@article {pmid30886355,
year = {2019},
author = {Varble, A and Meaden, S and Barrangou, R and Westra, ER and Marraffini, LA},
title = {Recombination between phages and CRISPR-cas loci facilitates horizontal gene transfer in staphylococci.},
journal = {Nature microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41564-019-0400-2},
pmid = {30886355},
issn = {2058-5276},
abstract = {CRISPR (clustered regularly interspaced short palindromic repeats) loci and their associated (cas) genes encode an adaptive immune system that protects prokaryotes from viral1 and plasmid2 invaders. Following viral (phage) infection, a small fraction of the prokaryotic cells are able to integrate a small sequence of the invader's genome into the CRISPR array1. These sequences, known as spacers, are transcribed and processed into small CRISPR RNA guides3-5 that associate with Cas nucleases to specify a viral target for destruction6-9. Although CRISPR-cas loci are widely distributed throughout microbial genomes and often display hallmarks of horizontal gene transfer10-12, the drivers of CRISPR dissemination remain unclear. Here, we show that spacers can recombine with phage target sequences to mediate a form of specialized transduction of CRISPR elements. Phage targets in phage 85, ΦNM1, ΦNM4 and Φ12 can recombine with spacers in either chromosomal or plasmid-borne CRISPR loci in Staphylococcus, leading to either the transfer of CRISPR-adjacent genes or the propagation of acquired immunity to other bacteria in the population, respectively. Our data demonstrate that spacer sequences not only specify the targets of Cas nucleases but also can promote horizontal gene transfer.},
}
@article {pmid30885348,
year = {2019},
author = {Perumal, E and So Youn, K and Sun, S and Seung-Hyun, J and Suji, M and Jieying, L and Yeun-Jun, C},
title = {PTEN inactivation induces epithelial-mesenchymal transition and metastasis by intranuclear translocation of β-catenin and snail/slug in non-small cell lung carcinoma cells.},
journal = {Lung cancer (Amsterdam, Netherlands)},
volume = {130},
number = {},
pages = {25-34},
doi = {10.1016/j.lungcan.2019.01.013},
pmid = {30885348},
issn = {1872-8332},
abstract = {OBJECTIVE: Epithelial-mesenchymal transition (EMT) is the key event in distant metastasis of diverse tumors including lung cancer. Recent evidence suggests the involvement of phosphatase and tensin homolog (PTEN) in EMT phenotypes. However, the molecular mechanism of EMT induced by PTEN inactivation is not clear in lung cancer. We aimed to investigate the role of PTEN inactivation in acquisition of EMT in lung cancer cells.<br><br>METHODS: We knocked out the PTEN in PTEN proficient lung cancer cells lines (A549 and NCI-H460) using CRISPR/Cas-9 system and observed the growth, EMT phenotypes, and EMT related molecules. We also explored the in vivo effect of PTEN inactivation on tumor cell growth and distant metastasis using nude mouse injection.<br><br>RESULTS: PTEN knockout (KO) cells showed faster growth, migration and invasion than PTEN wild-type (WT) cells. When we injected the cells into nude mice, PTEN-KO cells showed faster growth and higher metastatic potential. In PTEN-KO cells, the levels of phosphorylated AKT (Ser-473 and Thr-308) were profoundly elevated and the expressions of phosphorylated GSK-3β (Ser9, inactive form) increased, while that of β-catenin decreased. Regarding the EMT markers, the expression of E-cadherin decreased but those of N-cadherin, vimentin and MMP-2 increased in the PTEN-KO cells. Especially, PTEN-KO cells showed the almost complete intra-nuclear shift of β-catenin and no β-catenin signal was observed in the cell membrane. Accordingly, PTEN-KO cells exhibited morphological changes such as loss of cell-to-cell contact, pseudopodia and the round shape, which are the typical phenotypes of EMT. Snail and Slug were also dominantly accumulated in the nucleus after PTEN inactivation.<br><br>CONCLUSION: All these data consistently support that PTEN inactivation contributes to EMT by nuclear translocation of β-catenin and Snail/Slug in lung cancer cells.},
}
@article {pmid30237171,
year = {2018},
author = {Benoit, CR and Stanton, AE and Tartanian, AC and Motzer, AR and McGaughey, DM and Bond, SR and Brody, LC},
title = {Functional and phylogenetic characterization of noncanonical vitamin B12-binding proteins in zebrafish suggests involvement in cobalamin transport.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {45},
pages = {17606-17621},
pmid = {30237171},
issn = {1083-351X},
mesh = {Animals ; CRISPR-Cas Systems ; Protein Domains ; *Transcobalamins/chemistry/genetics/metabolism ; Vitamin B 12/chemistry/genetics/metabolism ; *Zebrafish/genetics/metabolism ; Zebrafish Proteins/chemistry/genetics/metabolism ; },
abstract = {In humans, transport of food-derived cobalamin (vitamin B12) from the digestive system into the bloodstream involves three paralogous proteins: transcobalamin (TC), haptocorrin (HC), and intrinsic factor (IF). Each of these proteins contains two domains, an α-domain and a β-domain, which together form a cleft in which cobalamin binds. Zebrafish (Danio rerio) are thought to possess only a single cobalamin transport protein, referred to as Tcn2, which is a transcobalamin homolog. Here, we used CRISPR/Cas9 mutagenesis to create null alleles of tcn2 in zebrafish. Fish homozygous for tcn2-null alleles were viable and exhibited no obvious developmentally or behaviorally abnormal phenotypes. For this reason, we hypothesized that previously unidentified cobalamin-carrier proteins encoded in the zebrafish genome may provide an additional pathway for cobalamin transport. We identified genes predicted to code for two such proteins, Tcn-beta-a (Tcnba) and Tcn-beta-b (Tcnbb), which differ from all previously characterized cobalamin transport proteins as they lack the α-domain. These β-domain-only proteins are representative of an undescribed class of cobalamin-carrier proteins that are highly conserved throughout the ray-finned fishes. We observed that the genes encoding the three cobalamin transport homologs, tcn2, tcnba, and tcnbb, are expressed in unique spatial and temporal patterns in the developing zebrafish. Moreover, exogenously expressed recombinant Tcnba and Tcnbb bound cobalamin with high affinity, comparable with binding by full-length Tcn2. Taken together, our results suggest that this noncanonical protein structure has evolved to fully function as a cobalamin-carrier protein, thereby allowing for a compensatory cobalamin transport mechanism in the tcn2-/- zebrafish.},
}
@article {pmid30118678,
year = {2018},
author = {Tan, Y and Jin, C and Ma, W and Hu, Y and Tanasa, B and Oh, S and Gamliel, A and Ma, Q and Yao, L and Zhang, J and Ohgi, K and Liu, W and Aggarwal, AK and Rosenfeld, MG},
title = {Dismissal of RNA Polymerase II Underlies a Large Ligand-Induced Enhancer Decommissioning Program.},
journal = {Molecular cell},
volume = {71},
number = {4},
pages = {526-539.e8},
pmid = {30118678},
issn = {1097-4164},
support = {R01 NS034934/NS/NINDS NIH HHS/United States ; R37 DK039949/DK/NIDDK NIH HHS/United States ; R01 CA213371/CA/NCI NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; R01 DK018477/DK/NIDDK NIH HHS/United States ; },
mesh = {Base Sequence ; Binding Sites ; CRISPR-Cas Systems ; *Enhancer Elements, Genetic ; Estradiol/pharmacology ; Estrogen Receptor alpha/*genetics/metabolism ; F-Box Proteins/*genetics/metabolism ; Gene Editing/methods ; Gene Expression Regulation/drug effects ; HEK293 Cells ; Hepatocyte Nuclear Factor 3-alpha/*genetics/metabolism ; Histones/genetics/metabolism ; Humans ; Jumonji Domain-Containing Histone Demethylases/*genetics/metabolism ; MCF-7 Cells ; Nedd4 Ubiquitin Protein Ligases/*genetics/metabolism ; Protein Binding ; RNA/genetics/metabolism ; RNA Polymerase II/*genetics/metabolism ; Signal Transduction ; Transcription, Genetic/drug effects ; Ubiquitination/drug effects ; },
