcification of iPSC-derived VSMCs. We successfully differentiated iPSCs into VSMCs based on a modified protocol. Calcification in VSMCs is induced by a commercial StemXVivo™ osteogenic medium. Calcification was verified using Calcein and Alizarin Red S staining or Calcium assays, and molecular analyses showed enhanced expression of calcification-associated genes. The presented method could help to study genetic risk variants, using the CRISPR/Cas technology through the introduction of Knockouts or Knockins of risk variants. Finally, this method can be applied for drug screening.},
}
@article {pmid30026227,
year = {2018},
author = {Grevet, JD and Lan, X and Hamagami, N and Edwards, CR and Sankaranarayanan, L and Ji, X and Bhardwaj, SK and Face, CJ and Posocco, DF and Abdulmalik, O and Keller, CA and Giardine, B and Sidoli, S and Garcia, BA and Chou, ST and Liebhaber, SA and Hardison, RC and Shi, J and Blobel, GA},
title = {Domain-focused CRISPR screen identifies HRI as a fetal hemoglobin regulator in human erythroid cells.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6399},
pages = {285-290},
doi = {10.1126/science.aao0932},
pmid = {30026227},
issn = {1095-9203},
support = {R37 DK058044/DK/NIDDK NIH HHS/United States ; R01 HL065449/HL/NHLBI NIH HHS/United States ; R56 DK065806/DK/NIDDK NIH HHS/United States ; R01 HL119479/HL/NHLBI NIH HHS/United States ; R01 GM110174/GM/NIGMS NIH HHS/United States ; U54 HG006998/HG/NHGRI NIH HHS/United States ; R01 AI118891/AI/NIAID NIH HHS/United States ; R01 DK054937/DK/NIDDK NIH HHS/United States ; R24 DK106766/DK/NIDDK NIH HHS/United States ; T32 GM008216/GM/NIGMS NIH HHS/United States ; R01 MD009124/MD/NIMHD NIH HHS/United States ; F30 DK107055/DK/NIDDK NIH HHS/United States ; },
mesh = {Anemia, Sickle Cell/drug therapy/*genetics ; CRISPR-Cas Systems ; Carrier Proteins/*genetics/metabolism ; Cell Line ; Erythroid Cells/*metabolism ; Fetal Hemoglobin/*genetics ; *Gene Expression Regulation ; Genetic Testing ; Humans ; Molecular Targeted Therapy ; Nuclear Proteins/*genetics/metabolism ; RNA, Guide ; eIF-2 Kinase/*genetics/metabolism ; },
abstract = {Increasing fetal hemoglobin (HbF) levels in adult red blood cells provides clinical benefit to patients with sickle cell disease and some forms of β-thalassemia. To identify potentially druggable HbF regulators in adult human erythroid cells, we employed a protein kinase domain-focused CRISPR-Cas9-based genetic screen with a newly optimized single-guide RNA scaffold. The screen uncovered the heme-regulated inhibitor HRI (also known as EIF2AK1), an erythroid-specific kinase that controls protein translation, as an HbF repressor. HRI depletion markedly increased HbF production in a specific manner and reduced sickling in cultured erythroid cells. Diminished expression of the HbF repressor BCL11A accounted in large part for the effects of HRI depletion. Taken together, these results suggest HRI as a potential therapeutic target for hemoglobinopathies.},
}
@article {pmid30024364,
year = {2018},
author = {Stout, EA and Sanozky-Dawes, R and Goh, YJ and Crawley, AB and Klaenhammer, TR and Barrangou, R},
title = {Deletion-based escape of CRISPR-Cas9 targeting in Lactobacillus gasseri.},
journal = {Microbiology (Reading, England)},
volume = {164},
number = {9},
pages = {1098-1111},
doi = {10.1099/mic.0.000689},
pmid = {30024364},
issn = {1465-2080},
abstract = {Lactobacillus gasseri is a human commensal which carries CRISPR-Cas, an adaptive immune system that protects the cell from invasive mobile genetic elements (MGEs). However, MGEs occasionally escape CRISPR targeting due to DNA mutations that occur in sequences involved in CRISPR interference. To better understand CRISPR escape processes, a plasmid interference assay was used to screen for mutants that escape CRISPR-Cas targeting. Plasmids containing a target sequence and a protospacer adjacent motif (PAM) were transformed for targeting by the native CRISPR-Cas system. Although the primary outcome of the assay was efficient interference, a small proportion of the transformed population overcame targeting. Mutants containing plasmids that had escaped were recovered to investigate the genetic routes of escape and their relative frequencies. Deletion of the targeting spacer in the native CRISPR array was the dominant pattern of escape, accounting for 52-70 % of the mutants from two L. gasseri strains. We repeatedly observed internal deletions in the chromosomal CRISPR array, characterized by polarized excisions from the leader end that spanned 1-15 spacers, and systematically included the leader-proximal targeting spacer. This study shows that deletions of spacers within CRISPR arrays constitute a key escape mechanism to evade CRISPR targeting, while preserving the functionality of the CRISPR-Cas system. This mechanism enables cells to maintain an active immune system, but allows the uptake of potentially beneficial plasmids. Our study revealed the co-occurrence of other genomic mutations associated with various phenotypes, showing how this selection process uncovers population diversification.},
}
@article {pmid30022698,
year = {2018},
author = {Jain, I and Minakhin, L and Mekler, V and Sitnik, V and Rubanova, N and Severinov, K and Semenova, E},
title = {Defining the seed sequence of the Cas12b CRISPR-Cas effector complex.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-10},
doi = {10.1080/15476286.2018.1495492},
pmid = {30022698},
issn = {1555-8584},
abstract = {Target binding by CRISPR-Cas ribonucleoprotein effectors is initiated by the recognition of double-stranded PAM motifs by the Cas protein moiety followed by destabilization, localized melting, and interrogation of the target by the guide part of CRISPR RNA moiety. The latter process depends on seed sequences, parts of the target that must be strictly complementary to CRISPR RNA guide. Mismatches between the target and CRISPR RNA guide outside the seed have minor effects on target binding, thus contributing to off-target activity of CRISPR-Cas effectors. Here, we define the seed sequence of the Type V Cas12b effector from Bacillus thermoamylovorans. While the Cas12b seed is just five bases long, in contrast to all other effectors characterized to date, the nucleotide base at the site of target cleavage makes a very strong contribution to target binding. The generality of this additional requirement was confirmed during analysis of target recognition by Cas12b effector from Alicyclobacillus acidoterrestris. Thus, while the short seed may contribute to Cas12b promiscuity, the additional specificity determinant at the site of cleavage may have a compensatory effect making Cas12b suitable for specialized genome editing applications.},
}
@article {pmid30021719,
year = {2018},
author = {Liu, HL and Shen, Y and Gao, Y and Zhou, L and Han, XS and Zhao, CZ and Yang, GJ and Chen, YL and Yang, H and Xie, SS},
title = {[Assessing abundance and specificity of different types of sgRNA targeting miRNA precursors].},
journal = {Yi chuan = Hereditas},
volume = {40},
number = {7},
pages = {561-571},
doi = {10.16288/j.yczz.17-417},
pmid = {30021719},
issn = {0253-9772},
abstract = {CRISPR/Cas technology enables efficient and specific editing the genome. Since different bacterial sources or artificially modified Cas9, as well as Cpf1 and other nucleases, recognize different PAMs (protospacer adjacent motifs), different gene editing nucleases may use different types of sgRNAs (small guide RNA). MicroRNAs (miRNAs) are a class of regulatory small non-coding RNAs. To determine whether specific targets for sgRNAs in miRNA precursor exit, the abundance and specificity of 11 different types of sgRNA targeting 28 645 miRNA precursors were analyzed in the present study using the CRISPR-offinder, a bioinformatics software developed in our own laboratory. The CRISPR/Cas9 lentivirus technology was used to target the miR-302/367 cluster in a porcine cell line, and its knockout efficiency for the miRNA target was evaluated. The results show that there are about 8 different types of sgRNAs that can target individual miRNA precursors. By assessing the off-target effect, only 18.2% of the sgRNAs showed high specificity for targeting the porcine miRNA precursors. Lastly, using the miR-302/367 cluster target as an example, we showed that the CRISPR/Cas9 lentivirus technology was 40% efficient in successfully establishing correct knockout of the target miRNA in the porcine cell line. This present study provides an important resource for the use of CRISPR/Cas technology to target miRNAs for knockout studies.},
}
@article {pmid30021624,
year = {2018},
author = {Sevim, H and Kocaefe, YÇ and Onur, MA and Uçkan-Çetinkaya, D and Gürpınar, ÖA},
title = {Bone marrow derived mesenchymal stem cells ameliorate inflammatory response in an in vitro model of familial hemophagocytic lymphohistiocytosis 2.},
journal = {Stem cell research &amp; therapy},
volume = {9},
number = {1},
pages = {198},
doi = {10.1186/s13287-018-0941-y},
pmid = {30021624},
issn = {1757-6512},
support = {SBAG-114S057//Türkiye Bilimsel ve Teknolojik Araştirma Kurumu (TR)/ ; 013D12601001//Hacettepe Üniversitesi/ ; },
abstract = {BACKGROUND: Familial hemophagocytic lymphohistiocytosis 2 (FHL2) is the most common familial type of hemophagocytic lymphohistiocytosis with immune dysregulation. FHL2 patients have mutations in the perforin gene which cause overactivation and proliferation of cytotoxic T lymphocytes and natural killer cells. Perforin is the key component of the cytolytic granule response function of cytotoxic T lymphocytes and natural killer cells. Perforin dysfunction causes a cytotoxic immune deficiency with a clinical outcome of uncontrolled and continuous immune stimulation response. This excessive stimulation leads to continuous systemic inflammation and, ultimately, multiorgan failure. Radical therapy is hematopoietic stem cell transplantation which is limited by the availability of a donor. Exacerbations of inflammatory attacks require a palliative immunosuppressive regimen. There is a need for an alternative or adjuvant therapy to maintain these patients when immunosuppression is ineffective or a donor is not available. Beneficial actions of mesenchymal stem cells (MSCs) have been shown in autoimmune diseases in clinical trials and are attributed to their immune-modulatory properties. This study aimed to assess the immune-modulatory effect of MSCs in an in-vitro model of FHL2.<br><br>METHODS: We generated a targeted mutation in the perforin gene of NK92 cells to create an in-vitro FLH2 model using Crispr/Cas technology. A coculture setup was employed to assess the immunomodulatory efficacy of MSCs.<br><br>RESULTS: Engineered NK92 clones did not show PRF1 mRNA expression and failed to secrete perforin upon phorbol myristate acetate-ionomycin stimulation, providing evidence for a valid FHL2 model. Coculture media of the engineered cells were investigated for the abundance of several cytokines. Coculture with MSCs revealed a reduction in major proinflammatory cytokines and an induction in anti-inflammatory and immunomodulatory cytokines compared to the parental NK92 cells.<br><br>CONCLUSIONS: This study shows the ameliorating effect of MSCs as an adjuvant immune modulator toward the therapy of FHL2 patients. MSCs are supportive therapy candidates for FHL2 patients under circumstances where prolonged immunosuppression is required to gain time before allogeneic hematopoietic stem cell transplantation.},
}
@article {pmid30014471,
year = {2018},
author = {Razzouk, S},
title = {CRISPR-Cas9: A cornerstone for the evolution of precision medicine.},
journal = {Annals of human genetics},
volume = {82},
number = {6},
pages = {331-357},
doi = {10.1111/ahg.12271},
pmid = {30014471},
issn = {1469-1809},
abstract = {Modern genetic therapy incorporates genomic testing and genome editing. It is the finest approach for precision medicine. Genome editing is a state-of-the-art technology to manipulate gene expression thus generating a particular genotype. It encompasses multiple programmable nuclease-based approaches leading to genetic changes. Not surprisingly, this method triggered internationally a wide array of controversies in the scientific community and in the public since it transforms the human genome. Given its importance, the pace of this technology is exceptionally fast. In this report, we introduce one aspect of genome editing, the CRISPR/Cas9 system, highlight its potential to correct genetic mutations and explore its utility in clinical setting. Our goal is to enlighten health care providers about genome editing and incite them to take part of this vital debate.},
}
@article {pmid30013417,
year = {2018},
author = {Vesikansa, A},
title = {Unraveling of Central Nervous System Disease Mechanisms Using CRISPR Genome Manipulation.},
journal = {Journal of central nervous system disease},
volume = {10},
number = {},
pages = {1179573518787469},
doi = {10.1177/1179573518787469},
pmid = {30013417},
issn = {1179-5735},
abstract = {The complex structure and highly variable gene expression profile of the brain makes it among the most challenging fields to study in both basic and translational biological research. Most of the brain diseases are multifactorial and despite the rapidly increasing genomic data, molecular pathways and causal links between genes and central nervous system (CNS) diseases are largely unknown. The advent of an easy and flexible CRISPR-Cas genome editing technology has rapidly revolutionized the field of functional genomics and opened unprecedented possibilities to dissect the mechanisms of CNS disease. CRISPR-Cas allows a plenitude of applications for both gene-focused and genome-wide approaches, ranging from original &quot;gene scissors&quot; making permanent modifications in the genome to the regulation of gene expression and epigenetics. CRISPR technology provides a unique opportunity to establish new cellular and animal models of CNS diseases and holds potential for breakthroughs in the CNS research and drug development.},
}
@article {pmid30005359,
year = {2018},
author = {Mahas, A and Mahfouz, M},
title = {Engineering virus resistance via CRISPR-Cas systems.},
journal = {Current opinion in virology},
volume = {32},
number = {},
pages = {1-8},
doi = {10.1016/j.coviro.2018.06.002},
pmid = {30005359},
issn = {1879-6265},
abstract = {In prokaryotes, CRISPR/Cas adaptive immunity systems target and destroy nucleic acids derived from invading bacteriophages and other foreign genetic elements. In eukaryotes, the native function of these systems has been exploited to combat viruses in mammals and plants. Rewired CRISPR/Cas9 and CRISPR/Cas13 systems have been used to confer resistance against DNA and RNA viruses, respectively. Here, we discuss recent approaches employing CRISPR/Cas systems to combat viruses in eukaryotes, highlight key challenges, and provide future perspectives. Moreover, we discuss the application of CRISPR/Cas systems in genome-wide screens to identify key host factors for virus infection to enhance our understanding of basic virus biology and to identify and study virus-host interactions.},
}
@article {pmid30004018,
year = {2018},
author = {Wang, W and Zhang, L and Wang, X and Zeng, Y},
title = {The advances in CRISPR technology and 3D genome.},
journal = {Seminars in cell &amp; developmental biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.semcdb.2018.07.009},
pmid = {30004018},
issn = {1096-3634},
abstract = {The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system is a prokaryotic immune system that used to resist foreign genetic factors. It rapidly becomes the hot technology in life sciences and is applies for genome editing to solve the problem of genome-derived diseases. Using CRISPR/Cas technique, the biological DNA sequence can be repaired, cut, replaced, or added. It can effectively change the human stem cells and is expected to achieve results in the treatment. Compared with ZFN and TALEN genome editing techniques, CRISPR is more effective, accurate, and convenient. The application of CRISPR technique in three dimensional (3D) genome structure makes us understand the relationship between linear DNA sequence and 3D chromatin structure. Utilizing CRISPR/Cas9 genome editing to reverse or delete CTCF binding sites, to recognize changes of topological isomerism of the genome and interactions between chromatin loops. The purpose of this review is to introduce the characteristics and classification of the current CRISPR/Cas system, multiple functions, and potential therapeutic uses, as well as to outline the effect of the technique on chromatin loops by changing CTCF sites in 3D genomes. We will also briefly describe the importance of ethical dilemmas to be faced in CRISPR applications and provide a perspective for potential CRISPR considerations.},
}
@article {pmid30002234,
year = {2018},
author = {Cohen, J},
title = {A 'gene drive' makes its debut in mammals.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6398},
pages = {118},
doi = {10.1126/science.361.6398.118},
pmid = {30002234},
issn = {1095-9203},
mesh = {Animals ; *CRISPR-Cas Systems ; *Gene Drive Technology ; Gene Editing/*methods ; Mice ; Mice, Inbred Strains/*genetics ; },
}
@article {pmid30002084,
year = {2018},
author = {Shayevitch, R and Askayo, D and Keydar, I and Ast, G},
title = {The importance of DNA methylation of exons on alternative splicing.},
journal = {RNA (New York, N.Y.)},
volume = {24},
number = {10},
pages = {1351-1362},
doi = {10.1261/rna.064865.117},
pmid = {30002084},
issn = {1469-9001},
mesh = {*Alternative Splicing ; CRISPR-Cas Systems ; Cell Line ; DNA (Cytosine-5-)-Methyltransferases/genetics/metabolism ; *DNA Methylation ; *Exons ; Gene Editing ; Gene Targeting ; Humans ; Introns ; RNA, Guide ; },
abstract = {Alternative splicing (AS) contributes to proteome diversity. As splicing occurs cotranscriptionally, epigenetic determinants such as DNA methylation likely play a part in regulation of AS. Previously, we have shown that DNA methylation marks exons and that a loss of DNA methylation alters splicing patterns in a genome-wide manner. To investigate the influence of DNA methylation on splicing of individual genes, we developed a method to manipulate DNA methylation in vivo in a site-specific manner using the deactivated endonuclease Cas9 fused to enzymes that methylate or demethylate DNA. We used this system to directly change the DNA methylation pattern of selected exons and introns. We demonstrated that changes in the methylation pattern of alternatively spliced exons, but not constitutively spliced exons or introns, altered inclusion levels. This is the first direct demonstration that DNA methylation of exon-encoding regions is directly involved in regulation of AS.},
}
@article {pmid30001549,
year = {2018},
author = {Xu, J and Li, W and Hossen, MM and Jia, Y and Li, L and Huang, Z},
title = {Optimized Plasmid Construction Strategy for Cas9.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {48},
number = {1},
pages = {131-137},
doi = {10.1159/000491669},
pmid = {30001549},
issn = {1421-9778},
mesh = {CRISPR-Cas Systems/*genetics ; Genes, Reporter ; HEK293 Cells ; Humans ; Plasmids/genetics/*metabolism ; RNA, Guide/genetics/*metabolism ; },
abstract = {BACKGROUND/AIMS: The target genome editing technology not only plays an important role in basic biology studies but also holds a great promise for potential clinical applications. The new generation of engineered nuclease RGEN (RNA Guided EndoNuclease) is much easier to construct and modify, and attracts more attentions. In the current study, we compared different plasmid construction strategies of Cas9-gRNA (guide RNA).<br><br>METHODS: Different plasmid construction strategies of Cas9-gRNA were compared. And more modifications were introduced into the plasmid construction strategy.<br><br>RESULTS: The plasmid construction efficiency of expressing the gRNA and Cas9 in one plasmid was lower than expressing them in two separate plasmids. However, they showed the similar genome editing efficiency. We further introduced the Golden-gate assembly and blue-white screening approaches into the Cas9-gRNA construction procedures, without the process of vector digestion and gel purification.<br><br>CONCLUSIONS: Combing with the optimized gRNA structure (gRNA-BL) we identified before, we established one more cost-effective, time-saving and efficient plasmid construction strategy for Cas9-gRNA.},
}
@article {pmid29995583,
year = {2018},
author = {Hou, S and Brenes-Álvarez, M and Reimann, V and Alkhnbashi, OS and Backofen, R and Muro-Pastor, AM and Hess, WR},
title = {CRISPR-Cas systems in multicellular cyanobacteria.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1493330},
pmid = {29995583},
issn = {1555-8584},
abstract = {Novel CRISPR-Cas systems possess substantial potential for genome editing and manipulation of gene expression. The types and numbers of CRISPR-Cas systems vary substantially between different organisms. Some filamentous cyanobacteria harbor > 40 different putative CRISPR repeat-spacer cassettes, while the number of cas gene instances is much lower. Here we addressed the types and diversity of CRISPR-Cas systems and of CRISPR-like repeat-spacer arrays in 171 publicly available genomes of multicellular cyanobacteria. The number of 1328 repeat-spacer arrays exceeded the total of 391 encoded Cas1 proteins suggesting a tendency for fragmentation or the involvement of alternative adaptation factors. The model cyanobacterium Anabaena sp. PCC 7120 contains only three cas1 genes but hosts three Class 1, possibly one Class 2 and five orphan repeat-spacer arrays, all of which exhibit crRNA-typical expression patterns suggesting active transcription, maturation and incorporation into CRISPR complexes. The CRISPR-Cas system within the element interrupting the Anabaena sp. PCC 7120 fdxN gene, as well as analogous arrangements in other strains, occupy the genetic elements that become excised during the differentiation-related programmed site-specific recombination. This fact indicates the propensity of these elements for the integration of CRISPR-cas systems and points to a previously not recognized connection. The gene all3613 resembling a possible Class 2 effector protein is linked to a short repeat-spacer array and a single tRNA gene, similar to its homologs in other cyanobacteria. The diversity and presence of numerous CRISPR-Cas systems in DNA elements that are programmed for homologous recombination make filamentous cyanobacteria a prolific resource for their study.<br><br>ABBREVIATIONS: Cas: CRISPR associated sequences; CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats; C2c: Class 2 candidate; SDR: small dispersed repeat; TSS: transcriptional start site; UTR: untranslated region.},
}
@article {pmid29995577,
year = {2018},
author = {Foster, K and Kalter, J and Woodside, W and Terns, RM and Terns, MP},
title = {The ribonuclease activity of Csm6 is required for anti-plasmid immunity by Type III-A CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1493334},
pmid = {29995577},
issn = {1555-8584},
abstract = {CRISPR-Cas systems provide prokaryotes with RNA-based adaptive immunity against viruses and plasmids. A unique feature of Type III CRISPR-Cas systems is that they selectively target transcriptionally-active invader DNA, and can cleave both the expressed RNA transcripts and source DNA. The Type III-A effector crRNP (CRISPR RNA-Cas protein complex), which contains Cas proteins Csm1-5, recognizes and degrades invader RNA and DNA in a crRNA-guided, manner. Interestingly, Type III-A systems also employ Csm6, an HEPN family ribonuclease that does not stably associate with the Type III-A effector crRNP, but nevertheless contributes to defense via mechanistic details that are still being determined. Here, we investigated the mechanism of action of Csm6 in Type III-A CRISPR-Cas systems from Lactococcus lactis, Staphylococcus epidermidis, and Streptococcus thermophilus expressed in Escherichia coli. We found that L. lactis and S. epidermidis Csm6 cleave RNA specifically after purines in vitro, similar to the activity reported for S. thermophilus Csm6. Moreover, L. lactis Csm6 functions as a divalent metal-independent, single strand-specific endoribonuclease that depends on the conserved HEPN domain. In vivo, we show that deletion of csm6 or expression of an RNase-defective form of Csm6 disrupts crRNA-dependent loss of plasmid DNA in all three systems expressed in E. coli. Mutations in the Csm1 palm domain, which are known to deactivate Csm6 ribonuclease activity, also prevent plasmid loss in the three systems. The results indicate that Csm6 ribonuclease activity rather than Csm1-mediated DNase activity effects anti-plasmid immunity by the three Type III-A systems investigated.},
}
@article {pmid29995560,
year = {2018},
author = {Chyou, TY and Brown, CM},
title = {Prediction and diversity of tracrRNAs from type II CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1498281},
pmid = {29995560},
issn = {1555-8584},
abstract = {Type II CRISPR-Cas9 systems require a small RNA called the trans-activating CRISPR RNA (tracrRNA) in order to function. The prediction of these non-coding RNAs in prokaryotic genomes is challenging because they have dissimilar structures, having short stems (3-6 bp) and non-canonical base-pairs e.g. G-A. Much of the tracrRNA is involved in base-pairing interactions with the CRISPR RNA, or itself, or in RNA-protein interactions with Cas9. Here we develop a new bioinformatic tool to predict tracrRNAs. On an experimentally verified test set the algorithm achieved a high sensitivity and specificity, and a low false discovery rate (FDR) on genome analysis. Analysis of representative RefSeq genomes (5462) detected 275 tracrRNAs from 165 genera. These tracrRNAs could be grouped into 15 clusters which were used to build covariance models. These clusters included Streptococci and Staphylococci tracrRNAs from the CRISPR-Cas9 systems which are currently used for gene editing. Compensating base changes observed in the models were consistent with the experimental structures of single guide RNAs (sgRNAs). Other clusters, for which there are not yet structures available, were predicted to form novel tracrRNA folds. These clusters included a large and divergent tracrRNA set from Bacteroidetes. These computational models contribute to the understanding of CRISPR-Cas biology, and will assist in the design of further engineered CRISPR-Cas9 systems. The tracrRNA prediction software is available through a galaxy web server.},
}
@article {pmid29995109,
year = {2018},
author = {Ramos, JN and Rodrigues, IDS and Baio, PVP and Veras, JFC and Ramos, RTJ and Pacheco, LG and Azevedo, VA and Hirata Júnior, R and Marín, MA and Mattos-Guaraldi, AL and Vieira, VV},
title = {Genome sequence of a multidrug-resistant Corynebacterium striatum isolated from bloodstream infection from a nosocomial outbreak in Rio de Janeiro, Brazil.},
journal = {Memorias do Instituto Oswaldo Cruz},
volume = {113},
number = {9},
pages = {e180051},
doi = {10.1590/0074-02760180051},
pmid = {29995109},
issn = {1678-8060},
mesh = {Anti-Bacterial Agents/pharmacology ; Bacteremia/*microbiology ; Brazil ; Corynebacterium/*drug effects/*genetics/isolation &amp; purification ; Corynebacterium Infections/*microbiology ; Cross Infection/*microbiology ; Disease Outbreaks ; Drug Resistance, Multiple, Bacterial/drug effects/*genetics ; Electrophoresis, Gel, Pulsed-Field ; Genome, Bacterial/*genetics ; Genotype ; Humans ; Microbial Sensitivity Tests ; Sequence Analysis, DNA ; },
abstract = {Multidrug-resistant (MDR) Corynebacterium striatum has been cited with increased frequency as pathogen of nosocomial infections. In this study, we report the draft genome of a C. striatum isolated from a patient with bloodstream infection in a hospital of Rio de Janeiro, Brazil. The isolate presented susceptibility only to tetracycline, vancomycin and linezolid. The detection of various antibiotic resistance genes is fully consistent with previously observed multidrug-resistant pattern in Corynebacterium spp. A large part of the pTP10 plasmid of MDR C. striatum M82B is present in the genome of our isolate. A SpaDEF cluster and seven arrays of CRISPR-Cas were found.},
}
@article {pmid29987047,
year = {2018},
author = {Verruto, J and Francis, K and Wang, Y and Low, MC and Greiner, J and Tacke, S and Kuzminov, F and Lambert, W and McCarren, J and Ajjawi, I and Bauman, N and Kalb, R and Hannum, G and Moellering, ER},
title = {Unrestrained markerless trait stacking in Nannochloropsis gaditana through combined genome editing and marker recycling technologies.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {30},
pages = {E7015-E7022},
doi = {10.1073/pnas.1718193115},
pmid = {29987047},
issn = {1091-6490},
mesh = {*Acyl-CoA Oxidase/genetics/metabolism ; *CRISPR-Cas Systems ; *Gene Editing ; Light-Harvesting Protein Complexes/genetics/metabolism ; *Lipids/biosynthesis/genetics ; *Quantitative Trait, Heritable ; *Stramenopiles/genetics/metabolism ; },
abstract = {Robust molecular tool kits in model and industrial microalgae are key to efficient targeted manipulation of endogenous and foreign genes in the nuclear genome for basic research and, as importantly, for the development of algal strains to produce renewable products such as biofuels. While Cas9-mediated gene knockout has been demonstrated in a small number of algal species with varying efficiency, the ability to stack traits or generate knockout mutations in two or more loci are often severely limited by selectable agent availability. This poses a critical hurdle in developing production strains, which require stacking of multiple traits, or in probing functionally redundant gene families. Here, we combine Cas9 genome editing with an inducible Cre recombinase in the industrial alga Nannochloropsis gaditana to generate a strain, NgCas9+Cre+, in which the potentially unlimited stacking of knockouts and addition of new genes is readily achievable. Cre-mediated marker recycling is first demonstrated in the removal of the selectable marker and GFP reporter transgenes associated with the Cas9/Cre construct in NgCas9+Cre+ Next, we show the proof-of-concept generation of a markerless knockout in a gene encoding an acyl-CoA oxidase (Aco1), as well as the markerless recapitulation of a 2-kb insert in the ZnCys gene 5'-UTR, which results in a doubling of wild-type lipid productivity. Finally, through an industrially oriented process, we generate mutants that exhibit up to ∼50% reduction in photosynthetic antennae size by markerless knockout of seven genes in the large light-harvesting complex gene family.},
}
@article {pmid29987021,
year = {2018},
author = {Banerjee, S and Ji, C and Mayfield, JE and Goel, A and Xiao, J and Dixon, JE and Guo, X},
title = {Ancient drug curcumin impedes 26S proteasome activity by direct inhibition of dual-specificity tyrosine-regulated kinase 2.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {32},
pages = {8155-8160},
doi = {10.1073/pnas.1806797115},
pmid = {29987021},
issn = {1091-6490},
support = {R01 DK018024/DK/NIDDK NIH HHS/United States ; R01 DK018849/DK/NIDDK NIH HHS/United States ; R37 DK018024/DK/NIDDK NIH HHS/United States ; T32 CA009523/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; Antineoplastic Agents/*pharmacology/therapeutic use ; Apoptosis/drug effects ; CRISPR-Cas Systems ; Cell Proliferation/drug effects ; Crystallography, X-Ray ; Curcumin/*pharmacology/therapeutic use ; Drug Synergism ; Female ; Gene Editing/methods ; Gene Knockout Techniques/methods ; HEK293 Cells ; Humans ; Inhibitory Concentration 50 ; Mice ; Neoplasms/*drug therapy/pathology ; Oligopeptides/pharmacology ; Proteasome Endopeptidase Complex/*metabolism ; Proteasome Inhibitors/pharmacology ; Protein-Serine-Threonine Kinases/*antagonists &amp; inhibitors/chemistry/genetics/metabolism ; Protein-Tyrosine Kinases/*antagonists &amp; inhibitors/chemistry/genetics/metabolism ; Signal Transduction/drug effects ; Tumor Burden/drug effects ; Xenograft Model Antitumor Assays ; },
abstract = {Curcumin, the active ingredient in Curcuma longa, has been in medicinal use since ancient times. However, the therapeutic targets and signaling cascades modulated by curcumin have been enigmatic despite extensive research. Here we identify dual-specificity tyrosine-regulated kinase 2 (DYRK2), a positive regulator of the 26S proteasome, as a direct target of curcumin. Curcumin occupies the ATP-binding pocket of DYRK2 in the cocrystal structure, and it potently and specifically inhibits DYRK2 over 139 other kinases tested in vitro. As a result, curcumin diminishes DYRK2-mediated 26S proteasome phosphorylation in cells, leading to reduced proteasome activity and impaired cell proliferation. Interestingly, curcumin synergizes with the therapeutic proteasome inhibitor carfilzomib to induce apoptosis in a variety of proteasome-addicted cancer cells, while this drug combination exhibits modest to no cytotoxicity to noncancerous cells. In a breast cancer xenograft model, curcumin treatment significantly reduces tumor burden in immunocompromised mice, showing a similar antitumor effect as CRISPR/Cas9-mediated DYRK2 depletion. These results reveal an unexpected role of curcumin in DYRK2-proteasome inhibition and provide a proof-of-concept that pharmacological manipulation of proteasome regulators may offer new opportunities for anticancer treatment.},
}
@article {pmid29985369,
year = {2018},
author = {Naeimi Kararoudi, M and Dolatshad, H and Trikha, P and Hussain, SA and Elmas, E and Foltz, JA and Moseman, JE and Thakkar, A and Nakkula, RJ and Lamb, M and Chakravarti, N and McLaughlin, KJ and Lee, DA},
title = {Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {136},
pages = {},
doi = {10.3791/58237},
pmid = {29985369},
issn = {1940-087X},
mesh = {CRISPR-Cas Systems/*genetics ; Genetic Engineering/*methods ; Genetic Therapy/*methods ; Humans ; Immunotherapy/*methods ; Killer Cells, Natural/*metabolism ; Ribonucleoproteins/*metabolism ; },
abstract = {CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging in primary NK cells. For example, transgene delivery using lentiviral or retroviral transduction resulted in a limited yield of genetically-engineered NK cells due to substantial procedure-associated NK cell apoptosis. We describe here a DNA-free method for genome editing of human primary and expanded NK cells using Cas9 ribonucleoprotein complexes (Cas9/RNPs). This method allowed efficient knockout of the TGFBR2 and HPRT1 genes in NK cells. RT-PCR data showed a significant decrease in gene expression level, and a cytotoxicity assay of a representative cell product suggested that the RNP-modified NK cells became less sensitive to TGFβ. Genetically modified cells could be expanded post-electroporation by stimulation with irradiated mbIL21-expressing feeder cells.},
}
@article {pmid29982016,
year = {2018},
author = {Schuh, RS and Poletto, É and Fachel, FNS and Matte, U and Baldo, G and Teixeira, HF},
title = {Physicochemical properties of cationic nanoemulsions and liposomes obtained by microfluidization complexed with a single plasmid or along with an oligonucleotide: Implications for CRISPR/Cas technology.},
journal = {Journal of colloid and interface science},
volume = {530},
number = {},
pages = {243-255},
doi = {10.1016/j.jcis.2018.06.058},
pmid = {29982016},
issn = {1095-7103},
abstract = {In this study, we investigated the effects of the association of a single plasmid or its co-complexation along with an oligonucleotide on the physicochemical properties of cationic nanoemulsions and liposomes intended for gene editing. Formulations composed of DOPE, DOTAP, DSPE-PEG (liposomes), MCT (nanoemulsions), and water were obtained by microfluidization. DSPE-PEG was found to play a crucial role on the size and polydispersity index of nanocarriers. Nucleic acids were complexated by adsorption at different charge ratios. No significant differences were noticed in the physicochemical properties of nanocarriers (i.e. droplet size, polydispersity index, or zeta potential) when a single plasmid or both plasmid and oligonucleotide were adsorbed to the formulations. Transmission electron microscopy photomicrographs suggested round nanostructures with the nucleic acids and DSPE-PEG enfolding the surface. Complexes at +4/-1 charge ratio protected nucleic acids against DNase I degradation. The oligonucleotide seemed to be released from the liposomal complexes, while nanoemulsions only released the plasmid after 24 and 48 h of incubation in DMEM supplemented or not. In vitro experiments demonstrated that complexes were highly tolerable to human fibroblasts, Hep-G2, and HEK-293 cells, demonstrating also an uptake ability of about 30%, 30%, and 90%, respectively, no matter what the formulation or the combination of nucleic acids used. Transfection efficiency of the formulations was around 25% in human fibroblasts, 32% in HEK-293, and 15% in Hep-G2 cells. The overall results demonstrated the behavior of liposomes and nanoemulsions complexed with a plasmid or a mixture of a plasmid and an oligonucleotide, and demonstrated that the association with one or two nucleic acids sequences of different length does not seem to interfere in the physicochemical characteristics of complexes or in the uptake capacity by three different types of cells.},
}
@article {pmid29980799,
year = {2018},
author = {Ungewiß, H and Rötzer, V and Meir, M and Fey, C and Diefenbacher, M and Schlegel, N and Waschke, J},
title = {Dsg2 via Src-mediated transactivation shapes EGFR signaling towards cell adhesion.},
journal = {Cellular and molecular life sciences : CMLS},
volume = {75},
number = {22},
pages = {4251-4268},
doi = {10.1007/s00018-018-2869-x},
pmid = {29980799},
issn = {1420-9071},
support = {SPP1782//Deutsche Forschungsgemeinschaft/ ; SPP1782//Deutsche Forschungsgemeinschaft/ ; },
mesh = {CRISPR-Cas Systems/genetics ; Caco-2 Cells ; Cell Adhesion ; Cell Line, Tumor ; Cell Proliferation ; Desmoglein 2/deficiency/genetics/*metabolism ; Desmosomes/metabolism ; Humans ; Intestinal Mucosa/cytology/metabolism ; Microscopy, Atomic Force ; Protein Binding ; Receptor, Epidermal Growth Factor/*metabolism ; Signal Transduction ; Transcriptional Activation ; p38 Mitogen-Activated Protein Kinases/metabolism ; src-Family Kinases/genetics/*metabolism ; },
abstract = {Rapidly renewing epithelial tissues such as the intestinal epithelium require precise tuning of intercellular adhesion and proliferation to preserve barrier integrity. Here, we provide evidence that desmoglein 2 (Dsg2), an adhesion molecule of desmosomes, controls cell adhesion and proliferation via epidermal growth factor receptor (EGFR) signaling. Dsg2 is required for EGFR localization at intercellular junctions as well as for Src-mediated EGFR activation. Src binds to EGFR and is required for localization of EGFR and Dsg2 to cell-cell contacts. EGFR is critical for cell adhesion and barrier recovery. In line with this, Dsg2-deficient enterocytes display impaired barrier properties and increased cell proliferation. Mechanistically, Dsg2 directly interacts with EGFR and undergoes heterotypic-binding events on the surface of living enterocytes via its extracellular domain as revealed by atomic force microscopy. Thus, our study reveals a new mechanism by which Dsg2 via Src shapes EGFR function towards cell adhesion.},
}
@article {pmid29980644,
year = {2018},
author = {Tan, ZY and Huang, T and Ngeow, J},
title = {65 YEARS OF THE DOUBLE HELIX: The advancements of gene editing and potential application to hereditary cancer.},
journal = {Endocrine-related cancer},
volume = {25},
number = {8},
pages = {T141-T158},
doi = {10.1530/ERC-18-0039},
pmid = {29980644},
issn = {1479-6821},
abstract = {Hereditary cancer predisposition syndromes are associated with germline mutations that lead to increased vulnerability for an individual to develop cancers. Such germline mutations in tumour suppressor genes, oncogenes and genes encoding for proteins essential in DNA repair pathways and cell cycle control can cause overall chromosomal instability in the genome and increase risk in developing cancers. Gene correction of these germline mutations to restore normal protein functions is anticipated as a new therapeutic option. This can be achieved through disruption of gain-of-function pathogenic mutation, restoration of loss-of-function mutation, addition of a transgene essential for cell function and single nucleotide changes. Genome editing tools are applicable to precise gene correction. Development of genome editing tools comes in two waves. The first wave focuses on improving targeting specificity and editing efficiency of nucleases, and the second wave of gene editing draws on innovative engineering of fusion proteins combining deactivated nucleases and other enzymes that are able to create limitless functional molecular tools. This gene editing advancement is going to impact medicine, particularly in hereditary cancers. In this review, we discuss the application of gene editing as an early intervention and possible treatment for hereditary cancers, by highlighting a selection of highly penetrant cancer syndromes as examples of how this may be achieved in clinical practice.},
}
@article {pmid29980564,
year = {2018},
author = {York, JR and Yuan, T and Lakiza, O and McCauley, DW},
title = {An ancestral role for Semaphorin3F-Neuropilin signaling in patterning neural crest within the new vertebrate head.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {14},
pages = {},
doi = {10.1242/dev.164780},
pmid = {29980564},
issn = {1477-9129},
mesh = {Animals ; *Body Patterning ; CRISPR-Cas Systems ; Cell Movement ; Gene Expression Regulation, Developmental ; Gene Knockout Techniques ; Head/*embryology ; Lampreys/genetics ; Melanocytes/cytology/metabolism ; Neural Crest/cytology/*embryology ; Neuropilins/genetics/*metabolism ; Phylogeny ; Semaphorins/genetics/*metabolism ; Sensory Receptor Cells/metabolism ; *Signal Transduction ; Skull/cytology ; },
abstract = {The origin of the vertebrate head is one of the great unresolved issues in vertebrate evolutionary developmental biology. Although many of the novelties in the vertebrate head and pharynx derive from the neural crest, it is still unknown how early vertebrates patterned the neural crest within the ancestral body plan they inherited from invertebrate chordates. Here, using a basal vertebrate, the sea lamprey, we show that homologs of Semaphorin3F (Sema3F) ligand and its Neuropilin (Nrp) receptors show complementary and dynamic patterns of expression that correlate with key periods of neural crest development (migration and patterning of cranial neural crest-derived structures). Using CRISPR/Cas9-mediated mutagenesis, we demonstrate that lamprey Sema3F is essential for patterning of neural crest-derived melanocytes, cranial ganglia and the head skeleton, but is not required for neural crest migration or patterning of trunk neural crest derivatives. Based on comparisons with jawed vertebrates, our results suggest that the deployment of Nrp-Sema3F signaling, along with other intercellular guidance cues, was pivotal in allowing early vertebrates to organize and pattern cranial neural crest cells into many of the hallmark structures that define the vertebrate head.},
}
@article {pmid29979631,
year = {2018},
author = {Wei, W and Zhang, S and Fleming, J and Chen, Y and Li, Z and Fan, S and Liu, Y and Wang, W and Wang, T and Liu, Y and Ren, B and Wang, M and Jiao, J and Chen, Y and Zhou, Y and Zhou, Y and Gu, S and Zhang, X and Wan, L and Chen, T and Zhou, L and Chen, Y and Zhang, XE and Li, C and Zhang, H and Bi, L},
title = {Mycobacterium tuberculosis type III-A CRISPR/Cas system crRNA and its maturation have atypical features.},
journal = {FASEB journal : official publication of the Federation of American Societies for Experimental Biology},
volume = {},
number = {},
pages = {fj201800557RR},
doi = {10.1096/fj.201800557RR},
pmid = {29979631},
issn = {1530-6860},
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (Cas) systems are prokaryotic adaptive immune systems against invading nucleic acids. CRISPR locus variability has been exploited in evolutionary and epidemiological studies of Mycobacterium tuberculosis, the causative agent of tuberculosis, for over 20 yr, yet the biological function of this type III-A system is largely unexplored. Here, using cell biology and biochemical, mutagenic, and RNA-seq approaches, we show it is active in invader defense and has features atypical of type III-A systems: mature CRISPR RNA (crRNA) in its crRNA-CRISPR/Cas protein complex are of uniform length (∼71 nt) and appear not to be subject to 3'-end processing after Cas6 cleavage of repeat RNA 8 nt from its 3' end. crRNAs generated resemble mature crRNA in type I systems, having both 5' (8 nt) and 3' (28 nt) repeat tags. Cas6 cleavage of repeat RNA is ion dependent, and accurate cleavage depends on the presence of a 3' hairpin in the repeat RNA and the sequence of its stem base nucleotides. This study unveils further diversity among CRISPR/Cas systems and provides insight into the crRNA recognition mechanism in M. tuberculosis, providing a foundation for investigating the potential of a type III-A-based genome editing system.-Wei, W., Zhang, S., Fleming, J., Chen, Y., Li, Z., Fan, S., Liu, Y., Wang, W., Wang, T., Liu, Y., Ren, B., Wang, M., Jiao, J., Chen, Y., Zhou, Yi., Zhou, Ya., Gu, S., Zhang, X., Wan, L., Chen, T., Zhou, L., Chen, Y., Zhang, X.-E., Li, C., Zhang, H., Bi, L. Mycobacterium tuberculosis type III-A CRISPR/Cas system crRNA and its maturation have atypical features.},
}
@article {pmid29974860,
year = {2018},
author = {Wu, RS and Lam, II and Clay, H and Duong, DN and Deo, RC and Coughlin, SR},
title = {A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish.},
journal = {Developmental cell},
volume = {46},
number = {1},
pages = {112-125.e4},
doi = {10.1016/j.devcel.2018.06.003},
pmid = {29974860},
issn = {1878-1551},
support = {F32 HL116194/HL/NHLBI NIH HHS/United States ; },
mesh = {Animals ; Base Sequence ; CRISPR-Cas Systems/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; GTP-Binding Protein alpha Subunits, G12-G13/genetics ; Gene Knockout Techniques/*methods ; Genetic Engineering/methods ; Heart/*embryology ; Morpholinos/genetics ; Myocytes, Cardiac/cytology ; Promyelocytic Leukemia Zinc Finger Protein/*genetics ; Transcription, Genetic/genetics ; Zebrafish/embryology/*genetics ; Zebrafish Proteins/*genetics ; },
abstract = {Zebrafish is a powerful model for forward genetics. Reverse genetic approaches are limited by the time required to generate stable mutant lines. We describe a system for gene knockout that consistently produces null phenotypes in G0 zebrafish. Yolk injection of sets of four CRISPR/Cas9 ribonucleoprotein complexes redundantly targeting a single gene recapitulated germline-transmitted knockout phenotypes in >90% of G0 embryos for each of 8 test genes. Early embryonic (6 hpf) and stable adult phenotypes were produced. Simultaneous multi-gene knockout was feasible but associated with toxicity in some cases. To facilitate use, we generated a lookup table of four-guide sets for 21,386 zebrafish genes and validated several. Using this resource, we targeted 50 cardiomyocyte transcriptional regulators and uncovered a role of zbtb16a in cardiac development. This system provides a platform for rapid screening of genes of interest in development, physiology, and disease models in zebrafish.},
}
@article {pmid29972722,
year = {2018},
author = {Lee, K and Zhang, Y and Kleinstiver, BP and Guo, JA and Aryee, MJ and Miller, J and Malzahn, A and Zarecor, S and Lawrence-Dill, CJ and Joung, JK and Qi, Y and Wang, K},
title = {Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize.},
journal = {Plant biotechnology journal},
volume = {},
number = {},
pages = {},
doi = {10.1111/pbi.12982},
pmid = {29972722},
issn = {1467-7652},
support = {K99 CA218870/CA/NCI NIH HHS/United States ; },