abstract = {Nuclear receptors induce both transcriptional activation and repression programs responsible for development, homeostasis, and disease. Here, we report a previously overlooked enhancer decommissioning strategy underlying a large estrogen receptor alpha (ERα)-dependent transcriptional repression program. The unexpected signature for this E2-induced program resides in indirect recruitment of ERα to a large cohort of pioneer factor basally active FOXA1-bound enhancers that lack cognate ERα DNA-binding elements. Surprisingly, these basally active estrogen-repressed (BAER) enhancers are decommissioned by ERα-dependent recruitment of the histone demethylase KDM2A, functioning independently of its demethylase activity. Rather, KDM2A tethers the E3 ubiquitin-protein ligase NEDD4 to ubiquitylate/dismiss Pol II to abrogate eRNA transcription, with consequent target gene downregulation. Thus, our data reveal that Pol II ubiquitylation/dismissal may serve as a potentially broad strategy utilized by indirectly bound nuclear receptors to abrogate large programs of pioneer factor-mediated, eRNA-producing enhancers.},
}
@article {pmid30078338,
year = {2018},
author = {Blokhin, I and Khorkova, O and Hsiao, J and Wahlestedt, C},
title = {Developments in lncRNA drug discovery: where are we heading?.},
journal = {Expert opinion on drug discovery},
volume = {13},
number = {9},
pages = {837-849},
doi = {10.1080/17460441.2018.1501024},
pmid = {30078338},
issn = {1746-045X},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Drug Discovery/*methods/trends ; Humans ; *Molecular Biology ; Oligonucleotides/administration &amp; dosage ; RNA, Long Noncoding/*genetics ; },
abstract = {INTRODUCTION: The central dogma of molecular biology, which states that the only role of long RNA transcripts is to convey information from gene to protein, was brought into question in recent years due to discovery of the extensive presence and complex roles of long noncoding RNAs (lncRNAs). Furthermore, lncRNAs were found to be involved in pathogenesis of multiple diseases and thus represent a new class of therapeutic targets. Translational efforts in the lncRNA field have been augmented by progress in optimizing the chemistry and delivery platforms of lncRNA-targeting modalities, including oligonucleotide-based drugs and CRISPR-Cas9. Areas covered: This review covers the current advances in characterizing diversity and biological functions of lncRNA focusing on their therapeutic potential in selected therapeutic areas. Expert opinion: Due to accelerating parallel progress in lncRNA biology and lncRNA-compatible therapeutic modalities, it is likely that lncRNA-dependent mechanisms of pathogenesis will soon be targeted in various disorders, including neurological, psychiatric, cardiovascular, infectious diseases, and cancer. Significant efforts, however, are still required to better understand the biology of both lncRNAs and lncRNA-targeting drugs. Further work is needed in the areas of lncRNA nomenclature, database representation, intra/interfield communication, and education of the community at large.},
}
@article {pmid30033371,
year = {2018},
author = {Shou, J and Li, J and Liu, Y and Wu, Q},
title = {Precise and Predictable CRISPR Chromosomal Rearrangements Reveal Principles of Cas9-Mediated Nucleotide Insertion.},
journal = {Molecular cell},
volume = {71},
number = {4},
pages = {498-509.e4},
doi = {10.1016/j.molcel.2018.06.021},
pmid = {30033371},
issn = {1097-4164},
mesh = {Base Sequence ; CRISPR-Associated Protein 9/*genetics/metabolism ; *CRISPR-Cas Systems ; Carrier Proteins/genetics/metabolism ; *Clustered Regularly Interspaced Short Palindromic Repeats ; DNA/genetics/metabolism ; DNA Breaks, Double-Stranded ; *DNA End-Joining Repair ; Fanconi Anemia Complementation Group D2 Protein/genetics/metabolism ; Gene Duplication ; Gene Editing/*methods ; Genome, Human ; HEK293 Cells ; Humans ; Mutagenesis, Insertional ; Nuclear Proteins/genetics/metabolism ; RNA, Guide/*genetics/metabolism ; Sequence Deletion ; Sequence Inversion ; },
abstract = {Chromosomal rearrangements including large DNA-fragment inversions, deletions, and duplications by Cas9 with paired sgRNAs are important to investigate genome structural variations and developmental gene regulation, but little is known about the underlying mechanisms. Here, we report that disrupting CtIP or FANCD2, which have roles in alternative non-homologous end joining, enhances precise DNA-fragment deletion. By analyzing the inserted nucleotides at the junctions of DNA-fragment editing of deletions, inversions, and duplications and characterizing the cleaved products, we find that Cas9 endonucleolytically cleaves the noncomplementary strand with a flexible scissile profile upstream of the -3 position of the PAM site in vivo and in vitro, generating double-strand break ends with 5' overhangs of 1-3 nucleotides. Moreover, we find that engineered Cas9 nucleases have distinct cleavage profiles. Finally, Cas9-mediated nucleotide insertions are nonrandom and are equal to the combined sequences upstream of both PAM sites with predicted frequencies. Thus, precise and predictable DNA-fragment editing could be achieved by perturbing DNA repair genes and using appropriate PAM configurations.},
}
@article {pmid30017060,
year = {2018},
author = {Contreras, LM},
title = {Methods and advances in RNA characterization and design.},
journal = {Methods (San Diego, Calif.)},
volume = {143},
number = {},
pages = {1-3},
doi = {10.1016/j.ymeth.2018.06.003},
pmid = {30017060},
issn = {1095-9130},
mesh = {CRISPR-Cas Systems/genetics ; Computational Biology/instrumentation/*methods ; Gene Editing/instrumentation/*methods ; *Gene Expression Regulation ; High-Throughput Nucleotide Sequencing/instrumentation/methods ; Nanotechnology/instrumentation/*methods ; Nucleic Acid Conformation ; RNA/chemistry/*genetics/isolation &amp; purification/metabolism ; RNA Processing, Post-Transcriptional ; Sequence Analysis, RNA/instrumentation/methods ; Structure-Activity Relationship ; },
}
@article {pmid29458767,
year = {2018},
author = {Paul, MW and Zelensky, AN and Wyman, C and Kanaar, R},
title = {Single-Molecule Dynamics and Localization of DNA Repair Proteins in Cells.},
journal = {Methods in enzymology},
volume = {600},
number = {},
pages = {375-406},
doi = {10.1016/bs.mie.2017.11.015},
pmid = {29458767},
issn = {1557-7988},
mesh = {Animals ; BRCA2 Protein/*analysis/chemistry/metabolism ; CRISPR-Cas Systems/genetics ; Cell Culture Techniques/instrumentation/*methods ; Cells, Cultured ; DNA Breaks, Double-Stranded ; Fluorescence Recovery After Photobleaching/instrumentation/methods ; Gene Editing/methods ; Green Fluorescent Proteins/chemistry ; Intravital Microscopy/instrumentation/*methods ; Luminescent Agents/chemistry ; Mice ; Microscopy, Fluorescence/instrumentation/methods ; Mouse Embryonic Stem Cells ; Protein Binding ; Rad51 Recombinase/*analysis/chemistry/metabolism ; *Recombinational DNA Repair ; Single Molecule Imaging/instrumentation/*methods ; },
abstract = {Direct observation of individual protein molecules in their native environment, at nanometer resolution, in a living cell, in motion is not only fascinating but also uniquely informative. Several recent major technological advances in genomic engineering, protein and synthetic fluorophore development, and light microscopy have dramatically increased the accessibility of this approach. This chapter describes the procedures for modifying endogenous genomic loci to producing fluorescently tagged proteins, their high-resolution visualization, and analysis of their dynamics in mammalian cells, using DNA repair proteins BRCA2 and RAD51 as an example.},
}
@article {pmid29309838,
year = {2018},
author = {Lee, YJ and Moon, TS},
title = {Design rules of synthetic non-coding RNAs in bacteria.},
journal = {Methods (San Diego, Calif.)},