abstract = {CRISPR/Cas9 and Cas12a (Cpf1) nucleases are two of the most powerful genome editing tools in plants. In this work, we compared their activities by targeting maize glossy2 gene coding region that has overlapping sequences recognized by both nucleases. We introduced constructs carrying SpCas9-guide RNA (gRNA) and LbCas12a-CRISPR RNA (crRNA) into maize inbred B104 embryos using Agrobacterium-mediated transformation. On-target mutation analysis showed that 90%-100% of the Cas9-edited T0 plants carried indel mutations and 63%-77% of them were homozygous or biallelic mutants. In contrast, 0%-60% of Cas12a-edited T0 plants had on-target mutations. We then conducted CIRCLE-seq analysis to identify genome-wide potential off-target sites for Cas9. A total of 18 and 67 potential off-targets were identified for the two gRNAs, respectively, with an average of five mismatches compared to the target sites. Sequencing analysis of a selected subset of the off-target sites revealed no detectable level of mutations in the T1 plants, which constitutively express Cas9 nuclease and gRNAs. In conclusion, our results suggest that the CRISPR/Cas9 system used in this study is highly efficient and specific for genome editing in maize, while CRISPR/Cas12a needs further optimization for improved editing efficiency.},
}
@article {pmid29970232,
year = {2018},
author = {Koh, HR and Myong, S},
title = {Single-Cell Imaging Approaches for Studying Small-RNA-Induced Gene Regulation.},
journal = {Biophysical journal},
volume = {115},
number = {2},
pages = {203-208},
doi = {10.1016/j.bpj.2018.05.040},
pmid = {29970232},
issn = {1542-0086},
abstract = {RNA interference (RNAi) is a process by which gene expression is downregulated by small interfering RNAs or microRNAs. The quantification of the RNAi efficiency can be performed at both the messenger RNA (mRNA) and the protein level, which is required to assess the potency of small interfering RNAs or microRNAs. Recently, we employed a single-cell mRNA imaging method to study RNAi in which we visualized individual mRNA targets with high precision while resolving the cellular localization and cell-to-cell heterogeneity in addition to RNAi efficiency. In this Biophysical Perspective, we highlight our recent work on quantitative analysis of the RNAi pathway and point out some important future directions. Alongside, we discuss about several single-cell imaging techniques that can be applied to study RNAi. The single-cell imaging techniques discussed here are widely applicable to other gene regulation processes such as the CRISPR-CAS system.},
}
@article {pmid29968520,
year = {2018},
author = {Perez Rojo, F and Nyman, RKM and Johnson, AAT and Navarro, MP and Ryan, MH and Erskine, W and Kaur, P},
title = {CRISPR-Cas systems: ushering in the new genome editing era.},
journal = {Bioengineered},
volume = {9},
number = {1},
pages = {214-221},
doi = {10.1080/21655979.2018.1470720},
pmid = {29968520},
issn = {2165-5987},
abstract = {In recent years there has been great progress with the implementation and utilization of Clustered Regularly Interspaced Palindromic Repeats (CRISPR) and CRISPR-associated protein (Cas) systems in the world of genetic engineering. Many forms of CRISPR-Cas9 have been developed as genome editing tools and techniques and, most recently, several non-genome editing CRISPR-Cas systems have emerged. Most of the CRISPR-Cas systems have been classified as either Class I or Class II and are further divided among several subtypes within each class. Research teams and companies are currently in dispute over patents for these CRISPR-Cas systems as numerous powerful applications are concurrently under development. This mini review summarizes the appearance of CRISPR-Cas systems with a focus on the predominant CRISPR-Cas9 system as well as the classifications and subtypes for CRISPR-Cas. Non-genome editing uses of CRISPR-Cas are also highlighted and a brief overview of the commercialization of CRISPR is provided.},
}
@article {pmid29968018,
year = {2018},
author = {Greene, M and Master, Z},
title = {Ethical Issues of Using CRISPR Technologies for Research on Military Enhancement.},
journal = {Journal of bioethical inquiry},
volume = {},
number = {},
pages = {},
doi = {10.1007/s11673-018-9865-6},
pmid = {29968018},
issn = {1176-7529},
abstract = {This paper presents an overview of the key ethical questions of performing gene editing research on military service members. The recent technological advance in gene editing capabilities provided by CRISPR/Cas9 and their path towards first-in-human trials has reinvigorated the debate on human enhancement for non-medical purposes. Human performance optimization has long been a priority of military research in order to close the gap between the advancement of warfare and the limitations of human actors. In spite of this focus on temporary performance improvement, biomedical enhancement is an extension of these endeavours and the ethical issues of such research should be considered. In this paper, we explore possible applications of CRISPR to military human gene editing research and how it could be specifically applied towards protection of service members against biological or chemical weapons. We analyse three normative areas including risk-benefit analysis, informed consent, and inequality of access as it relates to CRISPR applications for military research to help inform and provide considerations for military institutional review boards and policymakers.},
}
@article {pmid29967764,
year = {2018},
author = {Duensing, N and Sprink, T and Parrott, WA and Fedorova, M and Lema, MA and Wolt, JD and Bartsch, D},
title = {Novel Features and Considerations for ERA and Regulation of Crops Produced by Genome Editing.},
journal = {Frontiers in bioengineering and biotechnology},
volume = {6},
number = {},
pages = {79},
doi = {10.3389/fbioe.2018.00079},
pmid = {29967764},
issn = {2296-4185},
abstract = {Genome editing describes a variety of molecular biology applications enabling targeted and precise alterations of the genomes of plants, animals and microorganisms. These rapidly developing techniques are likely to revolutionize the breeding of new crop varieties. Since genome editing can lead to the development of plants that could also have come into existence naturally or by conventional breeding techniques, there are strong arguments that these cases should not be classified as genetically modified organisms (GMOs) and be regulated no differently from conventionally bred crops. If a specific regulation would be regarded necessary, the application of genome editing for crop development may challenge risk assessment and post-market monitoring. In the session &quot;Plant genome editing-any novel features to consider for ERA and regulation?&quot; held at the 14th ISBGMO, scientists from various disciplines as well as regulators, risk assessors and potential users of the new technologies were brought together for a knowledge-based discussion to identify knowledge gaps and analyze scenarios for the introduction of genome-edited crops into the environment. It was aimed to enable an open exchange forum on the regulatory approaches, ethical aspects and decision-making considerations.},
}
@article {pmid29967137,
year = {2018},
author = {Shao, J and Wang, M and Yu, G and Zhu, S and Yu, Y and Heng, BC and Wu, J and Ye, H},
title = {Synthetic far-red light-mediated CRISPR-dCas9 device for inducing functional neuronal differentiation.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {29},
pages = {E6722-E6730},
doi = {10.1073/pnas.1802448115},
pmid = {29967137},
issn = {1091-6490},
mesh = {Basic Helix-Loop-Helix Transcription Factors/*biosynthesis/genetics ; *CRISPR-Cas Systems ; *Cell Differentiation ; *Cellular Reprogramming ; *Epigenesis, Genetic ; HEK293 Cells ; HeLa Cells ; Humans ; *Light ; Nerve Tissue Proteins/*biosynthesis/genetics ; Neurons/cytology/*metabolism ; Optogenetics/methods ; Synthetic Biology ; },
abstract = {The ability to control the activity of CRISPR-dCas9 with precise spatiotemporal resolution will enable tight genome regulation of user-defined endogenous genes for studying the dynamics of transcriptional regulation. Optogenetic devices with minimal phototoxicity and the capacity for deep tissue penetration are extremely useful for precise spatiotemporal control of cellular behavior and for future clinic translational research. Therefore, capitalizing on synthetic biology and optogenetic design principles, we engineered a far-red light (FRL)-activated CRISPR-dCas9 effector (FACE) device that induces transcription of exogenous or endogenous genes in the presence of FRL stimulation. This versatile system provides a robust and convenient method for precise spatiotemporal control of endogenous gene expression and also has been demonstrated to mediate targeted epigenetic modulation, which can be utilized to efficiently promote differentiation of induced pluripotent stem cells into functional neurons by up-regulating a single neural transcription factor, NEUROG2 This FACE system might facilitate genetic/epigenetic reprogramming in basic biological research and regenerative medicine for future biomedical applications.},
}
@article {pmid29963037,
year = {2018},
author = {Toro, N and Martínez-Abarca, F and González-Delgado, A and Mestre, MR},
title = {On the Origin and Evolutionary Relationships of the Reverse Transcriptases Associated With Type III CRISPR-Cas Systems.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1317},
doi = {10.3389/fmicb.2018.01317},
pmid = {29963037},
issn = {1664-302X},
abstract = {Reverse transcriptases (RTs) closely related to those encoded by group II introns but lacking the intron RNA structure have been found associated with type III clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems, a prokaryotic immune system against invading viruses and foreign genetic elements. Two models have been proposed to explain the origin and evolutionary relationships of these RTs: (i) the &quot;single point of origin&quot; model, according to which these RTs originated from a single acquisition event in bacterial, with the various protein domains (RT, RT-Cas1, and Cas6-RT-Cas1 fusions) corresponding to single points in evolution; and (ii) the &quot;various origins&quot; model, according to which, independent acquisition events in different evolutionary episodes led to these fusions. We tested these alternative hypotheses, by analyzing and integrating published datasets of RT sequences associated with CRISPR-Cas systems and inferring phylogenetic trees by maximum likelihood (ML) methods. The RTs studied could be grouped into 13 clades, mostly in bacteria, in which they probably evolved. The various clades appear to form three independent lineages in bacteria and a recent lineage in archaea. Our data show that the Cas6 domain was acquired twice, independently, through RT-Cas1 fusion, in the bacterial lineages. Taken together, there more evidence to support the &quot;various origins&quot; hypothesis.},
}
@article {pmid29959923,
year = {2018},
author = {Ford, K and McDonald, D and Mali, P},
title = {Functional Genomics via CRISPR-Cas.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.06.034},
pmid = {29959923},
issn = {1089-8638},
support = {R01 CA222826/CA/NCI NIH HHS/United States ; R01 GM123313/GM/NIGMS NIH HHS/United States ; R01 HG009285/HG/NHGRI NIH HHS/United States ; },
abstract = {RNA-guided CRISPR (clustered regularly interspaced short palindromic repeat)-associated Cas proteins have recently emerged as versatile tools to investigate and engineer the genome. The programmability of CRISPR-Cas has proven especially useful for probing genomic function in high-throughput. Facile single-guide RNA library synthesis allows CRISPR-Cas screening to rapidly investigate the functional consequences of genomic, transcriptomic, and epigenomic perturbations. Furthermore, by combining CRISPR-Cas perturbations with downstream single-cell analyses (flow cytometry, expression profiling, etc.), forward screens can generate robust data sets linking genotypes to complex cellular phenotypes. In the following review, we highlight recent advances in CRISPR-Cas genomic screening while outlining protocols and pitfalls associated with screen implementation. Finally, we describe current challenges limiting the utility of CRISPR-Cas screening as well as future research needed to resolve these impediments. As CRISPR-Cas technologies develop, so too will their clinical applications. Looking ahead, patient centric functional screening in primary cells will likely play a greater role in disease management and therapeutic development.},
}
@article {pmid29959919,
year = {2018},
author = {Zhang, XY and Shan, HJ and Zhang, P and She, C and Zhou, XZ},
title = {LncRNA EPIC1 protects human osteoblasts from dexamethasone-induced cell death.},
journal = {Biochemical and biophysical research communications},
volume = {503},
number = {4},
pages = {2255-2262},
doi = {10.1016/j.bbrc.2018.06.146},
pmid = {29959919},
issn = {1090-2104},
abstract = {Dexamethasone (Dex) can induce injury to human osteoblasts. Long non-coding RNA (LncRNA) EPIC1 (Lnc-EPIC1) is a novel Myc-interacting LncRNA. Its effect on Dex-treated human osteoblasts is studied here. In OB-6 osteoblastic cells and primary human osteoblasts, treatment with Dex increased expression of Lnc-EPIC1. Its expression is also elevated in the necrotic femoral head tissues of Dex-taking patients. Ectopic overexpression of Lnc-EPIC1 inhibited Dex-induced apoptosis and programmed necrosis in OB-6 cells and primary human osteoblasts. Reversely, Lnc-EPIC1 silencing by targeted siRNA potentiated Dex-induced cytotoxicity. Myc is the target of Lnc-EPIC1 in osteoblasts. Exogenous overexpression of Myc protected OB-6 cells from Dex. Conversely, Myc knockout by CRISPR-Cas-9 method abolished Lnc-EPIC1-induced OB-6 cytoprotection against Dex. Together, Lnc-EPIC1 expression protects human osteoblasts from Dex possible via regulation of Myc.},
}
@article {pmid29959585,
year = {2018},
author = {Singh, M and Kumar, M and Albertsen, MC and Young, JK and Cigan, AM},
title = {Concurrent modifications in the three homeologs of Ms45 gene with CRISPR-Cas9 lead to rapid generation of male sterile bread wheat (Triticum aestivum L.).},
journal = {Plant molecular biology},
volume = {97},
number = {4-5},
pages = {371-383},
doi = {10.1007/s11103-018-0749-2},
pmid = {29959585},
issn = {1573-5028},
mesh = {Amino Acid Sequence ; *CRISPR-Cas Systems ; Flowers/genetics/growth &amp; development ; Mutation ; Plant Infertility/*genetics ; Plant Proteins/genetics/*metabolism ; Pollen/genetics/growth &amp; development ; Sequence Alignment ; Triticum/*genetics/growth &amp; development ; },
abstract = {KEY MESSAGE: Hexaploid bread wheat is not readily amenable to traditional mutagenesis approaches. In this study, we show efficient utilization of CRISPR-Cas system and Next Generation Sequencing for mutant analysis in wheat. Identification and manipulation of male fertility genes in hexaploid bread wheat is important for understanding the molecular basis of pollen development and to obtain novel sources of nuclear genetic male sterility (NGMS). The maize Male sterile 45 (Ms45) gene encodes a strictosidine synthase-like enzyme and has been shown to be required for male fertility. To investigate the role of Ms45 gene in wheat, mutations in the A, B and D homeologs were produced using CRISPR-Cas9. A variety of mutations in the three homeologs were recovered, including a plant from two different genotypes each with mutations in all three homeologs. Genetic analysis of the mutations demonstrated that all three wheat Ms45 homeologs contribute to male fertility and that triple homozygous mutants are required to abort pollen development and achieve male sterility. Further, it was demonstrated that a wild-type copy of Ms45 gene from rice was able to restore fertility to these wheat mutant plants. Taken together, these observations provide insights into the conservation of MS45 function in a polyploid species. Ms45 based NGMS can be potentially utilized for a Seed Production Technology (SPT)-like hybrid seed production system in wheat.},
}
@article {pmid29959543,
year = {2018},
author = {Anand, A and Jones, TJ},
title = {Advancing Agrobacterium-Based Crop Transformation and Genome Modification Technology for Agricultural Biotechnology.},
journal = {Current topics in microbiology and immunology},
volume = {},
number = {},
pages = {},
doi = {10.1007/82_2018_97},
pmid = {29959543},
issn = {0070-217X},
abstract = {The last decade has seen significant strides in Agrobacterium-mediated plant transformation technology. This has not only expanded the number of crop species that can be transformed by Agrobacterium, but has also made it possible to routinely transform several recalcitrant crop species including cereals (e.g., maize, sorghum, and wheat). However, the technology is limited by the random nature of DNA insertions, genotype dependency, low frequency of quality events, and variation in gene expression arising from genomic insertion sites. A majority of these deficiencies have now been addressed by improving the frequency of quality events, developing genotype-independent transformation capability in maize, developing an Agrobacterium-based site-specific integration technology for precise gene targeting, and adopting Agrobacterium-delivered CRISPR-Cas genes for gene editing. These improved transformation technologies are discussed in detail in this chapter.},
}
@article {pmid29951376,
year = {2018},
author = {He, Y and Wang, M and Liu, M and Huang, L and Liu, C and Zhang, X and Yi, H and Cheng, A and Zhu, D and Yang, Q and Wu, Y and Zhao, X and Chen, S and Jia, R and Zhang, S and Liu, Y and Yu, Y and Zhang, L},
title = {Cas1 and Cas2 From the Type II-C CRISPR-Cas System of Riemerella anatipestifer Are Required for Spacer Acquisition.},
journal = {Frontiers in cellular and infection microbiology},
volume = {8},
number = {},
pages = {195},
doi = {10.3389/fcimb.2018.00195},
pmid = {29951376},
issn = {2235-2988},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins provide acquired genetic immunity against the entry of mobile genetic elements (MGEs). The immune defense provided by various subtypes of the CRISPR-Cas system has been confirmed and is closely associated with the formation of immunological memory in CRISPR arrays, called CRISPR adaptation or spacer acquisition. However, whether type II-C CRISPR-Cas systems are also involved in spacer acquisition remains largely unknown. This study explores and provides some definitive evidence regarding spacer acquisition of the type II-C CRISPR-Cas system from Riemerella anatipestifer (RA) CH-2 (RA-CH-2). Firstly, introducing an exogenous plasmid into RA-CH-2 triggered spacer acquisition of RA CRISPR-Cas system, and the acquisition of new spacers led to plasmid instability in RA-CH-2. Furthermore, deletion of cas1 or cas2 of RA-CH-2 abrogated spacer acquisition and subsequently stabilized the exogenous plasmid, suggesting that both Cas1 and Cas2 are required for spacer acquisition of RA-CH-2 CRISPR-Cas system, consistent with the reported role of Cas1 and Cas2 in type I-E and II-A systems. Finally, assays for studying Cas1 nuclease activity and the interaction of Cas1 with Cas2 contributed to a better understanding of the adaptation mechanism of RA CRISPR-Cas system. This is the first experimental identification of the naïve adaptation of type II-C CRISPR-Cas system.},
}
@article {pmid29951046,
year = {2018},
author = {White Iii, RA and Wong, HL and Ruvindy, R and Neilan, BA and Burns, BP},
title = {Viral Communities of Shark Bay Modern Stromatolites.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1223},
doi = {10.3389/fmicb.2018.01223},
pmid = {29951046},
issn = {1664-302X},
abstract = {Single stranded DNA viruses have been previously shown to populate the oceans on a global scale, and are endemic in microbialites of both marine and freshwater systems. We undertook for the first time direct viral metagenomic shotgun sequencing to explore the diversity of viruses in the modern stromatolites of Shark Bay Australia. The data indicate that Shark Bay marine stromatolites have similar diversity of ssDNA viruses to that of Highbourne Cay, Bahamas. ssDNA viruses in cluster uniquely in Shark Bay and Highbourne Cay, potentially due to enrichment by phi29-mediated amplification bias. Further, pyrosequencing data was assembled from the Shark Bay systems into two putative viral genomes that are related to Genomoviridae family of ssDNA viruses. In addition, the cellular fraction was shown to be enriched for antiviral defense genes including CRISPR-Cas, BREX (bacteriophage exclusion), and DISARM (defense island system associated with restriction-modification), a potentially novel finding for these systems. This is the first evidence for viruses in the Shark Bay stromatolites, and these viruses may play key roles in modulating microbial diversity as well as potentially impacting ecosystem function through infection and the recycling of key nutrients.},
}
@article {pmid29951040,
year = {2018},
author = {Mašlaňová, I and Wertheimer, Z and Sedláček, I and Švec, P and Indráková, A and Kovařovic, V and Schumann, P and Spröer, C and Králová, S and Šedo, O and Krištofová, L and Vrbovská, V and Füzik, T and Petráš, P and Zdráhal, Z and Ružičková, V and Doškař, J and Pantuček, R},
title = {Description and Comparative Genomics of Macrococcus caseolyticus subsp. hominis subsp. nov., Macrococcus goetzii sp. nov., Macrococcus epidermidis sp. nov., and Macrococcus bohemicus sp. nov., Novel Macrococci From Human Clinical Material With Virulence Potential and Suspected Uptake of Foreign DNA by Natural Transformation.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1178},
doi = {10.3389/fmicb.2018.01178},
pmid = {29951040},
issn = {1664-302X},
abstract = {The genus Macrococcus is a close relative of the genus Staphylococcus. Whilst staphylococci are widespread as human pathogens, macrococci have not yet been reported from human clinical specimens. Here we investigated Gram-positive and catalase-positive cocci recovered from human clinical material and identified as Macrococcus sp. by a polyphasic taxonomic approach and by comparative genomics. Relevant phenotypic, genotypic and chemotaxonomic methods divided the analyzed strains into two separate clusters within the genus Macrococcus. Comparative genomics of four representative strains revealed enormous genome structural plasticity among the studied isolates. We hypothesize that high genomic variability is due to the presence of a com operon, which plays a key role in the natural transformation of bacilli and streptococci. The possible uptake of exogenous DNA by macrococci can contribute to a different mechanism of evolution from staphylococci, where phage-mediated horizontal gene transfer predominates. The described macrococcal genomes harbor novel plasmids, genomic islands and islets, as well as prophages. Capsule gene clusters, intracellular protease, and a fibronectin-binding protein enabling opportunistic pathogenesis were found in all four strains. Furthermore, the presence of a CRISPR-Cas system with 90 spacers in one of the sequenced genomes corresponds with the need to limit the burden of foreign DNA. The highly dynamic genomes could serve as a platform for the exchange of virulence and resistance factors, as was described for the methicillin resistance gene, which was found on the novel composite SCCmec-like element containing a unique mec gene complex that is considered to be one of the missing links in SCC evolution. The phenotypic, genotypic, chemotaxonomic and genomic results demonstrated that the analyzed strains represent one novel subspecies and three novel species of the genus Macrococcus, for which the names Macrococcus caseolyticus subsp. hominis subsp. nov. (type strain CCM 7927T = DSM 103682T), Macrococcus goetzii sp. nov. (type strain CCM 4927T = DSM 103683T), Macrococcus epidermidis sp. nov. (type strain CCM 7099T = DSM 103681T), and Macrococcus bohemicus sp. nov. (type strain CCM 7100T = DSM 103680T) are proposed. Moreover, a formal description of Macrococcus caseolyticus subsp. caseolyticus subsp. nov. and an emended description of the genus Macrococcus are provided.},
}
@article {pmid29950558,
year = {2018},
author = {Dong, C and Fontana, J and Patel, A and Carothers, JM and Zalatan, JG},
title = {Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2489},
doi = {10.1038/s41467-018-04901-6},
pmid = {29950558},
issn = {2041-1723},
abstract = {Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains. Effective gene activation requires target sites situated in a narrow region just upstream of the transcription start site, in sharp contrast to the relatively flexible target site requirements for gene activation in eukaryotic cells. Together with existing tools for CRISPRi gene repression, these bacterial activators enable programmable control over multiple genes with simultaneous activation and repression. Further, the entire gene expression program can be switched on by inducing expression of the CRISPR-Cas system. This work will provide a foundation for engineering synthetic bacterial cellular devices with applications including diagnostics, therapeutics, and industrial biosynthesis.},
}
@article {pmid29949763,
year = {2018},
author = {Goodwin, PR and Meng, A and Moore, J and Hobin, M and Fulga, TA and Van Vactor, D and Griffith, LC},
title = {MicroRNAs Regulate Sleep and Sleep Homeostasis in Drosophila.},
journal = {Cell reports},
volume = {23},
number = {13},
pages = {3776-3786},
doi = {10.1016/j.celrep.2018.05.078},
pmid = {29949763},
issn = {2211-1247},
support = {F32 GM109531/GM/NIGMS NIH HHS/United States ; P01 NS090994/NS/NINDS NIH HHS/United States ; T32 NS007292/NS/NINDS NIH HHS/United States ; },
abstract = {To discover microRNAs that regulate sleep, we performed a genetic screen using a library of miRNA sponge-expressing flies. We identified 25 miRNAs that regulate baseline sleep; 17 were sleep-promoting and 8 promoted wake. We identified one miRNA that is required for recovery sleep after deprivation and 8 miRNAs that limit the extent of recovery sleep. 65% of the hits belong to human-conserved families. Interestingly, the majority (75%), but not all, of the baseline sleep-regulating miRNAs are required in neurons. Sponges that target miRNAs in the same family, including the miR-92a/92b/310 family and the miR-263a/263b family, have similar effects. Finally, mutation of one of the screen's strongest hits, let-7, using CRISPR/Cas-9, phenocopies sponge-mediated let-7 inhibition. Cell-type-specific and temporally restricted let-7 sponge expression experiments suggest that let-7 is required in the mushroom body both during development and in adulthood. This screen sets the stage for understanding the role of miRNAs in sleep.},
}
@article {pmid29946325,
year = {2018},
author = {Lapham, R and Lee, LY and Tsugama, D and Lee, S and Mengiste, T and Gelvin, SB},
title = {VIP1 and Its Homologs Are Not Required for Agrobacterium-Mediated Transformation, but Play a Role in Botrytis and Salt Stress Responses.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {749},
doi = {10.3389/fpls.2018.00749},
pmid = {29946325},
issn = {1664-462X},
abstract = {The bZIP transcription factor VIP1 interacts with the Agrobacterium virulence protein VirE2, but the role of VIP1 in Agrobacterium-mediated transformation remains controversial. Previously tested vip1-1 mutant plants produce a truncated protein containing the crucial bZIP DNA-binding domain. We generated the CRISPR/Cas mutant vip1-2 that lacks this domain. The transformation susceptibility of vip1-2 and wild-type plants is similar. Because of potential functional redundancy among VIP1 homologs, we tested transgenic lines expressing VIP1 fused to a SRDX repression domain. All VIP1-SRDX transgenic lines showed wild-type levels of transformation, indicating that neither VIP1 nor its homologs are required for Agrobacterium-mediated transformation. Because VIP1 is involved in innate immune response signaling, we tested the susceptibility of vip1 mutant and VIP1-SRDX plants to Pseudomonas syringae and Botrytis cinerea. vip1 mutant and VIP1-SRDX plants show increased susceptibility to B. cinerea but not to P. syringae infection, suggesting a role for VIP1 in B. cinerea, but not in P. syringae, defense signaling. B. cinerea susceptibility is dependent on abscisic acid (ABA) which is also important for abiotic stress responses. The germination of vip1 mutant and VIP1-SRDX seeds is sensitive to exogenous ABA, suggesting a role for VIP1 in response to ABA. vip1 mutant and VIP1-SRDX plants show increased tolerance to growth in salt, indicating a role for VIP1 in response to salt stress.},
}
@article {pmid29946262,
year = {2018},
author = {Dangi, AK and Sinha, R and Dwivedi, S and Gupta, SK and Shukla, P},
title = {Cell Line Techniques and Gene Editing Tools for Antibody Production: A Review.},
journal = {Frontiers in pharmacology},
volume = {9},
number = {},
pages = {630},
doi = {10.3389/fphar.2018.00630},
pmid = {29946262},
issn = {1663-9812},
abstract = {The present day modern formulation practices for drugs are based on newer tools and techniques toward effective utilization. The methods of antibody formulations are to be revolutionized based on techniques of cell engineering and gene editing. In the present review, we have discussed innovations in cell engineering toward production of novel antibodies for therapeutic applications. Moreover, this review deciphers the use of RNAi, ribozyme engineering, CRISPR-Cas-based techniques for better strategies for antibody production. Overall, this review describes the multidisciplinary aspects of the production of therapeutic proteins that has gained more attention due to its increasing demand.},
}
@article {pmid29940185,
year = {2018},
author = {O'Connell, MR},
title = {Molecular Mechanisms of RNA Targeting by Cas13-containing Type VI CRISPR-Cas Systems.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.06.029},
pmid = {29940185},
issn = {1089-8638},
abstract = {Prokaryotic adaptive immune systems use Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and CRISPR-associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, contain a single protein, Cas13 (formerly C2c2) that when assembled with a CRISPR RNA (crRNA) forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two Higher Eukaryotes and Prokaryotes Nucleotide-binding (HEPN) domains, is required for degradation of target-RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications.},
}
@article {pmid29939173,
year = {2018},
author = {Feng, W and Herbst, L and Lichter, P and Pfister, SM and Liu, HK and Kawauchi, D},
title = {CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {136},
pages = {},
doi = {10.3791/57311},
pmid = {29939173},
issn = {1940-087X},
mesh = {Animals ; Brain/*metabolism/pathology ; CRISPR-Cas Systems/*genetics ; Electroporation/*methods ; Gene Transfer Techniques/*instrumentation ; Mice ; Neurons/metabolism ; },
abstract = {Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors of the diseases. To validate the contribution of a dysfunction of the mutated genes to disease development, the generation of animal models carrying the mutations is one obvious approach. While germline genetically engineered mouse models (GEMMs) are popular biological tools and exhibit reproducible results, it is restricted by time and costs. Meanwhile, non-germline GEMMs often enable exploring gene function in a more feasible manner. Since some brain diseases (e.g., brain tumors) appear to result from somatic but not germline mutations, non-germline chimeric mouse models, in which normal and abnormal cells coexist, could be helpful for disease-relevant analysis. In this study, we report a method for the induction of CRISPR-mediated somatic mutations in the cerebellum. Specifically, we utilized conditional knock-in mice, in which Cas9 and GFP are chronically activated by the CAG (CMV enhancer/chicken ß-actin) promoter after Cre-mediated recombination of the genome. The self-designed single-guide RNAs (sgRNAs) and the Cre recombinase sequence, both encoded in a single plasmid construct, were delivered into cerebellar stem/progenitor cells at an embryonic stage using in utero electroporation. Consequently, transfected cells and their daughter cells were labeled with green fluorescent protein (GFP), thus facilitating further phenotypic analyses. Hence, this method is not only showing electroporation-based gene delivery into embryonic cerebellar cells but also proposing a novel quantitative approach to assess CRISPR-mediated loss-of-function phenotypes.},
}
@article {pmid29937759,
year = {2018},
author = {Prihatna, C and Barbetti, MJ and Barker, SJ},
title = {A Novel Tomato Fusarium Wilt Tolerance Gene.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1226},
doi = {10.3389/fmicb.2018.01226},
pmid = {29937759},
issn = {1664-302X},
abstract = {The reduced mycorrhizal colonization (rmc) tomato mutant is unable to form mycorrhiza and is more susceptible to Fusarium wilt compared with its wild-type isogenic line 76R. The rmc mutant has a chromosomal deletion affecting five genes, one of which is similar to CYCLOPS. Loss of this gene is responsible for non-mycorrhizality in rmc but not enhanced Fusarium wilt susceptibility. Here, we describe assessment of a second gene in the rmc deletion, designated Solyc08g075770 that is expressed in roots. Sequence analyses show that Solyc08g075770 encodes a small transmembrane protein with putative phosphorylation and glycosylation sites. It is predicted to be localized in the plasma membrane and may function in transmembrane ion transport and/or as a cell surface receptor. Complementation and knock-out strategies were used to test its function. Some putative CRISPR/Cas-9 knock-out transgenic events exhibited Fusarium wilt susceptibility like rmc and some putative complementation lines were 76R-like, suggesting that the tomato Solyc08g075770 functions in Fusarium wilt tolerance. This is the first study to demonstrate that Solyc08g075770 is the contributor to the Tfw locus, conferring tolerance to Fusarium wilt in 76R which was lost in rmc.},
}
@article {pmid29937048,
year = {2018},
author = {Huang, CH and Lee, KC and Doudna, JA},
title = {Applications of CRISPR-Cas Enzymes in Cancer Therapeutics and Detection.},
journal = {Trends in cancer},
volume = {4},
number = {7},
pages = {499-512},
doi = {10.1016/j.trecan.2018.05.006},
pmid = {29937048},
issn = {2405-8025},
abstract = {Cancer is a complex disease caused by combinations of cellular genetic alterations and heterogeneous microenvironments. The use of the robust and programmable CRISPR-Cas systems has greatly improved genome editing for precision cancer modeling and enabled multiplexed genetic manipulation for cancer treatment and mutation detection. In this review, we outline the current CRISPR-Cas toolkit, and discuss the promises and hurdles in translating this revolutionary technology into effective and safe clinical applications for cancer treatment and diagnosis.},
}
@article {pmid29937002,
year = {2018},
author = {Nunes Dos Santos, RM and Carneiro D'Albuquerque, LA and Reyes, LM and Estrada, JL and Wang, ZY and Tector, M and Tector, AJ},
title = {CRISPR/Cas and recombinase-based human-to-pig orthotopic gene exchange for xenotransplantation.},
journal = {The Journal of surgical research},
volume = {229},
number = {},
pages = {28-40},
doi = {10.1016/j.jss.2018.03.051},
pmid = {29937002},
issn = {1095-8673},
abstract = {BACKGROUND: Tools for genome editing in pigs are improving rapidly so that making precise cuts in DNA for the purposes of deleting genes is straightforward. Development of means to replace pig genes with human genes with precision is very desirable for the future development of donor pigs for xenotransplantation.<br><br>MATERIALS AND METHODS: We used Cas9 to cut pig thrombomodulin (pTHBD) and replace it with a plasmid containing a promoterless antibiotic selection marker and the exon for human thrombomodulin. PhiC31 recombinase was used to remove the antibiotic selection marker to create porcine aortic endothelial cells expressing human instead of pTHBD, driven by the endogenous pig promoter.<br><br>RESULTS: The promoterless selection cassette permitted efficient enrichment of cells containing correctly inserted transgene. Recombinase treatment of selected cells excised the resistance marker permitting expression of the human transgene by the endogenous pTHBD promoter. Gene regulation was maintained after gene replacement because pig endogenous promoter was kept intact in the correct position.<br><br>CONCLUSIONS: Cas9 and recombinase technology make orthotopic human for pig gene exchange feasible and pave the way for creation of pigs with human genes that can be expressed in the appropriate tissues preserving gene regulation.},
}
@article {pmid29928285,
year = {2018},
author = {Stukenberg, D and Zauner, S and Dell'Aquila, G and Maier, UG},
title = {Optimizing CRISPR/Cas9 for the Diatom Phaeodactylum tricornutum.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {740},
doi = {10.3389/fpls.2018.00740},
pmid = {29928285},
issn = {1664-462X},
abstract = {CRISPR/Cas9 is a powerful tool for genome editing. We constructed an easy-to-handle expression vector for application in the model organism Phaeodactylum tricornutum and tested its capabilities in order to apply CRISPR/Cas9 technology for our purpose. In our experiments, we targeted two different genes, screened for mutations and analyzed mutated diatoms in a three-step process. In the end, we identified cells, showing either monoallelic or homo-biallelic targeted mutations. Thus, we confirm that application of the CRISPR/Cas9 system for P. tricornutum is very promising, although, as discussed, overlooked pitfalls have to be considered.},
}
@article {pmid29926763,
year = {2018},
author = {McCaughey, T and Budden, DM and Sanfilippo, PG and Gooden, GEC and Fan, L and Fenwick, E and Rees, G and MacGregor, C and Si, L and Chen, C and Liang, HH and Pébay, A and Baldwin, T and Hewitt, AW},
title = {A Need for Better Understanding Is the Major Determinant for Public Perceptions of Human Gene Editing.},
journal = {Human gene therapy},
volume = {},
number = {},
pages = {},
doi = {10.1089/hum.2018.033},
pmid = {29926763},
issn = {1557-7422},
abstract = {The CRISPR/Cas system could provide an efficient and reliable means of editing the human genome and has the potential to revolutionize modern medicine; however, rapid developments are raising complex ethical issues. There has been significant scientific debate regarding the acceptability of some applications of CRISPR/Cas, with leaders in the field highlighting the need for the lay public's views to shape expert discussion. As such, we sought to determine the factors that influence public opinion on gene editing. We created a 17-item online survey translated into 11 languages and advertised worldwide. Topic modeling was used to analyze textual responses to determine what factors influenced respondents' opinions toward human somatic or embryonic gene editing, and how this varied among respondents with differing attitudes and demographic backgrounds. A total of 3,988 free-text responses were analyzed. Respondents had a mean age of 32 (range, 11-90) years, and 37% were female. The most prevalent topics cited were Future Generations, Research, Human Editing, Children, and Health. Respondents who disagreed with gene editing for health-related purposes were more likely to cite the topic Better Understanding than those who agreed to both somatic and embryonic gene editing. Respondents from Western backgrounds more frequently discussed Future Generations, compared with participants from Eastern countries. Religious respondents did not cite the topic Religious Beliefs more frequently than did nonreligious respondents, whereas Christian respondents were more likely to cite the topic Future Generations. Our results suggest that public resistance to human somatic or embryonic gene editing does not stem from an inherent mistrust of genome modification, but rather a desire for greater understanding. Furthermore, we demonstrate that factors influencing public opinion vary greatly amongst demographic groups. It is crucial that the determinants of public attitudes toward CRISPR/Cas be well understood so that the technology does not suffer the negative public sentiment seen with previous genetic biotechnologies.},
}
@article {pmid29925039,
year = {2018},
author = {Santo, EE and Paik, J},
title = {A splice junction-targeted CRISPR approach (spJCRISPR) reveals human FOXO3B to be a protein-coding gene.},
journal = {Gene},
volume = {673},
number = {},
pages = {95-101},
doi = {10.1016/j.gene.2018.06.048},
pmid = {29925039},
issn = {1879-0038},
support = {R01 AG048284/AG/NIA NIH HHS/United States ; R01 CA219957/CA/NCI NIH HHS/United States ; },
mesh = {Alternative Splicing ; *CRISPR-Cas Systems ; Cloning, Molecular ; Cytosol/metabolism ; Deoxyribonuclease I/metabolism ; Embryonic Stem Cells/cytology ; Forkhead Box Protein O3/*genetics ; Gene Editing ; Gene Expression Regulation ; Genetic Techniques ; HEK293 Cells ; Humans ; Mutation ; Myoblasts/metabolism ; Phosphorylation ; Proto-Oncogene Proteins c-akt/genetics ; RNA, Guide/genetics ; RNA, Small Interfering/metabolism ; },
abstract = {The rapid development of CRISPR technology is revolutionizing molecular approaches to the dissection of complex biological phenomena. Here we describe an alternative generally applicable implementation of the CRISPR-Cas9 system that allows for selective knockdown of extremely homologous genes. This strategy employs the lentiviral delivery of paired sgRNAs and nickase Cas9 (Cas9D10A) to achieve targeted deletion of splice junctions. This general strategy offers several advantages over standard single-guide exon-targeting CRISPR-Cas9 such as greatly reduced off-target effects, more restricted genomic editing, routine disruption of target gene mRNA expression and the ability to differentiate between closely related genes. Here we demonstrate the utility of this strategy by achieving selective knockdown of the highly homologous human genes FOXO3A and suspected pseudogene FOXO3B. We find the spJCRISPR strategy to efficiently and selectively disrupt FOXO3A and FOXO3B mRNA and protein expression; thus revealing that the human FOXO3B locus encodes a bona fide human gene. Unlike FOXO3A, we find the FOXO3B protein to be cytosolically localized in both the presence and absence of active Akt. The ability to selectively target and efficiently disrupt the expression of the closely-related FOXO3A and FOXO3B genes demonstrates the efficacy of the spJCRISPR approach.},
}
@article {pmid29924860,
year = {2018},
author = {Kweon, J and Kim, DE and Jang, AH and Kim, Y},
title = {CRISPR/Cas-based customization of pooled CRISPR libraries.},
journal = {PloS one},
volume = {13},
number = {6},
pages = {e0199473},
doi = {10.1371/journal.pone.0199473},
pmid = {29924860},
issn = {1932-6203},
abstract = {Pooled CRISPR libraries are widely used in high-throughput screening to study various biological processes. Various pooled CRISPR libraries have been shared for CRISPR screens and useful tools have been developed to construct researcher's own libraries, however, many researchers are struggling to create their own pooled CRISPR libraries: it is a time-consuming, labor-intensive, and expensive process. In this study, we develop a simple method to customize conventional pooled CRISPR libraries using the CRISPR/Cas9 system. We show that conventional pooled CRISPR libraries can be modified by eliminating gRNAs that target positive genes, enabling the identification of unknown target genes in CRISPR screening. CRISPR/Cas9 system can be applied as a precise tool for customizing conventional pooled CRISPR libraries and will broaden the scope of high-throughput screening technology.},
}
@article {pmid29923454,
year = {2018},
author = {Yair, Y and Gophna, U},
title = {Repeat modularity as a beneficial property of multiple CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-3},
doi = {10.1080/15476286.2018.1474073},
pmid = {29923454},
issn = {1555-8584},
abstract = {CRISPR-Cas systems are a highly effective immune mechanism for prokaryotes, providing defense against invading foreign DNA. By definition, all CRISPR-Cas systems have short repeats interspersing their spacers. These repeats play a key role in preventing cleavage of self DNA and in the integration of new spacers. Here we focus on the phenomenon of repeat modularity, namely the unexpectedly high degree of repeat conservation across different systems within a genome or between different species. We hypothesize that modularity can be beneficial for CRISPR-Cas containing organisms, because it facilitates horizontal acquisition of 'pre-immunized' CRISPR arrays and allows the utilization of spacers acquired by one system for use by other systems within the same cell.},
}
@article {pmid29921752,
year = {2018},
author = {Hatoum-Aslan, A},
title = {Phage Genetic Engineering Using CRISPR⁻Cas Systems.},
journal = {Viruses},
volume = {10},
number = {6},
pages = {},
doi = {10.3390/v10060335},
pmid = {29921752},
issn = {1999-4915},
support = {K22 AI113106/AI/NIAID NIH HHS/United States ; },
mesh = {Archaea/virology ; Bacteria/virology ; Bacteriophages/*genetics ; *CRISPR-Cas Systems ; Genetic Engineering/*methods ; },
abstract = {Since their discovery over a decade ago, the class of prokaryotic immune systems known as CRISPR⁻Cas have afforded a suite of genetic tools that have revolutionized research in model organisms spanning all domains of life. CRISPR-mediated tools have also emerged for the natural targets of CRISPR⁻Cas immunity, the viruses that specifically infect bacteria, or phages. Despite their status as the most abundant biological entities on the planet, the majority of phage genes have unassigned functions. This reality underscores the need for robust genetic tools to study them. Recent reports have demonstrated that CRISPR⁻Cas systems, specifically the three major types (I, II, and III), can be harnessed to genetically engineer phages that infect diverse hosts. Here, the mechanisms of each of these systems, specific strategies used, and phage editing efficacies will be reviewed. Due to the relatively wide distribution of CRISPR⁻Cas systems across bacteria and archaea, it is anticipated that these immune systems will provide generally applicable tools that will advance the mechanistic understanding of prokaryotic viruses and accelerate the development of novel technologies based on these ubiquitous organisms.},
}
@article {pmid29917318,
year = {2018},
author = {Tarasava, K and Oh, EJ and Eckert, CA and Gill, RT},
title = {CRISPR-Enabled Tools for Engineering Microbial Genomes and Phenotypes.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700586},
doi = {10.1002/biot.201700586},
pmid = {29917318},
issn = {1860-7314},
support = {//US Department of Energy Office of Science Biological and Environmental Research Program/ ; },
abstract = {In recent years CRISPR-Cas technologies have revolutionized microbial engineering approaches. Genome editing and non-editing applications of various CRISPR-Cas systems have expanded the throughput and scale of engineering efforts, as well as opened up new avenues for manipulating genomes of non-model organisms. As we expand the range of organisms used for biotechnological applications, we need to develop better, more versatile tools for manipulation of these systems. Here the authors summarize the current advances in microbial gene editing using CRISPR-Cas based tools and highlight state-of-the-art methods for high-throughput, efficient genome-scale engineering in model organisms Escherichia coli and Saccharomyces cerevisiae. The authors also review non-editing CRISPR-Cas applications available for gene expression manipulation, epigenetic remodeling, RNA editing, labeling, and synthetic gene circuit design. Finally, the authors point out the areas of research that need further development in order to expand the range of applications and increase the utility of these new methods.},
}
@article {pmid29917197,
year = {2018},
author = {Bakhrebah, MA and Nassar, MS and Alsuabeyl, MS and Zaher, WA and Meo, SA},
title = {CRISPR technology: new paradigm to target the infectious disease pathogens.},
journal = {European review for medical and pharmacological sciences},
volume = {22},
number = {11},
pages = {3448-3452},
pmid = {29917197},
issn = {2284-0729},
abstract = {OBJECTIVE: Infectious diseases are one of the prime causes of death worldwide. An innovative sequence specific editing technology &quot;Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)&quot; has been tested on a broad range of microorganisms to target and destroy invading foreign DNA to human cells or tissues. This study aimed to discuss the mechanism and therapeutic usage of CRISPR/Cas9 genome editing technology in the management of various infectious disease pathogens.<br><br>MATERIALS AND METHODS: We conducted a broad search of the English-language literature in &quot;PubMed&quot; using the search terms &quot;CRISPR&quot;, &quot;Cas-9&quot;, &quot;Genome editing&quot;, &quot;Gene therapy&quot;, &quot;infectious disease pathogens&quot;. All the articles were reviewed and required information was recorded.<br><br>RESULTS: CRISPR technology is used to modify and modulate the gene expression in biomedical research and therapeutic development. This technology facilitates the understanding of fundamental biology and broadens the horizon of treatments of germ-laden conditions.<br><br>CONCLUSIONS: The applications of CRISPR technology are widely established in the diagnosis and treatment of various bacterial, viral, fungal and parasitic infectious diseases. CRISPR technology is a simple, efficient and tested on a broad range of microorganisms to rectify disease-associated genetic defects and destroy invading foreign DNA to human cells or tissues.},
}
@article {pmid29915899,
year = {2018},
author = {Miao, Z and Li, Q and Zhao, J and Wang, P and Wang, L and He, HP and Wang, N and Zhou, H and Zhang, TC and Luo, XG},
title = {Stable expression of infliximab in CRISPR/Cas9-mediated BAK1-deficient CHO cells.},
journal = {Biotechnology letters},
volume = {},
number = {},
pages = {},
doi = {10.1007/s10529-018-2578-4},
pmid = {29915899},
issn = {1573-6776},
support = {NO. 14CZDSY0005//Tianjin Science and Technology Support Program/ ; },
abstract = {OBJECTIVES: To establish stable infliximab-expressing Chinese hamster ovary (CHO) cells with high tolerance to serum-free culture.<br><br>RESULTS: Bcl-2 antagonist/killer 1 (BAK1), which is a key mediator of the apoptosis pathway, was disrupted, and infliximab, which is a broadly used monoclonal antibody for the treatment of rheumatoid arthritis and other autoimmune diseases, was incorporated into the BAK1 locus of the CHO chromosome using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas genome-editing technique. The activating effects of serum starvation on BAK1 and cytochrome C (CytC) were suppressed in the genome-edited cells, and the ability of the cells to resist the serum starvation-induced loss of mitochondrial membrane potential and apoptosis was increased, as indicated by the results of polymerase chain reaction (PCR), flow cytometry, enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC) analysis. In addition, during subsequent passages, infliximab could be stably produced in the genome-edited CHO cells, and the recombinant antibody could effectively antagonize the cytotoxic effect of tumor necrosis factor α (TNFα).<br><br>CONCLUSIONS: A CHO cell line capable of stably expressing infliximab and adapting to serum-free culture was constructed. This work lays the foundation for the development of infliximab biosimilars.},
}
@article {pmid29915307,
year = {2018},
author = {Crispim, JS and Dias, RS and Vidigal, PMP and de Sousa, MP and da Silva, CC and Santana, MF and de Paula, SO},
title = {Screening and characterization of prophages in Desulfovibrio genomes.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {9273},
doi = {10.1038/s41598-018-27423-z},
pmid = {29915307},
issn = {2045-2322},
abstract = {Bacteria of the genus Desulfovibrio belong to the group of Sulphate Reducing Bacteria (SRB). SRB generate significant liabilities in the petroleum industry, mainly due to their ability to microbiologically induce corrosion, biofilm formation and H2S production. Bacteriophages are an alternative control method for SRB, whose information for this group of bacteria however, is scarce. The present study developed a workflow for the identification of complete prophages in Desulfovibrio. Poly-lysogenesis was shown to be common in Desulfovibrio. In the 47 genomes analyzed 53 complete prophages were identified. These were classified within the order Caudovirales, with 69.82% belonging to the Myoviridade family. More than half the prophages identified have genes coding for lysozyme or holin. Four of the analyzed bacterial genomes present prophages with identity above 50% in the same strain, whose comparative analysis demonstrated the existence of colinearity between the sequences. Of the 17 closed bacterial genomes analyzed, 6 have the CRISPR-Cas system classified as inactive. The identification of bacterial poly-lysogeny, the proximity between the complete prophages and the possible inactivity of the CRISPR-Cas in closed bacterial genomes analyzed allowed the choice of poly-lysogenic strains with prophages belonging to the Myoviridae family for the isolation of prophages and testing of related strains for subsequent studies.},
}
@article {pmid29915237,
year = {2018},
author = {Wu, WY and Lebbink, JHG and Kanaar, R and Geijsen, N and van der Oost, J},
title = {Genome editing by natural and engineered CRISPR-associated nucleases.},
journal = {Nature chemical biology},
volume = {14},
number = {7},
pages = {642-651},
doi = {10.1038/s41589-018-0080-x},
pmid = {29915237},
issn = {1552-4469},
abstract = {Over the last decade, research on distinct types of CRISPR systems has revealed many structural and functional variations. Recently, several novel types of single-polypeptide CRISPR-associated systems have been discovered including Cas12a/Cpf1 and Cas13a/C2c2. Despite distant similarities to Cas9, these additional systems have unique structural and functional features, providing new opportunities for genome editing applications. Here, relevant fundamental features of natural and engineered CRISPR-Cas variants are compared. Moreover, practical matters are discussed that are essential for dedicated genome editing applications, including nuclease regulation and delivery, target specificity, as well as host repair diversity.},
}
@article {pmid29914921,
year = {2018},
author = {Ma, N and Zhang, J and Itzhaki, I and Zhang, SL and Chen, H and Haddad, F and Kitani, T and Wilson, KD and Tian, L and Shrestha, R and Wu, H and Lam, CK and Sayed, N and Wu, JC},
title = {Determining the Pathogenicity of a Genomic Variant of Uncertain Significance Using CRISPR/Cas9 and Human-Induced Pluripotent Stem Cells.},
journal = {Circulation},
volume = {},
number = {},
pages = {},
doi = {10.1161/CIRCULATIONAHA.117.032273},
pmid = {29914921},
issn = {1524-4539},
support = {R01 HL113006/HL/NHLBI NIH HHS/United States ; R01 HL130020/HL/NHLBI NIH HHS/United States ; K08 HL119251/HL/NHLBI NIH HHS/United States ; K01 HL135455/HL/NHLBI NIH HHS/United States ; R01 HL141371/HL/NHLBI NIH HHS/United States ; R01 HL126527/HL/NHLBI NIH HHS/United States ; },
abstract = {Background -The progression toward low-cost and rapid next-generation sequencing has uncovered a multitude of variants of uncertain significance (VUS) in both patients and asymptomatic &quot;healthy&quot; individuals. A VUS is a rare or novel variant for which disease pathogenicity has not been conclusively demonstrated or excluded, and thus cannot be definitively annotated. VUS, therefore, pose critical clinical interpretation and risk-assessment challenges, and new methods are urgently needed to better characterize their pathogenicity. Methods -To address this challenge and showcase the uncertainty surrounding genomic variant interpretation, we recruited a &quot;healthy&quot; asymptomatic individual, lacking cardiac-disease clinical history, carrying a hypertrophic cardiomyopathy (HCM)-associated genetic variant (NM_000258.2:c.170C>A, NP_000249.1:p.Ala57Asp) in the sarcomeric gene MYL3, reported by the ClinVar database to be &quot;likely pathogenic.&quot; Humaninduced pluripotent stem cells (iPSCs) were derived from the heterozygous VUSMYL3(170C>A) carrier, and their genome was edited using CRISPR/Cas9 to generate 4 isogenic iPSC lines: (1) corrected &quot;healthy&quot; control; (2) homozygous VUSMYL3(170C>A); (3) heterozygous frameshift mutation MYL3(170C>A/fs); and (4) known heterozygous MYL3 pathogenic mutation (NM_000258.2:c.170C>G), at the same nucleotide position as VUSMYL3(170C>A), lines. Extensive assays including measurements of gene expression, sarcomere structure, cell size, contractility, action potentials, and calcium handling were performed on the isogenic iPSC-derived cardiomyocytes (iPSC-CMs). Results -The heterozygous VUSMYL3(170C>A)-iPSC-CMs did not show an HCM phenotype at the gene expression, morphology, or functional levels. Furthermore, genome-edited homozygous VUSMYL3(170C>A)- and frameshift mutation MYL3(170C>A/fs)-iPSC-CMs lines were also asymptomatic, supporting a benign assessment for this particular MYL3 variant. Further assessment of the pathogenic nature of a genome-edited isogenic line carrying a known pathogenic MYL3 mutation, MYL3(170C>G), and a carrier-specific iPSC-CMs line, carrying a MYBPC3(961G>A) HCM variant, demonstrated the ability of this combined platform to provide both pathogenic and benign assessments. Conclusions -Our study illustrates the ability of clustered regularly interspaced short palindromic repeats/Cas9 genome-editing of carrier-specific iPSCs to elucidate both benign and pathogenic HCM functional phenotypes in a carrierspecific manner in a dish. As such, this platform represents a promising VUS riskassessment tool that can be used for assessing HCM-associated VUS specifically, and VUS in general, and thus significantly contribute to the arsenal of precision medicine tools available in this emerging field.},
}
@article {pmid29914659,
year = {2018},
author = {Forsythe, S},
title = {Microbial Source Tracking of Cronobacter spp.},
journal = {Advances in applied microbiology},
volume = {103},
number = {},
pages = {49-101},
doi = {10.1016/bs.aambs.2018.01.004},
pmid = {29914659},
issn = {0065-2164},
abstract = {Being able to track bacterial pathogens is essential for epidemiological purposes as well as monitoring in-house production facilities. Common bacterial pathogens, such as Salmonella serovars, are already been well defined, and their detection methods are very advanced. However, this will not be the case for emergent bacterial pathogens, as was the case for Cronobacter. The clinical significance of the organism is due to its association with rare sporadic infections in adults, and severe life-threatening outbreaks of necrotizing enterocolitis and meningitis in newborn babies. The main recognized route of infection being through the consumption of contaminated reconstituted powdered infant formula. Key to the advances in being able to track this organism during formula production and outbreaks in neonatal intensive care units has been the use of DNA sequence-based methods, and most recently those which profile whole-genome sequences. This chapter considers how the latest DNA sequence-based methods in genotyping Cronobacter serve as a model for analyzing emergent bacterial pathogens in the future. The methods considered will initially highlight the limitations of phenotyping, then advance from the DNA probe-based methods for serotyping through to DNA sequence-based methods, especially multilocus sequence typing which is supported by an open access database. Finally the development of typing methods based on whole-genomes sequences, CRISPR-cas array profiling and SNP analysis, will be covered. The overall perspective is that emergent pathogens need to be investigated with the most advanced methods in order for robust and reliable control measures to be adopted.},
}
@article {pmid29912188,
year = {2018},
author = {Carleton, JB and Berrett, KC and Gertz, J},
title = {Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {136},
pages = {},
doi = {10.3791/57883},
pmid = {29912188},
issn = {1940-087X},
support = {R00 HG006922/HG/NHGRI NIH HHS/United States ; R01 HG008974/HG/NHGRI NIH HHS/United States ; T32 GM007464/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Cell Line/cytology/*metabolism ; Enhancer Elements, Genetic/*genetics ; Humans ; },
abstract = {Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these enhancers combine to produce a transcriptional response. As millions of enhancers have been identified, high-throughput tools are needed to determine enhancer function on a genome-wide scale. Current methods for studying enhancer function include making genetic deletions using nuclease-proficient Cas9, but it is difficult to study the combinatorial effects of multiple enhancers using this technique, as multiple successive clonal cell lines must be generated. Here, we present Enhancer-i, a CRISPR interference-based method that allows for functional interrogation of multiple enhancers simultaneously at their endogenous loci. Enhancer-i makes use of two repressive domains fused to nuclease-deficient Cas9, SID and KRAB, to achieve enhancer deactivation via histone deacetylation at targeted loci. This protocol utilizes transient transfection of guide RNAs to enable transient inactivation of targeted regions and is particularly effective at blocking inducible transcriptional responses to stimuli in tissue culture settings. Enhancer-i is highly specific both in its genomic targeting and its effects on global gene expression. Results obtained from this protocol help to understand whether an enhancer is contributing to gene expression, the magnitude of the contribution, and how the contribution is affected by other nearby enhancers.},
}
@article {pmid29911924,
year = {2018},
author = {Shah, SA and Alkhnbashi, OS and Behler, J and Han, W and She, Q and Hess, WR and Garrett, RA and Backofen, R},
title = {Comprehensive search for accessory proteins encoded with archaeal and bacterial type III CRISPR-cas gene cassettes reveals 39 new cas gene families.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-13},
doi = {10.1080/15476286.2018.1483685},
pmid = {29911924},
issn = {1555-8584},
abstract = {A study was undertaken to identify conserved proteins that are encoded adjacent to cas gene cassettes of Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats - CRISPR associated) interference modules. Type III modules have been shown to target and degrade dsDNA, ssDNA and ssRNA and are frequently intertwined with cofunctional accessory genes, including genes encoding CRISPR-associated Rossman Fold (CARF) domains. Using a comparative genomics approach, and defining a Type III association score accounting for coevolution and specificity of flanking genes, we identified and classified 39 new Type III associated gene families. Most archaeal and bacterial Type III modules were seen to be flanked by several accessory genes, around half of which did not encode CARF domains and remain of unknown function. Northern blotting and interference assays in Synechocystis confirmed that one particular non-CARF accessory protein family was involved in crRNA maturation. Non-CARF accessory genes were generally diverse, encoding nuclease, helicase, protease, ATPase, transporter and transmembrane domains with some encoding no known domains. We infer that additional families of non-CARF accessory proteins remain to be found. The method employed is scalable for potential application to metagenomic data once automated pipelines for annotation of CRISPR-Cas systems have been developed. All accessory genes found in this study are presented online in a readily accessible and searchable format for researchers to audit their model organism of choice: http://accessory.crispr.dk .},
}
@article {pmid29910791,
year = {2018},
author = {Li, G and Shen, M and Yang, Y and Le, S and Li, M and Wang, J and Zhao, Y and Tan, Y and Hu, F and Lu, S},
title = {Adaptation of Pseudomonas aeruginosa to Phage PaP1 Predation via O-Antigen Polymerase Mutation.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1170},
doi = {10.3389/fmicb.2018.01170},
pmid = {29910791},
issn = {1664-302X},
abstract = {Adaptation of bacteria to phage predation poses a major obstacle for phage therapy. Bacteria adopt multiple mechanisms, such as inhibition of phage adsorption and CRISPR/Cas systems, to resist phage infection. Here, a phage-resistant mutant of Pseudomonas aeruginosa strain PA1 under the infection of lytic phage PaP1 was selected for further study. The PaP1-resistant variant, termed PA1RG, showed decreased adsorption to PaP1 and was devoid of long chain O-antigen on its cell envelope. Whole genome sequencing and comparative analysis revealed a single nucleotide mutation in the gene PA1S_08510, which encodes the O-antigen polymerase Wzy that is involved in lipopolysaccharide (LPS) biosynthesis. PA1_Wzy was classified into the O6 serotype based on sequence homology analysis and adopts a transmembrane topology similar to that seem with P. aeruginosa strain PAO1. Complementation of gene wzy in trans enabled the mutant PA1RG to produce the normal LPS pattern with long chain O-antigen and restored the susceptibility of PA1RG to phage PaP1 infection. While wzy mutation did not affect bacterial growth, mutant PA1RG exhibited decreased biofilm production, suggesting a fitness cost of PA1 associated with resistance of phage PaP1 predation. This study uncovered the mechanism responsible for PA1RG resistance to phage PaP1 via wzy mutation and revealed the role of phages in regulating bacterial behavior.},
}
@article {pmid29908341,
year = {2018},
author = {Ohde, T and Takehana, Y and Shiotsuki, T and Niimi, T},
title = {CRISPR/Cas9-based heritable targeted mutagenesis in Thermobia domestica: A genetic tool in an apterygote development model of wing evolution.},
journal = {Arthropod structure &amp; development},
volume = {47},
number = {4},
pages = {362-369},
doi = {10.1016/j.asd.2018.06.003},
pmid = {29908341},
issn = {1873-5495},
mesh = {Animals ; Base Sequence ; *Biological Evolution ; *CRISPR-Cas Systems ; Evolution, Molecular ; *Gene Expression Regulation, Developmental ; Insect Proteins/genetics ; Insecta/anatomy &amp; histology/*genetics ; *Mutagenesis ; Phylogeny ; *Wings, Animal/anatomy &amp; histology ; },
abstract = {Despite previous developmental studies on basally branching wingless insects and crustaceans, the evolutionary origin of insect wings remains controversial. Knowledge regarding genetic regulation of tissues hypothesized to have given rise to wings would help to elucidate how ancestral development changed to allow the evolution of true wings. However, genetic tools available for basally branching wingless species are limited. The firebrat Thermobia domestica is an apterygote species, phylogenetically related to winged insects. T. domestica presents a suitable morphology to investigate the origin of wings, as it forms the tergal paranotum, from which wings are hypothesized to have originated. Here we report the first successful CRISPR/Cas9-based germline genome editing in T. domestica. We provide a technological platform to understand the development of tissues hypothesized to have given rise to wings in an insect with a pre-wing evolution body plan.},
}
@article {pmid29907732,
year = {2018},
author = {Hong, S and Ka, D and Yoon, SJ and Suh, N and Jeong, M and Suh, JY and Bae, E},
title = {CRISPR RNA and anti-CRISPR protein binding to the Xanthomonas albilineans Csy1-Csy2 heterodimer in the type I-F CRISPR-Cas system.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {24},
pages = {9233},
doi = {10.1074/jbc.AAC118.004093},
pmid = {29907732},
issn = {1083-351X},
}
@article {pmid29907308,
year = {2018},
author = {Piatek, AA and Lenaghan, SC and Neal Stewart, C},
title = {Advanced editing of the nuclear and plastid genomes in plants.},
journal = {Plant science : an international journal of experimental plant biology},
volume = {273},
number = {},
pages = {42-49},
doi = {10.1016/j.plantsci.2018.02.025},
pmid = {29907308},
issn = {1873-2259},
mesh = {CRISPR-Cas Systems ; Cell Nucleus/genetics ; *Gene Editing ; Genome, Plant/*genetics ; Genome, Plastid/*genetics ; *Metabolic Engineering ; Plants/*genetics ; *Synthetic Biology ; },
abstract = {Genome editing is a powerful suite of technologies utilized in basic and applied plant research. Both nuclear and plastid genomes have been genetically engineered to alter traits in plants. While the most frequent molecular outcome of gene editing has been knockouts resulting in a simple deletion of an endogenous protein of interest from the host's proteome, new genes have been added to plant genomes and, in several instances, the sequence of endogenous genes have been targeted for a few coding changes. Targeted plant characteristics for genome editing range from single gene targets for agronomic input traits to metabolic pathways to endow novel plant function. In this paper, we review the fundamental approaches to editing nuclear and plastid genomes in plants with an emphasis on those utilizing synthetic biology. The differences between the eukaryotic-type nuclear genome and the prokaryotic-type plastid genome (plastome) in plants has profound consequences in the approaches employed to transform, edit, select transformants, and indeed, nearly all aspects of genetic engineering procedures. Thus, we will discuss the two genomes targeted for editing in plants, the toolbox used to make edits, along with strategies for future editing approaches to transform crop production and sustainability. While CRISPR/Cas9 is the current method of choice in editing nuclear genomes, the plastome is typically edited using homologous recombination approaches. A particularly promising synthetic biology approach is to replace the endogenous plastome with a 'synplastome' that is computationally designed, and synthesized and assembled in the lab, then installed into chloroplasts. The editing strategies, transformation methods, characteristics of the novel plant also affect how the genetically engineered plant may be governed and regulated. Each of these components and final products of gene editing affect the future of biotechnology and farming.},
}
@article {pmid29907307,
year = {2018},
author = {Vazquez-Vilar, M and Orzaez, D and Patron, N},
title = {DNA assembly standards: Setting the low-level programming code for plant biotechnology.},
journal = {Plant science : an international journal of experimental plant biology},
volume = {273},
number = {},
pages = {33-41},
doi = {10.1016/j.plantsci.2018.02.024},
pmid = {29907307},
issn = {1873-2259},
mesh = {Biotechnology ; CRISPR-Cas Systems ; Cloning, Molecular ; DNA, Plant/*genetics ; Genetic Engineering/*standards ; Genome, Plant/*genetics ; Plants/*genetics ; Synthetic Biology/*standards ; },
abstract = {Synthetic Biology is defined as the application of engineering principles to biology. It aims to increase the speed, ease and predictability with which desirable changes and novel traits can be conferred to living cells. The initial steps in this process aim to simplify the encoding of new instructions in DNA by establishing low-level programming languages for biology. Together with advances in the laboratory that allow multiple DNA molecules to be efficiently assembled together into a desired order in a single step, this approach has simplified the design and assembly of multigene constructs and has even facilitated the automated construction of synthetic chromosomes. These advances and technologies are now being applied to plants, for which there are a growing number of software and wetware tools for the design, construction and delivery of DNA molecules and for the engineering of endogenous genes. Here we review the efforts of the past decade that have established synthetic biology workflows and tools for plants and discuss the constraints and bottlenecks of this emerging field.},
}
@article {pmid29902435,
year = {2018},
author = {Chiu, C},
title = {Cutting-Edge Infectious Disease Diagnostics with CRISPR.},
journal = {Cell host &amp; microbe},
volume = {23},
number = {6},
pages = {702-704},
doi = {10.1016/j.chom.2018.05.016},
pmid = {29902435},
issn = {1934-6069},
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Viruses ; },
abstract = {Three recent Science articles (Chen et al., 2018; Gootenberg et al., 2018; Myhrvold et al., 2018) describe the use of CRISPR-Cas technology to develop point-of-care diagnostics that directly detect viruses from clinical samples. These tests could radically transform approaches to diagnosing infectious diseases at the bedside and in the field.},
}
@article {pmid29902258,
year = {2018},
author = {Pursey, E and Sünderhauf, D and Gaze, WH and Westra, ER and van Houte, S},
title = {CRISPR-Cas antimicrobials: Challenges and future prospects.},
journal = {PLoS pathogens},
volume = {14},
number = {6},
pages = {e1006990},
doi = {10.1371/journal.ppat.1006990},
pmid = {29902258},
issn = {1553-7374},
}
@article {pmid29900841,
year = {2018},
author = {Castino, G and Guillemet, M and Joly, A and Vignon, A},
title = {[The CRISPR/Cas system: a genome editing tool to develop animal models of viral infections].},
journal = {Medecine sciences : M/S},
volume = {34},
number = {5},
pages = {403-405},
doi = {10.1051/medsci/20183405011},
pmid = {29900841},
issn = {1958-5381},
}
@article {pmid29900838,
year = {2018},
author = {Friot, A and Guguin, J and Haniche, L and Vuillier, S},
title = {[Resistance to conjugative transfer via CRISPR/Cas and restriction/modification in Enterococcus faecalis].},
journal = {Medecine sciences : M/S},
volume = {34},
number = {5},
pages = {396-399},
doi = {10.1051/medsci/20183405008},
pmid = {29900838},
issn = {1958-5381},
}
@article {pmid29900640,
year = {2018},
author = {Kawahara, R and Niwa, Y and Simizu, S},
title = {Integrin β1 is an essential factor in vasculogenic mimicry of human cancer cells.},
journal = {Cancer science},
volume = {109},
number = {8},
pages = {2490-2496},
doi = {10.1111/cas.13693},
pmid = {29900640},
issn = {1349-7006},
mesh = {CRISPR-Cas Systems/genetics ; Cell Line ; Cell Line, Tumor ; Gene Deletion ; HEK293 Cells ; Humans ; Integrin beta1/*genetics ; Neovascularization, Pathologic/*genetics/*pathology ; },
abstract = {Vasculogenic mimicry (VM) formation by cancer cells is known to play a crucial role in tumor progression, but its detailed mechanism is unclear. In the present study, we focused on integrin β1 (ITGB1) and assessed the role of ITGB1 in VM formation. We used in vitro methods to seed cancer cells on Matrigel to evaluate the capability of VM formation. We carried out ITGB1 gene deletion using the CRISPR/Cas9 system, and these ITGB1-knockout cells did not show a VM-like network formation. Further, reintroduction of ITGB1 rescued VM-like network formation in ITGB1-knockout cells. In conclusion, ITGB1 is a critical factor in VM of human cancer cells, and inhibition of ITGB1 may be a novel therapeutic approach for malignant cancer.},
}
@article {pmid29899108,
year = {2018},
author = {TerBush, AA and Hafkamp, F and Lee, HJ and Coscoy, L},
title = {A Kaposi's Sarcoma-Associated Herpesvirus Infection Mechanism Is Independent of Integrins α3β1, αVβ3, and αVβ5.},
journal = {Journal of virology},
volume = {92},
number = {17},
pages = {},
doi = {10.1128/JVI.00803-18},
pmid = {29899108},
issn = {1098-5514},
mesh = {CRISPR-Cas Systems ; Cell Line ; Cell Membrane/metabolism ; Cells, Cultured ; Endothelial Cells/virology ; Ephrin-A2/genetics ; Fibroblasts/virology ; Gene Editing ; Gene Expression Regulation, Viral ; HeLa Cells ; Herpesviridae Infections/*virology ; *Herpesvirus 8, Human/physiology ; Humans ; Integrin alpha3beta1/*genetics/metabolism ; Integrin alphaVbeta3/*genetics/metabolism ; Pinocytosis ; Receptors, Vitronectin/*genetics/metabolism ; Signal Transduction/genetics ; *Virus Internalization ; },
abstract = {Host receptor usage by Kaposi's sarcoma-associated herpesvirus (KSHV) has been best studied using primary microvascular endothelial and fibroblast cells, although the virus infects a wide variety of cell types in culture and in natural infections. In these two infection models, KSHV adheres to the cell though heparan sulfate (HS) binding and then interacts with a complex of EphA2, xCT, and integrins α3β1, αVβ3, and αVβ5 to catalyze viral entry. We dissected this receptor complex at the genetic level with CRISPR-Cas9 to precisely determine receptor usage in two epithelial cell lines. Surprisingly, we discovered an infection mechanism that requires HS and EphA2 but is independent of αV- and β1-family integrin expression. Furthermore, infection appears to be independent of the EphA2 intracellular domain. We also demonstrated that while two other endogenous Eph receptors were dispensable for KSHV infection, transduced EphA4 and EphA5 significantly enhanced infection of cells lacking EphA2.IMPORTANCE Our data reveal an integrin-independent route of KSHV infection and suggest that multiple Eph receptors besides EphA2 can promote and regulate infection. Since integrins and Eph receptors are large protein families with diverse expression patterns across cells and tissues, we propose that KSHV may engage with several proteins from both families in different combinations to negotiate successful entry into diverse cell types.},
}
@article {pmid29899105,
year = {2018},
author = {Shen, J and Zhou, J and Chen, GQ and Xiu, ZL},
title = {Efficient Genome Engineering of a Virulent Klebsiella Bacteriophage Using CRISPR-Cas9.},
journal = {Journal of virology},
volume = {92},
number = {17},
pages = {},
doi = {10.1128/JVI.00534-18},
pmid = {29899105},
issn = {1098-5514},
mesh = {Bacteriophages/*genetics/pathogenicity ; Base Sequence ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; DNA Breaks, Double-Stranded ; Gene Editing/economics/*methods/standards ; Genome, Viral/*genetics ; Homologous Recombination ; Klebsiella pneumoniae/*virology ; Point Mutation ; RNA, Viral/chemistry/genetics ; Sequence Deletion ; Virulence ; },
abstract = {Klebsiella pneumoniae is one of the most common nosocomial opportunistic pathogens and usually exhibits multiple-drug resistance. Phage therapy, a potential therapeutic to replace or supplement antibiotics, has attracted much attention. However, very few Klebsiella phages have been well characterized because of the lack of efficient genome-editing tools. Here, Cas9 from Streptococcus pyogenes and a single guide RNA (sgRNA) were used to modify a virulent Klebsiella bacteriophage, phiKpS2. We first evaluated the distribution of sgRNA activity in phages and proved that it is largely inconsistent with the predicted activity from current models trained on eukaryotic cell data sets. A simple CRISPR-based phage genome-editing procedure was developed based on the discovery that homologous arms as short as 30 to 60 bp were sufficient to introduce point mutation, gene deletion, and swap. We also demonstrated that weak sgRNAs could be used for precise phage genome editing but failed to select random recombinants, possibly because inefficient cleavage can be tolerated through continuous repair by homologous recombination with the uncut genomes. Small frameshift deletion was proved to be an efficient way to evaluate the essentiality of phage genes. By using the abovementioned strategies, a putative promoter and nine genes of phiKpS2 were successfully deleted. Interestingly, the holin gene can be deleted with little effect on phiKpS2 infection, but the reason is not yet clear. This study established an efficient, time-saving, and cost-effective procedure for phage genome editing, which is expected to significantly promote the development of bacteriophage therapy.IMPORTANCE In the present study, we have addressed efficient, time-saving, and cost-effective CRISPR-based phage genome editing of Klebsiella phage, which has the potential to significantly expand our knowledge of phage-host interactions and to promote applications of phage therapy. The distribution of sgRNA activity was first evaluated in phages. Short homologous arms were proven to be enough to introduce point mutation, small frameshift deletion, gene deletion, and swap into phages, and weak sgRNAs were proven useful for precise phage genome editing but failed to select random recombinants, all of which makes the CRISPR-based phage genome-editing method easier to use.},
}
@article {pmid29893914,
year = {2018},
author = {Bernal-Bernal, D and Abellón-Ruiz, J and Iniesta, AA and Pajares-Martínez, E and Bastida-Martínez, E and Fontes, M and Padmanabhan, S and Elías-Arnanz, M},
title = {Multifactorial control of the expression of a CRISPR-Cas system by an extracytoplasmic function σ/anti-σ pair and a global regulatory complex.},
journal = {Nucleic acids research},
volume = {46},
number = {13},
pages = {6726-6745},
doi = {10.1093/nar/gky475},
pmid = {29893914},
issn = {1362-4962},
abstract = {Expression of CRISPR-Cas systems is a prerequisite for their defensive role against invading genetic elements. Yet, much remains unknown about how this crucial step is regulated. We describe a new mechanism controlling CRISPR-cas expression, which requires an extracytoplasmic function (ECF) σ factor (DdvS), its membrane-bound anti-σ (DdvA) and a global regulatory complex (CarD-CarG). Transcriptomic analyses revealed that the DdvS/CarD/CarG-dependent regulon comprises a type III-B CRISPR-Cas system in Myxococcus xanthus. We mapped four DdvS-driven CarD/CarG-dependent promoters, with one lying immediately upstream of the cas cluster. Consistent with direct action, DdvS and CarD-CarG localize at these promoters in vivo. The cas genes are transcribed as a polycistronic mRNA that reads through the leader into the CRISPR array, a putative σA-dependent promoter in the leader having negligible activity in vivo. Consequently, expression of the entire CRISPR-Cas system and mature CRISPR-RNA (crRNA) production is DdvS/CarD/CarG-dependent. DdvA likely uses its large C-terminal domain to sense and transduce the extracytoplasmic signal triggering CRISPR-cas expression, which we show is not starvation-induced multicellular development. An ECF-σ/anti-σ pair and a global regulatory complex provide an effective mechanism to coordinate signal-sensing with production of precursor crRNA, its processing Cas6 endoribonuclease and other Cas proteins for mature crRNA biogenesis and interference.},
}
@article {pmid29891675,
year = {2018},
author = {Ishii, T and Hayakawa, H and Igawa, T and Sekiguchi, T and Sekiguchi, M},
title = {Specific binding of PCBP1 to heavily oxidized RNA to induce cell death.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {26},
pages = {6715-6720},
doi = {10.1073/pnas.1806912115},
pmid = {29891675},
issn = {1091-6490},
mesh = {Amino Acid Substitution ; Apoptosis/*physiology ; CRISPR-Cas Systems ; Caspase 3/physiology ; Conserved Sequence ; Guanine/analogs &amp; derivatives/metabolism ; HeLa Cells ; Heterogeneous-Nuclear Ribonucleoprotein D/metabolism ; Heterogeneous-Nuclear Ribonucleoproteins/chemistry/*metabolism ; Humans ; Hydrogen Peroxide/pharmacology ; Oxidation-Reduction ; Protein Domains ; RNA, Messenger/chemistry/*metabolism ; Recombinant Proteins/chemistry/metabolism ; Structure-Activity Relationship ; },
abstract = {In aerobically growing cells, the guanine base of RNA is oxidized to 8-oxo-7,8-dihydroguanine (8-oxoG), which induces alteration in their gene expression. We previously demonstrated that the human AUF1 protein binds to 8-oxoG in RNA to induce the selective degradation of oxidized messenger RNA. We herein report that the poly(C)-binding protein PCBP1 binds to more severely oxidized RNA to activate apoptosis-related reactions. While AUF1 binds to oligoribonucleotides carrying a single 8-oxoG, PCBP1 does not bind to such oligoribonucleotides but instead binds firmly to oligoribonucleotides in which two 8-oxoG residues are located nearby. PCBP1-deficient cells, constructed from the human HeLa S3 line using the CRISPR-Cas9 system, exhibited higher survival rates than HeLa S3 cells when small doses of hydrogen peroxide were applied. The levels of caspase-3 activation and PARP-1 cleavage in the PCBP1-deficient cells were significantly lower than those in wild-type cells. The structure-function relationship of PCBP1 was established with the use of PCBP1 mutant proteins in which the conserved KH domains were defective. Human cells appear to possess two distinct mechanisms, one controlled by AUF1 and the other by PCBP1, with the former functioning when messenger RNA is moderately oxidized and the latter operating when the RNA is more severely damaged.},
}
@article {pmid29891635,
year = {2018},
author = {Drabavicius, G and Sinkunas, T and Silanskas, A and Gasiunas, G and Venclovas, Č and Siksnys, V},
title = {DnaQ exonuclease-like domain of Cas2 promotes spacer integration in a type I-E CRISPR-Cas system.},
journal = {EMBO reports},
volume = {19},
number = {7},
pages = {},
doi = {10.15252/embr.201745543},
pmid = {29891635},
issn = {1469-3178},
abstract = {CRISPR-Cas systems constitute an adaptive immune system that provides acquired resistance against phages and plasmids in prokaryotes. Upon invasion of foreign nucleic acids, some cells integrate short fragments of foreign DNA as spacers into the CRISPR locus to memorize the invaders and acquire resistance in the subsequent round of infection. This immunization step called adaptation is the least understood part of the CRISPR-Cas immunity. We have focused here on the adaptation stage of Streptococcus thermophilus DGCC7710 type I-E CRISPR4-Cas (St4) system. Cas1 and Cas2 proteins conserved in nearly all CRISPR-Cas systems are required for spacer acquisition. The St4 CRISPR-Cas system is unique because the Cas2 protein is fused to an additional DnaQ exonuclease domain. Here, we demonstrate that St4 Cas1 and Cas2-DnaQ form a multimeric complex, which is capable of integrating DNA duplexes with 3'-overhangs (protospacers) in vitro We further show that the DnaQ domain of Cas2 functions as a 3'-5'-exonuclease that processes 3'-overhangs of the protospacer to promote integration.},
}
@article {pmid29891532,
year = {2018},
author = {Eid, A and Alshareef, S and Mahfouz, MM},
title = {CRISPR base editors: genome editing without double-stranded breaks.},
journal = {The Biochemical journal},
volume = {475},
number = {11},
pages = {1955-1964},
doi = {10.1042/BCJ20170793},
pmid = {29891532},
issn = {1470-8728},
abstract = {The CRISPR (clustered regularly interspaced short palindromic repeat)/Cas9 adaptive immunity system has been harnessed for genome editing applications across eukaryotic species, but major drawbacks, such as the inefficiency of precise base editing and off-target activities, remain. A catalytically inactive Cas9 variant (dead Cas9, dCas9) has been fused to diverse functional domains for targeting genetic and epigenetic modifications, including base editing, to specific DNA sequences. As base editing does not require the generation of double-strand breaks, dCas9 and Cas9 nickase have been used to target deaminase domains to edit specific loci. Adenine and cytidine deaminases convert their respective nucleotides into other DNA bases, thereby offering many possibilities for DNA editing. Such base-editing enzymes hold great promise for applications in basic biology, trait development in crops, and treatment of genetic diseases. Here, we discuss recent advances in precise gene editing using different platforms as well as their potential applications in basic biology and biotechnology.},
}
@article {pmid29890897,
year = {2018},
author = {Mudziwapasi, R and Ndudzo, A and Nyamusamba, RP and Jomane, FN and Mutengwa, TT and Maphosa, M},
title = {Unlocking the potential of CRISPR technology for improving livelihoods in Africa.},
journal = {Biotechnology &amp; genetic engineering reviews},
volume = {34},
number = {2},
pages = {198-215},
doi = {10.1080/02648725.2018.1482101},
pmid = {29890897},
issn = {2046-5556},
mesh = {Africa ; Animals ; *CRISPR-Cas Systems ; Food Storage ; Food Supply ; Gene Editing/economics/*methods ; Humans ; Plants, Genetically Modified/*growth &amp; development ; },
abstract = {Africa is burdened with food shortages and plant, animal and human diseases. Some of these can be ameliorated by adopting genome editing technologies such as CRISPR. This technology is considered better than its predecessors, Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), because it is cheaper, easy to use, has high gene modification efficiency and is less time consuming. CRISPR technology has wide applications in the African context ranging from crop and animal improvement to disease diagnosis and treatment as well as improving food shelf life, organoleptic properties and food safety. It has the potential to bring back species of organisms that are extinct. However, some African countries have not taken advantage of the potential of CRISPR to solve many of their problems. This paper explores possible applications of CRISPR towards improvement of African livelihoods.},
}
@article {pmid29889198,
year = {2018},
author = {Farboud, B and Jarvis, E and Roth, TL and Shin, J and Corn, JE and Marson, A and Meyer, BJ and Patel, NH and Hochstrasser, ML},
title = {Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {135},
pages = {},
doi = {10.3791/57350},
pmid = {29889198},
issn = {1940-087X},
support = {R01 GM030702/GM/NIGMS NIH HHS/United States ; T32 GM007618/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Humans ; Ribonucleoproteins/*genetics/metabolism ; },
abstract = {Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has quickly become a commonplace amongst researchers pursuing a wide variety of biological questions. Users most often employ the Cas9 protein derived from Streptococcus pyogenes in a complex with an easily reprogrammed guide RNA (gRNA). These components are introduced into cells, and through a base pairing with a complementary region of the double-stranded DNA (dsDNA) genome, the enzyme cleaves both strands to generate a double-strand break (DSB). Subsequent repair leads to either random insertion or deletion events (indels) or the incorporation of experimenter-provided DNA at the site of the break. The use of a purified single-guide RNA and Cas9 protein, preassembled to form an RNP and delivered directly to cells, is a potent approach for achieving highly efficient gene editing. RNP editing particularly enhances the rate of gene insertion, an outcome that is often challenging to achieve. Compared to the delivery via a plasmid, the shorter persistence of the Cas9 RNP within the cell leads to fewer off-target events. Despite its advantages, many casual users of CRISPR gene editing are less familiar with this technique. To lower the barrier to entry, we outline detailed protocols for implementing the RNP strategy in a range of contexts, highlighting its distinct benefits and diverse applications. We cover editing in two types of primary human cells, T cells and hematopoietic stem/progenitor cells (HSPCs). We also show how Cas9 RNP editing enables the facile genetic manipulation of entire organisms, including the classic model roundworm Caenorhabditis elegans and the more recently introduced model crustacean, Parhyale hawaiensis.},
}
@article {pmid29888283,
year = {2018},
author = {Yasunaga, K and Ito, T and Miki, M and Ueda, K and Fujiyama, T and Tachibana, Y and Fujimori, N and Kawabe, K and Ogawa, Y},
title = {Using CRISPR/Cas9 to Knock out Amylase in Acinar Cells Decreases Pancreatitis-Induced Autophagy.},
journal = {BioMed research international},
volume = {2018},
number = {},
pages = {8719397},
doi = {10.1155/2018/8719397},
pmid = {29888283},
issn = {2314-6141},
mesh = {*Acinar Cells/metabolism/pathology ; Amylases/*genetics/metabolism ; Autophagy/*genetics ; Autophagy-Related Protein 12/genetics/metabolism ; *CRISPR-Cas Systems ; Cell Line ; *Gene Knockdown Techniques ; Humans ; *Neoplasm Proteins/genetics/metabolism ; *Pancreatic Neoplasms/genetics/metabolism/pathology ; *Pancreatitis/genetics/metabolism/pathology ; },
abstract = {Pancreatic cancer is a malignant neoplasm that originates from acinar cells. Acinar cells get reprogrammed to become duct cells, resulting in pancreatic cancer. Pancreatitis is an acinar cell inflammation, leading to &quot;impaired autophagy flux&quot;. Pancreatitis promotes acinar-to-ductal transdifferentiation. Expression of amylase gets eliminated during the progression of pancreatic cancer. Amylase is considered as an acinar cell marker; however, its function in cells is not known. Thus, we investigated whether amylase affects the acinar cell autophagy and whether it plays any role in development of pancreatitis. Here, we knocked out ATG12 in a pancreatic cancer cells and acinar cells using CRISPR/Cas9. Autophagy inhibition led to an increase in the expression of duct cell markers and a simultaneous decrease in that of acinar cell markers. It also caused an increase in cell viability and changes in mitochondrial morphology. Next, we knocked out amylase in acinar cells. Amylase deficiency decreased autophagy induced by pancreatitis. Our results suggest that amylase controls pancreatitis-induced autophagy. We found that eliminating amylase expression contributes to pancreatic cancer etiology by decreasing autophagy. Furthermore, our results indicate that amylase plays a role in selective pancreatitis-induced autophagy of pancreatic enzyme vesicles.},
}
@article {pmid29884745,
year = {2018},
author = {Germoglio, M and Adamo, A},
title = {A Role in Apoptosis Regulation for the rad-51 Gene of Caenorhabditis elegans.},
journal = {Genetics},
volume = {209},
number = {4},
pages = {1017-1028},
doi = {10.1534/genetics.118.301152},
pmid = {29884745},
issn = {1943-2631},
mesh = {Animals ; Apoptosis ; CRISPR-Cas Systems ; Caenorhabditis elegans/genetics/*metabolism ; Caenorhabditis elegans Proteins/*genetics/*metabolism ; DNA Damage ; Female ; Germ Cells/*cytology/metabolism ; Male ; Mutation ; Rad51 Recombinase/*genetics/*metabolism ; },
abstract = {The evolutionarily conserved RAD-51 protein is essential for homologous recombination in the germ line as well as homologous repair of DNA double-strand breaks in all eukaryotic cells. In the nematode Caenorhabditis elegans, the rad-51 gene is transcribed into messenger RNAs potentially coding three alternative protein isoforms. Null rad-51 alleles display embryonic lethality, severe defects in chromosome structure, and high levels of germ line apoptosis. To dissect its functions, we genetically modified the C. elegans rad-51 gene by clustered regularly interspaced short palindromic repeats/Cas9 genome-editing technology, obtaining a separation-of-function (sfi-) mutant allele that only disrupts the long-transcript isoform. This mutant shows no defects in an otherwise wild-type meiosis and is able to activate physiological germ cell death, which occurs at the late pachytene stage. However, although the mutant is competent in DNA damage checkpoint activation after exposure to ionizing radiation, it is defective for induction of DNA damage-induced apoptosis in meiotic germ cells. These results suggest that RAD-51 plays a novel role in germ line apoptosis independent of RAD-51-mediated strand invasion for homologous recombination.},
}
@article {pmid29884309,
year = {2018},
author = {Blake, DJ and Martiszus, JD and Lone, TH and Fenster, SD},
title = {Ablation of the CD9 receptor in human lung cancer cells using CRISPR/Cas alters migration to chemoattractants including IL-16.},
journal = {Cytokine},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.cyto.2018.05.038},
pmid = {29884309},
issn = {1096-0023},