volume = {143},
number = {},
pages = {58-69},
doi = {10.1016/j.ymeth.2018.01.001},
pmid = {29309838},
issn = {1095-9130},
mesh = {Aptamers, Nucleotide/chemical synthesis/genetics ; Bacteria/*genetics ; CRISPR-Cas Systems/genetics ; Computational Biology/instrumentation/methods ; *Gene Expression Regulation, Bacterial ; RNA Interference ; RNA, Antisense/*chemical synthesis/genetics ; RNA, Untranslated/*chemical synthesis/genetics ; Synthetic Biology/instrumentation/methods ; },
abstract = {One of the long-term goals of synthetic biology is to develop designable genetic parts with predictable behaviors that can be utilized to implement diverse cellular functions. The discovery of non-coding RNAs and their importance in cellular processing have rapidly attracted researchers' attention towards designing functional non-coding RNA molecules. These synthetic non-coding RNAs have simple design principles governed by Watson-Crick base pairing, but exhibit increasingly complex functions. Importantly, due to their specific and modular behaviors, synthetic non-coding RNAs have been widely adopted to modulate transcription and translation of target genes. In this review, we summarize various design rules and strategies employed to engineer synthetic non-coding RNAs. Specifically, we discuss how RNA molecules can be transformed into powerful regulators and utilized to control target gene expression. With the establishment of generalizable non-coding RNA design rules, the research community will shift its focus to RNA regulators from protein regulators.},
}
@article {pmid30883991,
year = {2019},
author = {Moses, C and Kaur, P},
title = {Applications of CRISPR systems in respiratory health: Entering a new 'red pen' era in genome editing.},
journal = {Respirology (Carlton, Vic.)},
volume = {},
number = {},
pages = {},
doi = {10.1111/resp.13527},
pmid = {30883991},
issn = {1440-1843},
abstract = {Respiratory diseases, such as influenza infection, acute tracheal bronchitis, pneumonia, tuberculosis, chronic obstructive pulmonary disease, asthma, lung cancer and nasopharyngeal carcinoma, continue to significantly impact human health. Diseases of the lung and respiratory tract are influenced by environmental conditions and socio-economic factors; however, many of these serious respiratory disorders are also rooted in genetic or epigenetic causes. Clustered regularly interspaced palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins, isolated from the immune system of prokaryotes, provide a tool to manipulate gene sequences and gene expression with significant implications for respiratory research. CRISPR/Cas systems allow preclinical modelling of causal factors involved in many respiratory diseases, providing new insights into their underlying mechanisms. CRISPR can also be used to screen for genes involved in respiratory processes, development and pathology, identifying novel disease drivers or drug targets. Finally, CRISPR/Cas systems can potentially correct genetic mutations and edit epigenetic marks that contribute to respiratory disorders, providing a form of personalized medicine that could be used in conjunction with other technologies such as stem cell reprogramming and transplantation. CRISPR gene editing is a young field of research, and concerns regarding its specificity, as well as the need for efficient and safe delivery methods, need to be addressed further. However, CRISPR/Cas systems represent a significant step forward for research and therapy in respiratory health, and it is likely we will see the breakthroughs generated from this technology continue.},
}
@article {pmid30881132,
year = {2019},
author = {Lu, ZJ and Yu, Q and Zhou, SH and Fan, J and Shen, LF and Bao, YY and Wu, TT and Zhou, ML and Huang, YP},
title = {Construction of a GLUT-1 and HIF-1α gene knockout cell model in HEp-2 cells using the CRISPR/Cas9 technique.},
journal = {Cancer management and research},
volume = {11},
number = {},
pages = {2087-2096},
doi = {10.2147/CMAR.S183859},
pmid = {30881132},
issn = {1179-1322},
abstract = {Background: Glucose transporter (GLUT)-mediated glucose uptake is an important process in the development of laryngeal carcinoma, one of the most common malignancies of the head and neck. GLUT-1, together with HIF-1α, is also an indicator of hypoxia. Both proteins play a critical role in glucose uptake and glycolysis in laryngeal carcinoma cells under hypoxic stress. A double gene knockout model in which HIF-1α and GLUT-1 are no longer expressed can provide important information about carcinogenesis in laryngeal carcinoma.<br><br>Purpose: In this study we used the CRISPR/Cas 9 system to induce HIF-1α and GLUT-1 double gene knockout in HEp-2 cells and then used the knocked-out cells to study the role of these markers in laryngeal carcinoma, including in chemoradioresistance.<br><br>Methods: High-grade small-guide RNAs (sgRNAs) of HIF-1α and GLUT-1 were designed using an online tool and inserted into the pUC57-T7-gRNA vector. The recombinant plasmids were transfected into HEp-2 cells and positive cells were screened using the dilution method. Gene mutation and expression were determined by sequence analysis and immunoblotting.<br><br>Results: In HIF-1α and GLUT-1 double gene knockout HEp-2 cells, a 171-bp deletion in the HIF-1α genomic sequence was detected, whereas multiple base insertions resulted in frameshift mutations in the GLUT-1 gene. Neither HIF-1α nor GLUT-1 protein was expressed in positive cells. The proliferation, migration, and invasion of HEp-2 cells were significantly decreased afterward. The possible mechanism may be that the inhibition PI3K/AKT/mTOR pathway by HIF-1α and GLUT-1 double gene knockout using CRISPR/Cas9 technique lead to reduction of glucose uptake and lactic acid generation.<br><br>Conclusion: Our HIF-1α and GLUT-1 double gene knockout HEp-2 cell model, obtained using a CRISPR/Cas9-based system, may facilitate studies of the pathogenesis of laryngeal carcinoma.},
}
@article {pmid30584102,
year = {2019},
author = {Xiao, B and Yin, S and Hu, Y and Sun, M and Wei, J and Huang, Z and Wen, Y and Dai, X and Chen, H and Mu, J and Cui, L and Jiang, L},
title = {Epigenetic editing by CRISPR/dCas9 in Plasmodium falciparum.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {116},
number = {1},
pages = {255-260},
doi = {10.1073/pnas.1813542116},
pmid = {30584102},
issn = {1091-6490},
support = {R01 AI116466/AI/NIAID NIH HHS/United States ; U19 AI089672/AI/NIAID NIH HHS/United States ; },
mesh = {CRISPR-Associated Protein 9/genetics ; *CRISPR-Cas Systems ; *Epigenesis, Genetic ; Erythrocytes/parasitology ; Gene Editing/*methods ; Gene Knockdown Techniques ; Genes, Protozoan/genetics ; Histone Acetyltransferases/genetics ; Histone Deacetylases/genetics ; Humans ; Malaria, Falciparum/parasitology ; Plasmodium falciparum/*genetics/physiology ; Recombinant Proteins ; },
abstract = {Genetic manipulation remains a major obstacle for understanding the functional genomics of the deadliest malaria parasite Plasmodium falciparum Although the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeat/CRISPR-associated protein 9) system has been successfully applied to introduce permanent changes in the parasite genome, its use is still limited. Here we show that fusing different epigenetic effector domains to a Cas9 null mutant efficiently and specifically reprograms the expression of target genes in P. falciparum By precisely writing and erasing histone acetylation at the transcription start site regions of the invasion-related genes reticulocyte binding protein homolog 4 (rh4) and erythrocyte binding protein 175 (eba-175), respectively, we achieved significant activation of rh4 and repression of eba-175, leading to the switch of the parasite invasion pathways into human erythrocytes. By using the epigenetic knockdown system, we have also characterized the effects of PfSET1, previously identified as an essential gene, on expression of mainly trophozoite- and schizont-specific genes, and therefore regulation of the growth of the mature forms of P. falciparum This epigenetic CRISPR/dCas9 system provides a powerful approach for regulating gene expression at the transcriptional level in P. falciparum.},