abstract = {CD9, a member of the tetraspanin superfamily, has been implicated in regulating various physiological processes, including cell motility, adhesion, apoptosis and metastasis. Recently, interleukin-16 (IL-16), a pro-inflammatory cytokine released by normal airway and alveolar epithelial cells, has been implicated as a possible ligand for CD9 as an alternative receptor. In this study, using A549 cells as a model of human alveolar epithelium, CD9 expression was ablated using CRISPR/Cas technology. Decreased expression of CD9 mRNA and protein levels was confirmed through RT-qPCR and flow cytometry, respectively. Individual clones were generated that expressed high levels of CD9 (wild-type, WT) or significantly less CD9 (knockdown, KD). Both wild-type and knockdown A549 cell migration was quantified using a FluoroBloc transwell chemotaxis assay. Our results indicate that wild-type A549 cells migrated towards chemoattractants. Moreover, CD9 expression was required in this process since the CD9 knockdown cells had a significantly reduced migration towards growth serum and IL-16. These results support the migratory properties for CD9 in human lung cells and support the hypothesis that CD9 serves as an alternative receptor for IL-16.},
}
@article {pmid29883605,
year = {2018},
author = {Shiimori, M and Garrett, SC and Graveley, BR and Terns, MP},
title = {Cas4 Nucleases Define the PAM, Length, and Orientation of DNA Fragments Integrated at CRISPR Loci.},
journal = {Molecular cell},
volume = {70},
number = {5},
pages = {814-824.e6},
doi = {10.1016/j.molcel.2018.05.002},
pmid = {29883605},
issn = {1097-4164},
support = {F32 GM110986/GM/NIGMS NIH HHS/United States ; R35 GM118140/GM/NIGMS NIH HHS/United States ; R35 GM118160/GM/NIGMS NIH HHS/United States ; },
abstract = {To achieve adaptive and heritable immunity against viruses and other mobile genetic elements, CRISPR-Cas systems must capture and store short DNA fragments (spacers) from these foreign elements into host genomic CRISPR arrays. This process is catalyzed by conserved Cas1/Cas2 integration complexes, but the specific roles of another highly conserved protein linked to spacer acquisition, the Cas4 nuclease, are just now emerging. Here, we show that two Cas4 nucleases (Cas4-1 and Cas4-2) play critical roles in CRISPR spacer acquisition in Pyrococcus furiosus. The nuclease activities of both Cas4 proteins are required to process protospacers to the correct size. Cas4-1 specifies the upstream PAM (protospacer adjacent motif), while Cas4-2 specifies the conserved downstream motif. Both Cas4 proteins ensure CRISPR spacer integration in a defined orientation leading to CRISPR immunity. Collectively, these findings provide in vivo evidence for critical roles of Cas4 nucleases in protospacer generation and functional spacer integration at CRISPR arrays.},
}
@article {pmid29883602,
year = {2018},
author = {Koonin, EV},
title = {Hunting for Treasure Chests in Microbial Defense Islands.},
journal = {Molecular cell},
volume = {70},
number = {5},
pages = {761-762},
doi = {10.1016/j.molcel.2018.05.025},
pmid = {29883602},
issn = {1097-4164},
abstract = {Microbes exist in a constant struggle with viruses and have evolved multiple defense mechanisms. Some of these, such as restriction endonucleases and CRISPR-Cas, have revolutionized genome editing methodology. A systematic strategy combining computation and experiment led to discovery of ten new defense systems that remain to be characterized mechanistically.},
}
@article {pmid29880725,
year = {2018},
author = {Xiao, Y and Luo, M and Dolan, AE and Liao, M and Ke, A},
title = {Structure basis for RNA-guided DNA degradation by Cascade and Cas3.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6397},
pages = {},
doi = {10.1126/science.aat0839},
pmid = {29880725},
issn = {1095-9203},
support = {R35 GM118174/GM/NIGMS NIH HHS/United States ; R01 GM102543/GM/NIGMS NIH HHS/United States ; },
mesh = {Actinobacteria/genetics/*metabolism ; Bacterial Proteins/*chemistry/genetics ; CRISPR-Associated Proteins/*chemistry/genetics ; Cryoelectron Microscopy ; DNA/*chemistry/genetics ; *DNA Breaks, Single-Stranded ; *DNA Fragmentation ; DNA Helicases/*chemistry/genetics ; Nucleic Acid Conformation ; Protein Conformation ; RNA, Guide/*chemistry/genetics ; },
abstract = {Type I CRISPR-Cas system features a sequential target-searching and degradation process on double-stranded DNA by the RNA-guided Cascade (CRISPR associated complex for antiviral defense) complex and the nuclease-helicase fusion enzyme Cas3, respectively. Here, we present a 3.7-angstrom-resolution cryo-electron microscopy (cryo-EM) structure of the Type I-E Cascade/R-loop/Cas3 complex, poised to initiate DNA degradation. Cas3 distinguishes Cascade conformations and only captures the R-loop-forming Cascade, to avoid cleaving partially complementary targets. Its nuclease domain recruits the nontarget strand (NTS) DNA at a bulged region for the nicking of single-stranded DNA. An additional 4.7-angstrom-resolution cryo-EM structure captures the postnicking state, in which the severed NTS retracts to the helicase entrance, to be threaded for adenosine 5'-triphosphate-dependent processive degradation. These snapshots form the basis for understanding RNA-guided DNA degradation in Type I-E CRISPR-Cas systems.},
}
@article {pmid29879957,
year = {2018},
author = {Gotesman, M and Menanteau-Ledouble, S and Saleh, M and Bergmann, SM and El-Matbouli, M},
title = {A new age in AquaMedicine: unconventional approach in studying aquatic diseases.},
journal = {BMC veterinary research},
volume = {14},
number = {1},
pages = {178},
doi = {10.1186/s12917-018-1501-5},
pmid = {29879957},
issn = {1746-6148},
support = {P28837-B22//Austrian Science Fund/ ; },
mesh = {Animals ; *Aquaculture ; Communicable Diseases/diagnosis/*veterinary ; Fish Diseases/*diagnosis/microbiology/virology ; *Fishes ; },
abstract = {BACKGROUND: Marine and aquaculture industries are important sectors of the food production and global trade. Unfortunately, the fish food industry is challenged with a plethora of infectious pathogens. The freshwater and marine fish communities are rapidly incorporating novel and most up to date techniques for detection, characterization and treatment strategies. Rapid detection of infectious diseases is important in preventing large disease outbreaks.<br><br>MAIN TEXT: One hundred forty-six articles including reviews papers were analyzed and their conclusions evaluated in the present paper. This allowed us to describe the most recent development research regarding the control of diseases in the aquatic environment as well as promising avenues that may result in beneficial developments. For the characterization of diseases, traditional sequencing and histological based methods have been augmented with transcriptional and proteomic studies. Recent studies have demonstrated that transcriptional based approaches using qPCR are often synergistic to expression based studies that rely on proteomic-based techniques to better understand pathogen-host interactions. Preventative therapies that rely on prophylactics such as vaccination with protein antigens or attenuated viruses are not always feasible and therefore, the development of therapies based on small nucleotide based medicine is on the horizon. Of those, RNAi or CRISPR/Cas- based therapies show great promise in combating various types of diseases caused by viral and parasitic agents that effect aquatic and fish medicine.<br><br>CONCLUSIONS: In our modern times, when the marine industry has become so vital for feed and economic stability, even the most extreme alternative treatment strategies such as the use of small molecules or even the use of disease to control invasive species populations should be considered.},
}
@article {pmid29878653,
year = {2018},
author = {Evens, H and Chuah, MK and VandenDriessche, T},
title = {Haemophilia gene therapy: From trailblazer to gamechanger.},
journal = {Haemophilia : the official journal of the World Federation of Hemophilia},
volume = {24 Suppl 6},
number = {},
pages = {50-59},
doi = {10.1111/hae.13494},
pmid = {29878653},
issn = {1365-2516},
mesh = {Animals ; Factor IX/genetics ; Factor VIII/genetics ; Genetic Therapy/*methods ; Genetic Vectors/genetics ; Hemophilia A/*genetics/*therapy ; Humans ; },
abstract = {Haemophilia is an attractive disease target for gene therapy that fostered the development of the field at large. The delivery of the clotting factor genes into the patients' cells could be accomplished using different types of gene delivery vehicles or vectors. Adeno-associated viral vectors (AAV) and lentiviral vectors represent some of the most promising gene delivery technologies that allow for a relatively efficient delivery of the therapeutic FVIII and FIX transgenes into the relevant target cells. To reduce the risks associated with insertional mutagenesis due to random vector integration, gene-editing approaches have also been considered based primarily on zinc finger nuclease (ZFN) and CRISPR/Cas. However, comprehensive analysis of off-target effects is still required. It is particularly encouraging that relatively stable therapeutic FVIII or FIX expression levels were reached in severe haemophilia patients in recent clinical trials after liver-directed AAV gene therapy. This success could be ascribed in part to improvements in vector design. In particular, clotting factor levels could be increased by codon optimization of coagulation factor transgenes. Alternatively, incorporation of a hyperactive gain-of-function R338L mutation (FIX Padua) in the FIX gene improved the overall efficacy. However, some patients still show transient liver toxicity, especially at high vector doses, possibly due to inflammatory immune responses, requiring the need for transient immunosuppression. The exact immune mechanisms are not fully understood, but may at least in some patients involve an AAV-capsid specific T cell response. Moreover, there is a need to identify the key factors that contribute to the interpatient variability in therapeutic efficacy and safety after gene therapy.},
}
@article {pmid29878242,
year = {2018},
author = {Dabrowska, M and Czubak, K and Juzwa, W and Krzyzosiak, WJ and Olejniczak, M and Kozlowski, P},
title = {qEva-CRISPR: a method for quantitative evaluation of CRISPR/Cas-mediated genome editing in target and off-target sites.},
journal = {Nucleic acids research},
volume = {46},
number = {17},
pages = {e101},
doi = {10.1093/nar/gky505},
pmid = {29878242},
issn = {1362-4962},
abstract = {Genome editing technology based on engineered nucleases has been increasingly applied for targeted modification of genes in a variety of cell types and organisms. However, the methods currently used for evaluating the editing efficiency still suffer from many limitations, including preferential detection of some mutation types, sensitivity to polymorphisms that hamper mismatch detection, lack of multiplex capability, or sensitivity to assay conditions. Here, we describe qEva-CRISPR, a new quantitative method that overcomes these limitations and allows simultaneous (multiplex) analysis of CRISPR/Cas9-induced modifications in a target and the corresponding off-targets or in several different targets. We demonstrate all of the advantages of the qEva-CRISPR method using a number of sgRNAs targeting the TP53, VEGFA, CCR5, EMX1 and HTT genes in different cell lines and under different experimental conditions. Unlike other methods, qEva-CRISPR detects all types of mutations, including point mutations and large deletions, and its sensitivity does not depend on the mutation type. Moreover, this approach allows for successful analysis of targets located in 'difficult' genomic regions. In conclusion, qEva-CRISPR may become a method of choice for unbiased sgRNA screening to evaluate experimental conditions that affect genome editing or to distinguish homology-directed repair from non-homologous end joining.},
}
@article {pmid29874214,
year = {2018},
author = {Smalley, E},
title = {As CRISPR-Cas adoption soars, summit calls for genome editing oversight.},
journal = {Nature biotechnology},
volume = {36},
number = {6},
pages = {485},
doi = {10.1038/nbt0618-485},
pmid = {29874214},
issn = {1546-1696},
}
@article {pmid29872009,
year = {2018},
author = {Chakraborty, S},
title = {Inconclusive studies on possible CRISPR-Cas off-targets should moderate expectations about enzymes that have evolved to be non-specific.},
journal = {Journal of biosciences},
volume = {43},
number = {2},
pages = {225-228},
pmid = {29872009},
issn = {0973-7138},
}
@article {pmid29870774,
year = {2018},
author = {Zhao, X and Liu, L and Lang, J and Cheng, K and Wang, Y and Li, X and Shi, J and Wang, Y and Nie, G},
title = {A CRISPR-Cas13a system for efficient and specific therapeutic targeting of mutant KRAS for pancreatic cancer treatment.},
journal = {Cancer letters},
volume = {431},
number = {},
pages = {171-181},
doi = {10.1016/j.canlet.2018.05.042},
pmid = {29870774},
issn = {1872-7980},
abstract = {Mutant KRAS is a known driver oncogene in pancreatic cancer. However, this protein remains an &quot;undruggable&quot; therapeutic target. Inhibiting mutated KRAS expression at the mRNA level is a potentially effective strategy. Recently, a novel CRISPR-Cas effector, Cas13a has been reported to specifically knock down mRNA expression under the guidance of a single CRISPR-RNA in mammalian cells. Here we demonstrate that the CRISPR-Cas13a system can be engineered for targeted therapy of mutant KRAS in pancreatic cancer. In initial screening, we show that the bacterial Cas13a protein and crRNA significantly knock down mutant KRAS mRNA expression, identifying a CRISPR-Cas13a system that can induce up to a 94% knockdown efficiency. Introducing a single mismatch into the crRNA-target duplex enabled the CRISPR-Cas13a system to specifically recognize KRAS-G12D mRNA with no detectable effects on wild-type KRAS mRNA. More importantly, CRISPR-Cas13a-mediated KRAS-G12D mRNA knockdown potently induced apoptosis in vitro and elicited marked tumor shrinkage in mice. Our work describes an optimization strategy for the development of a CRISPR-Cas13a system to affect efficient and specific knockdown of the oncogenic mRNA, establishing the CRISPR-Cas13a system as a flexible, targeted therapeutic tool.},
}
@article {pmid29867788,
year = {2018},
author = {Pratama, AA and Chaib De Mares, M and van Elsas, JD},
title = {Evolutionary History of Bacteriophages in the Genus Paraburkholderia.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {835},
doi = {10.3389/fmicb.2018.00835},
pmid = {29867788},
issn = {1664-302X},
abstract = {The genus Paraburkholderia encompasses mostly environmental isolates with diverse predicted lifestyles. Genome analyses have shown that bacteriophages form a considerable portion of some Paraburkholderia genomes. Here, we analyzed the evolutionary history of prophages across all Paraburkholderia spp. Specifically, we investigated to what extent the presence of prophages and their distribution affect the diversity/diversification of Paraburkholderia spp., as well as to what extent phages coevolved with their respective hosts. Particular attention was given to the presence of CRISPR-Cas arrays as a reflection of past interactions with phages. We thus analyzed 36 genomes of Paraburkholderia spp., including those of 11 new strains, next to those of three Burkholderia species. Most genomes were found to contain at least one full prophage sequence. The highest number was found in Paraburkholderia sp. strain MF2-27; the nine prophages found amount to up to 4% of its genome. Among all prophages, potential moron genes (e.g., DNA adenine methylase) were found that might be advantageous for host cell fitness. Co-phylogenetic analyses indicated the existence of complex evolutionary scenarios between the different Paraburkholderia hosts and their prophages, including short-term co-speciation, duplication, host-switching and phage loss events. Analysis of the CRISPR-Cas systems showed a record of diverse, potentially recent, phage infections. We conclude that, overall, different phages have interacted in diverse ways with their Paraburkholderia hosts over evolutionary time.},
}
@article {pmid29862665,
year = {2018},
author = {Arazoe, T and Kondo, A and Nishida, K},
title = {Targeted Nucleotide Editing Technologies for Microbial Metabolic Engineering.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700596},
doi = {10.1002/biot.201700596},
pmid = {29862665},
issn = {1860-7314},
support = {//New Energy and Industrial Technology Development Organization (NEDO)/ ; //Ministry of Education, Culture, Sports, Science and Technology (MEXT)/ ; 26119710//Japan Society for the Promotion of Science (JSPS)/ ; 16K14654//Japan Society for the Promotion of Science (JSPS)/ ; 17H05021//Japan Society for the Promotion of Science (JSPS)/ ; },
abstract = {Since the emergence of programmable RNA-guided nucleases based on clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) systems, genome editing technologies have become a simplified and versatile tool for genome editing in various organisms and cell types. Although genome editing enables efficient genome manipulations, such as gene disruptions, gene knockins, and chromosomal translocations via DNA double-strand break (DSB) repair in eukaryotes, DSBs induced by the CRISPR/Cas system are lethal or severely toxic to many microorganisms. Therefore, in many prokaryotes, including industrially useful microbes, the CRISPR/Cas system is often used as a negative selection component in combination with recombineering or other related strategies. Novel and revolutionary technologies have been recently developed to re-write targeted nucleotides (C:G to T:A and A:T to G:C) without DSBs and donor DNA templates. These technologies rely on the recruitment of deaminases at specific target loci using the nuclease-deficient CRISPR/Cas system. Here, the authors review and compare CRISPR-based genome editing, current base editing platforms and their spectra. The authors discuss how these technologies can be applied in various aspects of microbial metabolic engineering to overcome barriers to cellular regulation in prokaryotes.},
}
@article {pmid29858075,
year = {2018},
author = {Yanik, M and Ponnam, SPG and Wimmer, T and Trimborn, L and Müller, C and Gambert, I and Ginsberg, J and Janise, A and Domicke, J and Wende, W and Lorenz, B and Stieger, K},
title = {Development of a Reporter System to Explore MMEJ in the Context of Replacing Large Genomic Fragments.},
journal = {Molecular therapy. Nucleic acids},
volume = {11},
number = {},
pages = {407-415},
doi = {10.1016/j.omtn.2018.03.010},
pmid = {29858075},
issn = {2162-2531},
abstract = {Common genome-editing strategies are either based on non-homologous end joining (NHEJ) or, in the presence of a template DNA, based on homologous recombination with long (homology-directed repair [HDR]) or short (microhomology-mediated end joining [MMEJ]) homologous sequences. In the current study, we aim to develop a model system to test the activity of MMEJ after CRISPR/Cas9-mediated cleavage in cell culture. Following successful proof of concept in an episomally based reporter system, we tested template plasmids containing a promoter-less luciferase gene flanked by microhomologous sequences (mhs) of different length (5, 10, 15, 20, 30, and 50 bp) that are complementary to the mouse retinitis pigmentosa GTPase regulator (RPGR)-ORF15, which is under the control of a CMV promoter stably integrated into a HEK293 cell line. Luciferase signal appearance represented successful recombination events and was highest when the mhs were 5 bp long, while longer mhs revealed lower luciferase signal. In addition, presence of Csy4 RNase was shown to increase luciferase signaling. The luciferase reporter system is a valuable tool to study the input of the different DNA repair mechanisms in the replacement of large DNA sequences by mhs.},
}
@article {pmid29857590,
year = {2018},
author = {Angermeyer, A and Das, MM and Singh, DV and Seed, KD},
title = {Analysis of 19 Highly Conserved Vibrio cholerae Bacteriophages Isolated from Environmental and Patient Sources Over a Twelve-Year Period.},
journal = {Viruses},
volume = {10},
number = {6},
pages = {},
doi = {10.3390/v10060299},
pmid = {29857590},
issn = {1999-4915},
support = {R01 AI127652/AI/NIAID NIH HHS/United States ; },
abstract = {The Vibrio cholerae biotype &quot;El Tor&quot; is responsible for all of the current epidemic and endemic cholera outbreaks worldwide. These outbreaks are clonal, and it is hypothesized that they originate from the coastal areas near the Bay of Bengal, where the lytic bacteriophage ICP1 (International Centre for Diarrhoeal Disease Research, Bangladesh cholera phage 1) specifically preys upon these pathogenic outbreak strains. ICP1 has also been the dominant bacteriophage found in cholera patient stools since 2001. However, little is known about the genomic differences between the ICP1 strains that have been collected over time. Here, we elucidate the pan-genome and the phylogeny of the ICP1 strains by aligning, annotating, and analyzing the genomes of 19 distinct isolates that were collected between 2001 and 2012. Our results reveal that the ICP1 isolates are highly conserved and possess a large core-genome as well as a smaller, somewhat flexible accessory-genome. Despite its overall conservation, ICP1 strains have managed to acquire a number of unknown genes, as well as a CRISPR-Cas system which is known to be critical for its ongoing struggle for co-evolutionary dominance over its host. This study describes a foundation on which to construct future molecular and bioinformatic studies of these V. cholerae-associated bacteriophages.},
}
@article {pmid29857168,
year = {2018},
author = {Mefferd, AL and Bogerd, HP and Irwan, ID and Cullen, BR},
title = {Insights into the mechanisms underlying the inactivation of HIV-1 proviruses by CRISPR/Cas.},
journal = {Virology},
volume = {520},
number = {},
pages = {116-126},
doi = {10.1016/j.virol.2018.05.016},
pmid = {29857168},
issn = {1096-0341},
support = {R01 AI117780/AI/NIAID NIH HHS/United States ; T32 CA009111/CA/NCI NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; *HIV Long Terminal Repeat ; HIV-1/*genetics/physiology ; Humans ; Mutation ; Proviruses/*genetics/physiology ; RNA, Guide/genetics ; Transcriptional Activation ; *Virus Inactivation ; Virus Integration/genetics ; tat Gene Products, Human Immunodeficiency Virus/genetics/metabolism ; },
abstract = {DNA editing using CRISPR/Cas has emerged as a potential treatment for diseases caused by pathogenic human DNA viruses. One potential target is HIV-1, which replicates via a chromosomally integrated DNA provirus. While CRISPR/Cas can protect T cells from de novo HIV-1 infection, HIV-1 frequently becomes resistant due to mutations in the chosen single guide RNA (sgRNA) target site. To address this problem, we asked whether an sgRNA targeted to a conserved, functionally critical HIV-1 sequence might prevent the selection of escape mutants. We report that two sgRNAs specific for the HIV-1 transactivation response (TAR) element produce opposite results: the TAR2 sgRNA rapidly selects for mutants that retain TAR function, but are no longer inhibited by Cas9, while the TAR1 sgRNA fails to select any replication competent TAR mutants, most probably because it is targeted to a region of TAR that is disrupted by even minor mutations.},
}
@article {pmid29856367,
year = {2018},
author = {DiCarlo, JE and Mahajan, VB and Tsang, SH},
title = {Gene therapy and genome surgery in the retina.},
journal = {The Journal of clinical investigation},
volume = {128},
number = {6},
pages = {2177-2188},
doi = {10.1172/JCI120429},
pmid = {29856367},
issn = {1558-8238},
support = {R21 AG050437/AG/NIA NIH HHS/United States ; R01 EY018213/EY/NEI NIH HHS/United States ; P30 EY026877/EY/NEI NIH HHS/United States ; R01 EY024665/EY/NEI NIH HHS/United States ; R01 EY026682/EY/NEI NIH HHS/United States ; R01 EY024698/EY/NEI NIH HHS/United States ; P30 EY019007/EY/NEI NIH HHS/United States ; R01 EY025225/EY/NEI NIH HHS/United States ; P30 CA013696/CA/NCI NIH HHS/United States ; },
abstract = {Precision medicine seeks to treat disease with molecular specificity. Advances in genome sequence analysis, gene delivery, and genome surgery have allowed clinician-scientists to treat genetic conditions at the level of their pathology. As a result, progress in treating retinal disease using genetic tools has advanced tremendously over the past several decades. Breakthroughs in gene delivery vectors, both viral and nonviral, have allowed the delivery of genetic payloads in preclinical models of retinal disorders and have paved the way for numerous successful clinical trials. Moreover, the adaptation of CRISPR-Cas systems for genome engineering have enabled the correction of both recessive and dominant pathogenic alleles, expanding the disease-modifying power of gene therapies. Here, we highlight the translational progress of gene therapy and genome editing of several retinal disorders, including RPE65-, CEP290-, and GUY2D-associated Leber congenital amaurosis, as well as choroideremia, achromatopsia, Mer tyrosine kinase- (MERTK-) and RPGR X-linked retinitis pigmentosa, Usher syndrome, neovascular age-related macular degeneration, X-linked retinoschisis, Stargardt disease, and Leber hereditary optic neuropathy.},
}
@article {pmid29850463,
year = {2018},
author = {García-Martínez, J and Maldonado, RD and Guzmán, NM and Mojica, FJM},
title = {The CRISPR conundrum: evolve and maybe die, or survive and risk stagnation.},
journal = {Microbial cell (Graz, Austria)},
volume = {5},
number = {6},
pages = {262-268},
doi = {10.15698/mic2018.06.634},
pmid = {29850463},
issn = {2311-2638},
abstract = {CRISPR-Cas represents a prokaryotic defense mechanism against invading genetic elements. Although there is a diversity of CRISPR-Cas systems, they all share similar, essential traits. In general, a CRISPR-Cas system consists of one or more groups of DNA repeats named CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), regularly separated by unique sequences referred to as spacers, and a set of functionally associated cas (CRISPR associated) genes typically located next to one of the repeat arrays. The origin of spacers is in many cases unknown but, when ascertained, they usually match foreign genetic molecules. The proteins encoded by some of the cas genes are in charge of the incorporation of new spacers upon entry of a genetic element. Other Cas proteins participate in generating CRISPR-spacer RNAs and perform the task of destroying nucleic acid molecules carrying sequences similar to the spacer. In this way, CRISPR-Cas provides protection against genetic intruders that could substantially affect the cell viability, thus acting as an adaptive immune system. However, this defensive action also hampers the acquisition of potentially beneficial, horizontally transferred genes, undermining evolution. Here we cover how the model bacterium Escherichia coli deals with CRISPR-Cas to tackle this major dilemma, evolution versus survival.},
}
@article {pmid29849821,
year = {2018},
author = {Huang, LC and Tam, KW and Liu, WN and Lin, CY and Hsu, KW and Hsieh, WS and Chi, WM and Lee, AW and Yang, JM and Lin, CL and Lee, CH},
title = {CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer.},
journal = {Disease markers},
volume = {2018},
number = {},
pages = {3835783},
doi = {10.1155/2018/3835783},
pmid = {29849821},
issn = {1875-8630},
mesh = {Antineoplastic Agents/pharmacology ; *CRISPR-Cas Systems ; Cell Cycle/drug effects ; Cell Death/drug effects ; Cell Line, Tumor ; Gene Editing/*methods ; Humans ; Protein Kinase Inhibitors/pharmacology ; Quinazolines/pharmacology ; Receptor, Epidermal Growth Factor/*genetics ; Thyroid Carcinoma, Anaplastic/*genetics ; Thyroid Neoplasms/*genetics ; },
abstract = {Anaplastic carcinoma of the thyroid (ATC), also called undifferentiated thyroid cancer, is the least common but most aggressive and deadly thyroid gland malignancy of all thyroid cancers. The aim of this study is to explore essential biomarker and use CRISPR/Cas9 with lentivirus delivery to establish a gene-target therapeutic platform in ATC cells. At the beginning, the gene expression datasets from 1036 cancers from CCLE and 8215 tumors from TCGA were collected and analyzed, showing EGFR is predominantly overexpressed in thyroid cancers than other type of cancers (P = 0.017 in CCLE and P = 0.001 in TCGA). Using CRISPR/Cas9 genomic edit system, ATC cells with EGFR sgRNA lentivirus transfection obtained great disruptions on gene and protein expression, resulting in cell cycle arrest, cell growth inhibition, and most importantly metastasis turn-off ability. In addition, the FDA-approved TKI of afatinib for EGFR targeting also illustrates great anticancer activity on cancer cell death occurrence, cell growth inhibition, and cell cycle arrest in SW579 cells, an EGFR expressing human ATC cell line. Furthermore, off-target effect of using EGFR sgRNAs was measured and found no genomic editing can be detected in off-target candidate gene. To conclude, this study provides potential ATC therapeutic strategies for current and future clinical needs, which may be possible in increasing the survival rate of ATC patients by translational medicine.},
}
@article {pmid29848550,
year = {2018},
author = {Laursen, KB and Gudas, LJ},
title = {Combinatorial knockout of RARα, RARβ, and RARγ completely abrogates transcriptional responses to retinoic acid in murine embryonic stem cells.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {30},
pages = {11891-11900},
doi = {10.1074/jbc.RA118.001951},
pmid = {29848550},
issn = {1083-351X},
support = {R01 CA043796/CA/NCI NIH HHS/United States ; R01 DE010389/DE/NIDCR NIH HHS/United States ; },
abstract = {All-trans-retinoic acid (RA), a potent inducer of cellular differentiation, functions as a ligand for retinoic acid receptors (RARα, β, and γ). RARs are activated by ligand binding, which induces transcription of direct genomic targets. However, whether embryonic stem cells respond to RA through routes that do not involve RARs is unknown. Here, we used CRISPR technology to introduce biallelic frameshift mutations in RARα, RARβ, and RARγ, thereby abrogating all RAR functions in murine embryonic stem cells. We then evaluated RA-responsiveness of the RAR-null cells using RNA-Seq transcriptome analysis. We found that the RAR-null cells display no changes in transcripts in response to RA, demonstrating that the RARs are essential for the regulation of all transcripts in murine embryonic stem cells in response to RA. Our key finding, that in embryonic stem cells the transcriptional effects of RA all depend on RARs, addresses a long-standing topic of discussion in the field of retinoic acid signaling.},
}
@article {pmid29844281,
year = {2018},
author = {Wang, X and Zheng, P and Ma, T and Song, T},
title = {Small Universal Bacteria and Plasmid Computing Systems.},
journal = {Molecules (Basel, Switzerland)},
volume = {23},
number = {6},
pages = {},
doi = {10.3390/molecules23061307},
pmid = {29844281},
issn = {1420-3049},
mesh = {Adenosine Triphosphate/metabolism ; *Algorithms ; Bacteria/*chemistry/genetics/metabolism ; CRISPR-Cas Systems ; Cell Engineering/methods/*statistics &amp; numerical data ; Conjugation, Genetic ; Endonucleases/genetics/metabolism ; Gene Editing ; *Genome, Bacterial ; *Mathematical Computing ; Plasmids/*chemistry/metabolism ; RNA, Guide/genetics/metabolism ; },
abstract = {Bacterial computing is a known candidate in natural computing, the aim being to construct &quot;bacterial computers&quot; for solving complex problems. In this paper, a new kind of bacterial computing system, named the bacteria and plasmid computing system (BP system), is proposed. We investigate the computational power of BP systems with finite numbers of bacteria and plasmids. Specifically, it is obtained in a constructive way that a BP system with 2 bacteria and 34 plasmids is Turing universal. The results provide a theoretical cornerstone to construct powerful bacterial computers and demonstrate a concept of paradigms using a &quot;reasonable&quot; number of bacteria and plasmids for such devices.},
}
@article {pmid29844184,
year = {2018},
author = {KaramiNejadRanjbar, M and Eckermann, KN and Ahmed, HMM and Sánchez C, HM and Dippel, S and Marshall, JM and Wimmer, EA},
title = {Consequences of resistance evolution in a Cas9-based sex conversion-suppression gene drive for insect pest management.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {24},
pages = {6189-6194},
doi = {10.1073/pnas.1713825115},
pmid = {29844184},
issn = {1091-6490},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Ceratitis capitata/genetics ; Drosophila melanogaster/genetics ; *Evolution, Molecular ; Female ; Gene Editing ; Genes, Insect/*genetics ; Male ; Models, Genetic ; Pest Control, Biological/*methods ; Sex Determination Processes/*genetics ; },
abstract = {The use of a site-specific homing-based gene drive for insect pest control has long been discussed, but the easy design of such systems has become possible only with the recent establishment of CRISPR/Cas9 technology. In this respect, novel targets for insect pest management are provided by new discoveries regarding sex determination. Here, we present a model for a suppression gene drive designed to cause an all-male population collapse in an agricultural pest insect. To evaluate the molecular details of such a sex conversion-based suppression gene drive experimentally, we implemented this strategy in Drosophila melanogaster to serve as a safe model organism. We generated a Cas9-based homing gene-drive element targeting the transformer gene and showed its high efficiency for sex conversion from females to males. However, nonhomologous end joining increased the rate of mutagenesis at the target site, which resulted in the emergence of drive-resistant alleles and therefore curbed the gene drive. This confirms previous studies that simple homing CRISPR/Cas9 gene-drive designs will be ineffective. Nevertheless, by performing population dynamics simulations using the parameters we obtained in D. melanogaster and by adjusting the model for the agricultural pest Ceratitis capitata, we were able to identify adequate modifications that could be successfully applied for the management of wild Mediterranean fruit fly populations using our proposed sex conversion-based suppression gene-drive strategy.},
}
@article {pmid29844158,
year = {2018},
author = {Callender, JA and Yang, Y and Lordén, G and Stephenson, NL and Jones, AC and Brognard, J and Newton, AC},
title = {Protein kinase Cα gain-of-function variant in Alzheimer's disease displays enhanced catalysis by a mechanism that evades down-regulation.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {24},
pages = {E5497-E5505},
doi = {10.1073/pnas.1805046115},
pmid = {29844158},
issn = {1091-6490},
support = {R01 GM043154/GM/NIGMS NIH HHS/United States ; R35 GM122523/GM/NIGMS NIH HHS/United States ; R37 GM043154/GM/NIGMS NIH HHS/United States ; T32 GM007752/GM/NIGMS NIH HHS/United States ; //Cancer Research UK/United Kingdom ; },
mesh = {Alzheimer Disease/*genetics/metabolism ; Animals ; Brain/metabolism ; COS Cells ; CRISPR-Cas Systems/genetics ; Calcium/metabolism ; Catalysis ; Catalytic Domain/genetics ; Cell Line ; Cercopithecus aethiops ; Down-Regulation/*genetics ; Enzyme Activation/genetics ; Gain of Function Mutation/*genetics ; Humans ; Mice ; Mice, Inbred C57BL ; Mutation/genetics ; Phosphorylation/genetics ; Protein Kinase C-alpha/*genetics ; Signal Transduction/genetics ; },
abstract = {Conventional protein kinase C (PKC) family members are reversibly activated by binding to the second messengers Ca2+ and diacylglycerol, events that break autoinhibitory constraints to allow the enzyme to adopt an active, but degradation-sensitive, conformation. Perturbing these autoinhibitory constraints, resulting in protein destabilization, is one of many mechanisms by which PKC function is lost in cancer. Here, we address how a gain-of-function germline mutation in PKCα in Alzheimer's disease (AD) enhances signaling without increasing vulnerability to down-regulation. Biochemical analyses of purified protein demonstrate that this mutation results in an ∼30% increase in the catalytic rate of the activated enzyme, with no changes in the concentrations of Ca2+ or lipid required for half-maximal activation. Molecular dynamics simulations reveal that this mutation has both localized and allosteric effects, most notably decreasing the dynamics of the C-helix, a key determinant in the catalytic turnover of kinases. Consistent with this mutation not altering autoinhibitory constraints, live-cell imaging studies reveal that the basal signaling output of PKCα-M489V is unchanged. However, the mutant enzyme in cells displays increased sensitivity to an inhibitor that is ineffective toward scaffolded PKC, suggesting the altered dynamics of the kinase domain may influence protein interactions. Finally, we show that phosphorylation of a key PKC substrate, myristoylated alanine-rich C-kinase substrate, is increased in brains of CRISPR-Cas9 genome-edited mice containing the PKCα-M489V mutation. Our results unveil how an AD-associated mutation in PKCα permits enhanced agonist-dependent signaling via a mechanism that evades the cell's homeostatic down-regulation of constitutively active PKCα.},
}
@article {pmid29843790,
year = {2018},
author = {Wang, Y and Liu, KI and Sutrisnoh, NB and Srinivasan, H and Zhang, J and Li, J and Zhang, F and Lalith, CRJ and Xing, H and Shanmugam, R and Foo, JN and Yeo, HT and Ooi, KH and Bleckwehl, T and Par, YYR and Lee, SM and Ismail, NNB and Sanwari, NAB and Lee, STV and Lew, J and Tan, MH},
title = {Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {62},
doi = {10.1186/s13059-018-1445-x},
pmid = {29843790},
issn = {1474-760X},
support = {NRF2013-THE001-046//National Research Foundation Singapore/International ; NRF2013-THE001-093//National Research Foundation Singapore/International ; OFIRG/0017/2016//National Medical Research Council/International ; 1431AFG103//Agency for Science, Technology and Research/International ; RG50/17 (S)//Ministry of Education Singapore/International ; },
mesh = {*CRISPR-Cas Systems ; DNA End-Joining Repair ; DNA Repair ; DNA, Single-Stranded/metabolism ; *Gene Editing ; Humans ; Oligodeoxyribonucleotides ; Plasmids/genetics ; },
abstract = {BACKGROUND: While CRISPR-Cas systems hold tremendous potential for engineering the human genome, it is unclear how well each system performs against one another in both non-homologous end joining (NHEJ)-mediated and homology-directed repair (HDR)-mediated genome editing.<br><br>RESULTS: We systematically compare five different CRISPR-Cas systems in human cells by targeting 90 sites in genes with varying expression levels. For a fair comparison, we select sites that are either perfectly matched or have overlapping seed regions for Cas9 and Cpf1. Besides observing a trade-off between cleavage efficiency and target specificity for these natural endonucleases, we find that the editing activities of the smaller Cas9 enzymes from Staphylococcus aureus (SaCas9) and Neisseria meningitidis (NmCas9) are less affected by gene expression than the other larger Cas proteins. Notably, the Cpf1 nucleases from Acidaminococcus sp. BV3L6 and Lachnospiraceae bacterium ND2006 (AsCpf1 and LbCpf1, respectively) are able to perform precise gene targeting efficiently across multiple genomic loci using single-stranded oligodeoxynucleotide (ssODN) donor templates with homology arms as short as 17 nucleotides. Strikingly, the two Cpf1 nucleases exhibit a preference for ssODNs of the non-target strand sequence, while the popular Cas9 enzyme from Streptococcus pyogenes (SpCas9) exhibits a preference for ssODNs of the target strand sequence instead. Additionally, we find that the HDR efficiencies of Cpf1 and SpCas9 can be further improved by using asymmetric donors with longer arms 5' of the desired DNA changes.<br><br>CONCLUSIONS: Our work delineates design parameters for each CRISPR-Cas system and will serve as a useful reference for future genome engineering studies.},
}
@article {pmid29804829,
year = {2018},
author = {Brinkman, EK and Chen, T and de Haas, M and Holland, HA and Akhtar, W and van Steensel, B},
title = {Kinetics and Fidelity of the Repair of Cas9-Induced Double-Strand DNA Breaks.},
journal = {Molecular cell},
volume = {70},
number = {5},
pages = {801-813.e6},
doi = {10.1016/j.molcel.2018.04.016},
pmid = {29804829},
issn = {1097-4164},
abstract = {The RNA-guided DNA endonuclease Cas9 is a powerful tool for genome editing. Little is known about the kinetics and fidelity of the double-strand break (DSB) repair process that follows a Cas9 cutting event in living cells. Here, we developed a strategy to measure the kinetics of DSB repair for single loci in human cells. Quantitative modeling of repaired DNA in time series after Cas9 activation reveals variable and often slow repair rates, with half-life times up to ∼10 hr. Furthermore, repair of the DSBs tends to be error prone. Both classical and microhomology-mediated end joining pathways contribute to the erroneous repair. Estimation of their individual rate constants indicates that the balance between these two pathways changes over time and can be altered by additional ionizing radiation. Our approach provides quantitative insights into DSB repair kinetics and fidelity in single loci and indicates that Cas9-induced DSBs are repaired in an unusual manner.},
}
@article {pmid29802575,
year = {2018},
author = {O'Brien, CA and Morello, R},
title = {Modeling Rare Bone Diseases in Animals.},
journal = {Current osteoporosis reports},
volume = {16},
number = {4},
pages = {458-465},
doi = {10.1007/s11914-018-0452-x},
pmid = {29802575},
issn = {1544-2241},
support = {I01 BX000294/BX/BLRD VA/United States ; P20 GM125503/GM/NIGMS NIH HHS/United States ; R01 AR049794/AR/NIAMS NIH HHS/United States ; R01 AR060823/AR/NIAMS NIH HHS/United States ; },
abstract = {PURPOSE OF REVIEW: The goal of this review is to highlight some of the considerations involved in creating animal models to study rare bone diseases and then to compare and contrast approaches to creating such models, focusing on the advantages and novel opportunities offered by the CRISPR-Cas system.<br><br>RECENT FINDINGS: Gene editing after creation of double-stranded breaks in chromosomal DNA is increasingly being used to modify animal genomes. Multiple tools can be used to create such breaks, with the newest ones being based on the bacterial adaptive immune system known as CRISPR/Cas. Advances in gene editing have increased the ease and speed, while reducing the cost, of creating novel animal models of disease. Gene editing has also expanded the number of animal species in which genetic modification can be performed. These changes have significantly increased the options for investigators seeking to model rare bone diseases in animals.},
}
@article {pmid29802201,
year = {2018},
author = {Plouffe, SW and Lin, KC and Moore, JL and Tan, FE and Ma, S and Ye, Z and Qiu, Y and Ren, B and Guan, KL},
title = {The Hippo pathway effector proteins YAP and TAZ have both distinct and overlapping functions in the cell.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {28},
pages = {11230-11240},
doi = {10.1074/jbc.RA118.002715},
pmid = {29802201},
issn = {1083-351X},
support = {R01 DE015964/DE/NIDCR NIH HHS/United States ; R01 GM051586/GM/NIGMS NIH HHS/United States ; R35 CA196878/CA/NCI NIH HHS/United States ; },
abstract = {The Hippo pathway plays an important role in regulating tissue homeostasis, and its effectors, the transcriptional co-activators Yes-associated protein (YAP) and WW domain-containing transcription regulator 1 (WWTR1 or TAZ), are responsible for mediating the vast majority of its physiological functions. Although YAP and TAZ are thought to be largely redundant and similarly regulated by Hippo signaling, they have developmental, structural, and physiological differences that suggest they may differ in their regulation and downstream functions. To better understand the functions of YAP and TAZ in the Hippo pathway, using CRISPR/Cas9, we generated YAP KO, TAZ KO, and YAP/TAZ KO cell lines in HEK293A cells. We evaluated them in response to many environmental conditions and stimuli and used RNA-Seq to compare their transcriptional profiles. We found that YAP inactivation has a greater effect on cellular physiology (namely, cell spreading, volume, granularity, glucose uptake, proliferation, and migration) than TAZ inactivation. However, functional redundancy between YAP and TAZ was also observed. In summary, our findings confirm that the Hippo pathway effectors YAP and TAZ are master regulators for multiple cellular processes but also reveal that YAP has a stronger influence than TAZ.},
}
@article {pmid29797148,
year = {2018},
author = {Li, ZH and Liu, M and Wang, FQ and Wei, DZ},
title = {Cpf1-assisted efficient genomic integration of in vivo assembled DNA parts in Saccharomyces cerevisiae.},
journal = {Biotechnology letters},
volume = {40},
number = {8},
pages = {1253-1261},
doi = {10.1007/s10529-018-2574-8},
pmid = {29797148},
issn = {1573-6776},
support = {31500043//National Natural Science Foundation of China/ ; },
mesh = {Bacterial Proteins/genetics/*metabolism ; CRISPR-Cas Systems ; DNA, Fungal/genetics/*metabolism ; Francisella/enzymology/genetics ; Gene Editing ; Metabolic Engineering/*methods ; Saccharomyces cerevisiae/*genetics/*metabolism ; },
abstract = {OBJECTIVES: To test the applicability of Cpf1 from Francisella novivida in genomic integration of in vivo assembled DNA parts in Saccharomyces cerevisiae.<br><br>RESULTS: An easy-to-use vector toolkit, containing a CEN6/ARS4 plasmid expressing Cpf1 from Francisella novivida (FnCpf1) and a 2 μ plasmid for crRNA or crRNA array expressing, was constructed for Cpf1-assisted genomic integration in S. cerevisiae. Our results showed that FnCpf1 allowed for targeted singleplex, doubleplex, and tripleplex genomic integration of in vivo assembled DNA parts with efficiencies of 95, 52, and 43%, respectively.<br><br>CONCLUSIONS: CRISPR-Cpf1 system allows for efficient genomic integration of in vivo assembled DNA parts in S. cerevisiae, and thus provides an alternative CRISPR-Cas method for metabolic pathway engineering in addition to CRISPR-Cas9 system previously reported for yeast.},
}
@article {pmid29790280,
year = {2018},
author = {Swarts, DC and Jinek, M},
title = {Cas9 versus Cas12a/Cpf1: Structure-function comparisons and implications for genome editing.},
journal = {Wiley interdisciplinary reviews. RNA},
volume = {},
number = {},
pages = {e1481},
doi = {10.1002/wrna.1481},
pmid = {29790280},
issn = {1757-7012},
abstract = {Cas9 and Cas12a are multidomain CRISPR-associated nucleases that can be programmed with a guide RNA to bind and cleave complementary DNA targets. The guide RNA sequence can be varied, making these effector enzymes versatile tools for genome editing and gene regulation applications. While Cas9 is currently the best-characterized and most widely used nuclease for such purposes, Cas12a (previously named Cpf1) has recently emerged as an alternative for Cas9. Cas9 and Cas12a have distinct evolutionary origins and exhibit different structural architectures, resulting in distinct molecular mechanisms. Here we compare the structural and mechanistic features that distinguish Cas9 and Cas12a, and describe how these features modulate their activity. We discuss implications for genome editing, and how they may influence the choice of Cas9 or Cas12a for specific applications. Finally, we review recent studies in which Cas12a has been utilized as a genome editing tool. This article is categorized under: RNA Interactions with Proteins and Other Molecules > Protein-RNA Interactions: Functional Implications Regulatory RNAs/RNAi/Riboswitches > Biogenesis of Effector Small RNAs RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes.},
}
@article {pmid29789882,
year = {2018},
author = {Zhao, M and Wang, J and Luo, M and Luo, H and Zhao, M and Han, L and Zhang, M and Yang, H and Xie, Y and Jiang, H and Feng, L and Lu, H and Zhu, J},
title = {Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.},
journal = {Applied microbiology and biotechnology},
volume = {102},
number = {14},
pages = {6105-6117},
doi = {10.1007/s00253-018-9021-6},
pmid = {29789882},
issn = {1432-0614},
support = {No. 81273576//National Natural Science Foundation of China/ ; No. 81773621//National Natural Science Foundation of China/ ; 15431907000//Science and Technology Commission of Shanghai Municipality/ ; No. 17431904500//Science and Technology Commission of Shanghai Municipality/ ; },
mesh = {Animals ; CHO Cells ; *CRISPR-Cas Systems ; *Cell Line ; Cricetinae ; Cricetulus ; Recombinant Proteins/genetics ; Transgenes/genetics ; },
abstract = {Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.},
}
@article {pmid29787711,
year = {2018},
author = {Yao, X and Zhang, M and Wang, X and Ying, W and Hu, X and Dai, P and Meng, F and Shi, L and Sun, Y and Yao, N and Zhong, W and Li, Y and Wu, K and Li, W and Chen, ZJ and Yang, H},
title = {Tild-CRISPR Allows for Efficient and Precise Gene Knockin in Mouse and Human Cells.},
journal = {Developmental cell},
volume = {45},
number = {4},
pages = {526-536.e5},
doi = {10.1016/j.devcel.2018.04.021},
pmid = {29787711},
issn = {1878-1551},
mesh = {Animals ; *CRISPR-Cas Systems ; Cells, Cultured ; DNA/*administration &amp; dosage ; Electroporation ; Embryo, Mammalian/cytology/*metabolism ; Embryonic Stem Cells/cytology/*metabolism ; Female ; Fertilization in Vitro ; Gene Knock-In Techniques/*methods ; Homologous Recombination ; Humans ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Inbred DBA ; Mice, Inbred ICR ; RNA, Guide/*administration &amp; dosage ; Zygote/growth &amp; development/metabolism ; },
abstract = {The targeting efficiency of knockin sequences via homologous recombination (HR) is generally low. Here we describe a method we call Tild-CRISPR (targeted integration with linearized dsDNA-CRISPR), a targeting strategy in which a PCR-amplified or precisely enzyme-cut transgene donor with 800-bp homology arms is injected with Cas9 mRNA and single guide RNA into mouse zygotes. Compared with existing targeting strategies, this method achieved much higher knockin efficiency in mouse embryos, as well as brain tissue. Importantly, the Tild-CRISPR method also yielded up to 12-fold higher knockin efficiency than HR-based methods in human embryos, making it suitable for studying gene functions in vivo and developing potential gene therapies.},
}
@article {pmid29785946,
year = {2018},
author = {Liang, CJ and Meng, FM and Ai, YC},
title = {[CRISPR/Cas systems in genome engineering of bacteriophages].},
journal = {Yi chuan = Hereditas},
volume = {40},
number = {5},
pages = {378-389},
doi = {10.16288/j.yczz.17-419},
pmid = {29785946},
issn = {0253-9772},
abstract = {Researches on CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) systems, that are adaptive immunity systems encoded by prokaryotes, have promoted the development of new genome-editing tools. Bacteriophages are not only the driving elements for the evolution of prokaryotes' CRISPR arrays, but also the targets of the CRISPR/Cas systems. Studies on functional genomics of bacteriophages have been lagging behind the discovery of new phage strains and the sequencing of their genomes. CRISPR/Cas systems-driven genome engineering of bacteriophages provides a novel approach for bacteriophage functional genomics. This review comments on a few profound cases of genome engineering of bacteriophages that employed the CRISPR/Cas systems, and compares multiple procedures illustrating common or distinct features as well as advantages and disadvantages underlying each procedure. We design new applications of the CRISPR/Cas systems coupled with bacteriophage recombination systems, discuss their potential constraints, and offer suggestions for each option.},
}
@article {pmid29784811,
year = {2018},
author = {Shmakov, SA and Makarova, KS and Wolf, YI and Severinov, KV and Koonin, EV},
title = {Systematic prediction of genes functionally linked to CRISPR-Cas systems by gene neighborhood analysis.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {23},
pages = {E5307-E5316},
doi = {10.1073/pnas.1803440115},
pmid = {29784811},
issn = {1091-6490},
mesh = {Archaea/genetics ; Bacteria/genetics ; Base Sequence ; CRISPR-Associated Proteins/genetics ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Computer Simulation ; Evolution, Molecular ; Genes, Bacterial ; Genetic Testing ; Genome, Archaeal ; Genome, Bacterial ; Phylogeny ; },
abstract = {The CRISPR-Cas systems of bacterial and archaeal adaptive immunity consist of direct repeat arrays separated by unique spacers and multiple CRISPR-associated (cas) genes encoding proteins that mediate all stages of the CRISPR response. In addition to the relatively small set of core cas genes that are typically present in all CRISPR-Cas systems of a given (sub)type and are essential for the defense function, numerous genes occur in CRISPR-cas loci only sporadically. Some of these have been shown to perform various ancillary roles in CRISPR response, but the functional relevance of most remains unknown. We developed a computational strategy for systematically detecting genes that are likely to be functionally linked to CRISPR-Cas. The approach is based on a &quot;CRISPRicity&quot; metric that measures the strength of CRISPR association for all protein-coding genes from sequenced bacterial and archaeal genomes. Uncharacterized genes with CRISPRicity values comparable to those of cas genes are considered candidate CRISPR-linked genes. We describe additional criteria to predict functionally relevance for genes in the candidate set and identify 79 genes as strong candidates for functional association with CRISPR-Cas systems. A substantial majority of these CRISPR-linked genes reside in type III CRISPR-cas loci, which implies exceptional functional versatility of type III systems. Numerous candidate CRISPR-linked genes encode integral membrane proteins suggestive of tight membrane association of CRISPR-Cas systems, whereas many others encode proteins implicated in various signal transduction pathways. These predictions provide ample material for improving annotation of CRISPR-cas loci and experimental characterization of previously unsuspected aspects of CRISPR-Cas system functionality.},
}
@article {pmid29784672,
year = {2018},
author = {Wang, H and Zhang, W and Yu, J and Wu, C and Gao, Q and Li, X and Li, Y and Zhang, J and Tian, Y and Tan, T and Ji, W and Li, L and Yu, Y and Shuai, L},
title = {Genetic screening and multipotency in rhesus monkey haploid neural progenitor cells.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {11},
pages = {},
doi = {10.1242/dev.160531},
pmid = {29784672},
issn = {1477-9129},
mesh = {Aniline Compounds/pharmacology ; Animals ; CRISPR-Cas Systems ; DNA Transposable Elements/genetics ; Drug Evaluation, Preclinical/*methods ; Embryonic Stem Cells/*cytology ; Furans/pharmacology ; Galactosyltransferases/*genetics ; Gene Editing/*methods ; Genetic Testing/methods/*veterinary ; Haploidy ; Macaca mulatta/*embryology ; Neural Stem Cells/*cytology ; Poisons/pharmacology ; },
abstract = {Haploid embryonic stem cells (haESCs) have been extensively applied in forward and reverse genetic screening. However, a mammalian haploid somatic cell line is difficult to achieve because of spontaneous diploidization in differentiation. As a non-human primate species, monkeys are widely used in basic and pre-clinical research in which haploid cells are restricted to ESCs. Here, we report that rhesus monkey haESCs in an optimized culture medium show naïve-state pluripotency and stable haploidy. This model facilitated the derivation of haploid neural progenitor cells (haNPCs), which maintained haploidy and differentiation potential into neurons and glia for a long period in vitro High-throughput trapping mutations can be efficiently introduced into haNPCs via piggyBac transposons. This system proves useful when identifying gene targets of neural toxicants via a proof-of-concept experiment. Using CRISPR/Cas9 editing, we confirmed that B4GALT6, from the candidate gene list, is a resistance gene of A803467 (a tetrodotoxin-like toxicant). This model is the first non-human primate haploid somatic cell line with proliferative ability, multipotency and an intact genome, thus providing a cellular resource for recessive genetic and potential drug screening.},
}
@article {pmid29782532,
year = {2018},
author = {Liang, Y and Cao, X and Ding, Q and Zhao, Y and He, Z and Zhong, J},
title = {Hepatitis C virus NS4B induces the degradation of TRIF to inhibit TLR3-mediated interferon signaling pathway.},
journal = {PLoS pathogens},
volume = {14},
number = {5},
pages = {e1007075},
doi = {10.1371/journal.ppat.1007075},
pmid = {29782532},
issn = {1553-7374},
mesh = {Adaptor Proteins, Signal Transducing/genetics/metabolism ; Adaptor Proteins, Vesicular Transport/*metabolism ; CRISPR-Cas Systems ; Caspase 8/genetics/metabolism ; Caspase 9/genetics/metabolism ; Cell Line, Tumor ; Gene Knockout Techniques ; HEK293 Cells ; Hepacivirus/*physiology ; Humans ; Immune Evasion/physiology ; Immunity, Innate/immunology ; Interferons/*metabolism ; Membrane Proteins/physiology ; Signal Transduction/*physiology ; Toll-Like Receptor 3/*antagonists &amp; inhibitors/metabolism ; Transfection ; Viral Nonstructural Proteins/*physiology ; },
abstract = {Toll-like receptor 3 (TLR3) senses dsRNA intermediates produced during RNA virus replication to activate innate immune signaling pathways through adaptor protein TRIF. Many viruses have evolved strategies to block TLR3-mediated interferon signaling via targeting TRIF. Here we studied how hepatitis C virus (HCV) antagonizes the TLR3-mediated interferon signaling. We found that HCV-encoded NS4B protein inhibited TLR3-mediated interferon signaling by down-regulating TRIF protein level. Mechanism studies indicated that the downregulation of TRIF by NS4B was dependent on caspase8. NS4B transfection or HCV infection can activate caspase8 to promote TRIF degradation, leading to suppression of TLR3-mediated interferon signaling. Knockout of caspase8 can prevent TRIF degradation triggered by NS4B, thereby enhancing the TLR3-mediated interferon signaling activation in response to HCV infection. In conclusion, our work revealed a new mechanism for HCV to evade innate immune response by blocking the TLR3-mediated interferon signaling via NS4B-induced TRIF degradation.},
}
@article {pmid29779105,
year = {2018},
author = {Khromov, AV and Gushchin, VA and Timerbaev, VI and Kalinina, NO and Taliansky, ME and Makarov, VV},
title = {Guide RNA Design for CRISPR/Cas9-Mediated Potato Genome Editing.},
journal = {Doklady. Biochemistry and biophysics},
volume = {479},
number = {1},
pages = {90-94},
doi = {10.1134/S1607672918020084},
pmid = {29779105},
issn = {1608-3091},
mesh = {Base Sequence ; CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Genome, Plant/*genetics ; RNA, Guide/*genetics ; Solanum tuberosum/*genetics ; },
abstract = {The activity of the pool of sgRNA molecules designed for different regions of potato coilin and phytoene desaturase genes was compared in vitro. Due to the presence of nucleotides unpaired with DNA, sgRNA is able not only to inhibit but also to stimulate the activity of the Cas9-sgRNA complex in vitro. Although the first six nucleotides located in the DNA substrate proximally to the PAM site at the 3' end are the binding sites for cas9, they had no significant effect on the activity of the Cas9-sgRNA complex.},
}
@article {pmid29775460,
year = {2018},
author = {Alex, A and Antunes, A},
title = {Genus-wide comparison of Pseudovibrio bacterial genomes reveal diverse adaptations to different marine invertebrate hosts.},
journal = {PloS one},
volume = {13},
number = {5},
pages = {e0194368},
doi = {10.1371/journal.pone.0194368},
pmid = {29775460},
issn = {1932-6203},
mesh = {*Adaptation, Physiological ; Animals ; Aquatic Organisms/*microbiology ; DNA, Bacterial ; *Genome, Bacterial ; Invertebrates/*microbiology ; Phylogeny ; Seawater/*microbiology ; Symbiosis ; Vibrionaceae/*genetics/isolation &amp; purification ; },
abstract = {Bacteria belonging to the genus Pseudovibrio have been frequently found in association with a wide variety of marine eukaryotic invertebrate hosts, indicative of their versatile and symbiotic lifestyle. A recent comparison of the sponge-associated Pseudovibrio genomes has shed light on the mechanisms influencing a successful symbiotic association with sponges. In contrast, the genomic architecture of Pseudovibrio bacteria associated with other marine hosts has received less attention. Here, we performed genus-wide comparative analyses of 18 Pseudovibrio isolated from sponges, coral, tunicates, flatworm, and seawater. The analyses revealed a certain degree of commonality among the majority of sponge- and coral-associated bacteria. Isolates from other marine invertebrate host, tunicates, exhibited a genetic repertoire for cold adaptation and specific metabolic abilities including mucin degradation in the Antarctic tunicate-associated bacterium Pseudovibrio sp. Tun.PHSC04_5.I4. Reductive genome evolution was simultaneously detected in the flatworm-associated bacteria and the sponge-associated bacterium P. axinellae AD2, through the loss of major secretion systems (type III/VI) and virulence/symbioses factors such as proteins involved in adhesion and attachment to the host. Our study also unraveled the presence of a CRISPR-Cas system in P. stylochi UST20140214-052 a flatworm-associated bacterium possibly suggesting the role of CRISPR-based adaptive immune system against the invading virus particles. Detection of mobile elements and genomic islands (GIs) in all bacterial members highlighted the role of horizontal gene transfer for the acquisition of novel genetic features, likely enhancing the bacterial ecological fitness. These findings are insightful to understand the role of genome diversity in Pseudovibrio as an evolutionary strategy to increase their colonizing success across a wide range of marine eukaryotic hosts.},
}
@article {pmid29771955,
year = {2018},
author = {Perera, OP and Little, NS and Pierce, CA},
title = {CRISPR/Cas9 mediated high efficiency knockout of the eye color gene Vermillion in Helicoverpa zea (Boddie).},
journal = {PloS one},
volume = {13},
number = {5},
pages = {e0197567},
doi = {10.1371/journal.pone.0197567},
pmid = {29771955},
issn = {1932-6203},
abstract = {Among various genome editing tools available for functional genomic studies, reagents based on clustered regularly interspersed palindromic repeats (CRISPR) have gained popularity due to ease and versatility. CRISPR reagents consist of ribonucleoprotein (RNP) complexes formed by combining guide RNA (gRNA) that target specific genomics regions and a CRISPR associated nuclease (Cas). The gRNA targeting specific gene sequences may be delivered as a plasmid construct that needs to be transcribed or as a synthetic RNA. The Cas nuclease can be introduced as a plasmid construct, mRNA, or purified protein. The efficiency of target editing is dependent on intrinsic factors specific to each species, the target gene sequence, and the delivery methods of CRISPR gRNA and the Cas nuclease. Although intrinsic factors affecting genome editing may not be altered in most experiments, the delivery method for CRISPR/Cas reagents can be optimized to produce the best results. In this study, the efficiency of genome editing by CRISPR/Cas system in the bollworm, Helicoverpa zea (Boddie), was evaluated using ribonucleoprotein (RNP) complexes assembled by binding synthetic gRNA with purified Cas9 nuclease engineered with nuclear localization signals to target the vermillion (eye color) gene. Mutation rates of adults emerging from embryos microinjected with 1, 2, or 4 μM RNP complexes were compared using replicated experiments. Embryos injected with 2 or 4 μM RNP complexes displayed significantly higher mutation rates (>88%) in surviving adults compared to those injected with 1 μM. The hatch rate in embryos injected with RNP complexes and with injection buffer only (mock injections) was reduced by 19.8(±5.2)% compared to noninjected control embryos, but did not differ significantly between injected embryos. Evaluation of potential off-target sites in H. zea genome did not identify any mutations. This study demonstrates that in vitro assembled synthetic RNP complexes can be used to obtain high genome editing rates in a reproducible manner in functional genomics or genetic manipulation studies.},
}
@article {pmid29766738,
year = {2018},
author = {Fan, HC and Chi, CS and Lee, YJ and Tsai, JD and Lin, SZ and Harn, HJ},
title = {The Role of Gene Editing in Neurodegenerative Diseases.},
journal = {Cell transplantation},
volume = {27},
number = {3},
pages = {364-378},
doi = {10.1177/0963689717753378},
pmid = {29766738},
issn = {1555-3892},
support = {27306C0004/ES/NIEHS NIH HHS/United States ; },
abstract = {Neurodegenerative diseases (NDs), at least including Alzheimer's, Huntington's, and Parkinson's diseases, have become the most dreaded maladies because there are no precise diagnostic tools or definite treatments for these debilitating diseases. The increased prevalence and a substantial impact on the social-economic and medical care of NDs propel governments to develop policies to counteract the impact. Although the etiologies of NDs are still unknown, growing evidence suggests that genetic, cellular, and circuit alternations may cause the generation of abnormal misfolded proteins, which uncontrolledly accumulate to damage and eventually overwhelm the protein-disposal mechanisms of these neurons, leading to a common pathological feature of NDs. If the functions and the connectivity can be restored, alterations and accumulated damages may improve. The gene-editing tools including zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats-associated nucleases (CRISPR/CAS) have emerged as a novel tool not only for generating specific ND animal models for interrogating the mechanisms and screening potential drugs against NDs but also for the editing sequence-specific genes to help patients with NDs to regain function and connectivity. This review introduces the clinical manifestations of three distinct NDs and the applications of the gene-editing technology on these debilitating diseases.},
}
@article {pmid29764585,
year = {2018},
author = {Meng, F and Zhao, D and Zhou, Q and Liu, Z},
title = {[Construction of EZH2 Knockout Animal Model by CRISPR/Cas9 Technology].},
journal = {Zhongguo fei ai za zhi = Chinese journal of lung cancer},
volume = {21},
number = {5},
pages = {358-364},
doi = {10.3779/j.issn.1009-3419.2018.05.02},
pmid = {29764585},
issn = {1999-6187},
mesh = {Animals ; *CRISPR-Cas Systems ; Enhancer of Zeste Homolog 2 Protein/*genetics/metabolism ; Female ; Gene Knockout Techniques ; Gene Targeting ; Humans ; Lung Neoplasms/genetics/*metabolism ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; RNA, Guide ; },
abstract = {BACKGROUND: It has been proven that CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9) system was the modern gene-editing technology through the constitutive expression of nucleases Cas9 in the mammalian, which binds to the specific site in the genome mediated by single-guide RNA (sgRNA) at desired genomic loci. The aim of this study is that the animal model of EZH2 gene knockout was constructed using CRISPR/Cas9 technology.<br><br>METHODS: In this study, we designed two single-guide RNAs targeting the Exon3 and Exon4 of EZH2 gene. Then, their gene-targeting efficiency were detected by SURVEYOR assay. The lentivirus was perfused into the lungs of mice by using a bronchial tube and detected by immunohistochemistry and qRT-PCR.<br><br>RESULTS: The experimental results of NIH-3T3 cells verify that the designed sgEZH2 can efficiently effect the cleavage of target DNA by Cas9 in vitro. The immunohistochemistry and qRT-PCR results showed that the EZH2 expression in experimental group was significantly decreased in the mouse lung tissue.<br><br>CONCLUSIONS: The study successfully designed two sgRNA which can play a knock-out EZH2 function. An EZH2 knockout animal model was successfully constructed by CRISPR/Cas9 system, and it will be an effective animal model for studying the functions and mechanisms of EZH2.},
}
@article {pmid29757293,
year = {2018},
author = {Prior, H and MacConnachie, L and Martinez, JL and Nicholl, GCB and Beg, AA},
title = {A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {134},
pages = {},
doi = {10.3791/57518},
pmid = {29757293},
issn = {1940-087X},
support = {P40 OD010440/OD/NIH HHS/United States ; R01 NS094678/NS/NINDS NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Caenorhabditis elegans/*genetics/metabolism ; Genomics/*methods ; Point Mutation/*genetics ; Ribonucleoproteins/*metabolism ; },
abstract = {The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.},
}
@article {pmid29757280,
year = {2018},
author = {Chu, FC and Wu, PS and Pinzi, S and Grubbs, N and Lorenzen, MD},
title = {Microinjection of Western Corn Rootworm, Diabrotica virgifera virgifera, Embryos for Germline Transformation, or CRISPR/Cas9 Genome Editing.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {134},
pages = {},
doi = {10.3791/57497},
pmid = {29757280},
issn = {1940-087X},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Coleoptera ; Gene Editing/*methods ; Germ-Line Mutation/*genetics ; Microinjections/*methods ; RNA Interference ; },
abstract = {The western corn rootworm (WCR) is an important pest of corn and is well known for its ability to rapidly adapt to pest management strategies. Although RNA interference (RNAi) has proved to be a powerful tool for studying WCR biology, it has its limitations. Specifically, RNAi itself is transient (i.e. does not result in long-term Mendelian inheritance of the associated phenotype), and it requires knowing the DNA sequence of the target gene. The latter can be limiting if the phenotype of interest is controlled by poorly conserved, or even novel genes, because identifying useful targets would be challenging, if not impossible. Therefore, the number of tools in WCR's genomic toolbox should be expanded by the development of methods that could be used to create stable mutant strains and enable sequence-independent surveys of the WCR genome. Herein, we detail the methods used to collect and microinject precellular WCR embryos with nucleic acids. While the protocols described herein are aimed at the creation of transgenic WCR, CRISPR/Cas9-genome editing could also be performed using the same protocols, with the only difference being the composition of the solution injected into the embryos.},
}
@article {pmid29754234,
year = {2018},
author = {Liu, KI and Ramli, MNB and Sutrisnoh, NB and Tan, MH},
title = {Rapid Control of Genome Editing in Human Cells by Chemical-Inducible CRISPR-Cas Systems.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1772},
number = {},
pages = {267-288},
doi = {10.1007/978-1-4939-7795-6_15},
pmid = {29754234},
issn = {1940-6029},
abstract = {Genome editing using programmable DNA endonucleases enables the engineering of eukaryotic cells and living organisms with desirable properties or traits. Among the various molecular scissors that have been developed to date, the most versatile and easy-to-use family of nucleases derives from CRISPR-Cas, which exists naturally as an adaptive immune system in bacteria. Recent advances in the CRISPR-Cas technology have expanded our ability to manipulate complex genomes for myriad biomedical and biotechnological applications. Some of these applications are time-sensitive or demand high spatial precision. Here, we describe the use of an inducible CRISPR-Cas9 system, termed iCas, which we have developed to enable rapid and tight control of genome editing in mammalian cells. The iCas system can be switched on or off as desired through the introduction or removal of the small molecule tamoxifen or its related analogs such as 4-hydroxytamoxifen (4-HT).},
}
@article {pmid29754226,
year = {2018},
author = {Carstens, CP and Felts, KA and Johns, SE},
title = {Construction of CRISPR Libraries for Functional Screening.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1772},
number = {},
pages = {139-150},
doi = {10.1007/978-1-4939-7795-6_7},
pmid = {29754226},
issn = {1940-6029},
abstract = {Identification of gene function has been aided by the ability to generate targeted gene knockouts or transcriptional repression using the CRISPR/CAS9 system. Using pooled libraries of guide RNA expression vectors that direct CAS9 to a specific genomic site allows identification of genes that are either enriched or depleted in response to a selection scheme, thus linking the affected gene to the chosen phenotype. The quality of the data generated by the screening is dependent on the quality of the guide RNA delivery library with regards to error rates and especially evenness of distribution of the guides. Here, we describe a method for constructing complex plasmid libraries based on pooled designed oligomers with high representation and tight distributions. The procedure allows construction of plasmid libraries of >60,000 members with a 95th/5th percentile ratio of less than 3.5.},
}
@article {pmid29754224,
year = {2018},
author = {Lodens, S and De Graeve, M and Roelants, SLKW and De Maeseneire, SL and Soetaert, W},
title = {Transformation of an Exotic Yeast Species into a Platform Organism: A Case Study for Engineering Glycolipid Production in the Yeast Starmerella bombicola.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1772},
number = {},
pages = {95-123},
doi = {10.1007/978-1-4939-7795-6_5},
pmid = {29754224},
issn = {1940-6029},
abstract = {In this chapter, a step-by-step approach on how to transform non-conventional yeasts or fungi into platform organisms is described. The non-conventional glycolipid producing yeast Starmerella bombicola (and in some cases also Pseudohyphozyma bogoriensis) is used as a case study. And more specifically how to engineer it toward production of new-to-nature glycolipids like bola sophorolipids. When starting genetic engineering efforts for non-lab strains, one should start at the very basis: identifying selection markers and possibly developing auxotrophic strains. Once this is done, the quest for the development of an optimal transformation method can be started. After optimization thereof, knock-out and knock-in strains can be generated based upon the specific strategy/aim. Sometimes this can lead to unexpected, but yet very interesting findings. To fully and efficiently expand the potential as a production platform of these yeast strains, a range of additional molecular tools are required. A well-equipped molecular toolbox should contain a set of characterized promotors, terminators, and defined genomic landing paths. The availability of an episomal system greatly facilitates engineering and screening efforts, but also offers the possibility of developing more advanced engineering techniques such as Crispr-Cas. InBio.be is a world leading pioneer to do this for the yeast S. bombicola and combined, these efforts will result in the commercialization of new types of glycolipids in the next few years.},
}
@article {pmid29752409,
year = {2018},
author = {Stopschinski, BE and Holmes, BB and Miller, GM and Manon, VA and Vaquer-Alicea, J and Prueitt, WL and Hsieh-Wilson, LC and Diamond, MI},
title = {Specific glycosaminoglycan chain length and sulfation patterns are required for cell uptake of tau versus α-synuclein and β-amyloid aggregates.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {27},
pages = {10826-10840},
doi = {10.1074/jbc.RA117.000378},
pmid = {29752409},
issn = {1083-351X},
support = {F31 NS079039/NS/NINDS NIH HHS/United States ; T32 GM007200/GM/NIGMS NIH HHS/United States ; },
abstract = {Transcellular propagation of protein aggregate &quot;seeds&quot; has been proposed to mediate the progression of neurodegenerative diseases in tauopathies and α-synucleinopathies. We previously reported that tau and α-synuclein aggregates bind heparan sulfate proteoglycans (HSPGs) on the cell surface, promoting cellular uptake and intracellular seeding. However, the specificity and binding mode of these protein aggregates to HSPGs remain unknown. Here, we measured direct interaction with modified heparins to determine the size and sulfation requirements for tau, α-synuclein, and β-amyloid (Aβ) aggregate binding to glycosaminoglycans (GAGs). Varying the GAG length and sulfation patterns, we next conducted competition studies with heparin derivatives in cell-based assays. Tau aggregates required a precise GAG architecture with defined sulfate moieties in the N- and 6-O-positions, whereas the binding of α-synuclein and Aβ aggregates was less stringent. To determine the genes required for aggregate uptake, we used CRISPR/Cas9 to individually knock out the major genes of the HSPG synthesis pathway in HEK293T cells. Knockouts of the extension enzymes exostosin 1 (EXT1), exostosin 2 (EXT2), and exostosin-like 3 (EXTL3), as well as N-sulfotransferase (NDST1) or 6-O-sulfotransferase (HS6ST2) significantly reduced tau uptake, consistent with our biochemical findings, and knockouts of EXT1, EXT2, EXTL3, or NDST1, but not HS6ST2 reduced α-synuclein uptake. In summary, tau aggregates display specific interactions with HSPGs that depend on GAG length and sulfate moiety position, whereas α-synuclein and Aβ aggregates exhibit more flexible interactions with HSPGs. These principles may inform the development of mechanism-based therapies to block transcellular propagation of amyloid protein-based pathologies.},
}
@article {pmid29752075,
year = {2018},
author = {Scheben, A and Edwards, D},
title = {Towards a more predictable plant breeding pipeline with CRISPR/Cas-induced allelic series to optimize quantitative and qualitative traits.},
journal = {Current opinion in plant biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.pbi.2018.04.013},
pmid = {29752075},
issn = {1879-0356},
abstract = {The rate of crop improvement must increase to meet rising global demand for food. Crop breeding pipelines can be hampered by the imprecision and multi-generational timeframe of methods such as intercrossing and stochastic mutagenesis used to generate variation. Genome editing can generate targeted allelic series of trait-related genes and regulatory elements, creating a series of variable phenotypes for breeding within a single generation. Disrupting genic and regulatory regions is particularly effective for engineering quantitative traits. Although qualitative traits can be more difficult to engineer using disruption, precise base editing may allow an efficient path to rationally improve qualitative traits if protein function can be accurately modelled. As functional understanding of genes and regulatory elements increases, genome editing can enhance the predictability of plant breeding outcomes and will ensure food security.},
}
@article {pmid29748239,
year = {2018},
author = {Zhu, Y and Klompe, SE and Vlot, M and van der Oost, J and Staals, RHJ},
title = {Shooting the messenger: RNA-targetting CRISPR-Cas systems.},
journal = {Bioscience reports},
volume = {38},
number = {3},
pages = {},
doi = {10.1042/BSR20170788},
pmid = {29748239},
issn = {1573-4935},
abstract = {Since the discovery of CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR-associated genes) immune systems, astonishing progress has been made on revealing their mechanistic foundations. Due to the immense potential as genome engineering tools, research has mainly focussed on a subset of Cas nucleases that target DNA. In addition, however, distinct types of RNA-targetting CRISPR-Cas systems have been identified. The focus of this review will be on the interference mechanisms of the RNA targetting type III and type VI CRISPR-Cas systems, their biological relevance and their potential for applications.},
}
@article {pmid29748193,
year = {2018},
author = {Thomas, SP and Hoang, TT and Ressler, VT and Raines, RT},
title = {Human angiogenin is a potent cytotoxin in the absence of ribonuclease inhibitor.},
journal = {RNA (New York, N.Y.)},
volume = {24},
number = {8},
pages = {1018-1027},
doi = {10.1261/rna.065516.117},
pmid = {29748193},
issn = {1469-9001},
support = {P30 CA014520/CA/NCI NIH HHS/United States ; R01 CA073808/CA/NCI NIH HHS/United States ; T32 GM007215/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems ; Carrier Proteins/genetics/*metabolism ; Cell Death/genetics/*physiology ; Cell Line, Tumor ; Cell Proliferation ; Cytotoxins/genetics/*metabolism ; Gene Knockout Techniques ; HeLa Cells ; Humans ; MicroRNAs/genetics ; Oxidative Stress ; Protein Binding/genetics ; RNA, Transfer/*genetics ; Ribonuclease, Pancreatic/genetics/*metabolism ; },
abstract = {Angiogenin (ANG) is a secretory ribonuclease that promotes the proliferation of endothelial cells, leading to angiogenesis. This function relies on its ribonucleolytic activity, which is low for simple RNA substrates. Upon entry into the cytosol, ANG is sequestered by the ribonuclease inhibitor protein (RNH1). We find that ANG is a potent cytotoxin for RNH1-knockout HeLa cells, belying its inefficiency as a nonspecific catalyst. The toxicity does, however, rely on the ribonucleolytic activity of ANG and a cytosolic localization, which lead to the accumulation of particular tRNA fragments (tRFs), such as tRF-5 Gly-GCC. These up-regulated tRFs are highly cytotoxic at physiological concentrations. Although ANG is well-known for its promotion of cell growth, our results reveal that ANG can also cause cell death.},
}
@article {pmid29746102,
year = {2018},
author = {Kartje, ZJ and Barkau, CL and Rohilla, KJ and Ageely, EA and Gagnon, KT},
title = {Chimeric Guides Probe and Enhance Cas9 Biochemical Activity.},
journal = {Biochemistry},
volume = {57},
number = {21},
pages = {3027-3031},
doi = {10.1021/acs.biochem.8b00107},
pmid = {29746102},
issn = {1520-4995},
mesh = {Bacterial Proteins/*chemistry/*genetics/metabolism ; CRISPR-Associated Proteins/metabolism ; CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; DNA/genetics ; DNA Cleavage ; Endonucleases/*chemistry/*genetics/metabolism ; RNA, Bacterial/chemistry ; RNA, Guide ; },
abstract = {DNA substitutions in RNA can probe the importance of A-form structure, 2'-hydroxyl contacts, and conformational constraints within RNA-guided enzymes. Using this approach, we found that Cas9 biochemical activity tolerated significant substitution with DNA nucleotides in the clustered regularly interspaced short palindromic repeat RNA (crRNA). Only minimal RNA content was needed in or near the seed region. Simultaneous substitution at all positions with predicted crRNA-Cas9 2'-hydroxyl contacts had no effect on enzyme activity. The trans-activating crRNA (tracrRNA) also tolerated >50% substitution with DNA. DNA substitutions in the tracrRNA-pairing region of crRNA consistently enhanced cleavage activity while maintaining or improving target specificity. Together, results point to a prominent role for guide:target A-form-like helical structure and a possible regulatory role for the crRNA-tracrRNA pairing motif. A model chimeric crRNA with high activity did not significantly alter RNP assembly or target binding but did reduce Cas9 ribonucleoprotein stability, suggesting effects through conformation or dynamics. Cas9 directed by chimeric RNA-DNA guides may represent a cost-effective synthetic or molecular biology tool for robust and specific DNA cleavage.},
}
@article {pmid29743593,
year = {2018},
author = {Maurizi, G and Verma, N and Gadi, A and Mansukhani, A and Basilico, C},
title = {Sox2 is required for tumor development and cancer cell proliferation in osteosarcoma.},
journal = {Oncogene},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41388-018-0292-2},
pmid = {29743593},
issn = {1476-5594},
support = {R21 CA186031/CA/NCI NIH HHS/United States ; },
abstract = {The stem cell transcription factor Sox2 is highly expressed in many cancers where it is thought to mark cancer stem cells (CSCs). In osteosarcomas, the most common bone malignancy, high Sox2 expression marks and maintains a fraction of tumor-initiating cells that show all the properties of CSC. Knockdown of Sox2 expression abolishes tumorigenicity and suppresses the CSC phenotype. Here we show that, in a mouse model of osteosarcoma, osteoblast-specific Sox2 conditional knockout (CKO) causes a drastic reduction in the frequency and onset of tumors. The rare tumors detected in the Sox2 CKO animals were all Sox2 positive, indicating that they arose from cells that had escaped Sox2 deletion. Furthermore, Sox2 inactivation in cultured osteosarcoma cells by CRISPR/CAS technology leads to a loss of viability and proliferation of the entire cell population. Inactivation of the YAP gene, a major Hippo pathway effector which is a direct Sox2 target, causes similar results and YAP overexpression rescues cells from the lethality caused by Sox2 inactivation. These effects were osteosarcoma-specific, suggesting a mechanism of cell &quot;addiction&quot; to Sox2-initiated pathways. The requirement of Sox2 for osteosarcoma formation as well as for the survival of the tumor cells suggests that disruption of Sox2-initiated pathways could be an effective strategy for the treatment of osteosarcoma.},
}
@article {pmid29742140,
year = {2018},
author = {Obinata, H and Sugimoto, A and Niwa, S},
title = {Streptothricin acetyl transferase 2 (Sat2): A dominant selection marker for Caenorhabditis elegans genome editing.},
journal = {PloS one},
volume = {13},
number = {5},
pages = {e0197128},
doi = {10.1371/journal.pone.0197128},
pmid = {29742140},
issn = {1932-6203},
mesh = {Acetyltransferases/*genetics ; Animals ; CRISPR-Cas Systems/genetics ; Caenorhabditis elegans/*genetics ; Culture Media/chemistry ; Gene Editing/*methods ; *Genetic Markers/genetics ; Genome, Helminth ; Hygromycin B/pharmacology ; Streptothricins/pharmacology ; },
abstract = {Studies on Caenorhabditis elegans would benefit from the introduction of new selectable markers to allow more complex types of experiments to be conducted with this model animal. We established a new antibiotic selection marker for C. elegans transformation based on nourseothricin (NTC) and its resistance-encoding gene, streptothricin-acetyl transferase 2 (Sat2). NTC was able to efficiently prevent worm development at very low concentrations, and the worms expressing Sat2 were able to survive on the selection plates without any developmental defects. Using CRISPR/Cas9 and NTC selection, we were able to easily insert a 13-kb expression cassette into a defined locus in C. elegans. The structure and spectrum of NTC differs from other antibiotics like hygromycin B and geneticin, making it possible to use NTC alongside them. Indeed, we confirmed NTC-sat2 selection could work with the hygromycin B selection system simultaneously. Thus, the new NTC-Sat2 system can act as a useful dominant marker for gene transfer and genome editing in C. elegans.},
}
@article {pmid29740742,
year = {2018},
author = {Fontana, J and Voje, WE and Zalatan, JG and Carothers, JM},
title = {Prospects for engineering dynamic CRISPR-Cas transcriptional circuits to improve bioproduction.},
journal = {Journal of industrial microbiology &amp; biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s10295-018-2039-z},
pmid = {29740742},
issn = {1476-5535},
support = {Career Award at the Scientific Interface//Burroughs Wellcome Fund/ ; 1517052//Division of Molecular and Cellular Biosciences/ ; Presidential Innovation Award//University of Washington/ ; },
abstract = {Dynamic control of gene expression is emerging as an important strategy for controlling flux in metabolic pathways and improving bioproduction of valuable compounds. Integrating dynamic genetic control tools with CRISPR-Cas transcriptional regulation could significantly improve our ability to fine-tune the expression of multiple endogenous and heterologous genes according to the state of the cell. In this mini-review, we combine an analysis of recent literature with examples from our own work to discuss the prospects and challenges of developing dynamically regulated CRISPR-Cas transcriptional control systems for applications in synthetic biology and metabolic engineering.},
}
@article {pmid29740340,
year = {2018},
author = {Cornejo, I and Villanueva, S and Burgos, J and López-Cayuqueo, KI and Chambrey, R and Julio-Kalajzić, F and Buelvas, N and Niemeyer, MI and Figueiras-Fierro, D and Brown, PD and Sepúlveda, FV and Cid, LP},
title = {Tissue Distribution of Kir7.1 Inwardly Rectifying K+ Channel Probed in a Knock-in Mouse Expressing a Haemagglutinin-Tagged Protein.},
journal = {Frontiers in physiology},
volume = {9},
number = {},
pages = {428},
doi = {10.3389/fphys.2018.00428},
pmid = {29740340},
issn = {1664-042X},
abstract = {Kir7.1 encoded by the Kcnj13 gene in the mouse is an inwardly rectifying K+ channel present in epithelia where it shares membrane localization with the Na+/K+-pump. Further investigations of the localisation and function of Kir7.1 would benefit from the availability of a knockout mouse, but perinatal mortality attributed to cleft palate in the neonate has thwarted this research. To facilitate localisation studies we now use CRISPR/Cas9 technology to generate a knock-in mouse, the Kir7.1-HA that expresses the channel tagged with a haemagglutinin (HA) epitope. The availability of antibodies for the HA epitope allows for application of western blot and immunolocalisation methods using widely available anti-HA antibodies with WT tissues providing unambiguous negative control. We demonstrate that Kir7.1-HA cloned from the choroid plexus of the knock-in mouse has the electrophysiological properties of the native channel, including characteristically large Rb+ currents. These large Kir7.1-mediated currents are accompanied by abundant apical membrane Kir7.1-HA immunoreactivity. WT-controlled western blots demonstrate the presence of Kir7.1-HA in the eye and the choroid plexus, trachea and lung, and intestinal epithelium but exclusively in the ileum. In the kidney, and at variance with previous reports in the rat and guinea-pig, Kir7.1-HA is expressed in the inner medulla but not in the cortex or outer medulla. In isolated tubules immunoreactivity was associated with inner medulla collecting ducts but not thin limbs of the loop of Henle. Kir7.1-HA shows basolateral expression in the respiratory tract epithelium from trachea to bronchioli. The channel also appears basolateral in the epithelium of the nasal cavity and nasopharynx in newborn animals. We show that HA-tagged Kir7.1 channel introduced in the mouse by a knock-in procedure has functional properties similar to the native protein and the animal thus generated has clear advantages in localisation studies. It might therefore become a useful tool to unravel Kir7.1 function in the different organs where it is expressed.},
}
@article {pmid29735716,
year = {2018},
author = {Champer, J and Liu, J and Oh, SY and Reeves, R and Luthra, A and Oakes, N and Clark, AG and Messer, PW},
title = {Reducing resistance allele formation in CRISPR gene drive.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {21},
pages = {5522-5527},
doi = {10.1073/pnas.1720354115},
pmid = {29735716},
issn = {1091-6490},
support = {R21 AI130635/AI/NIAID NIH HHS/United States ; },
mesh = {Alleles ; Animals ; CRISPR-Cas Systems/*genetics ; Disease Resistance/*genetics ; Drosophila Proteins/*genetics ; Drosophila melanogaster/*genetics ; *Gene Drive Technology ; Genetics, Population ; Germ Cells ; Mutation ; RNA, Guide/*genetics ; RNA-Binding Proteins ; },
abstract = {CRISPR homing gene drives can convert heterozygous cells with one copy of the drive allele into homozygotes, thereby enabling super-Mendelian inheritance. Such a mechanism could be used, for example, to rapidly disseminate a genetic payload in a population, promising effective strategies for the control of vector-borne diseases. However, all CRISPR homing gene drives studied in insects thus far have produced significant quantities of resistance alleles that would limit their spread. In this study, we provide an experimental demonstration that multiplexing of guide RNAs can both significantly increase the drive conversion efficiency and reduce germline resistance rates of a CRISPR homing gene drive in Drosophila melanogaster We further show that an autosomal drive can achieve drive conversion in the male germline, with no subsequent formation of resistance alleles in embryos through paternal carryover of Cas9. Finally, we find that the nanos promoter significantly lowers somatic Cas9 expression compared with the vasa promoter, suggesting that nanos provides a superior choice in drive strategies where gene disruption in somatic cells could have fitness costs. Comparison of drive parameters among the different constructs developed in this study and a previous study suggests that, while drive conversion and germline resistance rates are similar between different genomic targets, embryo resistance rates can vary significantly. Taken together, our results mark an important step toward developing effective gene drives capable of functioning in natural populations and provide several possible avenues for further control of resistance rates.},
}
@article {pmid29732484,
year = {2018},
author = {Franco-Tormo, MJ and Salas-Crisostomo, M and Rocha, NB and Budde, H and Machado, S and Murillo-Rodríguez, E},
title = {CRISPR/Cas9, the Powerful New Genome-Editing Tool for Putative Therapeutics in Obesity.},
journal = {Journal of molecular neuroscience : MN},
volume = {65},
number = {1},
pages = {10-16},
doi = {10.1007/s12031-018-1076-4},
pmid = {29732484},
issn = {1559-1166},
support = {CN-17-19//University of California Institute for Mexico and the United States/ ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Gene Editing/*methods ; Genetic Therapy/*methods ; Humans ; Obesity/*genetics/therapy ; },
abstract = {The molecular technology known as clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) is revolutionizing the field of medical research and deepening our understanding of numerous biological processes. The attraction of CRISPR/Cas9 lies in its ability to efficiently edit DNA or modulate gene expression in living eukaryotic cells and organisms, a technology that was once considered either too expensive or scientifically risky. CRISPR/Cas9 has been successfully applied in agriculture to develop the next generation of disease-resistant plants. Now, the capability of gene editing has been translated to the biomedical area, focusing on the future of medicine faced with drug-resistant microbes by selectively targeting genes involved in antibiotic resistance, for example, or finding the ultimate strategy for cancer or HIV. In this regard, it was recently demonstrated that an injection of cancer-fighting CRISPR-modified white blood cells in a patient suffering from metastatic lung cancer could lead to promising results. Researchers and bioethicists are debating questions about the regulation of CRISPR/Cas9 that must be addressed. While legal challenges surround the use of this technique for genetically modifying cell lines in humans, we review the basic understanding of CRISPR/Cas9 and discuss how this technology could represent a candidate for treatment of non-communicable diseases in nutrition, such as obesity.},
}
@article {pmid29730672,
year = {2018},
author = {Kocak, DD and Gersbach, CA},
title = {From CRISPR scissors to virus sensors.},
journal = {Nature},
volume = {557},
number = {7704},
pages = {168-169},
doi = {10.1038/d41586-018-04975-8},
pmid = {29730672},
issn = {1476-4687},
mesh = {CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; DNA Viruses ; *Gene Editing ; },
}
@article {pmid29729377,
year = {2018},