}
@article {pmid30529264,
year = {2019},
author = {Shi, X and He, W and Guo, S and Zhang, B and Ren, S and Liu, K and Sun, T and Cui, J},
title = {RNA-seq Analysis of the SCN1A-KO Model based on CRISPR/Cas9 Genome Editing Technology.},
journal = {Neuroscience},
volume = {398},
number = {},
pages = {1-11},
doi = {10.1016/j.neuroscience.2018.11.052},
pmid = {30529264},
issn = {1873-7544},
mesh = {Animals ; *CRISPR-Cas Systems ; Cell Line ; Epilepsies, Myoclonic/genetics/metabolism ; *Gene Editing ; Gene Expression ; *Gene Knockout Techniques/methods ; Mice ; NAV1.1 Voltage-Gated Sodium Channel/*deficiency/genetics ; RNA, Messenger/metabolism ; Sequence Analysis, RNA ; Signal Transduction ; },
abstract = {Dravet syndrome (DS) is a disease that is primarily caused by the inactivation of the SCN1A-encoded voltage-gated sodium channel alpha subunit (Nav1.1). In this study, we constructed an SCN1A gene knockout model using CRISPR/Cas9 genome editing technology to deprive the Nav1.1 function in vitro. With mRNA-seq analysis we found abundant gene changes after SCN1A knockout, which associated with various signaling pathways, such as cancer pathways, the PI3K-AKT signaling pathway, the MAPK signaling pathway, and pathways involved in HTLV-I infection. We also noticed changes in the spliceosome, decreased glycolytic capacity, disturbances in calcium signaling pathways, and changes in the potassium, sodium, chloride, and calcium plasma channels after SCN1A knockout. In this study, we have been the first time to discover these changes and summarize them here and hope it would provide some clue for the study of Nav1.1 in the nervous system.},
}
@article {pmid30476497,
year = {2019},
author = {Fujii, M and Clevers, H and Sato, T},
title = {Modeling Human Digestive Diseases With CRISPR-Cas9-Modified Organoids.},
journal = {Gastroenterology},
volume = {156},
number = {3},
pages = {562-576},
doi = {10.1053/j.gastro.2018.11.048},
pmid = {30476497},
issn = {1528-0012},
mesh = {CRISPR-Cas Systems/*genetics ; Colorectal Neoplasms/genetics/pathology ; Esophageal Neoplasms/genetics/pathology ; Female ; Gastrointestinal Diseases/genetics/pathology ; Gastrointestinal Neoplasms/*genetics/*pathology ; Gastrointestinal Tract/pathology ; *Genetic Predisposition to Disease ; Humans ; Male ; *Organoids ; Pancreatic Neoplasms/genetics/pathology ; Sensitivity and Specificity ; },
abstract = {Insights into the stem cell niche have allowed researchers to cultivate adult tissue stem cells as organoids that display structural and phenotypic features of healthy and diseased epithelial tissues. Organoids derived from patients' tissues are used as models of disease and to test drugs. CRISPR-Cas9 technology can be used to genetically engineer organoids for studies of monogenic diseases and cancer. We review the derivation of organoids from human gastrointestinal tissues and how CRISPR-Cas9 technology can be used to study these organoids. We discuss burgeoning technologies that are broadening our understanding of diseases of the digestive system.},
}
@article {pmid30258161,
year = {2018},
author = {DeWeerdt, S},
title = {The genomics of brain cancer.},
journal = {Nature},
volume = {561},
number = {7724},
pages = {S54-S55},
doi = {10.1038/d41586-018-06711-8},
pmid = {30258161},
issn = {1476-4687},
mesh = {Adult ; Animals ; Brain Neoplasms/diagnosis/*genetics/*therapy ; CRISPR-Cas Systems/genetics ; Chromosome Deletion ; Chromosomes, Human, Pair 19/genetics ; Gene Editing ; *Genetic Predisposition to Disease ; Genome, Human/*genetics ; *Genomics ; Glioblastoma/diagnosis/genetics/therapy ; Glioma/diagnosis/genetics/therapy ; Humans ; Isocitrate Dehydrogenase/genetics ; Mice ; Mutation ; Oligodendroglioma/diagnosis/pathology/therapy ; *Pharmacogenomic Testing ; Precision Medicine ; Prognosis ; Survival Analysis ; Telomere Homeostasis/genetics ; Treatment Outcome ; World Health Organization ; },
}
@article {pmid30224336,
year = {2018},
author = {Wang, H and Park, H and Liu, J and Sternberg, PW},
title = {An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {11},
pages = {3607-3616},
pmid = {30224336},
issn = {2160-1836},
support = {K99 GM126137/GM/NIGMS NIH HHS/United States ; P40 OD010440/OD/NIH HHS/United States ; R24 OD023041/OD/NIH HHS/United States ; T32 GM007616/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Caenorhabditis elegans/*genetics ; Caenorhabditis elegans Proteins/genetics ; *Gene Editing ; Mutation ; },
abstract = {Null mutants are essential for analyzing gene function. Here, we describe a simple and efficient method to generate Caenorhabditis elegans null mutants using CRISPR/Cas9 and short single stranded DNA oligo repair templates to insert a universal 43-nucleotide-long knock-in cassette (STOP-IN) into the early exons of target genes. This STOP-IN cassette has stop codons in all three reading frames and leads to frameshifts, which will generate putative null mutations regardless of the reading frame of the insertion position in exons. The STOP-IN cassette also contains an exogenous Cas9 target site that allows further genome editing and provides a unique sequence that simplifies the identification of successful insertion events via PCR. As a proof of concept, we inserted the STOP-IN cassette at a Cas9 target site in aex-2 to generate new putative null alleles by injecting preassembled Cas9 ribonucleoprotein and a short synthetic single stranded DNA repair template containing the STOP-IN cassette and two ∼35-nucleotide-long homology arms identical to the sequences flanking the Cas9 cut site. We showed that these new aex-2 alleles phenocopied an existing loss-of-function allele of aex-2 We further showed that the new aex-2 null alleles could be reverted back to the wild-type sequence by targeting the exogenous Cas9 cut site included in the STOP-IN cassette and providing a single stranded wild-type DNA repair oligo. We applied our STOP-IN method to generate new putative null mutants for 20 additional genes, including three pharyngeal muscle-specific genes (clik-1, clik-2, and clik-3), and reported a high insertion rate (46%) based on the animals we screened. We showed that null mutations of clik-2 cause recessive lethality with a severe pumping defect and clik-3 null mutants have a mild pumping defect, while clik-1 is dispensable for pumping. We expect that the knock-in method using the STOP-IN cassette will facilitate the generation of new null mutants to understand gene function in C. elegans and other genetic model organisms.},
}
@article {pmid30213867,
year = {2018},
author = {Huynh, N and Zeng, J and Liu, W and King-Jones, K},
title = {A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {11},
pages = {3593-3605},
pmid = {30213867},
issn = {2160-1836},
mesh = {Animals ; CRISPR-Cas Systems ; Cytochrome P-450 Enzyme System/genetics ; Drosophila/*genetics ; Drosophila Proteins/genetics ; Exocrine Glands/*metabolism ; Gene Expression Regulation ; Mixed Function Oxygenases/genetics ; },