author = {Sun, T and Li, S and Song, X and Diao, J and Chen, L and Zhang, W},
title = {Toolboxes for cyanobacteria: Recent advances and future direction.},
journal = {Biotechnology advances},
volume = {36},
number = {4},
pages = {1293-1307},
doi = {10.1016/j.biotechadv.2018.04.007},
pmid = {29729377},
issn = {1873-1899},
abstract = {Photosynthetic cyanobacteria are important primary producers and model organisms for studying photosynthesis and elements cycling on earth. Due to the ability to absorb sunlight and utilize carbon dioxide, cyanobacteria have also been proposed as renewable chassis for carbon-neutral &quot;microbial cell factories&quot;. Recent progresses on cyanobacterial synthetic biology have led to the successful production of more than two dozen of fuels and fine chemicals directly from CO2, demonstrating their potential for scale-up application in the future. However, compared with popular heterotrophic chassis like Escherichia coli and Saccharomyces cerevisiae, where abundant genetic tools are available for manipulations at levels from single gene, pathway to whole genome, limited genetic tools are accessible to cyanobacteria. Consequently, this significant technical hurdle restricts both the basic biological researches and further development and application of these renewable systems. Though still lagging the heterotrophic chassis, the vital roles of genetic tools in tuning of gene expression, carbon flux re-direction as well as genome-wide manipulations have been increasingly recognized in cyanobacteria. In recent years, significant progresses on developing and introducing new and efficient genetic tools have been made for cyanobacteria, including promoters, riboswitches, ribosome binding site engineering, clustered regularly interspaced short palindromic repeats/CRISPR-associated nuclease (CRISPR/Cas) systems, small RNA regulatory tools and genome-scale modeling strategies. In this review, we critically summarize recent advances on development and applications as well as technical limitations and future directions of the genetic tools in cyanobacteria. In addition, toolboxes feasible for using in large-scale cultivation are also briefly discussed.},
}
@article {pmid29729270,
year = {2018},
author = {Chen, G and Zhang, D and Zhang, L and Feng, G and Zhang, B and Wu, Y and Li, W and Zhang, Y and Hu, B},
title = {RBM14 is indispensable for pluripotency maintenance and mesoderm development of mouse embryonic stem cells.},
journal = {Biochemical and biophysical research communications},
volume = {501},
number = {1},
pages = {259-265},
doi = {10.1016/j.bbrc.2018.04.231},
pmid = {29729270},
issn = {1090-2104},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Differentiation ; Gene Knockout Techniques ; Mesoderm/*embryology/*metabolism ; Mice ; Mice, Inbred NOD ; Mice, SCID ; Mouse Embryonic Stem Cells/*cytology/*metabolism/transplantation ; Transcription Factors/deficiency/genetics/*metabolism ; Transcriptome ; Transforming Growth Factor beta/metabolism ; Wnt Signaling Pathway ; },
abstract = {The pluripotency of embryonic stem cells (ESCs) is maintained by core pluripotency transcription factors, cofactors and several signaling pathways. RBM14 is a component of the para-speckle complex, which has been implicated in multiple important biological processes. The role of RBM14 in ESCs and lineage differentiation remains to be elucidated. In the present study, we provided evidence that RBM14 plays important roles in maintaining pluripotency and in the early differentiation of ESCs. RBM14 was demonstrated to be expressed in mouse embryonic stem cells (mESCs) and localized in the nucleus. RBM14 expression was depleted in mESCs using clustered regularly interspaced short palindromic repeats (CRISPR) technology. Our results also showed that RBM14 depletion altered the gene expression profiles of mESCs. In particular, pluripotency-associated genes and genes involved in the Wnt and TGF-β signaling pathways were downregulated in RBM14 knockout mESCs. Furthermore, RBM14 was found to be essential for mesoderm development in vitro and in vivo. The specific effects of RBM14 depletion were verified by conducting a rescue experiment. Our findings demonstrated that RBM14 not only plays an important role in maintaining the pluripotency of mESCs but is also indispensable for mesoderm development.},
}
@article {pmid29725684,
year = {2018},
author = {Liu, Y and Zhao, G and Xu, CF and Luo, YL and Lu, ZD and Wang, J},
title = {Systemic delivery of CRISPR/Cas9 with PEG-PLGA nanoparticles for chronic myeloid leukemia targeted therapy.},
journal = {Biomaterials science},
volume = {6},
number = {6},
pages = {1592-1603},
doi = {10.1039/c8bm00263k},
pmid = {29725684},
issn = {2047-4849},
mesh = {Animals ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Female ; Fusion Proteins, bcr-abl/*genetics ; Genetic Therapy/*methods ; Humans ; Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/*therapy ; Mice, Inbred NOD ; Mice, SCID ; Nanoparticles/*chemistry ; Polyesters/*chemistry ; Polyethylene Glycols/*chemistry ; },
abstract = {Chronic myeloid leukemia (CML), which is characterized by the Philadelphia translocation, which fuses breakpoint cluster region (BCR) sequences from chromosome 22 upstream of the Abelson murine leukemia viral oncogene homolog (ABL) on chromosome 9, requires specific and efficient treatment. The CRISPR/Cas9 system, with its mechanism of specific DNA complementary recognition by engineered guide RNA (gRNA), allows the development of novel therapeutics for CML. To achieve targeted therapy of CML with the CRISPR/Cas9 system, we encapsulated a CRISPR/Cas9 plasmid (pCas9) expressing gRNA targeting the overhanging fusion region of the BCR-ABL gene (pCas9/gBCR-ABL) with poly(ethylene glycol)-b-poly(lactic acid-co-glycolic acid) (PEG-PLGA)-based cationic lipid-assisted polymeric nanoparticles (CLANs), which specifically disrupted the CML-related BCR-ABL gene while sparing the BCR and ABL genes in normal cells. After intravenous injection, CLANs carrying pCas9/gBCR-ABL (CLANpCas9/gBCR-ABL) efficiently knocked out the BCR-ABL fusion gene of CML cells and improved the survival of a CML mouse model, indicating that the combination of the CRISPR/Cas9 system with nanocarriers is a promising strategy for targeted treatment of CML.},
}
@article {pmid29723268,
year = {2018},
author = {Tröder, SE and Ebert, LK and Butt, L and Assenmacher, S and Schermer, B and Zevnik, B},
title = {An optimized electroporation approach for efficient CRISPR/Cas9 genome editing in murine zygotes.},
journal = {PloS one},
volume = {13},
number = {5},
pages = {e0196891},
doi = {10.1371/journal.pone.0196891},
pmid = {29723268},
issn = {1932-6203},
mesh = {Animals ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Electroporation/economics/instrumentation/*methods ; Endonucleases/genetics/metabolism ; Female ; Gene Editing/*methods ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Transgenic ; RNA, Guide/genetics/metabolism ; Zygote/growth &amp; development/*metabolism ; },
abstract = {Electroporation of zygotes represents a rapid alternative to the elaborate pronuclear injection procedure for CRISPR/Cas9-mediated genome editing in mice. However, current protocols for electroporation either require the investment in specialized electroporators or corrosive pre-treatment of zygotes which compromises embryo viability. Here, we describe an easily adaptable approach for the introduction of specific mutations in C57BL/6 mice by electroporation of intact zygotes using a common electroporator with synthetic CRISPR/Cas9 components and minimal technical requirement. Direct comparison to conventional pronuclear injection demonstrates significantly reduced physical damage and thus improved embryo development with successful genome editing in up to 100% of living offspring. Hence, our novel approach for Easy Electroporation of Zygotes (EEZy) allows highly efficient generation of CRISPR/Cas9 transgenic mice while reducing the numbers of animals required.},
}
@article {pmid29720387,
year = {2018},
author = {Kurata, JS and Lin, RJ},
title = {MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs.},
journal = {RNA (New York, N.Y.)},
volume = {24},
number = {7},
pages = {966-981},
doi = {10.1261/rna.066282.118},
pmid = {29720387},
issn = {1469-9001},
support = {P30 CA033572/CA/NCI NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; Cell Line, Tumor ; Female ; Genome, Human ; HeLa Cells ; Humans ; MicroRNAs/*genetics/metabolism ; Stomach Neoplasms/genetics/metabolism ; Uterine Cervical Neoplasms/genetics/metabolism ; },
abstract = {MicroRNAs (miRNAs) are post-transcriptional gene regulators that play important roles in the control of cell fitness, differentiation, and development. The CRISPR-Cas9 gene-editing system is composed of the Cas9 nuclease in complex with a single guide RNA (sgRNA) and directs DNA cleavage at a predetermined site. Several CRISPR-Cas9 libraries have been constructed for genome-scale knockout screens of protein function; however, few libraries have included miRNA genes. Here we constructed a miRNA-focused CRISPR-Cas9 library that targets 1594 (85%) annotated human miRNA stem-loops. The sgRNAs in our LX-miR library are designed to have high on-target and low off-target activity, and each miRNA is targeted by four to five sgRNAs. We used this sgRNA library to screen for miRNAs that affect cell fitness of HeLa or NCI-N87 cells by monitoring the change in frequency of each sgRNA over time. By considering the expression in the tested cells and the dysregulation of the miRNAs in cancer specimens, we identified five HeLa pro-fitness and cervical cancer up-regulated miRNAs (miR-31-5p, miR-92b-3p, miR-146b-5p, miR-151a-3p, and miR-194-5p). Similarly, we identified six NCI-N87 pro-fitness and gastric cancer up-regulated miRNAs (miR-95-3p, miR-181a-5p, miR-188-5p, miR-196b-5p, miR-584-5p, and miR-1304-3p), as well as three anti-fitness and down-regulated miRNAs (let-7a-3p, miR-100-5p, and miR-149-5p). Some of those miRNAs are known to be oncogenic or tumor-suppressive, but others are novel. Taken together, the LX-miR library is useful for genome-wide unbiased screening to identify miRNAs important for cellular fitness and likely to be useful for other functional screens.},
}
@article {pmid29718443,
year = {2018},
author = {Jamison, BV and Thairu, MW and Hansen, AK},
title = {Efficacy of In Vivo Electroporation on the Delivery of Molecular Agents into Aphid (Hemiptera: Aphididae) Ovarioles.},
journal = {Journal of insect science (Online)},
volume = {18},
number = {2},
pages = {},
doi = {10.1093/jisesa/iey041},
pmid = {29718443},
issn = {1536-2442},
mesh = {Animals ; *Aphids ; *CRISPR-Cas Systems ; *Electroporation ; Female ; *Microinjections ; },
abstract = {While the wealth of genomic data presently available is increasing rapidly, the advancement of functional genomics technologies for the large majority of these organisms has lagged behind. The Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 system is an emerging gene-editing technology derived from a bacterial adaptive immune system that has proven highly effective in multiple model systems. Here, the CRISPR/Cas9 system was delivered into the ovarioles of the pea aphid, Acyrthosiphon pisum (Harris) (Hemiptera, Aphididae), with a new delivery method utilizing in vivo electroporation. To validate gene-editing, a target sequence within the marker tor pigment gene was chosen, and gene-editing was predicted to result in white pigmentation in the offspring of treated adult aphids. Adult aphids (10-d old) were injected with the tor single guide RNA and Cas9 complex and subsequently subjected to electroporation. Adult aphids were given 4 d to produce viviparous offspring. After offspring developed for 6 d, DNA was extracted and sequenced to validate if CRISPR/Cas9-directed gene editing occurred. A survival rate over 70% was found in treated adult aphids. A distinct white pigmentation was found in 2.5% of aphids; however, gene-editing within the target sequence was not found in any of the individuals screened. Presence of white aphids without gene-editing suggests other mechanisms may have influenced pigmentation. High survival rates in experimental treatments demonstrate the robustness of this new technique, and further refinement of this technique may prove it as an effective functional genomics tool for viviparous insects and/or gene editing at a somatic level.},
}
@article {pmid29718217,
year = {2018},
author = {Fujita, T and Yuno, M and Kitaura, F and Fujii, H},
title = {Detection of genome-edited cells by oligoribonucleotide interference-PCR.},
journal = {DNA research : an international journal for rapid publication of reports on genes and genomes},
volume = {25},
number = {4},
pages = {395-407},
doi = {10.1093/dnares/dsy012},
pmid = {29718217},
issn = {1756-1663},
mesh = {CRISPR-Cas Systems ; Cell Line, Tumor ; *Gene Editing ; Humans ; Mutation ; Oligoribonucleotides ; Polymerase Chain Reaction/*methods ; },
abstract = {Genome editing by engineered sequence-specific nucleases, such as the clustered regularly interspaced short palindromic repeats (CRISPR) system is widely used for analysis of gene functions. Several techniques have been developed for detection of genome-edited cells, but simple, cost-effective, and positive detection methods remain limited. Recently, we developed oligoribonucleotide (ORN) interference-PCR (ORNi-PCR), in which hybridization of an ORN with a complementary DNA sequence inhibits amplification across the sequence. Here, we investigated whether ORNi-PCR can be used to detect genome-edited cells. First, we showed that ORNs that hybridize to a CRISPR target site in the THYN1 locus inhibited amplification across the target site, but no longer inhibited amplification after the target site was edited, resulting in mismatches. Importantly, ORNi-PCR could distinguish even single-nucleotide differences. These features of ORNi-PCR enabled detection of genome-edited cells by positive PCR amplification. In addition, ORNi-PCR was successful in discriminating genome-edited cells from wild-type cells, and multiplex ORNi-PCR simultaneously detected indel mutations at multiple loci. However, endpoint ORNi-PCR may not be able to distinguish between mono- and bi-allelic mutations, which may limit its utility. Taken together, these results demonstrate the potential utility of ORNi-PCR for the screening of genome-edited cells.},
}
@article {pmid29717930,
year = {2018},
author = {Zhang, Y and Long, C and Bassel-Duby, R and Olson, EN},
title = {Myoediting: Toward Prevention of Muscular Dystrophy by Therapeutic Genome Editing.},
journal = {Physiological reviews},
volume = {98},
number = {3},
pages = {1205-1240},
doi = {10.1152/physrev.00046.2017},
pmid = {29717930},
issn = {1522-1210},
support = {U54 HD087351/HD/NICHD NIH HHS/United States ; },
abstract = {Muscular dystrophies represent a large group of genetic disorders that significantly impair quality of life and often progress to premature death. There is no effective treatment for these debilitating diseases. Most therapies, developed to date, focus on alleviating the symptoms or targeting the secondary effects, while the underlying gene mutation is still present in the human genome. The discovery and application of programmable nucleases for site-specific DNA double-stranded breaks provides a powerful tool for precise genome engineering. In particular, the CRISPR/Cas system has revolutionized the genome editing field and is providing a new path for disease treatment by targeting the disease-causing genetic mutations. In this review, we provide a historical overview of genome-editing technologies, summarize the most recent advances, and discuss potential strategies and challenges for permanently correcting genetic mutations that cause muscular dystrophies.},
}
@article {pmid29717009,
year = {2018},
author = {Hullahalli, K and Rodrigues, M and Nguyen, UT and Palmer, K},
title = {An Attenuated CRISPR-Cas System in Enterococcus faecalis Permits DNA Acquisition.},
journal = {mBio},
volume = {9},
number = {3},
pages = {},
doi = {10.1128/mBio.00414-18},
pmid = {29717009},
issn = {2150-7511},
support = {R01 AI116610/AI/NIAID NIH HHS/United States ; },
abstract = {Antibiotic-resistant bacteria are critical public health concerns. Among the prime causative factors for the spread of antibiotic resistance is horizontal gene transfer (HGT). A useful model organism for investigating the relationship between HGT and antibiotic resistance is the opportunistic pathogen Enterococcus faecalis, since the species possesses highly conjugative plasmids that readily disseminate antibiotic resistance genes and virulence factors in nature. Unlike many commensal E. faecalis strains, the genomes of multidrug-resistant (MDR) E. faecalis clinical isolates are enriched for mobile genetic elements (MGEs) and lack clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) genome defense systems. CRISPR-Cas systems cleave foreign DNA in a programmable, sequence-specific manner and are disadvantageous for MGE-derived genome expansion. An unexplored facet of CRISPR biology in E. faecalis is that MGEs that are targeted by native CRISPR-Cas systems can be maintained transiently. Here, we investigate the basis for this &quot;CRISPR tolerance.&quot; We observe that E. faecalis can maintain self-targeting constructs that direct Cas9 to cleave the chromosome, but at a fitness cost. Interestingly, DNA repair genes were not upregulated during self-targeting, but integrated prophages were strongly induced. We determined that low cas9 expression contributes to this transient nonlethality and used this knowledge to develop a robust CRISPR-assisted genome-editing scheme. Our results suggest that E. faecalis has maximized the potential for DNA acquisition by attenuating its CRISPR machinery, thereby facilitating the acquisition of potentially beneficial MGEs that may otherwise be restricted by genome defense.IMPORTANCE CRISPR-Cas has provided a powerful toolkit to manipulate bacteria, resulting in improved genetic manipulations and novel antimicrobials. These powerful applications rely on the premise that CRISPR-Cas chromosome targeting, which leads to double-stranded DNA breaks, is lethal. In this study, we show that chromosomal CRISPR targeting in Enterococcus faecalis is transiently nonlethal. We uncover novel phenotypes associated with this &quot;CRISPR tolerance&quot; and, after determining its genetic basis, develop a genome-editing platform in E. faecalis with negligible off-target effects. Our findings reveal a novel strategy exploited by a bacterial pathogen to cope with CRISPR-induced conflicts to more readily accept DNA, and our robust CRISPR editing platform will help simplify genetic modifications in this organism.},
}
@article {pmid29716997,
year = {2018},
author = {Aboudehen, K and Farahani, S and Kanchwala, M and Chan, SC and Avdulov, S and Mickelson, A and Lee, D and Gearhart, MD and Patel, V and Xing, C and Igarashi, P},
title = {Long noncoding RNA Hoxb3os is dysregulated in autosomal dominant polycystic kidney disease and regulates mTOR signaling.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {24},
pages = {9388-9398},
doi = {10.1074/jbc.RA118.001723},
pmid = {29716997},
issn = {1083-351X},
support = {R01 DK102572/DK/NIDDK NIH HHS/United States ; R37 DK042921/DK/NIDDK NIH HHS/United States ; UL1 TR001105/TR/NCATS NIH HHS/United States ; },
abstract = {Autosomal dominant polycystic kidney disease (ADPKD) is a debilitating disease that is characterized by the accumulation of numerous fluid-filled cysts in the kidney. ADPKD is primarily caused by mutations in two genes, PKD1 and PKD2 Long noncoding RNAs (lncRNA), defined by a length >200 nucleotides and absence of a long ORF, have recently emerged as epigenetic regulators of development and disease; however, their involvement in PKD has not been explored previously. Here, we performed deep RNA-Seq to identify lncRNAs that are dysregulated in two orthologous mouse models of ADPKD (kidney-specific Pkd1 and Pkd2 mutant mice). We identified a kidney-specific, evolutionarily conserved lncRNA called Hoxb3os that was down-regulated in cystic kidneys from Pkd1 and Pkd2 mutant mice. The human ortholog HOXB3-AS1 was down-regulated in cystic kidneys from ADPKD patients. Hoxb3os was highly expressed in renal tubules in adult WT mice, whereas its expression was lost in the cyst epithelium of mutant mice. To investigate the function of Hoxb3os, we utilized CRISPR/Cas9 to knock out its expression in mIMCD3 cells. Deletion of Hoxb3os resulted in increased phosphorylation of mTOR and its downstream targets, including p70 S6 kinase, ribosomal protein S6, and the translation repressor 4E-BP1. Consistent with activation of mTORC1 signaling, Hoxb3os mutant cells displayed increased mitochondrial respiration. The Hoxb3os mutant phenotype was partially rescued upon re-expression of Hoxb3os in knockout cells. These findings identify Hoxb3os as a novel lncRNA that is down-regulated in ADPKD and regulates mTOR signaling and mitochondrial respiration.},
}
@article {pmid29716628,
year = {2018},
author = {Ling, K and Jiang, L and Liang, S and Kwong, J and Yang, L and Li, Y and PingYin, and Deng, Q and Liang, Z},
title = {Nanog interaction with the androgen receptor signaling axis induce ovarian cancer stem cell regulation: studies based on the CRISPR/Cas9 system.},
journal = {Journal of ovarian research},
volume = {11},
number = {1},
pages = {36},
doi = {10.1186/s13048-018-0403-2},
pmid = {29716628},
issn = {1757-2215},
support = {81602282//National Natural Science Foundation of China/ ; 81501264//National Natural Science Foundation of China/ ; CYB16121//The Postgraduate Scientific Innovation Project of Chongqing Education Commission/ ; },
mesh = {Androgens/genetics/metabolism ; Animals ; CRISPR-Cas Systems/genetics ; Carcinogenesis/*genetics ; Cell Line, Tumor ; Cell Movement ; Cell Proliferation/genetics ; Female ; Gene Expression Regulation, Neoplastic ; Humans ; Mice ; Nanog Homeobox Protein/*genetics ; Neoplastic Stem Cells/pathology ; Ovarian Neoplasms/*genetics/pathology ; Ovary/growth &amp; development/pathology ; Promoter Regions, Genetic/genetics ; Receptors, Androgen/*genetics ; Signal Transduction/genetics ; Xenograft Model Antitumor Assays ; },
abstract = {BACKGROUND: Ovarian cancer stem cells (OCSCs) contribute to the poor prognosis of ovarian cancer. Involvement of the androgen receptor (AR) in the malignant behaviors of other tumors has been reported. However, whether AR associates with Nanog (a stem cell marker) and participates in OCSC functions remain unclear. In this study, we investigated the interaction of Nanog with AR and examined whether this interaction induced stem-like properties in ovarian cancer cells.<br><br>METHODS: AR and Nanog expression in ovarian tumors was evaluated. Using the CRISPR/Cas9 system, we constructed a Nanog green fluorescent protein (GFP) marker cell model to investigate the expression and co-localization of Nanog and AR. Then, we examined the effect of androgen on the Nanog promoter in ovarian cancer cell lines (A2780 and SKOV3). After androgen or anti-androgen treatment, cell proliferation, migration, sphere formation, colony formation and tumorigenesis were assessed in vitro and in vivo.<br><br>RESULTS: Both AR and Nanog expression were obviously high in ovarian tumors. Our results showed that Nanog expression was correlated with AR expression. The androgen 5α-dihydrotestosterone (DHT) activated Nanog promoter transcription. Meanwhile, Nanog GFP-positive cells treated with DHT exhibited higher levels of proliferation, migration, sphere formation and colony formation. We also observed that the tumorigenesis of Nanog GFP-positive cells was significantly higher than that of the GFP-negative cells. Xenografts of Nanog GFP-positive cells showed significant differences when treated with androgen or anti-androgen drugs in vivo.<br><br>CONCLUSIONS: The interaction of Nanog with the AR signaling axis might induce or contribute to OCSC regulation. In addition, androgen might promote stemness characteristics in ovarian cancer cells by activating the Nanog promoter. This finding merits further study because it may provide a new understanding of OCSC regulation from a hormone perspective and lead to the reevaluation of stem cell therapy for ovarian cancer.},
}
@article {pmid29710373,
year = {2018},
author = {Schindele, P and Wolter, F and Puchta, H},
title = {Transforming plant biology and breeding with CRISPR/Cas9, Cas12 and Cas13.},
journal = {FEBS letters},
volume = {592},
number = {12},
pages = {1954-1967},
doi = {10.1002/1873-3468.13073},
pmid = {29710373},
issn = {1873-3468},
abstract = {Currently, biology is revolutionized by ever growing applications of the CRISPR/Cas system. As discussed in this Review, new avenues have opened up for plant research and breeding by the use of the sequence-specific DNases Cas9 and Cas12 (formerly named Cpf1) and, more recently, the RNase Cas13 (formerly named C2c2). Although double strand break-induced gene editing based on error-prone nonhomologous end joining has been applied to obtain new traits, such as powdery mildew resistance in wheat or improved pathogen resistance and increased yield in tomato, improved technologies based on CRISPR/Cas for programmed change in plant genomes via homologous recombination have recently been developed. Cas9- and Cas12- mediated DNA binding is used to develop tools for many useful applications, such as transcriptional regulation or fluorescence-based imaging of specific chromosomal loci in plant genomes. Cas13 has recently been applied to degrade mRNAs and combat viral RNA replication. By the possibility to address multiple sequences with different guide RNAs and by the simultaneous use of different Cas proteins in a single cell, we should soon be able to achieve complex changes of plant metabolism in a controlled way.},
}
@article {pmid29708546,
year = {2018},
author = {Brunetti, L and Gundry, MC and Kitano, A and Nakada, D and Goodell, MA},
title = {Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {134},
pages = {},
doi = {10.3791/57278},
pmid = {29708546},
issn = {1940-087X},
support = {P50 CA126752/CA/NCI NIH HHS/United States ; S10 RR024574/RR/NCRR NIH HHS/United States ; P30 CA125123/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Editing ; Hematopoietic Stem Cells/*metabolism ; Humans ; Mice ; Stem Cells/*metabolism ; },
abstract = {Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols. A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.},
}
@article {pmid29706536,
year = {2018},
author = {Loeff, L and Brouns, SJJ and Joo, C},
title = {Repetitive DNA Reeling by the Cascade-Cas3 Complex in Nucleotide Unwinding Steps.},
journal = {Molecular cell},
volume = {70},
number = {3},
pages = {385-394.e3},
doi = {10.1016/j.molcel.2018.03.031},
pmid = {29706536},
issn = {1097-4164},
abstract = {CRISPR-Cas provides RNA-guided adaptive immunity against invading genetic elements. Interference in type I systems relies on the RNA-guided Cascade complex for target DNA recognition and the Cas3 helicase/nuclease protein for target degradation. Even though the biochemistry of CRISPR interference has been largely covered, the biophysics of DNA unwinding and coupling of the helicase and nuclease domains of Cas3 remains elusive. Here, we employed single-molecule Förster resonance energy transfer (FRET) to probe the helicase activity with high spatiotemporal resolution. We show that Cas3 remains tightly associated with the target-bound Cascade complex while reeling the DNA using a spring-loaded mechanism. This spring-loaded reeling occurs in distinct bursts of 3 bp, which underlie three successive 1-nt unwinding events. Reeling is highly repetitive, allowing Cas3 to repeatedly present its inefficient nuclease domain with single-strand DNA (ssDNA) substrate. Our study reveals that the discontinuous helicase properties of Cas3 and its tight interaction with Cascade ensure controlled degradation of target DNA only.},
}
@article {pmid29704220,
year = {2018},
author = {Mollanoori, H and Teimourian, S},
title = {Therapeutic applications of CRISPR/Cas9 system in gene therapy.},
journal = {Biotechnology letters},
volume = {40},
number = {6},
pages = {907-914},
doi = {10.1007/s10529-018-2555-y},
pmid = {29704220},
issn = {1573-6776},
mesh = {*CRISPR-Cas Systems ; *Gene Editing ; *Genetic Therapy ; Humans ; },
abstract = {Gene therapy is based on the principle of the genetic manipulation of DNA or RNA for treating and preventing human diseases. The clustered regularly interspaced short palindromic repeats/CRISPR associated nuclease9 (CRISPR/Cas9) system, derived from the acquired immune system in bacteria and archaea, has provided a new tool for accurate manipulation of genomic sequence to attain a therapeutic result. The advantage of CRISPR which made it an easy and flexible tool for diverse genome editing purposes is that a single protein (Cas9) complex with 2 short RNA sequences, function as a site-specific endonuclease. Recently, application of CRISPR/Cas9 system has become popular for therapeutic aims such as gene therapy. In this article, we review the fundamental mechanisms of CRISPR-Cas9 function and summarize preclinical CRISPR-mediated gene therapy reports on a wide variety of disorders.},
}
@article {pmid29702666,
year = {2018},
author = {Breunig, CT and Durovic, T and Neuner, AM and Baumann, V and Wiesbeck, MF and Köferle, A and Götz, M and Ninkovic, J and Stricker, SH},
title = {One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR).},
journal = {PloS one},
volume = {13},
number = {4},
pages = {e0196015},
doi = {10.1371/journal.pone.0196015},
pmid = {29702666},
issn = {1932-6203},
mesh = {CRISPR-Cas Systems ; Gene Editing ; Genetic Engineering/*methods ; HeLa Cells ; Humans ; Promoter Regions, Genetic ; RNA, Guide/*genetics ; },
abstract = {Novel applications based on the bacterial CRISPR system make genetic, genomic, transcriptional and epigenomic engineering widely accessible for the first time. A significant advantage of CRISPR over previous methods is its tremendous adaptability due to its bipartite nature. Cas9 or its engineered variants define the molecular effect, while short gRNAs determine the targeting sites. A majority of CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into single cells, either as an essential precondition, to increase responsive cell populations or to enhance phenotypic outcomes. Despite these requirements, methods allowing the efficient generation and delivery of multiple gRNA expression units into single cells are still sparse. Here we present STAgR (String assembly gRNA cloning), a single step gRNA multiplexing system, that obtains its advantages by employing the N20 targeting sequences as necessary homologies for Gibson assembly. We show that STAgR allows reliable and cost-effective generation of vectors with high numbers of gRNAs enabling multiplexed CRISPR approaches. Moreover, STAgR is easily customizable, as vector backbones as well as gRNA structures, numbers and promoters can be freely chosen and combined. Finally, we demonstrate STAgR's widespread functionality, its efficiency in multi-targeting approaches, using it for both, genome and transcriptome editing, as well as applying it in vitro and in vivo.},
}
@article {pmid29700254,
year = {2018},
author = {Chertow, DS},
title = {Next-generation diagnostics with CRISPR.},
journal = {Science (New York, N.Y.)},
volume = {360},
number = {6387},
pages = {381-382},
doi = {10.1126/science.aat4982},
pmid = {29700254},
issn = {1095-9203},
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Editing ; Humans ; },
}
@article {pmid29700113,
year = {2018},
author = {Abdulrahman, BA and Abdelaziz, DH and Schatzl, HM},
title = {Autophagy regulates exosomal release of prions in neuronal cells.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {23},
pages = {8956-8968},
doi = {10.1074/jbc.RA117.000713},
pmid = {29700113},
issn = {1083-351X},
support = {R01 NS076853/NS/NINDS NIH HHS/United States ; },
abstract = {Prions are protein-based infectious agents that autocatalytically convert the cellular prion protein PrPC to its pathological isoform PrPSc Subsequent aggregation and accumulation of PrPSc in nervous tissues causes several invariably fatal neurodegenerative diseases in humans and animals. Prions can infect recipient cells when packaged into endosome-derived nanoparticles called exosomes, which are present in biological fluids such as blood, urine, and saliva. Autophagy is a basic cellular degradation and recycling machinery that also affects exosomal processing, but whether autophagy controls release of prions in exosomes is unclear. Our work investigated the effect of autophagy modulation on exosomal release of prions and how this interplay affects cellular prion infection. Exosomes isolated from cultured murine central neuronal cells (CAD5) and peripheral neuronal cells (N2a) contained prions as shown by immunoblotting for PrPSc, prion-conversion activity, and cell culture infection. We observed that autophagy stimulation with the mTOR inhibitor rapamycin strongly inhibited exosomal prion release. In contrast, inhibition of autophagy by wortmannin or CRISPR/Cas9-mediated knockout of the autophagy protein Atg5 (autophagy-related 5) greatly increased the release of exosomes and exosome-associated prions. We also show that a difference in exosomal prion release between CAD5 and N2a cells is related to differences at the level of basal autophagy. Taken together, our results indicate that autophagy modulation can control lateral transfer of prions by interfering with their exosomal release. We describe a novel role of autophagy in the prion life cycle, an understanding that may provide useful targets for containing prion diseases.},
}
@article {pmid29695630,
year = {2018},
author = {Cleves, PA and Strader, ME and Bay, LK and Pringle, JR and Matz, MV},
title = {CRISPR/Cas9-mediated genome editing in a reef-building coral.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {20},
pages = {5235-5240},
doi = {10.1073/pnas.1722151115},
pmid = {29695630},
issn = {1091-6490},
mesh = {Animals ; Base Sequence ; *CRISPR-Cas Systems ; *Coral Reefs ; Fibroblast Growth Factor 1/*antagonists &amp; inhibitors/genetics ; *Gene Editing ; Genome ; Genomics ; Green Fluorescent Proteins/*antagonists &amp; inhibitors/genetics ; Luminescent Proteins/*antagonists &amp; inhibitors/genetics ; *Mutation ; Phenotype ; Sequence Homology ; },
abstract = {Reef-building corals are critically important species that are threatened by anthropogenic stresses including climate change. In attempts to understand corals' responses to stress and other aspects of their biology, numerous genomic and transcriptomic studies have been performed, generating a variety of hypotheses about the roles of particular genes and molecular pathways. However, it has not generally been possible to test these hypotheses rigorously because of the lack of genetic tools for corals. Here, we demonstrate efficient genome editing using the CRISPR/Cas9 system in the coral Acropora millepora We targeted the genes encoding fibroblast growth factor 1a (FGF1a), green fluorescent protein (GFP), and red fluorescent protein (RFP). After microinjecting CRISPR/Cas9 ribonucleoprotein complexes into fertilized eggs, we detected induced mutations in the targeted genes using changes in restriction-fragment length, Sanger sequencing, and high-throughput Illumina sequencing. We observed mutations in ∼50% of individuals screened, and the proportions of wild-type and various mutant gene copies in these individuals indicated that mutation induction continued for at least several cell cycles after injection. Although multiple paralogous genes encoding green fluorescent proteins are present in A. millepora, appropriate design of the guide RNA allowed us to induce mutations simultaneously in more than one paralog. Because A. millepora larvae can be induced to settle and begin colony formation in the laboratory, CRISPR/Cas9-based gene editing should allow rigorous tests of gene function in both larval and adult corals.},
}
@article {pmid29693372,
year = {2018},
author = {Skyrud, W and Liu, J and Thankachan, D and Cabrera, M and Seipke, RF and Zhang, W},
title = {Biosynthesis of the 15-Membered Ring Depsipeptide Neoantimycin.},
journal = {ACS chemical biology},
volume = {13},
number = {5},
pages = {1398-1406},
doi = {10.1021/acschembio.8b00298},
pmid = {29693372},
issn = {1554-8937},
abstract = {Antimycins are a family of natural products possessing outstanding biological activities and unique structures, which have intrigued chemists for over a half century. Of particular interest are the ring-expanded antimycins that show promising anticancer potential and whose biosynthesis remains uncharacterized. Specifically, neoantimycin and its analogs have been shown to be effective regulators of the oncogenic proteins GRP78/BiP and K-Ras. The neoantimycin structural skeleton is built on a 15-membered tetralactone ring containing one methyl, one hydroxy, one benzyl, and three alkyl moieties, as well as an amide linkage to a conserved 3-formamidosalicylic acid moiety. Although the biosynthetic gene cluster for neoantimycins was recently identified, the enzymatic logic that governs the synthesis of neoantimycins has not yet been revealed. In this work, the neoantimycin gene cluster is identified, and an updated sequence and annotation is provided delineating a nonribosomal peptide synthetase/polyketide synthase (NRPS/PKS) hybrid scaffold. Using cosmid expression and CRISPR/Cas-based genome editing, several heterologous expression strains for neoantimycin production are constructed in two separate Streptomyces species. A combination of in vivo and in vitro analysis is further used to completely characterize the biosynthesis of neoantimycins including the megasynthases and trans-acting domains. This work establishes a set of highly tractable hosts for producing and engineering neoantimycins and their C11 oxidized analogs, paving the way for neoantimycin-based drug discovery and development.},
}
@article {pmid29690921,
year = {2018},
author = {Sashital, DG},
title = {Pathogen detection in the CRISPR-Cas era.},
journal = {Genome medicine},
volume = {10},
number = {1},
pages = {32},
doi = {10.1186/s13073-018-0543-4},
pmid = {29690921},
issn = {1756-994X},
abstract = {CRISPR-Cas systems have provided revolutionary tools for genome editing. The discovery of Cas proteins with alternative activities has now enabled sensitive and robust tools for detecting nucleic acids. Recent reports harnessing these new CRISPR-Cas technologies display their potential for providing low-cost and practical diagnostic tools for pathogen and disease detection.},
}
@article {pmid29690746,
year = {2018},
author = {Sun, SJ and Huo, JH and Geng, ZJ and Sun, XY and Fu, XB},
title = {[Advances in application of clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 system in stem cells research].},
journal = {Zhonghua shao shang za zhi = Zhonghua shaoshang zazhi = Chinese journal of burns},
volume = {34},
number = {4},
pages = {253-256},
pmid = {29690746},
issn = {1009-2587},
mesh = {Animals ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Editing/*methods ; Humans ; Stem Cells ; },
abstract = {Gene engineering has attracted worldwide attention because of its ability of precise location of disease mutations in genome. As a new gene editing technology, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system is simple, fast, and accurate to operate at a specific gene site. It overcomes the long-standing problem of conventional operation. At the same time, stem cells are a good foundation for establishing disease model in vitro. Therefore, it has great significance to combine stem cells with the rapidly developing gene manipulation techniques. In this review, we mainly focus on the mechanism of CRISPR/Cas9 technology and its application in stem cell genomic editing, so as to pave the way for promoting rapid application and development of CRISPR/Cas9 technology.},
}
@article {pmid29690620,
year = {2018},
author = {, and Sybesma, W and Rohde, C and Bardy, P and Pirnay, JP and Cooper, I and Caplin, J and Chanishvili, N and Coffey, A and De Vos, D and Scholz, AH and McCallin, S and Püschner, HM and Pantucek, R and Aminov, R and Doškař, J and Kurtbӧke, Dİ},
title = {Silk Route to the Acceptance and Re-Implementation of Bacteriophage Therapy-Part II.},
journal = {Antibiotics (Basel, Switzerland)},
volume = {7},
number = {2},
pages = {},
doi = {10.3390/antibiotics7020035},
pmid = {29690620},
issn = {2079-6382},
abstract = {This perspective paper follows up on earlier communications on bacteriophage therapy that we wrote as a multidisciplinary and intercontinental expert-panel when we first met at a bacteriophage conference hosted by the Eliava Institute in Tbilisi, Georgia in 2015. In the context of a society that is confronted with an ever-increasing number of antibiotic-resistant bacteria, we build on the previously made recommendations and specifically address how the Nagoya Protocol might impact the further development of bacteriophage therapy. By reviewing a number of recently conducted case studies with bacteriophages involving patients with bacterial infections that could no longer be successfully treated by regular antibiotic therapy, we again stress the urgency and significance of the development of international guidelines and frameworks that might facilitate the legal and effective application of bacteriophage therapy by physicians and the receiving patients. Additionally, we list and comment on several recently started and ongoing clinical studies, including highly desired double-blind placebo-controlled randomized clinical trials. We conclude with an outlook on how recently developed DNA editing technologies are expected to further control and enhance the efficient application of bacteriophages.},
}
@article {pmid29686335,
year = {2018},
author = {Neff, EP},
title = {CRISPR through to emphysema.},
journal = {Lab animal},
volume = {47},
number = {5},
pages = {124},
doi = {10.1038/s41684-018-0055-2},
pmid = {29686335},
issn = {1548-4475},
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Emphysema ; Humans ; },
}
@article {pmid29686087,
year = {2018},
author = {Wang, HX and Song, Z and Lao, YH and Xu, X and Gong, J and Cheng, D and Chakraborty, S and Park, JS and Li, M and Huang, D and Yin, L and Cheng, J and Leong, KW},
title = {Nonviral gene editing via CRISPR/Cas9 delivery by membrane-disruptive and endosomolytic helical polypeptide.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {19},
pages = {4903-4908},
doi = {10.1073/pnas.1712963115},
pmid = {29686087},
issn = {1091-6490},
support = {R01 AI096305/AI/NIAID NIH HHS/United States ; R01 GM110494/GM/NIGMS NIH HHS/United States ; R01 HL109442/HL/NHLBI NIH HHS/United States ; UH3 TR000505/TR/NCATS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; *Cell-Penetrating Peptides/chemistry/pharmacology ; Gene Editing/*methods ; *Gene Transfer Techniques ; HEK293 Cells ; HeLa Cells ; Humans ; K562 Cells ; Mice ; NIH 3T3 Cells ; Nanoparticles/*chemistry ; *Plasmids/chemistry/genetics/pharmacology ; },
abstract = {Effective and safe delivery of the CRISPR/Cas9 gene-editing elements remains a challenge. Here we report the development of PEGylated nanoparticles (named P-HNPs) based on the cationic α-helical polypeptide poly(γ-4-((2-(piperidin-1-yl)ethyl)aminomethyl)benzyl-l-glutamate) for the delivery of Cas9 expression plasmid and sgRNA to various cell types and gene-editing scenarios. The cell-penetrating α-helical polypeptide enhanced cellular uptake and promoted escape of pCas9 and/or sgRNA from the endosome and transport into the nucleus. The colloidally stable P-HNPs achieved a Cas9 transfection efficiency up to 60% and sgRNA uptake efficiency of 67.4%, representing an improvement over existing polycation-based gene delivery systems. After performing single or multiplex gene editing with an efficiency up to 47.3% in vitro, we demonstrated that P-HNPs delivering Cas9 plasmid/sgRNA targeting the polo-like kinase 1 (Plk1) gene achieved 35% gene deletion in HeLa tumor tissue to reduce the Plk1 protein level by 66.7%, thereby suppressing the tumor growth by >71% and prolonging the animal survival rate to 60% within 60 days. Capable of delivering Cas9 plasmids to various cell types to achieve multiplex gene knock-out, gene knock-in, and gene activation in vitro and in vivo, the P-HNP system offers a versatile gene-editing platform for biological research and therapeutic applications.},
}
@article {pmid29685979,
year = {2018},
author = {Geel, TM and Ruiters, MHJ and Cool, RH and Halby, L and Voshart, DC and Andrade Ruiz, L and Niezen-Koning, KE and Arimondo, PB and Rots, MG},
title = {The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.},
journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences},
volume = {373},
number = {1748},
pages = {},
doi = {10.1098/rstb.2017.0077},
pmid = {29685979},
issn = {1471-2970},
abstract = {The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'.},
}
@article {pmid29685168,
year = {2018},
author = {Zhao, Q and Qian, Q and Cao, D and Yang, J and Gui, T and Shen, K},
title = {Role of BMI1 in epithelial ovarian cancer: investigated via the CRISPR/Cas9 system and RNA sequencing.},
journal = {Journal of ovarian research},
volume = {11},
number = {1},
pages = {31},
doi = {10.1186/s13048-018-0406-z},
pmid = {29685168},
issn = {1757-2215},
support = {81372780//National Natural Science Foundation of China (CN)/ ; 81402140//National Natural Science Foundation of China (CN)/ ; },
mesh = {Animals ; Apoptosis ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Movement/genetics ; Flow Cytometry ; Focal Adhesions/genetics ; Gene Expression Regulation, Neoplastic ; Gene Silencing ; High-Throughput Nucleotide Sequencing/*methods ; Humans ; Mice ; Neoplasm Invasiveness/genetics ; Neoplasms, Glandular and Epithelial/*genetics/pathology ; Ovarian Neoplasms/*genetics/pathology ; Polycomb Repressive Complex 1/antagonists &amp; inhibitors/*genetics ; Sequence Analysis, RNA ; Xenograft Model Antitumor Assays ; },
abstract = {BACKGROUND: B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) might be an appropriate biomarker in the management of epithelial ovarian cancer (EOC). However, the biological role of BMI1 and its relevant molecular mechanism needs further elaboration. Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system is an excellent genome-editing tool and is scarcely used in EOC studies.<br><br>METHODS: We first applied CRISPR/Cas9 technique to silence BMI1 in EOC cells; thereafter we accomplished various in vivo and in vitro experiments to detect biological behaviors of ovarian cancer cells, including MTT, flow cytometry, Transwell, real-time polymerase chain reaction and western blotting assays, etc.; eventually, we used RNA sequencing to reveal the underlying molecular traits driven by BMI1 in EOC.<br><br>RESULTS: We successfully shut off the expression of BMI1 in EOC cells using CRISPR/Cas9 system, providing an ideal cellular model for investigations of target gene. Silencing BMI1 could reduce cell growth and metastasis, promote cell apoptosis, and enhance the platinum sensitivity of EOC cells. BMI1 might alter extracellular matrix structure and angiogenesis of tumor cells through regulating Focal adhesion and PI3K/AKT pathways.<br><br>CONCLUSION: BMI1 is a potential biomarker in EOC management, especially for tumor progression and chemo-resistance. Molecular traits, including BMI1 and core genes in Focal adhesion and PI3K/AKT pathways, might be alternatives as therapeutic targets for EOC.},
}
@article {pmid29685154,
year = {2018},
author = {Wang, B and Hu, Q and Zhang, Y and Shi, R and Chai, X and Liu, Z and Shang, X and Zhang, Y and Wen, T},
title = {A RecET-assisted CRISPR-Cas9 genome editing in Corynebacterium glutamicum.},
journal = {Microbial cell factories},
volume = {17},
number = {1},
pages = {63},
doi = {10.1186/s12934-018-0910-2},
pmid = {29685154},