abstract = {Targeting gene function with spatial or temporal specificity is a key goal in molecular genetics. CRISPR-Cas9 has greatly facilitated this strategy, but some standard approaches are problematic. For instance, simple tissue-specific or global overexpression of Cas9 can cause significant lethality or developmental delays even in the absence of gRNAs. In particular, we found that Gal4-mediated expression of UAS-Cas9 in the Drosophila prothoracic gland (PG) was not a suitable strategy to disrupt gene expression, since Cas9 alone caused widespread lethality. The PG is widely used for studying endocrine gland function during animal development, but tools validating PG-specific RNAi phenotypes are lacking. Here, we present a collection of modular gateway-compatible CRISPR-Cas9 tools that allow precise modulation of target gene activity with temporal and spatial specificity. We also demonstrate that Cas9 fused to the progesterone ligand-binding domain can be used to activate gene expression via RU486. Using these approaches, we were able to avoid the lethality associated with simple GAL4-mediated overexpression of Cas9 in the PG. Given that the PG is a polytene tissue, we conclude that these tools work effectively in endoreplicating cells where Cas9 has to target multiple copies of the same locus. Our toolkit can be easily adapted for other tissues and can be used both for gain- and loss-of-function studies.},
}
@article {pmid30169977,
year = {2018},
author = {Luther, DC and Lee, YW and Nagaraj, H and Scaletti, F and Rotello, VM},
title = {Delivery approaches for CRISPR/Cas9 therapeutics in vivo: advances and challenges.},
journal = {Expert opinion on drug delivery},
volume = {15},
number = {9},
pages = {905-913},
doi = {10.1080/17425247.2018.1517746},
pmid = {30169977},
issn = {1744-7593},
support = {R01 EB022641/EB/NIBIB NIH HHS/United States ; R01 GM077173/GM/NIGMS NIH HHS/United States ; T32 GM008515/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Editing/*methods ; Gene Transfer Techniques ; Genetic Therapy/*methods ; Humans ; RNA, Messenger/genetics ; },
abstract = {INTRODUCTION: Therapeutic gene editing is becoming a viable biomedical tool with the emergence of the CRISPR/Cas9 system. CRISPR-based technologies have promise as a therapeutic platform for many human genetic diseases previously considered untreatable, providing a flexible approach to high-fidelity gene editing. For many diseases, such as sickle-cell disease and beta thalassemia, curative therapy may already be on the horizon, with CRISPR-based clinical trials slated for the next few years. Translation of CRISPR-based therapy to in vivo application however, is no small feat, and major hurdles remain for efficacious use of the CRISPR/Cas9 system in clinical contexts. Areas covered: In this topical review, we highlight recent advances to in vivo delivery of the CRISPR/Cas9 system using various packaging formats, including viral, mRNA, plasmid, and protein-based approaches. We also discuss some of the barriers which have yet to be overcome for successful translation of this technology. Expert opinion: This review focuses on the challenges to efficacy for various delivery formats, with specific emphasis on overcoming these challenges through the development of carrier vehicles for transient approaches to CRISPR/Cas9 delivery in vivo.},
}
@article {pmid30061297,
year = {2018},
author = {Callahan, SJ and Tepan, S and Zhang, YM and Lindsay, H and Burger, A and Campbell, NR and Kim, IS and Hollmann, TJ and Studer, L and Mosimann, C and White, RM},
title = {Cancer modeling by Transgene Electroporation in Adult Zebrafish (TEAZ).},
journal = {Disease models &amp; mechanisms},
volume = {11},
number = {9},
pages = {},
pmid = {30061297},
issn = {1754-8411},
support = {DP2 CA186572/CA/NCI NIH HHS/United States ; F30 CA220954/CA/NCI NIH HHS/United States ; K08 AR055368/AR/NIAMS NIH HHS/United States ; P30 CA008748/CA/NCI NIH HHS/United States ; F99 CA212436/CA/NCI NIH HHS/United States ; T32 GM007739/GM/NIGMS NIH HHS/United States ; F31 CA196305/CA/NCI NIH HHS/United States ; },
mesh = {Aging/*genetics ; Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems/genetics ; Carcinogenesis/genetics/pathology ; Disease Models, Animal ; Disease Progression ; *Electroporation ; Embryo, Nonmammalian/metabolism ; Gene Transfer Techniques ; Melanoma/pathology ; Plasmids/genetics ; Promoter Regions, Genetic ; *Transgenes ; Zebrafish/embryology/*genetics ; },
abstract = {Transgenic animals are invaluable for modeling cancer genomics, but often require complex crosses of multiple germline alleles to obtain the desired combinations. Zebrafish models have advantages in that transgenes can be rapidly tested by mosaic expression, but typically lack spatial and temporal control of tumor onset, which limits their utility for the study of tumor progression and metastasis. To overcome these limitations, we have developed a method referred to as Transgene Electroporation in Adult Zebrafish (TEAZ). TEAZ can deliver DNA constructs with promoter elements of interest to drive fluorophores, oncogenes or CRISPR-Cas9-based mutagenic cassettes in specific cell types. Using TEAZ, we created a highly aggressive melanoma model via Cas9-mediated inactivation of Rb1 in the context of BRAFV600E in spatially constrained melanocytes. Unlike prior models that take ∼4 months to develop, we found that TEAZ leads to tumor onset in ∼7 weeks, and these tumors develop in fully immunocompetent animals. As the resulting tumors initiated at highly defined locations, we could track their progression via fluorescence, and documented deep invasion into tissues and metastatic deposits. TEAZ can be deployed to other tissues and cell types, such as the heart, with the use of suitable transgenic promoters. The versatility of TEAZ makes it widely accessible for rapid modeling of somatic gene alterations and cancer progression at a scale not achievable in other in vivo systems.},
}
@article {pmid29981117,
year = {2018},
author = {Loyola-Vargas, VM and Avilez-Montalvo, RN},
title = {Plant Tissue Culture: A Battle Horse in the Genome Editing Using CRISPR/Cas9.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1815},
number = {},
pages = {131-148},
doi = {10.1007/978-1-4939-8594-4_7},
pmid = {29981117},
issn = {1940-6029},
mesh = {CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; *Gene Editing ; *Genome, Plant ; Plants/*genetics ; Tissue Culture Techniques/*methods ; },
abstract = {Plant tissue culture (PTC) is a set of techniques for culturing cells, tissues, or organs in an aseptic medium with a defined chemical composition, in a controlled environment. Tissue culture, when combined with molecular biology techniques, becomes a powerful tool for the study of metabolic pathways, elucidation of cellular processes, genetic improvement and, through genetic engineering, the generation of cell lines resistant to biotic and abiotic stress, obtaining improved plants of agronomic interest, or studying the complex cellular genome. In this chapter, we analyze in general the use of plant tissue culture, in particular protoplasts and calli, in the implementation of CRISPR/Cas9 technology.},
}
@article {pmid29963983,
year = {2018},
author = {Rouillon, C and Athukoralage, JS and Graham, S and Grüschow, S and White, MF},
title = {Control of cyclic oligoadenylate synthesis in a type III CRISPR system.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {29963983},
issn = {2050-084X},
support = {Project grant BB/M000400/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Adenine Nucleotides/*biosynthesis ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; DNA-Binding Proteins/genetics/metabolism ; Endodeoxyribonucleases/*genetics/metabolism ; Endoribonucleases/genetics/metabolism ; Escherichia coli Proteins/genetics/metabolism ; Kinetics ; Oligoribonucleotides/*biosynthesis ; Phosphorothioate Oligonucleotides/pharmacology ; RNA Cleavage ; RNA Viruses/*genetics/metabolism ; RNA, Viral/*genetics/metabolism ; RNA-Binding Proteins/genetics/metabolism ; Sulfolobus solfataricus/drug effects/*genetics/immunology/metabolism ; Time Factors ; },
abstract = {The CRISPR system for prokaryotic adaptive immunity provides RNA-mediated protection from viruses and mobile genetic elements. When viral RNA transcripts are detected, type III systems adopt an activated state that licenses DNA interference and synthesis of cyclic oligoadenylate (cOA). cOA activates nucleases and transcription factors that orchestrate the antiviral response. We demonstrate that cOA synthesis is subject to tight temporal control, commencing on target RNA binding, and is deactivated rapidly as target RNA is cleaved and dissociates. Mismatches in the target RNA are well tolerated and still activate the cyclase domain, except when located close to the 3' end of the target. Phosphorothioate modification reduces target RNA cleavage and stimulates cOA production. The 'RNA shredding' activity originally ascribed to type III systems may thus be a reflection of an exquisite mechanism for control of the Cas10 subunit, rather than a direct antiviral defence.},
}
@article {pmid29174564,
year = {2018},
author = {Rauch, F and Geng, Y and Lamplugh, L and Hekmatnejad, B and Gaumond, MH and Penney, J and Yamanaka, Y and Moffatt, P},
title = {Crispr-Cas9 engineered osteogenesis imperfecta type V leads to severe skeletal deformities and perinatal lethality in mice.},
journal = {Bone},
volume = {107},
number = {},
pages = {131-142},
doi = {10.1016/j.bone.2017.11.013},
pmid = {29174564},
issn = {1873-2763},
support = {MOP-137102//CIHR/Canada ; },
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Cell Differentiation/genetics ; *Disease Models, Animal ; Gene Editing/methods ; Gene Knock-In Techniques ; Inflammation/genetics/pathology ; Membrane Proteins/*genetics ; Mesenchymal Stem Cells/metabolism/pathology ; Mice ; Mutation ; Osteoblasts/metabolism/*pathology ; Osteogenesis/genetics ; Osteogenesis Imperfecta/*genetics/*pathology ; },
abstract = {Osteogenesis imperfecta (OI) type V is caused by an autosomal dominant mutation in the IFITM5 gene, also known as BRIL. The c.-14C>T mutation in the 5'UTR of BRIL creates a novel translational start site adding 5 residues (MALEP) in frame with the natural coding of BRIL. A neomorphic function has been proposed for the MALEP-BRIL but the mechanisms at play are still unknown. In order to further understand the effects of MALEP-BRIL in vivo, we generated a knockin (KI) mouse model having the exact genetic -14C>T replica of patients with OI type V. Live KI descendants were never obtained from 2 male mosaic founders. Skeletal staining with alizarin red/alcian blue and μCT imaging of KI embryos revealed striking skeletal anomalies such as hypomineralized skull, short and bent long bones, and frail and wavy ribs. Histology and histochemical labeling revealed that midshaft of long bones was filled with hypertrophic chondrocytes, lacked a defined primary ossification center with the absence of defined cortices. Gene expression monitoring at E15.5 and E17.5 showed no change in Osx but decreased Bril itself as well as other differentiated osteoblast markers (Ibsp, Bglap, Sost). However, upregulation of Ptgs2 and Nr4a3 suggested that a pro-inflammatory reaction was activated. Primary osteoblasts from KI calvaria showed delayed differentiation and mineralization, with decreased abundance of BRIL. However, the upregulation AdipoQ and Fabp4 in young cultures indicated a possible switch in fate towards adipogenesis. Altogether our data suggest that the low level expression of MALEP-BRIL in Osx+ mesenchymal progenitors blunted their further differentiation into mature osteoblasts, which may have resulted in part from an inflammatory response.},
}
@article {pmid30878030,
year = {2018},
author = {Makarova, SS and Khromov, AV and Spechenkova, NA and Taliansky, ME and Kalinina, NO},
title = {Application of the CRISPR/Cas System for Generation of Pathogen-Resistant Plants.},
journal = {Biochemistry. Biokhimiia},
volume = {83},
number = {12},
pages = {1552-1562},
doi = {10.1134/S0006297918120131},
pmid = {30878030},
issn = {1608-3040},
abstract = {The use of the CRISPR/Cas9 prokaryotic adaptive immune system has led to a breakthrough in targeted genome editing in eukaryotes. The CRISPR/Cas technology allows to generate organisms with desirable characteristics by introducing deletions/insertions into selected genome loci resulting in the knockout or modification of target genes. This review focuses on the current state of the CRISPR/Cas use for the generation of plants resistant to viruses, bacteria, and parasitic fungi. Resistance to DNA- and RNA-containing viruses is usually provided by expression in transgenic plants of the Cas endonuclease gene and short guide RNAs (sgRNAs) targeting certain sites in the viral or the host plant genomes to ensure either direct cleavage of the viral genome or modification of the plant host genome in order to decrease the efficiency of virus replication. Editing of plant genes involved in the defense response to pathogens increases plants resistance to bacteria and pathogenic fungi. The review explores strategies and prospects of the development of pathogen-resistant plants with a focus on the generation of non-transgenic (non-genetically modified) organisms, in particular, by using plasmid (DNA)-free systems for delivery of the Cas/sgRNA editing complex into plant cells.},
}
@article {pmid30877356,
year = {2019},
author = {Zhang, YT and Jiang, JY and Shi, TQ and Sun, XM and Zhao, QY and Huang, H and Ren, LJ},
title = {Application of the CRISPR/Cas system for genome editing in microalgae.},
journal = {Applied microbiology and biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00253-019-09726-x},
pmid = {30877356},
issn = {1432-0614},
support = {21878151//National Natural Science Foundation of China/ ; BK20160092//Outstanding Youth Foundation of Jiangsu Province of China/ ; 2015//Program for Innovative Research Teams in Universities of Jiangsu Province/ ; XTE1829//Jiangsu Synergetic Innovation Center for Advanced Bio-Manufacture/ ; 18KJB530007//General Program on Natural Science Research Projects of Higher Education of Jiangsu/ ; },
abstract = {Microalgae are arguably the most abundant single-celled eukaryotes and are widely distributed in oceans and freshwater lakes. Moreover, microalgae are widely used in biotechnology to produce bioenergy and high-value products such as polyunsaturated fatty acids (PUFAs), bioactive peptides, proteins, antioxidants and so on. In general, genetic editing techniques were adapted to increase the production of microalgal metabolites. The main genome editing tools available today include zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas nuclease system. Due to its high genome editing efficiency, the CRISPR/Cas system is emerging as the most important genome editing method. In this review, we summarized the available literature on the application of CRISPR/Cas in microalgal genetic engineering, including transformation methods, strategies for the expression of Cas9 and sgRNA, the CRISPR/Cas9-mediated gene knock-in/knock-out strategies, and CRISPR interference expression modification strategies.},
}
@article {pmid30875129,
year = {2019},
author = {Musharova, O and Sitnik, V and Vlot, M and Savitskaya, E and Datsenko, KA and Krivoy, A and Fedorov, I and Semenova, E and Brouns, SJJ and Severinov, K},
title = {Systematic analysis of Type I-E Escherichia coli CRISPR-Cas PAM sequences ability to promote interference and primed adaptation.},
journal = {Molecular microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/mmi.14237},
pmid = {30875129},
issn = {1365-2958},