issn = {1475-2859},
support = {KFJ-STS-QYZD-047//the Science and Technology Service Network Initiative of the Chinese Academy of Sciences/ ; KFJ-EW-STS-078//the Science and Technology Service Network Initiative of the Chinese Academy of Sciences/ ; 31100074//National Natural Science Foundation of China/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Corynebacterium glutamicum/*metabolism ; Gene Editing/*methods ; },
abstract = {BACKGROUND: Extensive modification of genome is an efficient manner to regulate the metabolic network for producing target metabolites or non-native products using Corynebacterium glutamicum as a cell factory. Genome editing approaches by means of homologous recombination and counter-selection markers are laborious and time consuming due to multiple round manipulations and low editing efficiencies. The current two-plasmid-based CRISPR-Cas9 editing methods generate false positives due to the potential instability of Cas9 on the plasmid, and require a high transformation efficiency for co-occurrence of two plasmids transformation.<br><br>RESULTS: Here, we developed a RecET-assisted CRISPR-Cas9 genome editing method using a chromosome-borne Cas9-RecET and a single plasmid harboring sgRNA and repair templates. The inducible expression of chromosomal RecET promoted the frequencies of homologous recombination, and increased the efficiency for gene deletion. Due to the high transformation efficiency of a single plasmid, this method enabled 10- and 20-kb region deletion, 2.5-, 5.7- and 7.5-kb expression cassette insertion and precise site-specific mutation, suggesting a versatility of this method. Deletion of argR and farR regulators as well as site-directed mutation of argB and pgi genes generated the mutant capable of accumulating L-arginine, indicating the stability of chromosome-borne Cas9 for iterative genome editing. Using this method, the model-predicted target genes were modified to redirect metabolic flux towards 1,2-propanediol biosynthetic pathway. The final engineered strain produced 6.75 ± 0.46 g/L of 1,2-propanediol that is the highest titer reported in C. glutamicum. Furthermore, this method is available for Corynebacterium pekinense 1.563, suggesting its universal applicability in other Corynebacterium species.<br><br>CONCLUSIONS: The RecET-assisted CRISPR-Cas9 genome editing method will facilitate engineering of metabolic networks for the synthesis of interested bio-based products from renewable biomass using Corynebacterium species as cell factories.},
}
@article {pmid29684067,
year = {2018},
author = {Uusi-Mäkelä, MIE and Barker, HR and Bäuerlein, CA and Häkkinen, T and Nykter, M and Rämet, M},
title = {Chromatin accessibility is associated with CRISPR-Cas9 efficiency in the zebrafish (Danio rerio).},
journal = {PloS one},
volume = {13},
number = {4},
pages = {e0196238},
doi = {10.1371/journal.pone.0196238},
pmid = {29684067},
issn = {1932-6203},
mesh = {Animals ; CRISPR-Cas Systems ; Chromatin/*chemistry/genetics ; Databases, Genetic ; Embryonic Development ; Gene Expression ; Gene Expression Regulation, Developmental ; RNA, Guide/*genetics ; Transcriptional Activation ; Zebrafish/*embryology/genetics ; Zebrafish Proteins/*genetics ; },
abstract = {CRISPR-Cas9 technology is routinely applied for targeted mutagenesis in model organisms and cell lines. Recent studies indicate that the prokaryotic CRISPR-Cas9 system is affected by eukaryotic chromatin structures. Here, we show that the likelihood of successful mutagenesis correlates with transcript levels during early development in zebrafish (Danio rerio) embryos. In an experimental setting, we found that guide RNAs differ in their onset of mutagenesis activity in vivo. Furthermore, some guide RNAs with high in vitro activity possessed poor mutagenesis activity in vivo, suggesting the presence of factors that limit the mutagenesis in vivo. Using open access datasets generated from early developmental stages of the zebrafish, and guide RNAs selected from the CRISPRz database, we provide further evidence for an association between gene expression during early development and the success of CRISPR-Cas9 mutagenesis in zebrafish embryos. In order to further inspect the effect of chromatin on CRISPR-Cas9 mutagenesis, we analysed the relationship of selected chromatin features on CRISPR-Cas9 mutagenesis efficiency using publicly available data from zebrafish embryos. We found a correlation between chromatin openness and the efficiency of CRISPR-Cas9 mutagenesis. These results indicate that CRISPR-Cas9 mutagenesis is influenced by chromatin accessibility in zebrafish embryos.},
}
@article {pmid29678175,
year = {2018},
author = {Zhang, JL and Peng, YZ and Liu, D and Liu, H and Cao, YX and Li, BZ and Li, C and Yuan, YJ},
title = {Gene repression via multiplex gRNA strategy in Y. lipolytica.},
journal = {Microbial cell factories},
volume = {17},
number = {1},
pages = {62},
doi = {10.1186/s12934-018-0909-8},
pmid = {29678175},
issn = {1475-2859},
support = {&quot;973&quot;Program: 2014CB745100//The Ministry of Science and Technology of China/ ; Major Program: 21621004//The National Natural Science Foundation of China/ ; Foundation for Young Scholars: 21506153//The National Natural Science Foundation of China/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Gene Expression/*genetics ; RNA, Guide/*genetics ; Yarrowia/*genetics/metabolism ; },
abstract = {BACKGROUND: The oleaginous yeast Yarrowia lipolytica is a promising microbial cell factory due to their biochemical characteristics and native capacity to accumulate lipid-based chemicals. To create heterogenous biosynthesis pathway and manipulate metabolic flux in Y. lipolytica, numerous studies have been done for developing synthetic biology tools for gene regulation. CRISPR interference (CRISPRi), as an emerging technology, has been applied for specifically repressing genes of interest.<br><br>RESULTS: In this study, we established CRISPRi systems in Y. lipolytica based on four different repressors, that was DNase-deactivated Cpf1 (dCpf1) from Francisella novicida, deactivated Cas9 (dCas9) from Streptococcus pyogenes, and two fusion proteins (dCpf1-KRAB and dCas9-KRAB). Ten gRNAs that bound to different regions of gfp gene were designed and the results indicated that there was no clear correlation between the repression efficiency and targeting sites no matter which repressor protein was used. In order to rapidly yield strong gene repression, a multiplex gRNAs strategy based on one-step Golden-brick assembly technology was developed. High repression efficiency 85% (dCpf1) and 92% (dCas9) were achieved in a short time by making three different gRNAs towards gfp gene simultaneously, which avoided the need of screening effective gRNA loci in advance. Moreover, two genes interference including gfp and vioE and three genes repression including vioA, vioB and vioE in protodeoxy-violaceinic acid pathway were also realized.<br><br>CONCLUSION: Taken together, successful CRISPRi-mediated regulation of gene expression via four different repressors dCpf1, dCas9, dCpf1-KRAB and dCas9-KRAB in Y. lipolytica is achieved. And we demonstrate a multiplexed gRNA targeting strategy can efficiently achieve transcriptional simultaneous repression of several targeted genes and different sites of one gene using the one-step Golden-brick assembly. This timesaving method promised to be a potent transformative tool valuable for metabolic engineering, synthetic biology, and functional genomic studies of Y. lipolytica.},
}
@article {pmid29676032,
year = {2018},
author = {Acosta, S and Fiore, L and Carota, IA and Oliver, G},
title = {Use of two gRNAs for CRISPR/Cas9 improves bi-allelic homologous recombination efficiency in mouse embryonic stem cells.},
journal = {Genesis (New York, N.Y. : 2000)},
volume = {56},
number = {5},
pages = {e23212},
doi = {10.1002/dvg.23212},
pmid = {29676032},
issn = {1526-968X},
support = {R01 EY012162/EY/NEI NIH HHS/United States ; },
mesh = {Alleles ; Animals ; CRISPR-Cas Systems/genetics/physiology ; Gene Editing/*methods ; Gene Targeting/methods ; Genetic Engineering/methods ; Homologous Recombination/genetics ; Mice/embryology ; Mouse Embryonic Stem Cells/metabolism ; RNA, Guide/*genetics/metabolism ; Regulatory Sequences, Nucleic Acid/genetics ; },
abstract = {Targeted genome editing in mouse embryonic stem cells (ESCs) is a powerful resource to functionally characterize genes and regulatory elements. The use of the CRISPR/Cas9 genome editing approach has remarkably improved the time and efficiency of targeted recombination. However, the efficiency of this protocol is still far from ideal when aiming for bi-allelic homologous recombination, requiring at least two independent targeting recombination events. Here we describe an improved protocol that uses two gRNAs flanking the selected targeted region, leading to highly efficient homologous recombination in mouse ESCs. The bi-allelic recombination targeting efficiency is over 90% when using two gRNAs together with the inhibition of non-homologous end-joint repair. Moreover, this technique is compatible with the generation of knocked-in mice and the use of ESC-derived differentiation protocols, therefore facilitating and accelerating the gene targeting in mice and ESCs.},
}
@article {pmid29672299,
year = {2018},
author = {Liu, T and Yan, Z and Liu, Y and Choy, E and Hornicek, FJ and Mankin, H and Duan, Z},
title = {CRISPR-Cas9-Mediated Silencing of CD44 in Human Highly Metastatic Osteosarcoma Cells.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {46},
number = {3},
pages = {1218-1230},
doi = {10.1159/000489072},
pmid = {29672299},
issn = {1421-9778},
mesh = {Bone Neoplasms/*pathology ; CRISPR-Cas Systems/*genetics ; Cell Culture Techniques ; Cell Line, Tumor ; Cell Movement ; Databases, Factual ; Humans ; Hyaluronan Receptors/deficiency/*genetics ; Microscopy, Fluorescence ; Neoplasm Metastasis ; Osteosarcoma/*pathology ; },
abstract = {BACKGROUND/AIMS: Metastasis is the major cause of death in patients with osteosarcoma. There is an urgent need to identify molecular markers that promote metastasis. Cluster of differentiation 44 is a receptor for hyaluronic acid (HA) and HA-binding has been proven to participate in various biological tumor activities, including tumor progression and metastasis.<br><br>METHODS: We performed a meta-analysis to investigate the relationship between CD44 expression, survival, and metastasis in patients with osteosarcoma. We then utilized the CRISPR-Cas9 system to specifically silence CD44 in highly metastatic human osteosarcoma cells (MNNG/HOS and 143B) and further determined the functional effects of CD44 knockout in these cells.<br><br>RESULTS: The meta-analysis demonstrated that a high level of CD44 may predict poor survival and higher potential of metastasis in patients with osteosarcoma. The expression of CD44 in highly metastatic human osteosarcoma cell lines was efficiently blocked by CRISPR-Cas9. When CD44 was silenced, the proliferation and spheroid formation of these osteosarcoma cells was inhibited under 3-D culture conditions. Furthermore, the migratory and invasive functions were also impaired in these highly metastatic osteosarcoma cells.<br><br>CONCLUSION: These results suggest that developing new strategies to target CD44 in osteosarcoma may prevent metastasis and improve the clinical outcome of osteosarcoma patients.},
}
@article {pmid29671068,
year = {2018},
author = {Xiao, Q and Min, T and Ma, S and Hu, L and Chen, H and Lu, D},
title = {Intracellular generation of single-strand template increases the knock-in efficiency by combining CRISPR/Cas9 with AAV.},
journal = {Molecular genetics and genomics : MGG},
volume = {293},
number = {4},
pages = {1051-1060},
doi = {10.1007/s00438-018-1437-2},
pmid = {29671068},
issn = {1617-4623},
support = {2017YFC0907501//Precision Medicine Research Key Project of National Key R&amp;D Plan/ ; 81772657//National Natural Science Foundation of China/ ; 31571371//National Natural Science Foundation of China/ ; 81372706//National Natural Science Foundation of China/ ; },
mesh = {*CRISPR-Cas Systems ; DNA, Single-Stranded/genetics/metabolism ; *DNA, Viral/biosynthesis/genetics ; *Dependovirus/genetics/metabolism ; Gene Knock-In Techniques/*methods ; *Genome, Viral ; HEK293 Cells ; Humans ; *Terminal Repeat Sequences ; },
abstract = {Targeted integration of transgenes facilitates functional genomic research and holds prospect for gene therapy. The established microhomology-mediated end-joining (MMEJ)-based strategy leads to the precise gene knock-in with easily constructed donor, yet the limited efficiency remains to be further improved. Here, we show that single-strand DNA (ssDNA) donor contributes to efficient increase of knock-in efficiency and establishes a method to achieve the intracellular linearization of long ssDNA donor. We identified that the CRISPR/Cas9 system is responsible for breaking double-strand DNA (dsDNA) of palindromic structure in inverted terminal repeats (ITRs) region of recombinant adeno-associated virus (AAV), leading to the inhibition of viral second-strand DNA synthesis. Combing Cas9 plasmids targeting genome and ITR with AAV donor delivery, the precise knock-in of gene cassette was achieved, with 13-14% of the donor insertion events being mediated by MMEJ in HEK 293T cells. This study describes a novel method to integrate large single-strand transgene cassettes into the genomes, increasing knock-in efficiency by 13.6-19.5-fold relative to conventional AAV-mediated method. It also provides a comprehensive solution to the challenges of complicated production and difficult delivery with large exogenous fragments.},
}
@article {pmid29670305,
year = {2017},
author = {Scott, R and Wilkinson, S},
title = {Germline Genetic Modification and Identity: the Mitochondrial and Nuclear Genomes.},
journal = {Oxford journal of legal studies},
volume = {37},
number = {4},
pages = {886-915},
doi = {10.1093/ojls/gqx012},
pmid = {29670305},
issn = {0143-6503},
support = {//Wellcome Trust/United Kingdom ; },
abstract = {In a legal 'first', the UK removed a prohibition against modifying embryos in human reproduction, to enable mitochondrial replacement techniques (MRTs), a move the Government distanced from 'germline genetic modification', which it aligned with modifying the nuclear genome. This paper (1) analyzes the uses and meanings of this term in UK/US legal and policy debates; and (2) evaluates related ethical concerns about identity. It shows that, with respect to identity, MRTs and nuclear genome editing techniques such as CRISPR/Cas-9 (now a policy topic), are not as different as has been supposed. While it does not follow that the two should be treated exactly alike, one of the central reasons offered for treating MRTs more permissively than nuclear genetic modification, and for not regarding MRTs as 'germline genetic modification', is thereby in doubt. Identity cannot, by itself, do the work thus far assigned to it, explicitly or otherwise, in law and policy.},
}
@article {pmid29669988,
year = {2018},
author = {Ishino, T and Hashimoto, M and Amagasa, M and Saito, N and Dochi, O and Kirisawa, R and Kitamura, H},
title = {Establishment of protocol for preparation of gene-edited bovine ear-derived fibroblasts for somatic cell nuclear transplantation.},
journal = {Biomedical research (Tokyo, Japan)},
volume = {39},
number = {2},
pages = {95-104},
doi = {10.2220/biomedres.39.95},
pmid = {29669988},
issn = {1880-313X},
mesh = {Animals ; CRISPR-Cas Systems ; Cattle ; Clone Cells ; Fibroblasts/*metabolism ; *Gene Editing/methods ; Genetic Loci ; Genotype ; HeLa Cells ; Humans ; Mutation ; *Nuclear Transfer Techniques ; Receptor-Like Protein Tyrosine Phosphatases, Class 2/genetics ; Reproducibility of Results ; Transfection ; },
abstract = {Recently, gene-editing using the clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR-associated protein 9 (Cas9) technique has attempted to utilize fibroblasts of livestock animals for somatic cell nuclear transfer. In this study, we establish the procedure for preparing skin fibroblast clones whose genes were edited by the CRISPR/Cas9 technique. After isolating fibroblasts from earlobes of Japanese Black cattle, subsequent collagenase-digestion and extensive wash procedures enabled us to avoid contamination of fungi. Electroporation using NEPA21, rather than lipofection using commercially available liposome reagents, allowed us to perform more efficient transfection of plasmid constructs. Although bovine ear-derived fibroblasts were not able to proliferate in single cell cultures in Dulbecco's modified Eagle medium containing 10% fetal calf serum, supplementation with insulin-transferrin-selenium mixture, human recombinant epidermal growth factor, or human recombinant basic fibroblast growth factor promoted proliferation of the cells, even in a single cell culture. Taking advantage of our established protocol, we eventually obtained eight ear-derived fibroblast clones with a recessive mutation in the isoleucyl-tRNA synthetase gene corrected by the CRISPR/Cas9 technique.},
}
@article {pmid29668265,
year = {2018},
author = {Rouet, R and Thuma, BA and Roy, MD and Lintner, NG and Rubitski, DM and Finley, JE and Wisniewska, HM and Mendonsa, R and Hirsh, A and de Oñate, L and Compte Barrón, J and McLellan, TJ and Bellenger, J and Feng, X and Varghese, A and Chrunyk, BA and Borzilleri, K and Hesp, KD and Zhou, K and Ma, N and Tu, M and Dullea, R and McClure, KF and Wilson, RC and Liras, S and Mascitti, V and Doudna, JA},
title = {Receptor-Mediated Delivery of CRISPR-Cas9 Endonuclease for Cell-Type-Specific Gene Editing.},
journal = {Journal of the American Chemical Society},
volume = {140},
number = {21},
pages = {6596-6603},
doi = {10.1021/jacs.8b01551},
pmid = {29668265},
issn = {1520-5126},
support = {//Howard Hughes Medical Institute/United States ; },
mesh = {*CRISPR-Cas Systems ; Cell Line, Tumor ; Endonucleases/genetics/*metabolism ; *Gene Editing ; Hep G2 Cells ; Humans ; Molecular Structure ; Protein Engineering ; },
abstract = {CRISPR-Cas RNA-guided endonucleases hold great promise for disrupting or correcting genomic sequences through site-specific DNA cleavage and repair. However, the lack of methods for cell- and tissue-selective delivery currently limits both research and clinical uses of these enzymes. We report the design and in vitro evaluation of S. pyogenes Cas9 proteins harboring asialoglycoprotein receptor ligands (ASGPrL). In particular, we demonstrate that the resulting ribonucleoproteins (Cas9-ASGPrL RNP) can be engineered to be preferentially internalized into cells expressing the corresponding receptor on their surface. Uptake of such fluorescently labeled proteins in liver-derived cell lines HEPG2 (ASGPr+) and SKHEP (control; diminished ASGPr) was studied by live cell imaging and demonstrates increased accumulation of Cas9-ASGPrL RNP in HEPG2 cells as a result of effective ASGPr-mediated endocytosis. When uptake occurred in the presence of a peptide with endosomolytic properties, we observed receptor-facilitated and cell-type specific gene editing that did not rely on electroporation or the use of transfection reagents. Overall, these in vitro results validate the receptor-mediated delivery of genome-editing enzymes as an approach for cell-selective gene editing and provide a framework for future potential applications to hepatoselective gene editing in vivo.},
}
@article {pmid29668111,
year = {2018},
author = {Dahan-Meir, T and Filler-Hayut, S and Melamed-Bessudo, C and Bocobza, S and Czosnek, H and Aharoni, A and Levy, AA},
title = {Efficient in planta gene targeting in tomato using geminiviral replicons and the CRISPR/Cas9 system.},
journal = {The Plant journal : for cell and molecular biology},
volume = {95},
number = {1},
pages = {5-16},
doi = {10.1111/tpj.13932},
pmid = {29668111},
issn = {1365-313X},
abstract = {Current breeding relies mostly on random mutagenesis and recombination to generate novel genetic variation. However, targeted genome editing is becoming an increasingly important tool for precise plant breeding. Using the CRISPR-Cas system combined with the bean yellow dwarf virus rolling circle replicon, we optimized a method for targeted mutagenesis and gene replacement in tomato. The carotenoid isomerase (CRTISO) and phytoene synthase 1 (PSY1) genes from the carotenoid biosynthesis pathway were chosen as targets due to their easily detectable change of phenotype. We took advantage of the geminiviral replicon amplification as a means to provide a large amount of donor template for the repair of a CRISPR-Cas-induced DNA double-strand break (DSB) in the target gene, via homologous recombination (HR). Mutagenesis experiments, performed in the Micro-Tom variety, achieved precise modification of the CRTISO and PSY1 loci at an efficiency of up to 90%. In the gene targeting (GT) experiments, our target was a fast-neutron-induced crtiso allele that contained a 281-bp deletion. This deletion was repaired with the wild-type sequence through HR between the CRISPR-Cas-induced DSB in the crtiso target and the amplified donor in 25% of the plants transformed. This shows that efficient GT can be achieved in the absence of selection markers or reporters using a single and modular construct that is adaptable to other tomato targets and other crops.},
}
@article {pmid29666786,
year = {2018},
author = {LaMarca, EA and Powell, SK and Akbarian, S and Brennand, KJ},
title = {Modeling Neuropsychiatric and Neurodegenerative Diseases With Induced Pluripotent Stem Cells.},
journal = {Frontiers in pediatrics},
volume = {6},
number = {},
pages = {82},
doi = {10.3389/fped.2018.00082},
pmid = {29666786},
issn = {2296-2360},
abstract = {Human-induced pluripotent stem cells (hiPSCs) have revolutionized our ability to model neuropsychiatric and neurodegenerative diseases, and recent progress in the field is paving the way for improved therapeutics. In this review, we discuss major advances in generating hiPSC-derived neural cells and cutting-edge techniques that are transforming hiPSC technology, such as three-dimensional &quot;mini-brains&quot; and clustered, regularly interspersed short palindromic repeats (CRISPR)-Cas systems. We examine specific examples of how hiPSC-derived neural cells are being used to uncover the pathophysiology of schizophrenia and Parkinson's disease, and consider the future of this groundbreaking research.},
}
@article {pmid29666291,
year = {2018},
author = {Cooper, LA and Stringer, AM and Wade, JT},
title = {Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.},
journal = {mBio},
volume = {9},
number = {2},
pages = {},
doi = {10.1128/mBio.02100-17},
pmid = {29666291},
issn = {2150-7511},
support = {R01 GM122836/GM/NIGMS NIH HHS/United States ; R21 AI126416/AI/NIAID NIH HHS/United States ; },
abstract = {In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing.IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets.},
}
@article {pmid29666231,
year = {2018},
author = {Jia, Y and Xu, RG and Ren, X and Ewen-Campen, B and Rajakumar, R and Zirin, J and Yang-Zhou, D and Zhu, R and Wang, F and Mao, D and Peng, P and Qiao, HH and Wang, X and Liu, LP and Xu, B and Ji, JY and Liu, Q and Sun, J and Perrimon, N and Ni, JQ},
title = {Next-generation CRISPR/Cas9 transcriptional activation in Drosophila using flySAM.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {18},
pages = {4719-4724},
doi = {10.1073/pnas.1800677115},
pmid = {29666231},
issn = {1091-6490},
support = {F32 GM113395/GM/NIGMS NIH HHS/United States ; R01 GM084947/GM/NIGMS NIH HHS/United States ; R24 OD021997/OD/NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Animals ; *Animals, Genetically Modified/genetics/metabolism ; *CRISPR-Cas Systems ; *Drosophila Proteins/biosynthesis/genetics ; Drosophila melanogaster ; Gene Expression Regulation/*genetics ; *Transcription Factors/biosynthesis/genetics ; },
abstract = {CRISPR/Cas9-based transcriptional activation (CRISPRa) has recently emerged as a powerful and scalable technique for systematic overexpression genetic analysis in Drosophila melanogaster We present flySAM, a potent tool for in vivo CRISPRa, which offers major improvements over existing strategies in terms of effectiveness, scalability, and ease of use. flySAM outperforms existing in vivo CRISPRa strategies and approximates phenotypes obtained using traditional Gal4-UAS overexpression. Moreover, because flySAM typically requires only a single sgRNA, it dramatically improves scalability. We use flySAM to demonstrate multiplexed CRISPRa, which has not been previously shown in vivo. In addition, we have simplified the experimental use of flySAM by creating a single vector encoding both the UAS:Cas9-activator and the sgRNA, allowing for inducible CRISPRa in a single genetic cross. flySAM will replace previous CRISPRa strategies as the basis of our growing genome-wide transgenic overexpression resource, TRiP-OE.},
}
@article {pmid29665362,
year = {2018},
author = {Ooga, M and Funaya, S and Hashioka, Y and Fujii, W and Naito, K and Suzuki, MG and Aoki, F},
title = {Chd9 mediates highly loosened chromatin structure in growing mouse oocytes.},
journal = {Biochemical and biophysical research communications},
volume = {500},
number = {3},
pages = {583-588},
doi = {10.1016/j.bbrc.2018.04.105},
pmid = {29665362},
issn = {1090-2104},
mesh = {Animals ; Base Sequence ; Blastocyst/metabolism ; CRISPR-Cas Systems/genetics ; Cell Proliferation ; Chromatin/*metabolism ; Female ; Gene Expression Profiling ; Gene Expression Regulation, Developmental ; Green Fluorescent Proteins/metabolism ; Histones/metabolism ; Mice, Inbred C57BL ; Mice, Knockout ; Oocytes/*cytology/*metabolism ; Trans-Activators/deficiency/*metabolism ; },
abstract = {During oogenesis, oocytes prepare for embryonic development following fertilization. The mechanisms underlying this process are still unknown. Recently, it has been suggested that a loosened chromatin structure is involved in pluripotency and totipotency in embryonic stem (ES) cells and early preimplantation embryos, respectively. Here, we explored chromatin looseness in oocytes by fluorescence recovery after photobleaching (FRAP) using enhanced green fluorescent protein-tagged histone H2B. The results indicated that the chromatin in growing oocytes was already highly loosened to a level comparable to that in early preimplantation embryos. To elucidate the mechanism underlying the loosened chromatin structure in oocytes, we focused on chromodomain helicase DNA binding protein 9 (Chd9), which is highly expressed in growing oocytes. The oocytes from Chd9 knockout mice (Chd9-/-) generated using the CRISPR/Cas9 system exhibited a less loosened chromatin structure than that of wild-type mice, suggesting that Chd9 is involved in the loosened chromatin structure in growing oocytes. These results suggest that a loosened chromatin structure, which is mediated by Chd9, is a prerequisite for the acquisition of totipotency after fertilization.},
}
@article {pmid29663663,
year = {2018},
author = {Deaner, M and Holzman, A and Alper, HS},
title = {Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700582},
doi = {10.1002/biot.201700582},
pmid = {29663663},
issn = {1860-7314},
support = {FA9550-14-1-0089//Air Force Office of Scientific Research/ ; },
abstract = {Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale.},
}
@article {pmid29661863,
year = {2018},
author = {Reyes-Robles, T and Dillard, RS and Cairns, LS and Silva-Valenzuela, CA and Housman, M and Ali, A and Wright, ER and Camilli, A},
title = {Vibrio cholerae outer membrane vesicles inhibit bacteriophage infection.},
journal = {Journal of bacteriology},
volume = {},
number = {},
pages = {},
doi = {10.1128/JB.00792-17},
pmid = {29661863},
issn = {1098-5530},
support = {P30 AI050409/AI/NIAID NIH HHS/United States ; R01 AI055058/AI/NIAID NIH HHS/United States ; R01 GM104540/GM/NIGMS NIH HHS/United States ; T32 AI007329/AI/NIAID NIH HHS/United States ; },
abstract = {Novel preventatives could help in efforts to limit Vibrio cholerae infection and the spread of cholera. Bacteriophage (or phage) treatment has been proposed to be an alternative intervention, given the rapid replication of virulent phages, prey specificity, and relative ease of finding new virulent phages. Phage tropism is dictated in part by the presence of phage receptors on the bacterial surface. While many phages that can kill V. cholerae have been isolated, whether this pathogen is able to defend itself by neutralizing phage binding is unknown. Here we show that secreted outer membrane vesicles (OMVs) act as a defense mechanism that confers protection to V. cholerae against phage predation and that this OMV-mediated inhibition is phage receptor-dependent. Our results suggest that phage therapy or prophylaxis should take into consideration the production of OMVs as a bacterial decoy mechanism that could influence the outcome of phage treatment.IMPORTANCE Phages have been increasingly realized for the significance of their interactions with bacterial cells in multiple environments. Bacteria use myriad strategies to defend against phage infection, including: restriction modification, abortive infection, phase variation of cell surface receptors, phage-inducible chromosomal islands, and CRISPR-Cas systems. The data presented here suggest that the apparently passive process of OMV release can also contribute to phage defense. By considering the effect of OMVs on infection of V. cholerae by three unique virulent phages, ICP1, ICP2 and ICP3, we show that, in vitro, a reproducible reduction in bacterial killing is both dose- and phage receptor-dependent. This work supports a role for OMVs as natural decoys to defend bacteria from phage predation.},
}
@article {pmid29658880,
year = {2018},
author = {Taschner, M and Lorentzen, A and Mourão, A and Collins, T and Freke, GM and Moulding, D and Basquin, J and Jenkins, D and Lorentzen, E},
title = {Crystal structure of intraflagellar transport protein 80 reveals a homo-dimer required for ciliogenesis.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
doi = {10.7554/eLife.33067},
pmid = {29658880},
issn = {2050-084X},
support = {NNF15OC00114164//Novo Nordisk/ ; MR/L009978/1//Medical Research Council/United Kingdom ; STU100044631//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {Oligomeric assemblies of intraflagellar transport (IFT) particles build cilia through sequential recruitment and transport of ciliary cargo proteins within cilia. Here we present the 1.8 Å resolution crystal structure of the Chlamydomonas IFT-B protein IFT80, which reveals the architecture of two N-terminal β-propellers followed by an α-helical extension. The N-terminal β-propeller tethers IFT80 to the IFT-B complex via IFT38 whereas the second β-propeller and the C-terminal α-helical extension result in IFT80 homo-dimerization. Using CRISPR/Cas to create biallelic Ift80 frameshift mutations in IMCD3 mouse cells, we demonstrate that IFT80 is absolutely required for ciliogenesis. Structural mapping and rescue experiments reveal that human disease-causing missense mutations do not cluster within IFT80 and form functional IFT particles. Unlike missense mutant forms of IFT80, deletion of the C-terminal dimerization domain prevented rescue of ciliogenesis. Taken together our results may provide a first insight into higher order IFT complex formation likely required for IFT train formation.},
}
@article {pmid29655033,
year = {2018},
author = {Mushtaq, M and Bhat, JA and Mir, ZA and Sakina, A and Ali, S and Singh, AK and Tyagi, A and Salgotra, RK and Dar, AA and Bhat, R},
title = {CRISPR/Cas approach: A new way of looking at plant-abiotic interactions.},
journal = {Journal of plant physiology},
volume = {224-225},
number = {},
pages = {156-162},
doi = {10.1016/j.jplph.2018.04.001},
pmid = {29655033},
issn = {1618-1328},
mesh = {*CRISPR-Cas Systems ; Genetic Engineering ; *Genome, Plant ; Plant Physiological Phenomena/*genetics ; *Stress, Physiological ; },
abstract = {It is not the most grounded of the species that survive, nor the most shrewd, however one most receptive to change. Crop plants being sessile are subjected to various abiotic stresses resulting significant yield losses about an average of more than 50 percent, thus greatly threatening the global crop production. In this regard, plant breeding innovations and genetic engineering approaches have been used in the past for generating stress tolerant crop genotypes, but due to complex inheritance of abiotic stress tolerance these approaches are not enough to bring significant trait improvement and to guarantee world's future sustenance security. Although, RNA interference (RNAi) technology has been utilized amid the most recent decades to produce plants tolerant to environmental stress. But this technique ordinarily prompts to down-regulate as opposed to complete inhibition of target genes. Therefore, scientist/researchers were looking for techniques that should be efficient, precise and reliable as well as have potential to solve the issues experienced by previous approaches, and hence the CRISPR/Cas system came into spotlight. Although, only few studies using CRISPR/Cas approach for targeting abiotic stress tolerance related genes have been reported, but suggested its effective role for future applications in molecular breeding to improve abiotic stress tolerance. Hence, genome engineering via CRISPR-Cas system for targeted mutagenesis promise its immense potential in generating elite cultivars of crop plants with enhanced and durable climate resilience. Lastly, CRISPR-Cas will be future of crop breeding as well as to target minor gene variation of complex quantitative traits, and thus will be the key approach to release global hunger and maintain food security.},
}
@article {pmid29653191,
year = {2018},
author = {Vila, J},
title = {Microbiota transplantation and/or CRISPR/Cas in the battle against antimicrobial resistance.},
journal = {Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases},
volume = {24},
number = {7},
pages = {684-686},
doi = {10.1016/j.cmi.2018.03.043},
pmid = {29653191},
issn = {1469-0691},
}
@article {pmid29652983,
year = {2018},
author = {Xu, Y and Xu, M and Zhang, M and Tan, J and Su, Z and Chen, X and Zhou, Q},
title = {[Knocking-out of HIF1α gene by CRISPR/cas9 inhibits proliferation and invasiveness of prostate cancer DU145 cells].},
journal = {Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics},
volume = {35},
number = {2},
pages = {160-164},
doi = {10.3760/cma.j.issn.1003-9406.2018.02.003},
pmid = {29652983},
issn = {1003-9406},
mesh = {CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Cell Movement ; Cell Proliferation ; *Gene Editing ; Humans ; Hypoxia-Inducible Factor 1, alpha Subunit/*genetics/physiology ; Male ; Neoplasm Invasiveness ; Prostatic Neoplasms/*pathology ; },
abstract = {OBJECTIVE: To explore the role of HIF1α gene in prostate cancer cell line DU145 by knocking it out with a novel gene-editing tool CRISPR/cas9 system.<br><br>METHODS: A CRISPR/cas9 system with two sgRNAs targeting exon 1 of the HIF1α gene was constructed for the knock out experiment. CCK8 assay and transwell experiment were carried out to assess the effect of the knock out on the proliferation, migration and invasiveness of DU145 cells.<br><br>RESULTS: The efficiency of gene-targeting was measured through a T7E1 assaying and sequence analysis, which confirmed that the partial knock out was successful and has led to a significant decrease in the expression of HIF1α and inhibition of cell proliferation, migration and invasiveness.<br><br>CONCLUSION: A CRISPR/cas9 system for the knock out of HIF1α has been successfully constructed, which could inhibit the proliferation and migration of DU145 cells. The system can facilitate further studies of the HIF1α gene and its roles in tumorigenesis.},
}
@article {pmid29649958,
year = {2018},
author = {Maier, LK and Stachler, AE and Brendel, J and Stoll, B and Fischer, S and Haas, KA and Schwarz, TS and Alkhnbashi, OS and Sharma, K and Urlaub, H and Backofen, R and Gophna, U and Marchfelder, A},
title = {The nuts and bolts of the Haloferax CRISPR-Cas system I-B.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1460994},
pmid = {29649958},
issn = {1555-8584},
abstract = {Invading genetic elements pose a constant threat to prokaryotic survival, requiring an effective defence. Eleven years ago, the arsenal of known defence mechanisms was expanded by the discovery of the CRISPR-Cas system. Although CRISPR-Cas is present in the majority of archaea, research often focuses on bacterial models. Here, we provide a perspective based on insights gained studying CRISPR-Cas system I-B of the archaeon Haloferax volcanii. The system relies on more than 50 different crRNAs, whose stability and maintenance critically depend on the proteins Cas5 and Cas7, which bind the crRNA and form the Cascade complex. The interference machinery requires a seed sequence and can interact with multiple PAM sequences. H. volcanii stands out as the first example of an organism that can tolerate autoimmunity via the CRISPR-Cas system while maintaining a constitutively active system. In addition, the H. volcanii system was successfully developed into a tool for gene regulation.},
}
@article {pmid29649291,
year = {2018},
author = {Rylee, JC and Siniard, DJ and Doucette, K and Zentner, GE and Zelhof, AC},
title = {Expanding the genetic toolkit of Tribolium castaneum.},
journal = {PloS one},
volume = {13},
number = {4},
pages = {e0195977},
doi = {10.1371/journal.pone.0195977},
pmid = {29649291},
issn = {1932-6203},
mesh = {Animals ; CRISPR-Cas Systems ; Gene Expression ; Gene Order ; Gene Targeting ; Genes, Reporter ; *Genetic Techniques ; Genetic Vectors/genetics ; Phenotype ; Promoter Regions, Genetic ; Transgenes ; Tribolium/*genetics ; },
abstract = {The red flour beetle, Tribolium castaneum, is an important model insect and agricultural pest. However, many standard genetic tools are lacking or underdeveloped in this system. Here, we present a set of new reagents to augment existing Tribolium genetic tools. We demonstrate a new GAL4 driver line that employs the promoter of a ribosomal protein gene to drive expression of a UAS responder in the fat body. We also present a novel dual fluorescent reporter that labels cell membranes and nuclei with different fluorophores for the analysis of cellular morphology. This approach also demonstrates the functionality of the viral T2A peptide for bicistronic gene expression in Tribolium. To facilitate classical genetic analysis, we created lines with visible genetic markers by CRISPR-mediated disruption of the yellow and ebony body color loci with a cassette carrying an attP site, enabling future φC31-mediated integration. Together, the reagents presented here will facilitate more robust genetic analysis in Tribolium and serve as a blueprint for the further development of this powerful model's genetic toolkit.},
}
@article {pmid29648539,
year = {2018},
author = {Blesa, A and Averhoff, B and Berenguer, J},
title = {Horizontal Gene Transfer in Thermus spp.},
journal = {Current issues in molecular biology},
volume = {29},
number = {},
pages = {23-36},
doi = {10.21775/cimb.029.023},
pmid = {29648539},
issn = {1467-3045},
abstract = {The small amount of genetic content in thermophiles generally limits their adaptability to environmental changes. In Thermus spp., very active horizontal gene transfer (HGT) mechanisms allow the rapid spread of strain-specific adaptive gene modules among the entire population. Constitutive expression of a rather particular and highly efficient DNA transport apparatus (DTA) is at the center of this HGT-mediated enhanced adaptability. The function of the DTA is dependent on the integrity and longevity of the extracellular DNA (eDNA) being transformed, which can be improved by the production of extracellular vesicles (EV) through lysis of a fraction of the population. The DTA must also contend with the recipient cell's defensive barriers, namely restriction enzymes, a panoply of CRISPR-Cas systems, and the argonaute-like protein TtAgo, which may be bypassed by transjugation, a new class of bidirectional transformation-dependent conjugation. Efficient transjugation depends on the presence of the ICETh1, an integrative and conjugative element which promotes simultaneous, generalized DNA transfer from several points in the genome. Transjugation shows preference for genes located within a megaplasmid replicon, where the main strain-specific adaptive modules are located. Contribution of transformation, vesicle-mediated eDNAs, and transjugation to HGT in this genus is discussed.},
}
@article {pmid29644494,
year = {2018},
author = {Cui, Y and Xu, J and Cheng, M and Liao, X and Peng, S},
title = {Review of CRISPR/Cas9 sgRNA Design Tools.},
journal = {Interdisciplinary sciences, computational life sciences},
volume = {10},
number = {2},
pages = {455-465},
doi = {10.1007/s12539-018-0298-z},
pmid = {29644494},
issn = {1867-1462},
support = {2017YFB0202602//National Key R&amp;D Program of China/ ; 2017YFC1311003//National Key R&amp;D Program of China/ ; 2016YFC1302500//National Key R&amp;D Program of China/ ; 2016YFB0200400//National Key R&amp;D Program of China/ ; 2017YFB0202104//National Key R&amp;D Program of China/ ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Editing ; *Genetic Techniques ; Humans ; RNA, Guide/*metabolism ; },
abstract = {The adaptive immunity system in bacteria and archaea, Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR-associate (CRISPR/Cas), has been adapted as a powerful gene editing tool and got a broad application in genome research field due to its ease of use and cost-effectiveness. The performance of CRISPR/Cas relies on well-designed single-guide RNA (sgRNA), so a lot of bioinformatic tools have been developed to assist the design of highly active and specific sgRNA. These tools vary in design specifications, parameters, genomes and so on. To help researchers to choose their proper tools, we reviewed various sgRNA design tools, mainly focusing on their on-target efficiency prediction model and off-target detection algorithm.},
}
@article {pmid29642627,
year = {2018},
author = {Duba, A and Goriewa-Duba, K and Wachowska, U},
title = {A Review of the Interactions between Wheat and Wheat Pathogens: Zymoseptoria tritici, Fusarium spp. and Parastagonospora nodorum.},
journal = {International journal of molecular sciences},
volume = {19},
number = {4},
pages = {},
doi = {10.3390/ijms19041138},
pmid = {29642627},
issn = {1422-0067},
mesh = {Ascomycota/*pathogenicity ; Disease Resistance ; Genes, Plant ; *Host-Pathogen Interactions ; Triticum/genetics/immunology/*microbiology ; },
abstract = {Zymoseptoria tritici is a hemibiotrophic pathogen which causes Septoria leaf blotch in wheat. The pathogenesis of the disease consists of a biotrophic phase and a necrotrophic phase. The pathogen infects the host plant by suppressing its immune response in the first stage of infection. Hemibiotrophic pathogens of the genus Fusarium cause Fusarium head blight, and the necrotrophic Parastagonosporanodorum is responsible for Septoria nodorum blotch in wheat. Cell wall-degrading enzymes in plants promote infections by necrotrophic and hemibiotrophic pathogens, and trichothecenes, secondary fungal metabolites, facilitate infections caused by fungi of the genus Fusarium. There are no sources of complete resistance to the above pathogens in wheat. Defense mechanisms in wheat are controlled by many genes encoding resistance traits. In the wheat genome, the characteristic features of loci responsible for resistance to pathogenic infections indicate that at least several dozen genes encode resistance to pathogens. The molecular interactions between wheat and Z. tritici, P. nodorum and Fusarium spp. pathogens have been insufficiently investigated. Most studies focus on the mechanisms by which the hemibiotrophic Z. tritici suppresses immune responses in plants and the role of mycotoxins and effector proteins in infections caused by P. nodorum and Fusarium spp. fungi. Trichothecene glycosylation and effector proteins, which are involved in defense responses in wheat, have been described at the molecular level. Recent advances in molecular biology have produced interesting findings which should be further elucidated in studies of molecular interactions between wheat and fungal pathogens. The Clustered Regularly-Interspaced Short Palindromic Repeats/ CRISPR associated (CRISPR/Cas) system can be used to introduce targeted mutations into the wheat genome and confer resistance to selected fungal diseases. Host-induced gene silencing and spray-induced gene silencing are also useful tools for analyzing wheat-pathogens interactions which can be used to develop new strategies for controlling fungal diseases.},
}
@article {pmid29641956,
year = {2018},
author = {Al-Chalabi, A and Brown, RH},
title = {Finding a Treatment for ALS - Will Gene Editing Cut It?.},
journal = {The New England journal of medicine},
volume = {378},
number = {15},
pages = {1454-1456},
doi = {10.1056/NEJMcibr1716741},
pmid = {29641956},
issn = {1533-4406},
mesh = {Amyotrophic Lateral Sclerosis/genetics/*therapy ; Animals ; *CRISPR-Cas Systems ; Dependovirus ; Disease Models, Animal ; *Gene Editing ; Gene Expression ; Genetic Therapy/*methods ; Humans ; Mice ; Mice, Transgenic ; Mutation ; Superoxide Dismutase/*genetics ; },
}
@article {pmid29637228,
year = {2018},
author = {Wu, H and Liu, Q and Shi, H and Xie, J and Zhang, Q and Ouyang, Z and Li, N and Yang, Y and Liu, Z and Zhao, Y and Lai, C and Ruan, D and Peng, J and Ge, W and Chen, F and Fan, N and Jin, Q and Liang, Y and Lan, T and Yang, X and Wang, X and Lei, Z and Doevendans, PA and Sluijter, JPG and Wang, K and Li, X and Lai, L},
title = {Engineering CRISPR/Cpf1 with tRNA promotes genome editing capability in mammalian systems.},
journal = {Cellular and molecular life sciences : CMLS},
volume = {75},
number = {19},
pages = {3593-3607},
doi = {10.1007/s00018-018-2810-3},
pmid = {29637228},
issn = {1420-9071},
support = {81702115//National Natural Science Foundation of China/ ; 81672317//National Natural Science Foundation of China/ ; 2017YFA0105103//National Key R&amp;D Program of China/ ; },
mesh = {Animals ; Animals, Genetically Modified ; Animals, Newborn ; Bacterial Proteins/*genetics/metabolism ; CRISPR-Cas Systems/*genetics ; Cells, Cultured ; Cloning, Molecular/*methods ; Cloning, Organism/*methods ; Embryo, Mammalian ; Endonucleases/*genetics/metabolism ; Female ; Fetus ; Gene Editing/*methods ; Genome/genetics ; HEK293 Cells ; HeLa Cells ; Humans ; Male ; Mammals/embryology/genetics ; Mutagenesis ; Nuclear Transfer Techniques ; Pregnancy ; RNA, Guide/genetics ; RNA, Transfer/*genetics ; Rabbits ; Swine ; Swine, Miniature ; },
abstract = {CRISPR/Cpf1 features a number of properties that are distinct from CRISPR/Cas9 and provides an excellent alternative to Cas9 for genome editing. To date, genome engineering by CRISPR/Cpf1 has been reported only in human cells and mouse embryos of mammalian systems and its efficiency is ultimately lower than that of Cas9 proteins from Streptococcus pyogenes. The application of CRISPR/Cpf1 for targeted mutagenesis in other animal models has not been successfully verified. In this study, we designed and optimized a guide RNA (gRNA) transcription system by inserting a transfer RNA precursor (pre-tRNA) sequence downstream of the gRNA for Cpf1, protecting gRNA from immediate digestion by 3'-to-5' exonucleases. Using this new gRNAtRNA system, genome editing, including indels, large fragment deletion and precise point mutation, was induced in mammalian systems, showing significantly higher efficiency than the original Cpf1-gRNA system. With this system, gene-modified rabbits and pigs were generated by embryo injection or somatic cell nuclear transfer (SCNT) with an efficiency comparable to that of the Cas9 gRNA system. These results demonstrated that this refined gRNAtRNA system can boost the targeting capability of CRISPR/Cpf1 toolkits.},
}