abstract = {CRISPR interference occurs when a protospacer recognized by the CRISPR RNA is destroyed by Cas effectors. In Type I CRISPR-Cas systems, protospacer recognition can lead to «primed adaptation» - acquisition of new spacers from in cis located sequences. Type I CRISPR-Cas systems require the presence of a trinucleotide protospacer adjacent motif (PAM) for efficient interference. Here, we investigated the ability of each of 64 possible trinucleotides located at the PAM position to induce CRISPR interference and primed adaptation by the Escherichia coli Type I-E CRISPR-Cas system. We observed clear separation of PAM variants into three groups: those unable to cause interference, those that support rapid interference, and those that lead to reduced interference that occurs over extended periods of time. PAM variants unable to support interference also did not support primed adaptation; those that supported rapid interference led to no or low levels of adaptation, while those that caused attenuated levels of interference consistently led to highest levels of adaptation. The results suggest that primed adaptation is fueled by the products of CRISPR interference. Extended over time interference with targets containing «attenuated» PAM variants provides a continuous source of new spacers leading to high overall level of spacer acquisition. This article is protected by copyright. All rights reserved.},
}
@article {pmid30874768,
year = {2019},
author = {Atmadjaja, AN and Holby, V and Harding, AJ and Krabben, P and Smith, HK and Jenkinson, ER},
title = {CRISPR-Cas, a highly effective tool for genome editing in Clostridium saccharoperbutylacetonicum N1-4(HMT).},
journal = {FEMS microbiology letters},
volume = {},
number = {},
pages = {},
doi = {10.1093/femsle/fnz059},
pmid = {30874768},
issn = {1574-6968},
abstract = {The solventogenic clostridia have long been known for their ability to convert sugars from complex feedstocks into commercially important solvents. Although the acetone-butanol-ethanol (ABE) process fell out of favour decades ago, renewed interest in sustainability and 'green' chemistry has re-established our appetite for reviving technologies such as these, albeit with 21st century improvements. As CRISPR-Cas genome editing tools are being developed and applied to the solventogenic clostridia, their industrial potential is growing. Through integration of new pathways, the beneficial traits and historical track record of clostridial fermentation can be exploited to generate a much wider range of industrially relevant products. Here we show the application of genome editing using the endogenous CRISPR-Cas mechanism of Clostridium saccharoperbutylacetonicum N1-4(HMT), to generate a deletion, SNP and to integrate new DNA into the genome. These technological advancements pave the way for application of clostridial species to the production of an array of products.},
}
@article {pmid30871003,
year = {2019},
author = {Ashley, CL and Abendroth, A and McSharry, BP and Slobedman, B},
title = {Interferon-Independent Upregulation of Interferon-Stimulated Genes during Human Cytomegalovirus Infection is Dependent on IRF3 Expression.},
journal = {Viruses},
volume = {11},
number = {3},
pages = {},
doi = {10.3390/v11030246},
pmid = {30871003},
issn = {1999-4915},
support = {1063738//National Health and Medical Research Council/ ; },
abstract = {The antiviral activity of type I interferons (IFNs) is primarily mediated by interferon-stimulated genes (ISGs). Induction of ISG transcription is achieved when type I IFNs bind to their cognate receptor and activate the Janus Kinase/Signal Transducer and Activator of Transcription (JAK/STAT) signaling pathways. Recently it has become clear that a number of viruses are capable of directly upregulating a subset of ISGs in the absence of type I IFN production. Using cells engineered to block either the response to, or production of type I IFN, the regulation of IFN-independent ISGs was examined in the context of human cytomegalovirus (HCMV) infection. Several ISGs, including IFIT1, IFIT2, IFIT3, Mx1, Mx2, CXCL10 and ISG15 were found to be upregulated transcriptionally following HCMV infection independently of type I IFN-initiated JAK-STAT signaling, but dependent on intact IRF3 signaling. ISG15 protein regulation mirrored that of its transcript with IFNβ neutralization failing to completely inhibit ISG15 expression post HCMV infection. In addition, no detectable ISG15 protein expression was observed following HCMV infection in IRF3 knockdown CRISPR/Cas-9 clones indicating that IFN-independent control of ISG expression during HCMV infection of human fibroblasts is absolutely dependent on IRF3 expression.},
}
@article {pmid30260998,
year = {2018},
author = {Veach, RA and Wilson, MH},
title = {CRISPR/Cas9 engineering of a KIM-1 reporter human proximal tubule cell line.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0204487},
pmid = {30260998},
issn = {1932-6203},
support = {I01 BX002190/BX/BLRD VA/United States ; I01 BX004258/BX/BLRD VA/United States ; R01 DK093660/DK/NIDDK NIH HHS/United States ; },
mesh = {Acute Kidney Injury/genetics/metabolism ; CRISPR-Cas Systems ; Cell Line ; Cisplatin/pharmacology ; Gene Knock-In Techniques ; Gene Targeting ; Genes, Reporter ; Genetic Engineering ; Glucose/pharmacology ; Green Fluorescent Proteins/genetics ; Hepatitis A Virus Cellular Receptor 1/*genetics/*metabolism ; Homologous Recombination ; Humans ; Kidney Tubules, Proximal/cytology/drug effects/*metabolism ; Luciferases/genetics ; Up-Regulation/drug effects ; },
abstract = {We used the CRISPR/Cas9 system to knock-in reporter transgenes at the kidney injury molecule-1 (KIM-1) locus and isolated human proximal tubule cell (HK-2) clones. PCR verified targeted knock-in of the luciferase and eGFP reporter at the KIM-1 locus. HK-2-KIM-1 reporter cells responded to various stimuli including hypoxia, cisplatin, and high glucose, indicative of upregulation of KIM-1 expression. We attempted using CRISPR/Cas9 to also engineer the KIM-1 reporter in telomerase-immortalized human RPTEC cells. However, these cells demonstrated an inability to undergo homologous recombination at the target locus. KIM-1-reporter human proximal tubular cells could be valuable tools in drug discovery for molecules inhibiting kidney injury. Additionally, our gene targeting strategy could be used in other cell lines to evaluate the biology of KIM-1 in vitro or in vivo.},
}
@article {pmid30043304,
year = {2018},
author = {Curtin, SJ},
title = {Editing the Medicago truncatula Genome: Targeted Mutagenesis Using the CRISPR-Cas9 Reagent.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1822},
number = {},
pages = {161-174},
doi = {10.1007/978-1-4939-8633-0_12},
pmid = {30043304},
issn = {1940-6029},
mesh = {*CRISPR-Cas Systems ; Chromosome Deletion ; Chromosomes, Plant ; *Gene Editing ; Gene Knockout Techniques ; Genes, Plant ; Genetic Engineering ; *Genome, Plant ; *Genomics/methods ; Mutagenesis ; },
abstract = {Medicago truncatula is an annual plant used for studying legume biology, in particular symbioses with nitrogen-fixing rhizobia and arbuscular mycorrhizal fungi. Efforts to decipher the genetic basis of these ecologically and economically important traits are a major goal of plant and crop biology. M. truncatula is an excellent model system for this purpose, as it has several publicly available sequenced genomes, has a rapid seed-to-seed generation time, and is highly transformable. Various mutagenesis platforms such as Tnt1 retrotransposons and RNAi knockdown have been used successfully in forward and reverse genetic studies to identify and functionally characterize candidate genes. The CRISPR/Cas9 reagent is the most recent mutagenesis platform and is highly effective at generating site-directed double-stranded breaks (DSB) in M. truncatula. This protocol will demonstrate the construction of reagents using two genome engineering platforms that have successfully generated mutant plants in M. truncatula, M. sativa, and soybean systems. The reagents are easy to assemble, can be quickly retrofitted to test novel regulatory sequences for improved efficiency, and can be used for more advanced genome engineering strategies such as gene insertion or gene replacement.},
}
@article {pmid29475732,
year = {2018},
author = {Fehse, B and Abramowski-Mock, U},
title = {The Time Is Ripe for Somatic Genome Editing: NIH Program to Strengthen Translation.},
journal = {Molecular therapy : the journal of the American Society of Gene Therapy},
volume = {26},
number = {3},
pages = {671-674},