@article {pmid29636073,
year = {2018},
author = {Yutin, N and Bäckström, D and Ettema, TJG and Krupovic, M and Koonin, EV},
title = {Vast diversity of prokaryotic virus genomes encoding double jelly-roll major capsid proteins uncovered by genomic and metagenomic sequence analysis.},
journal = {Virology journal},
volume = {15},
number = {1},
pages = {67},
doi = {10.1186/s12985-018-0974-y},
pmid = {29636073},
issn = {1743-422X},
support = {310039//European Research Council/International ; },
abstract = {BACKGROUND: Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome.<br><br>RESULTS: We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family &quot;Autolykiviridae&quot;. Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by archaea and others by bacteria, suggesting that collectively, the DJR MCP-encoding elements have a broad host range among prokaryotes.<br><br>CONCLUSIONS: The findings reported here greatly expand the known host range of (putative) viruses of bacteria and archaea that encode a DJR MCP. They also demonstrate the extreme diversity of genome architectures in these viruses that encode no universal proteins other than the capsid protein that was used as the marker for their identification. From a supposedly minor group of bacterial and archaeal viruses, these viruses are emerging as a substantial component of the prokaryotic virome.},
}
@article {pmid29635744,
year = {2018},
author = {Fontana, J and Dong, C and Ham, JY and Zalatan, JG and Carothers, JM},
title = {Regulated Expression of sgRNAs Tunes CRISPRi in E. coli.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1800069},
doi = {10.1002/biot.201800069},
pmid = {29635744},
issn = {1860-7314},
support = {MCB 1517052//Division of Molecular and Cellular Biosciences/ ; Presidential Innovation Award//University of Washington/ ; Career Award at the Scientific Interface//Burroughs Wellcome Fund/ ; },
abstract = {Methods for implementing dynamically-controlled multi-gene programs could expand capabilities to engineer metabolism for efficiently producing high-value compounds. This work explores whether CRISPRi repression can be tuned in E. coli through the regulated expression of the CRISPRi machinery. When dCas9 is not limiting, variations in sgRNA expression alone can lead to CRISPRi repression levels ranging from 5- to 300-fold. Titrating sgRNA expression over a 2.5-fold range results in 16-fold changes in reporter gene expression. Many different classes of genetic controllers can generate 2.5-fold differences in transcription, suggesting they may be integrated into dynamically-regulated CRISPRi circuits. Finally, CRISPRi cannot be reversed for up to 12 hours by expressing a competing sgRNA later in the growth phase, indicating that CRISPR-Cas:DNA interactions can be persistent in vivo. Collectively, these results identify genetic architectures for tuning CRISPRi repression through regulated sgRNA expression and suggest that dynamically-regulated CRISPRi systems targeting multiple genes may be within reach.},
}
@article {pmid29632194,
year = {2018},
author = {Wu, Q and Tian, Y and Zhang, J and Tong, X and Huang, H and Li, S and Zhao, H and Tang, Y and Yuan, C and Wang, K and Fang, Z and Gao, L and Hu, X and Li, F and Qin, Z and Yao, S and Chen, T and Chen, H and Zhang, G and Liu, W and Sun, Y and Chen, L and Wong, KK and Ge, K and Chen, L and Ji, H},
title = {In vivo CRISPR screening unveils histone demethylase UTX as an important epigenetic regulator in lung tumorigenesis.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {17},
pages = {E3978-E3986},
doi = {10.1073/pnas.1716589115},
pmid = {29632194},
issn = {1091-6490},
mesh = {Animals ; *CRISPR-Cas Systems ; Cell Transformation, Neoplastic/genetics/*metabolism/pathology ; *Epigenesis, Genetic ; *Gene Expression Regulation, Neoplastic ; Histone Demethylases/genetics/*metabolism ; Humans ; Lung Neoplasms/genetics/*metabolism/pathology ; Mice ; Mice, Knockout ; Neoplasms, Experimental/genetics/*metabolism/pathology ; Proto-Oncogene Proteins p21(ras)/genetics/metabolism ; Tumor Suppressor Proteins/genetics/metabolism ; },
abstract = {Lung cancer is the leading cause of cancer-related death worldwide. Inactivation of tumor suppressor genes (TSGs) promotes lung cancer malignant progression. Here, we take advantage of the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated somatic gene knockout in a KrasG12D/+ mouse model to identify bona fide TSGs. From individual knockout of 55 potential TSGs, we identify five genes, including Utx, Ptip, Acp5, Acacb, and Clu, whose knockout significantly promotes lung tumorigenesis. These candidate genes are frequently down-regulated in human lung cancer specimens and significantly associated with survival in patients with lung cancer. Through crossing the conditional Utx knockout allele to the KrasG12D/+ mouse model, we further find that Utx deletion dramatically promotes lung cancer progression. The tumor-promotive effect of Utx knockout in vivo is mainly mediated through an increase of the EZH2 level, which up-regulates the H3K27me3 level. Moreover, the Utx-knockout lung tumors are preferentially sensitive to EZH2 inhibitor treatment. Collectively, our study provides a systematic screening of TSGs in vivo and identifies UTX as an important epigenetic regulator in lung tumorigenesis.},
}
@article {pmid29632189,
year = {2018},
author = {Shang, W and Jiang, Y and Boettcher, M and Ding, K and Mollenauer, M and Liu, Z and Wen, X and Liu, C and Hao, P and Zhao, S and McManus, MT and Wei, L and Weiss, A and Wang, H},
title = {Genome-wide CRISPR screen identifies FAM49B as a key regulator of actin dynamics and T cell activation.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {17},
pages = {E4051-E4060},
doi = {10.1073/pnas.1801340115},
pmid = {29632189},
issn = {1091-6490},
support = {R37 AI114575/AI/NIAID NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Actins/genetics ; Antigens, CD/genetics/immunology ; Antigens, Differentiation, T-Lymphocyte/genetics/immunology ; CRISPR-Cas Systems ; Cytoskeleton/genetics/immunology ; Genome-Wide Association Study ; Humans ; Jurkat Cells ; Lectins, C-Type/genetics/immunology ; *Lymphocyte Activation ; Neoplasm Proteins/genetics/*immunology ; Proto-Oncogene Proteins c-akt/genetics/immunology ; T-Lymphocytes/cytology/*immunology ; },
abstract = {Despite decades of research, mechanisms controlling T cell activation remain only partially understood, which hampers T cell-based immune cancer therapies. Here, we performed a genome-wide CRISPR screen to search for genes that regulate T cell activation. Our screen confirmed many of the known regulators in proximal T cell receptor signaling and, importantly, also uncovered a previously uncharacterized regulator, FAM49B (family with sequence similarity 49 member B). FAM49B deficiency led to hyperactivation of Jurkat T cells following T cell receptor stimulation, as indicated by enhancement of CD69 induction, PAK phosphorylation, and actin assembly. FAM49B directly interacted with the active form of the small GTPase Rac, and genetic disruption of the FAM49B-Rac interaction compromised FAM49B function. Thus, FAM49B inhibits T cell activation by repressing Rac activity and modulating cytoskeleton reorganization.},
}
@article {pmid29629622,
year = {2018},
author = {Guo, T and Han, W and She, Q},
title = {Tolerance of Sulfolobus SMV1 virus to the immunity of I-A and III-B CRISPR-Cas systems in Sulfolobus islandicus.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-8},
doi = {10.1080/15476286.2018.1460993},
pmid = {29629622},
issn = {1555-8584},
abstract = {Sulfolobus islandicus Rey15A encodes one Type I-A and two Type III-B systems, all of which are active in mediating nucleic acids interference. However, the effectiveness of each CRISPR system against virus infection was not tested in this archaeon. Here we constructed S. islandicus strains that constitutively express the antiviral immunity from either I-A, or III-B, or I-A plus III-B systems against SMV1 and tested the response of each host to SMV1 infection. We found that, although both CRISPR immunities showed a strong inhibition to viral DNA replication at an early stage of incubation, the host I-A CRISPR immunity gradually lost the control on virus proliferation, allowing accumulation of cellular viral DNA and release of a large number of viral particles. In contrast, the III-B CRISPR immunity showed a tight control on both viral DNA replication and virus particle formation. Furthermore, the SMV1 tolerance to the I-A CRISPR immunity did not result from the occurrence of escape mutations, suggesting the virus probably encodes an anti-CRISPR protein (Acr) to compromise the host I-A CRISPR immunity. Together, this suggests that the interplay between viral Acrs and CRISPR-Cas systems in thermophilic archaea could have shaped the stable virus-host relationship that is observed for many archaeal viruses.},
}
@article {pmid29626478,
year = {2018},
author = {He, J and Zhang, W and Li, A and Chen, F and Luo, R},
title = {Knockout of NCOA5 impairs proliferation and migration of hepatocellular carcinoma cells by suppressing epithelial-to-mesenchymal transition.},
journal = {Biochemical and biophysical research communications},
volume = {500},
number = {2},
pages = {177-183},
doi = {10.1016/j.bbrc.2018.04.017},
pmid = {29626478},
issn = {1090-2104},
mesh = {Base Sequence ; CRISPR-Cas Systems/genetics ; Carcinoma, Hepatocellular/genetics/*pathology ; Cell Line, Tumor ; *Cell Movement/genetics ; Cell Proliferation/genetics ; *Epithelial-Mesenchymal Transition/genetics ; Gene Expression Regulation, Neoplastic ; *Gene Knockout Techniques ; Humans ; Liver Neoplasms/genetics/*pathology ; Nuclear Receptor Coactivators/*metabolism ; Spheroids, Cellular/metabolism/pathology ; },
abstract = {Nuclear receptor coactivator 5 (NCOA5) plays important roles in the development of a variety of malignancies. However, the underlying mechanisms remain obscure. In this study, we successfully generated the NCOA5 knockout hepatocellular carcinoma (HCC) cells by CRISPR/Cas9 - mediated genome editing and found that knockout of NCOA5 inhibited the proliferation and tumor microsphere formation of HCC cells significantly. Moreover, the migration ability of NCOA5 knockout HCC cells declined. Mechanistic analyses indicated that knockout of NCOA5 can suppress the epithelial - mesenchymal transition (EMT) in HCC cells. In conclusion, our findings provide a mechanistic insight into the role of NCOA5 in HCC progression.},
}
@article {pmid29626235,
year = {2018},
author = {Grzybek, M and Golonko, A and Górska, A and Szczepaniak, K and Strachecka, A and Lass, A and Lisowski, P},
title = {The CRISPR/Cas9 system sheds new lights on the biology of protozoan parasites.},
journal = {Applied microbiology and biotechnology},
volume = {102},
number = {11},
pages = {4629-4640},
doi = {10.1007/s00253-018-8927-3},
pmid = {29626235},
issn = {1432-0614},
support = {2012/07/N/NZ9/02060//Narodowe Centrum Nauki/ ; 2016/22/M/NZ2/00548//Narodowe Centrum Nauki/ ; 428/STYP/11/2016//Ministerstwo Nauki i Szkolnictwa Wyższego/ ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Eukaryota/genetics/*physiology ; Genome, Protozoan/genetics ; Parasites/genetics/*physiology ; },
abstract = {The CRISPR/Cas9 system, a natural defence system of bacterial organisms, has recently been used to modify genomes of the most important protozoa parasites. Successful genome manipulations with the CRISPR/Cas9 system are changing the present view of genetics in parasitology. The application of this system offers a major chance to overcome the current restriction in culturing, maintaining and analysing protozoan parasites, and allows dynamic analysis of parasite genes functions, leading to a better understanding of pathogenesis. CRISPR/Cas9 system will have a significant influence on the process of developing novel drugs and treatment strategies against protozoa parasites.},
}
@article {pmid29625575,
year = {2018},
author = {Lyu, C and Shen, J and Wang, R and Gu, H and Zhang, J and Xue, F and Liu, X and Liu, W and Fu, R and Zhang, L and Li, H and Zhang, X and Cheng, T and Yang, R and Zhang, L},
title = {Targeted genome engineering in human induced pluripotent stem cells from patients with hemophilia B using the CRISPR-Cas9 system.},
journal = {Stem cell research &amp; therapy},
volume = {9},
number = {1},
pages = {92},
doi = {10.1186/s13287-018-0839-8},
pmid = {29625575},
issn = {1757-6512},
support = {81470302//National Natural Science Foundation of China/ ; 81421002//National Natural Science Foundation of China/ ; 81730006//National Natural Science Foundation of China/ ; 81400134//National Natural Science Foundation of China/ ; 81400152//National Natural Science Foundation of China/ ; 15JCZDJC35800//Tianjin Municipal Science and Technology Commission Grant/ ; 2016-I2M-1-018//CAMS Initiative for Innovative Medicine/ ; 2016-I2M-1-017//CAMS Initiative for Innovative Medicine/ ; 2016GH3100001//CAMS Initiative for Innovative Medicine/ ; 2016YFA0100600//the Ministry of Science and Technology of China/ ; },
abstract = {BACKGROUND: Replacement therapy for hemophilia remains a lifelong treatment. Only gene therapy can cure hemophilia at a fundamental level. The clustered regularly interspaced short palindromic repeats-CRISPR associated nuclease 9 (CRISPR-Cas9) system is a versatile and convenient genome editing tool which can be applied to gene therapy for hemophilia.<br><br>METHODS: A patient's induced pluripotent stem cells (iPSCs) were generated from their peripheral blood mononuclear cells (PBMNCs) using episomal vectors. The AAVS1-Cas9-sgRNA plasmid which targets the AAVS1 locus and the AAVS1-EF1α-F9 cDNA-puromycin donor plasmid were constructed, and they were electroporated into the iPSCs. When insertion of F9 cDNA into the AAVS1 locus was confirmed, whole genome sequencing (WGS) was carried out to detect the off-target issue. The iPSCs were then differentiated into hepatocytes, and human factor IX (hFIX) antigen and activity were measured in the culture supernatant. Finally, the hepatocytes were transplanted into non-obese diabetic/severe combined immunodeficiency disease (NOD/SCID) mice through splenic injection.<br><br>RESULTS: The patient's iPSCs were generated from PBMNCs. Human full-length F9 cDNA was inserted into the AAVS1 locus of iPSCs of a hemophilia B patient using the CRISPR-Cas9 system. No off-target mutations were detected by WGS. The hepatocytes differentiated from the inserted iPSCs could secrete hFIX stably and had the ability to be transplanted into the NOD/SCID mice in the short term.<br><br>CONCLUSIONS: PBMNCs are good somatic cell choices for generating iPSCs from hemophilia patients. The iPSC technique is a good tool for genetic therapy for human hereditary diseases. CRISPR-Cas9 is versatile, convenient, and safe to be used in iPSCs with low off-target effects. Our research offers new approaches for clinical gene therapy for hemophilia.},
}
@article {pmid29621903,
year = {2018},
author = {Shao, J and Glorieux, C and Liao, J and Chen, P and Lu, W and Liang, Z and Wen, S and Hu, Y and Huang, P},
title = {Impact of Nrf2 on tumour growth and drug sensitivity in oncogenic K-ras-transformed cells in vitro and in vivo.},
journal = {Free radical research},
volume = {52},
number = {6},
pages = {661-671},
doi = {10.1080/10715762.2018.1462494},
pmid = {29621903},
issn = {1029-2470},
mesh = {Animals ; Antineoplastic Agents/pharmacology ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Proliferation/drug effects ; Cell Transformation, Neoplastic/*genetics/metabolism/pathology ; Doxorubicin/pharmacology ; Drug Resistance, Neoplasm/drug effects/*genetics ; Female ; Gene Editing/methods ; *Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; HEK293 Cells ; Heme Oxygenase-1/genetics/metabolism ; Humans ; Isothiocyanates/pharmacology ; Membrane Proteins/genetics/metabolism ; Mice ; Mice, Nude ; NAD(P)H Dehydrogenase (Quinone)/genetics/metabolism ; NF-E2-Related Factor 2/deficiency/*genetics ; Proto-Oncogene Proteins p21(ras)/*genetics/metabolism ; Reactive Oxygen Species/metabolism ; Signal Transduction ; Tumor Burden/drug effects ; },
abstract = {K-ras is one of the most common oncogenes in human cancers, and its aberrant activation may lead to malignant transformation associated with oxidative stress and activation of the transcription factor Nrf2 that regulates multiple detoxification enzymes. The purpose of this research was to use gene editing technology to evaluate the role of Nrf2 in affecting tumour growth and drug sensitivity of K-rasG12V-transformed cells. We showed that induction of K-rasG12V caused a significant activation of Nrf2 associated with increased expression of its target genes NAD(P)H:quinone oxidoreductase 1 (NQO1) and haem oxygenase-1 (HO-1). Interestingly, knock-out of Nrf2 by CRISPR/Cas9 in K-rasG12V-expressing cells only impacted the expression of NQO1 but not HO-1. We also found that Nrf2 knock-out caused high reactive oxygen species (ROS) stress, suppression of cell proliferation, increased apoptosis in vitro, and a decrease of tumour growth in vivo. Furthermore, abrogation of Nrf2 significantly increased the sensitivity of K-rasG12V cells to multiple anticancer agents including phenethyl isothiocyanate (PEITC), doxorubicin, etoposide, and cisplatin. These results show that genetic abrogation of Nrf2 impairs the malignant phenotype of K-RasG12V-transformed cells in vitro and in vivo, and demonstrates the critical role of Nrf2 in promoting cell survival and drug resistance in cells harbouring oncogenic K-ras. As such, inhibition of Nrf2 would be an attractive strategy to increase the therapeutic effect and overcome drug resistance in cancer with oncogenic K-ras activation.},
}
@article {pmid29621632,
year = {2018},
author = {Zhang, J and Song, F and Sun, Y and Yu, K and Xiang, J},
title = {CRISPR/Cas9-mediated deletion of EcMIH shortens metamorphosis time from mysis larva to postlarva of Exopalaemon carinicauda.},
journal = {Fish &amp; shellfish immunology},
volume = {77},
number = {},
pages = {244-251},
doi = {10.1016/j.fsi.2018.04.002},
pmid = {29621632},
issn = {1095-9947},
mesh = {Amino Acid Sequence ; Animals ; Arthropod Proteins/chemistry/*genetics ; Base Sequence ; CRISPR-Cas Systems/*physiology ; Gene Expression Profiling ; Invertebrate Hormones/chemistry/*genetics ; Larva/genetics/growth &amp; development ; Molting/*genetics ; Palaemonidae/*genetics/growth &amp; development ; Phylogeny ; Sequence Alignment ; },
abstract = {The recently emerged CRISPR/Cas9 technology is the most flexible means to produce targeted mutations at the genomic loci in a variety of organisms. In Crustaceans, molt-inhibiting hormone (MIH) is an important negative-regulatory factor and plays a key role in suppressing the molting process. However, whether precise disruption of MIH in crustacean can be achieved and successfully used to improve the development and growth has not been proved. In this research, the complementary DNA (cDNA) and genomic DNA, including flanking regions of the MIH gene (EcMIH) of ridgetail white prawn Exopalaemon carinicauda, were cloned and sequenced. Sequence analysis revealed that EcMIH was composed of three exons and two introns. Analysis by RT-PCR showed that EcMIH mainly expressed in eyestalks. During different development periods, EcMIH was highest in juvenile stage and extremely low in others but adult prawns eyestalks. In addition, we applied CRISPR/Cas9 technology to generate EcMIH knock-out (KO) prawns and then analyzed the changes in their phenotypes. We efficiently generated 12 EcMIH-KO prawns out of 250 injected one-cell stage embryos and the mutant rate reached 4.8% after embryo injection with one sgRNA targeting the second exon of EcMIH. The EcMIH-KO prawns exhibited increased the body length and shortened the metamorphosis time of larvae from mysis larva to postlarva. Meanwhile, EcMIH-KO did not cause the health problems such as early stage death or deformity. In conclusion, we successfully obtained EcMIH gene and generated EcMIH-KO prawns using CRISPR/Cas9 technology. This study will certainly lead to a wide application prospect of MIH gene in prawns breeding.},
}
@article {pmid29621180,
year = {2018},
author = {Cho, S and Shin, J and Cho, BK},
title = {Applications of CRISPR/Cas System to Bacterial Metabolic Engineering.},
journal = {International journal of molecular sciences},
volume = {19},
number = {4},
pages = {},
doi = {10.3390/ijms19041089},
pmid = {29621180},
issn = {1422-0067},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Editing ; Humans ; *Metabolic Engineering ; },
abstract = {The clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) adaptive immune system has been extensively used for gene editing, including gene deletion, insertion, and replacement in bacterial and eukaryotic cells owing to its simple, rapid, and efficient activities in unprecedented resolution. Furthermore, the CRISPR interference (CRISPRi) system including deactivated Cas9 (dCas9) with inactivated endonuclease activity has been further investigated for regulation of the target gene transiently or constitutively, avoiding cell death by disruption of genome. This review discusses the applications of CRISPR/Cas for genome editing in various bacterial systems and their applications. In particular, CRISPR technology has been used for the production of metabolites of high industrial significance, including biochemical, biofuel, and pharmaceutical products/precursors in bacteria. Here, we focus on methods to increase the productivity and yield/titer scan by controlling metabolic flux through individual or combinatorial use of CRISPR/Cas and CRISPRi systems with introduction of synthetic pathway in industrially common bacteria including Escherichia coli. Further, we discuss additional useful applications of the CRISPR/Cas system, including its use in functional genomics.},
}
@article {pmid29618812,
year = {2018},
author = {Takahashi, F and Suzuki, T and Osakabe, Y and Betsuyaku, S and Kondo, Y and Dohmae, N and Fukuda, H and Yamaguchi-Shinozaki, K and Shinozaki, K},
title = {A small peptide modulates stomatal control via abscisic acid in long-distance signalling.},
journal = {Nature},
volume = {556},
number = {7700},
pages = {235-238},
doi = {10.1038/s41586-018-0009-2},
pmid = {29618812},
issn = {1476-4687},
mesh = {Abscisic Acid/biosynthesis/*metabolism ; Arabidopsis/*metabolism ; Arabidopsis Proteins/metabolism ; CRISPR-Cas Systems ; Dehydration ; Dioxygenases/metabolism ; Gene Expression Regulation ; Intercellular Signaling Peptides and Proteins/metabolism ; Mutation ; Plant Leaves/metabolism ; Plant Proteins/metabolism ; Plant Roots/metabolism ; Plant Stomata/*metabolism ; Protein-Serine-Threonine Kinases/metabolism ; *Signal Transduction ; Water/metabolism ; },
abstract = {Mammalian peptide hormones propagate extracellular stimuli from sensing tissues to appropriate targets to achieve optimal growth maintenance 1 . In land plants, root-to-shoot signalling is important to prevent water loss by transpiration and to adapt to water-deficient conditions 2, 3 . The phytohormone abscisic acid has a role in the regulation of stomatal movement to prevent water loss 4 . However, no mobile signalling molecules have yet been identified that can trigger abscisic acid accumulation in leaves. Here we show that the CLAVATA3/EMBRYO-SURROUNDING REGION-RELATED 25 (CLE25) peptide transmits water-deficiency signals through vascular tissues in Arabidopsis, and affects abscisic acid biosynthesis and stomatal control of transpiration in association with BARELY ANY MERISTEM (BAM) receptors in leaves. The CLE25 gene is expressed in vascular tissues and enhanced in roots in response to dehydration stress. The root-derived CLE25 peptide moves from the roots to the leaves, where it induces stomatal closure by modulating abscisic acid accumulation and thereby enhances resistance to dehydration stress. BAM receptors are required for the CLE25 peptide-induced dehydration stress response in leaves, and the CLE25-BAM module therefore probably functions as one of the signalling molecules for long-distance signalling in the dehydration response.},
}
@article {pmid29618800,
year = {2018},
author = {Trubiroha, A and Gillotay, P and Giusti, N and Gacquer, D and Libert, F and Lefort, A and Haerlingen, B and De Deken, X and Opitz, R and Costagliola, S},
title = {A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {5647},
doi = {10.1038/s41598-018-24036-4},
pmid = {29618800},
issn = {2045-2322},
abstract = {The foregut endoderm gives rise to several organs including liver, pancreas, lung and thyroid with important roles in human physiology. Understanding which genes and signalling pathways regulate their development is crucial for understanding developmental disorders as well as diseases in adulthood. We exploited unique advantages of the zebrafish model to develop a rapid and scalable CRISPR/Cas-based mutagenesis strategy aiming at the identification of genes involved in morphogenesis and function of the thyroid. Core elements of the mutagenesis assay comprise bi-allelic gene invalidation in somatic mutants, a non-invasive monitoring of thyroid development in live transgenic fish, complementary analyses of thyroid function in fixed specimens and quantitative analyses of mutagenesis efficiency by Illumina sequencing of individual fish. We successfully validated our mutagenesis-phenotyping strategy in experiments targeting genes with known functions in early thyroid morphogenesis (pax2a, nkx2.4b) and thyroid functional differentiation (duox, duoxa, tshr). We also demonstrate that duox and duoxa crispants phenocopy thyroid phenotypes previously observed in human patients with bi-allelic DUOX2 and DUOXA2 mutations. The proposed combination of efficient mutagenesis protocols, rapid non-invasive phenotyping and sensitive genotyping holds great potential to systematically characterize the function of larger candidate gene panels during thyroid development and is applicable to other organs and tissues.},
}
@article {pmid29617431,
year = {2018},
author = {Del'Guidice, T and Lepetit-Stoffaes, JP and Bordeleau, LJ and Roberge, J and Théberge, V and Lauvaux, C and Barbeau, X and Trottier, J and Dave, V and Roy, DC and Gaillet, B and Garnier, A and Guay, D},
title = {Membrane permeabilizing amphiphilic peptide delivers recombinant transcription factor and CRISPR-Cas9/Cpf1 ribonucleoproteins in hard-to-modify cells.},
journal = {PloS one},
volume = {13},
number = {4},
pages = {e0195558},
doi = {10.1371/journal.pone.0195558},
pmid = {29617431},
issn = {1932-6203},
mesh = {Animals ; *CRISPR-Cas Systems ; Cells, Cultured ; Cerebral Cortex/cytology/metabolism ; Cricetulus ; Cytosol/metabolism ; Endocytosis ; Escherichia coli ; Gene Editing/*methods ; Humans ; Mice ; Myoblasts/cytology/metabolism ; Rats ; Recombinant Proteins/administration &amp; dosage/metabolism ; Stem Cells/cytology/metabolism ; Transcription Factors/*administration &amp; dosage/metabolism ; },
abstract = {Delivery of recombinant proteins to therapeutic cells is limited by a lack of efficient methods. This hinders the use of transcription factors or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) ribonucleoproteins to develop cell therapies. Here, we report a soluble peptide designed for the direct delivery of proteins to mammalian cells including human stem cells, hard-to-modify primary natural killer (NK) cells, and cancer cell models. This peptide is composed of a 6x histidine-rich domain fused to the endosomolytic peptide CM18 and the cell penetrating peptide PTD4. A less than two-minute co-incubation of 6His-CM18-PTD4 peptide with spCas9 and/or asCpf1 CRISPR ribonucleoproteins achieves robust gene editing. The same procedure, co-incubating with the transcription factor HoxB4, achieves transcriptional regulation. The broad applicability and flexibility of this DNA- and chemical-free method across different cell types, particularly hard-to-transfect cells, opens the way for a direct use of proteins for biomedical research and cell therapy manufacturing.},
}
@article {pmid29617297,
year = {2018},
author = {Watanabe, S and Sakurai, T and Nakamura, S and Miyoshi, K and Sato, M},
title = {The Combinational Use of CRISPR/Cas9 and Targeted Toxin Technology Enables Efficient Isolation of Bi-Allelic Knockout Non-Human Mammalian Clones.},
journal = {International journal of molecular sciences},
volume = {19},
number = {4},
pages = {},
doi = {10.3390/ijms19041075},
pmid = {29617297},
issn = {1422-0067},
mesh = {Alleles ; Animals ; Base Sequence ; *CRISPR-Cas Systems ; Gene Editing ; Gene Knockout Techniques ; *Gene Targeting ; Genetic Vectors ; Genotype ; Glycoside Hydrolases/genetics ; Humans ; INDEL Mutation ; Mammals/genetics ; RNA, Guide ; Toxins, Biological/*genetics ; },
abstract = {Recent advances in genome editing systems such as clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease (CRISPR/Cas9) have facilitated genomic modification in mammalian cells. However, most systems employ transient treatment with selective drugs such as puromycin to obtain the desired genome-edited cells, which often allows some untransfected cells to survive and decreases the efficiency of generating genome-edited cells. Here, we developed a novel targeted toxin-based drug-free selection system for the enrichment of genome-edited cells. Cells were transfected with three expression vectors, each of which carries a guide RNA (gRNA), humanized Cas9 (hCas9) gene, or Clostridium perfringens-derived endo-&amp;beta;-galactosidase C (EndoGalC) gene. Once EndoGalC is expressed in a cell, it digests the cell-surface &amp;alpha;-Gal epitope, which is specifically recognized by BS-I-B₄ lectin (IB4). Three days after transfection, these cells were treated with cytotoxin saporin-conjugated IB4 (IB4SAP) for 30 min at 37 &amp;deg;C prior to cultivation in a normal medium. Untransfected cells and those weakly expressing EndoGalC will die due to the internalization of saporin. Cells transiently expressing EndoGalC strongly survive, and some of these surviving clones are expected to be genome-edited bi-allelic knockout (KO) clones due to their strong co-expression of gRNA and hCas9. When porcine &amp;alpha;-1,3-galactosyltransferase gene, which can synthesize the &amp;alpha;-Gal epitope, was attempted to be knocked out, 16.7% and 36.7% of the surviving clones were bi-allelic and mono-allelic knockout (KO) cells, respectively, which was in contrast to the isolation of clones in the absence of IB4SAP treatment. Namely, 0% and 13.3% of the resulting clones were bi-allelic and mono-allelic KO cells, respectively. A similar tendency was seen when other target genes such as DiGeorge syndrome critical region gene 2 and transforming growth factor-&amp;beta; receptor type 1 gene were targeted to be knocked out. Our results indicate that a combination of the CRISPR/Cas9 system and targeted toxin technology using IB4SAP allows efficient enrichment of genome-edited clones, particularly bi-allelic KO clones.},
}
@article {pmid29616920,
year = {2018},
author = {Silas, S and Lucas-Elio, P and Jackson, SA and Aroca-Crevillén, A and Hansen, LL and Fineran, PC and Fire, AZ and Sánchez-Amat, A},
title = {Correction: Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
doi = {10.7554/eLife.36853},
pmid = {29616920},
issn = {2050-084X},
}
@article {pmid29616594,
year = {2018},
author = {Qiu, GH and Huang, C and Zheng, X and Yang, X},
title = {The protective function of noncoding DNA in genome defense of eukaryotic male germ cells.},
journal = {Epigenomics},
volume = {10},
number = {4},
pages = {499-517},
doi = {10.2217/epi-2017-0103},
pmid = {29616594},
issn = {1750-192X},
abstract = {Peripheral and abundant noncoding DNA has been hypothesized to protect the genome and the central protein-coding sequences against DNA damage in somatic genome. In the cytosol, invading exogenous nucleic acids may first be deactivated by small RNAs encoded by noncoding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. In the nucleus, the radicals generated by radiation in the cytosol, radiation energy and invading exogenous nucleic acids are absorbed, blocked and/or reduced by peripheral heterochromatin, and damaged DNA in heterochromatin is removed and excluded from the nucleus to the cytoplasm through nuclear pore complexes. To further strengthen the hypothesis, this review summarizes the experimental evidence supporting the protective function of noncoding DNA in the genome of male germ cells. Based on these data, this review provides evidence supporting the protective role of noncoding DNA in the genome defense of sperm genome through similar mechanisms to those of the somatic genome.},
}
@article {pmid29614837,
year = {2018},
author = {Gao, J and Zhang, T and Xu, B and Jia, L and Xiao, B and Liu, H and Liu, L and Yan, H and Xia, Q},
title = {CRISPR/Cas9-Mediated Mutagenesis of Carotenoid Cleavage Dioxygenase 8 (CCD8) in Tobacco Affects Shoot and Root Architecture.},
journal = {International journal of molecular sciences},
volume = {19},
number = {4},
pages = {},
doi = {10.3390/ijms19041062},
pmid = {29614837},
issn = {1422-0067},
mesh = {CRISPR-Cas Systems/genetics/physiology ; Dioxygenases/genetics/*metabolism ; Gene Expression Regulation, Plant ; Plant Proteins/genetics/*metabolism ; Plant Roots/*enzymology/genetics/*metabolism ; Plant Shoots/*enzymology/genetics/*metabolism ; Tobacco/*enzymology/genetics/*metabolism ; },
abstract = {Strigolactones (SLs) are a class of phytohormones that regulate plant architecture. Carotenoid cleavage dioxygenase (CCD) genes are involved in the biosynthesis of SLs and are identified and characterized in many plants. However, the function of CCD genes in tobacco remains poorly understood. In this study, two closely related genes NtCCD8A and NtCCD8B were cloned from tobacco (Nicotiana tabacum L.). The two NtCCD8 genes are orthologues of the tomato (Solanum lycopersicum) carotenoid cleavage dioxygenase 8 (SlCCD8) gene. NtCCD8A and NtCCD8B were primarily expressed in tobacco roots, but low expression levels of these genes were detected in all plant tissues, and their transcript levels significantly increased in response to phosphate limitation. NtCCD8A and NtCCD8B mutations were introduced into tobacco using the CRISPR/Cas9 system and transgenic tobacco lines for both ntccd8 mutant alleles were identified. The ntccd8a and ntccd8b mutant alleles were inactivated by a deletion of three nucleotides and insertion of one nucleotide, respectively, both of which led to the production of premature stop codons. The ntccd8 mutants had increased shoot branching, reduced plant height, increased number of leaves and nodes, and reduced total plant biomass compared to wild-type plants; however, the root-to-shoot ratio was unchanged. In addition, mutant lines had shorter primary roots and more of lateral roots than wild type. These results suggest that NtCCD8 genes are important for changes in tobacco plant architecture.},
}
@article {pmid29614006,
year = {2018},
author = {Yajima, M and Ikuta, K and Kanda, T},
title = {Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.},
journal = {Viruses},
volume = {10},
number = {4},
pages = {},
doi = {10.3390/v10040171},
pmid = {29614006},
issn = {1999-4915},
mesh = {*CRISPR-Cas Systems ; Chromosomes, Artificial, Bacterial ; *Cloning, Molecular ; DNA, Viral ; *Epstein-Barr Virus Infections ; *Genome, Viral ; Herpesvirus 4, Human/*genetics ; Homologous Recombination ; Humans ; Plasmids/genetics ; Sequence Analysis, DNA ; Transgenes ; Virus Integration ; *Virus Latency ; Whole Genome Sequencing ; },
abstract = {Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.},
}
@article {pmid29610341,
year = {2018},
author = {Younis, S and Kamel, W and Falkeborn, T and Wang, H and Yu, D and Daniels, R and Essand, M and Hinkula, J and Akusjärvi, G and Andersson, L},
title = {Multiple nuclear-replicating viruses require the stress-induced protein ZC3H11A for efficient growth.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {16},
pages = {E3808-E3816},
doi = {10.1073/pnas.1722333115},
pmid = {29610341},
issn = {1091-6490},
mesh = {Adenoviruses, Human/genetics/physiology ; Binding Sites ; Biological Transport ; CRISPR-Cas Systems ; Cell Nucleus/metabolism/*virology ; Cytoplasm/virology ; Gene Knockout Techniques ; HeLa Cells ; Heat-Shock Response/genetics/physiology ; High-Throughput Nucleotide Sequencing ; Host-Pathogen Interactions ; Humans ; Nuclear Proteins/antagonists &amp; inhibitors/*physiology ; Protein Domains ; Protein Stability ; RNA, Messenger/*metabolism ; RNA, Viral/*metabolism ; RNA-Binding Proteins/antagonists &amp; inhibitors/*physiology ; Serine-Arginine Splicing Factors/physiology ; *Virus Replication ; Zinc Fingers/*physiology ; },
abstract = {The zinc finger CCCH-type containing 11A (ZC3H11A) gene encodes a well-conserved zinc finger protein that may function in mRNA export as it has been shown to associate with the transcription export (TREX) complex in proteomic screens. Here, we report that ZC3H11A is a stress-induced nuclear protein with RNA-binding capacity that localizes to nuclear splicing speckles. During an adenovirus infection, the ZC3H11A protein and splicing factor SRSF2 relocalize to nuclear regions where viral DNA replication and transcription take place. Knockout (KO) of ZC3H11A in HeLa cells demonstrated that several nuclear-replicating viruses are dependent on ZC3H11A for efficient growth (HIV, influenza virus, herpes simplex virus, and adenovirus), whereas cytoplasmic replicating viruses are not (vaccinia virus and Semliki Forest virus). High-throughput sequencing of ZC3H11A-cross-linked RNA showed that ZC3H11A binds to short purine-rich ribonucleotide stretches in cellular and adenoviral transcripts. We show that the RNA-binding property of ZC3H11A is crucial for its function and localization. In ZC3H11A KO cells, the adenovirus fiber mRNA accumulates in the cell nucleus. Our results suggest that ZC3H11A is important for maintaining nuclear export of mRNAs during stress and that several nuclear-replicating viruses take advantage of this mechanism to facilitate their replication.},
}
@article {pmid29610331,
year = {2018},
author = {Letelier, J and Terriente, J and Belzunce, I and Voltes, A and Undurraga, CA and Polvillo, R and Devos, L and Tena, JJ and Maeso, I and Retaux, S and Gomez-Skarmeta, JL and Martínez-Morales, JR and Pujades, C},
title = {Evolutionary emergence of the rac3b/rfng/sgca regulatory cluster refined mechanisms for hindbrain boundaries formation.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {16},
pages = {E3731-E3740},
doi = {10.1073/pnas.1719885115},
pmid = {29610331},
issn = {1091-6490},
mesh = {Actomyosin/*physiology ; Animals ; Body Patterning/genetics ; CRISPR-Cas Systems ; Cell Movement ; Characidae/genetics/physiology ; Chromatin/genetics/ultrastructure ; Evolution, Molecular ; Fishes/classification/genetics ; *Gene Expression Regulation, Developmental ; Morphogenesis ; Mutagenesis, Site-Directed ; Neurogenesis ; Phylogeny ; Rhombencephalon/*embryology ; Sarcoglycans/genetics/*physiology ; Species Specificity ; Zebrafish/*embryology/genetics ; Zebrafish Proteins/genetics/*physiology ; rac GTP-Binding Proteins/genetics/*physiology ; },
abstract = {Developmental programs often rely on parallel morphogenetic mechanisms that guarantee precise tissue architecture. While redundancy constitutes an obvious selective advantage, little is known on how novel morphogenetic mechanisms emerge during evolution. In zebrafish, rhombomeric boundaries behave as an elastic barrier, preventing cell intermingling between adjacent compartments. Here, we identify the fundamental role of the small-GTPase Rac3b in actomyosin cable assembly at hindbrain boundaries. We show that the novel rac3b/rfng/sgca regulatory cluster, which is specifically expressed at the boundaries, emerged in the Ostariophysi superorder by chromosomal rearrangement that generated new cis-regulatory interactions. By combining 4C-seq, ATAC-seq, transgenesis, and CRISPR-induced deletions, we characterized this regulatory domain, identifying hindbrain boundary-specific cis-regulatory elements. Our results suggest that the capacity of boundaries to act as an elastic mesh for segregating rhombomeric cells evolved by cooption of critical genes to a novel regulatory block, refining the mechanisms for hindbrain segmentation.},
}
@article {pmid29608720,
year = {2018},
author = {Gilbert, MJ and Duim, B and van der Graaf-van Bloois, L and Wagenaar, JA and Zomer, AL},
title = {Homologous Recombination between Genetically Divergent Campylobacter fetus Lineages Supports Host-Associated Speciation.},
journal = {Genome biology and evolution},
volume = {10},
number = {3},
pages = {716-722},
doi = {10.1093/gbe/evy048},
pmid = {29608720},
issn = {1759-6653},
mesh = {Animals ; Campylobacter Infections/*genetics/microbiology ; Campylobacter fetus/*genetics/pathogenicity ; Genetic Drift ; *Genetic Variation ; Genome, Bacterial/genetics ; Homologous Recombination/*genetics ; Mammals/embryology/microbiology ; Phylogeny ; RNA, Ribosomal, 16S/genetics ; Reptiles/embryology/microbiology ; Species Specificity ; Whole Genome Sequencing ; },
abstract = {Homologous recombination is a major driver of bacterial speciation. Genetic divergence and host association are important factors influencing homologous recombination. Here, we study these factors for Campylobacter fetus, which shows a distinct intraspecific host dichotomy. Campylobacter fetus subspecies fetus (Cff) and venerealis are associated with mammals, whereas C. fetus subsp. testudinum (Cft) is associated with reptiles. Recombination between these genetically divergent C. fetus lineages is extremely rare. Previously it was impossible to show whether this barrier to recombination was determined by the differential host preferences, by the genetic divergence between both lineages or by other factors influencing recombination, such as restriction-modification, CRISPR/Cas, and transformation systems. Fortuitously, a distinct C. fetus lineage (ST69) was found, which was highly related to mammal-associated C. fetus, yet isolated from a chelonian. The whole genome sequences of two C. fetus ST69 isolates were compared with those of mammal- and reptile-associated C. fetus strains for phylogenetic and recombination analysis. In total, 5.1-5.5% of the core genome of both ST69 isolates showed signs of recombination. Of the predicted recombination regions, 80.4% were most closely related to Cft, 14.3% to Cff, and 5.6% to C. iguaniorum. Recombination from C. fetus ST69 to Cft was also detected, but to a lesser extent and only in chelonian-associated Cft strains. This study shows that despite substantial genetic divergence no absolute barrier to homologous recombination exists between two distinct C. fetus lineages when occurring in the same host type, which provides valuable insights in bacterial speciation and evolution.},
}
@article {pmid29608569,
year = {2018},
author = {Costa, FC and Francisco, AF and Jayawardhana, S and Calderano, SG and Lewis, MD and Olmo, F and Beneke, T and Gluenz, E and Sunter, J and Dean, S and Kelly, JM and Taylor, MC},
title = {Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.},
journal = {PLoS neglected tropical diseases},
volume = {12},
number = {4},
pages = {e0006388},
doi = {10.1371/journal.pntd.0006388},
pmid = {29608569},
issn = {1935-2735},
support = {PG/13/88/30556//British Heart Foundation/United Kingdom ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Chagas Disease/diagnosis/*parasitology ; Female ; Fluorescence ; Genes, Reporter ; Green Fluorescent Proteins/genetics/metabolism ; Humans ; Luminescent Measurements/*methods ; Mice ; Mice, Inbred BALB C ; Phenotype ; Trypanosoma cruzi/*chemistry/*genetics/isolation &amp; purification/physiology ; },
abstract = {BACKGROUND: Infection with Trypanosoma cruzi causes Chagas disease, a major public health problem throughout Latin America. There is no vaccine and the only drugs have severe side effects. Efforts to generate new therapies are hampered by limitations in our understanding of parasite biology and disease pathogenesis. Studies are compromised by the complexity of the disease, the long-term nature of the infection, and the fact that parasites are barely detectable during the chronic stage. In addition, functional dissection of T. cruzi biology has been restricted by the limited flexibility of the genetic manipulation technology applicable to this parasite.<br><br>Here, we describe two technical innovations, which will allow the role of the parasite in disease progression to be better assessed. First, we generated a T. cruzi reporter strain that expresses a fusion protein comprising red-shifted luciferase and green fluorescent protein domains. Bioluminescence allows the kinetics of infection to be followed within a single animal, and specific foci of infection to be pinpointed in excised tissues. Fluorescence can then be used to visualise individual parasites in tissue sections to study host-parasite interactions at a cellular level. Using this strategy, we have been routinely able to find individual parasites within chronically infected murine tissues for the first time. The second advance is the incorporation of a streamlined CRISPR/Cas9 functionality into this reporter strain that can facilitate genome editing using a PCR-based approach that does not require DNA cloning. This system allows the rapid generation of null mutants and fluorescently tagged parasites in a background where the in vivo phenotype can be rapidly assessed.<br><br>CONCLUSIONS/SIGNIFICANCE: The techniques described here will have multiple applications for studying aspects of T. cruzi biology and Chagas disease pathogenesis previously inaccessible to conventional approaches. The reagents and cell lines have been generated as a community resource and are freely available on request.},
}
@article {pmid29605859,
year = {2018},
author = {Grob, A and Marbiah, M and Isalan, M},
title = {Functional Insulator Scanning of CpG Islands to Identify Regulatory Regions of Promoters Using CRISPR.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1766},
number = {},
pages = {285-301},
doi = {10.1007/978-1-4939-7768-0_16},
pmid = {29605859},
issn = {1940-6029},
abstract = {The ability to mutate a promoter in situ is potentially a very useful approach for gaining insights into endogenous gene regulation mechanisms. The advent of CRISPR/Cas systems has provided simple, efficient, and targeted genetic manipulation in eukaryotes, which can be applied to studying genome structure and function.The basic CRISPR toolkit comprises an endonuclease, Cas9, and a short DNA-targeting sequence, made up of a single guide RNA (sgRNA). The catalytic domains of Cas9 are rendered active upon dimerization of Cas9 with sgRNA, resulting in targeted double stranded DNA breaks. Among other applications, this method of DNA cleavage can be coupled to endogenous homology-directed repair (HDR) mechanisms for the generation of site-specific editing or knockin mutations, at both promoter regulatory and gene coding sequences.A well-characterized regulatory feature of promoter regions is the high abundance of CpGs. These CpG islands tend to be unmethylated, ensuring a euchromatic environment that promotes gene transcription. Here, we demonstrate CRISPR-mediated editing of two CpG islands located within the promoter region of the MDR1 gene (Multi Drug Resistance 1). Cas9 is used to generate double stranded breaks across multiple target sites, which are then repaired while inserting the beta globin (β-globin) insulator, 5'HS5. Thus, we are screening through promoter regulatory sequences with a chromatin barrier element to identify functional regions via &quot;insulator scanning.&quot; Transcriptional and functional assessment of MDR1 expression provides evidence of genome engineering. Overall, this method allows the scanning of CpG islands to identify their promoter functions.},
}
@article {pmid29604449,
year = {2018},
author = {Zhai, J and Wang, Q and Gao, Y and Zhang, R and Li, S and Wei, B and You, Y and