pmid = {29475732},
issn = {1525-0024},
mesh = {Animals ; CRISPR-Cas Systems ; Capital Financing ; *Gene Editing/methods ; *Genome ; *Genomics/methods ; Humans ; National Institutes of Health (U.S.) ; Transcription Activator-Like Effector Nucleases ; Translational Medical Research/methods/organization &amp; administration ; United States ; },
}
@article {pmid29324392,
year = {2018},
author = {Banaszak, LG and Giudice, V and Zhao, X and Wu, Z and Gao, S and Hosokawa, K and Keyvanfar, K and Townsley, DM and Gutierrez-Rodrigues, F and Fernandez Ibanez, MDP and Kajigaya, S and Young, NS},
title = {Abnormal RNA splicing and genomic instability after induction of DNMT3A mutations by CRISPR/Cas9 gene editing.},
journal = {Blood cells, molecules &amp; diseases},
volume = {69},
number = {},
pages = {10-22},
doi = {10.1016/j.bcmd.2017.12.002},
pmid = {29324392},
issn = {1096-0961},
support = {/HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Apoptosis/genetics ; *CRISPR-Cas Systems ; Cell Differentiation/genetics ; Cell Line, Tumor ; Cell Proliferation ; DNA (Cytosine-5-)-Methyltransferases/*genetics/metabolism ; DNA Damage ; *Gene Editing ; *Genomic Instability ; Humans ; K562 Cells ; Mutation ; *RNA Splicing ; Sequence Analysis, DNA ; Spliceosomes/metabolism ; },
abstract = {DNA methyltransferase 3A (DNMT3A) mediates de novo DNA methylation. Mutations in DNMT3A are associated with hematological malignancies, most frequently acute myeloid leukemia. DNMT3A mutations are hypothesized to establish a pre-leukemic state, rendering cells vulnerable to secondary oncogenic mutations and malignant transformation. However, the mechanisms by which DNMT3A mutations contribute to leukemogenesis are not well-defined. Here, we successfully created four DNMT3A-mutated K562 cell lines with frameshift mutations resulting in truncated DNMT3A proteins. DNMT3A-mutated cell lines exhibited significantly impaired growth and increased apoptotic activity compared to wild-type (WT) cells. Consistent with previous studies, DNMT3A-mutated cells displayed impaired differentiation capacity. RNA-seq was used to compare transcriptomes of DNMT3A-mutated and WT cells; DNMT3A ablation resulted in downregulation of genes involved in spliceosome function, causing dysfunction of RNA splicing. Unexpectedly, we observed DNMT3A-mutated cells to exhibit marked genomic instability and an impaired DNA damage response compared to WT. CRISPR/Cas9-mediated DNMT3A-mutated K562 cells may be used to model effects of DNMT3A mutations in human cells. Our findings implicate aberrant splicing and induction of genomic instability as potential mechanisms by which DNMT3A mutations might predispose to malignancy.},
}
@article {pmid28811591,
year = {2017},
author = {Zhang, X and Li, W and Liu, C and Peng, X and Lin, J and He, S and Li, X and Han, B and Zhang, N and Wu, Y and Chen, L and Wang, L and MaYila, and Huang, J and Liu, M},
title = {Alteration of sheep coat color pattern by disruption of ASIP gene via CRISPR Cas9.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {8149},
pmid = {28811591},
issn = {2045-2322},
mesh = {Agouti Signaling Protein/*genetics ; Amino Acid Sequence ; Animals ; Base Sequence ; *CRISPR-Cas Systems ; Caspase 9/metabolism ; Gene Editing ; Gene Targeting ; Genetic Loci ; Genotype ; Hair Color/*genetics ; Phenotype ; Polymorphism, Single Nucleotide ; RNA, Guide ; RNA, Messenger/genetics ; Sequence Analysis, DNA ; Sheep/*genetics ; Zygote/metabolism ; },
abstract = {Coat color is an important characteristic and economic trait in domestic sheep. Aiming at alteration of Chinese merino sheep coat color by genome manipulation, we disrupted sheep agouti signaling protein gene by CRISPR/Cas9. A total of seven indels were identified in 5 of 6 born lambs. Each targeted lamb happened at least two kinds of modifications, and targeted lambs with multiple modifications displayed variety of coat color patterns. Three lambs with 4 bp deletion showed badgerface with black body coat color in two lambs, and brown coat color with light ventral pigmentation in another one. The black-white spotted color was observed in two lambs with 2 bp deletion. Further analysis unraveled that modifications happened in one or more than two copies of ASIP gene, and moreover, the additional spontaneous mutations of D9 and/or D5 preceding the targeting modification could also involve the formation of coat color patterns. Taken together, the entanglement of ASIP modifications by CRISPR/Cas9, spontaneous D9/D5 mutations, and ASIP gene duplications contributed to the variety of coat color patterns in targeted lambs.},
}
@article {pmid30870431,
year = {2019},
author = {Thomas, M and Burgio, G and Adams, DJ and Iyer, V},
title = {Collateral damage and CRISPR genome editing.},
journal = {PLoS genetics},
volume = {15},
number = {3},
pages = {e1007994},
doi = {10.1371/journal.pgen.1007994},
pmid = {30870431},
issn = {1553-7404},
abstract = {The simplicity and the versatility of clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR-Cas) systems have enabled the genetic modification of virtually every organism and offer immense therapeutic potential for the treatment of human disease. Although these systems may function efficiently within eukaryotic cells, there remain concerns about the accuracy of Cas endonuclease effectors and their use for precise gene editing. Recently, two independent reports investigating the editing accuracy of the CRISPR-Cas9 system were published by separate groups at the Wellcome Sanger Institute; our study-Iyer and colleagues [1]-defined the landscape of off-target mutations, whereas the other by Kosicki and colleagues [2] detailed the existence of on-target, potentially deleterious deletions. Although both studies found evidence of large on-target CRISPR-induced deletions, they reached seemingly very different conclusions.},
}
@article {pmid30867524,
year = {2019},
author = {Odamaki, T and Bottacini, F and Mitsuyama, E and Yoshida, K and Kato, K and Xiao, JZ and van Sinderen, D},
title = {Impact of a bathing tradition on shared gut microbe among Japanese families.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {4380},
doi = {10.1038/s41598-019-40938-3},
pmid = {30867524},
issn = {2045-2322},
support = {FEMS-RG-2016-0103//Federation of European Microbiological Societies (FEMS)/ ; 17/IFB/5429//Science Foundation Ireland (SFI)/ ; SFI/12/RC/2273//Science Foundation Ireland (SFI)/ ; },
abstract = {Sharing of Bifidobacterium longum strains had recently been shown to occur among Japanese family members, a phenomenon that is not confined to mother-infant pairs. In the current study, we investigated if bathtub water is a possible vehicle for the exchange of strains as a consequence of a Japanese custom to share bathtub water by family members during bathing practices. A total of twenty-one subjects from five Japanese families, each consisting of parents with either 2 or 3 children, were enrolled in this study and the fecal microbiota of all participants was determined. Viable bifidobacterial strains were isolated from all bathtub water samples. A subsequent comparative genome analysis using ninety-eight strains indicated that certain strain-sets, which were isolated from feces and bathtub water, share near identical genome sequences, including CRISPR/Cas protospacers. By means of unweighted UniFrac distance analysis based on 16S rRNA gene analysis of 59 subjects from sixteen Japanese families, we showed that the fecal microbiota composition among family members that share bathtub water is significantly closer than that between family members that do not engage in this practice. Our results indicate that bathtub water represents a vehicle for the transmission of gut bacteria, and that the Japanese custom of sharing bathtub water contributes to the exchange of gut microbes, in particular bifidobacteria, among family members.},
}
@article {pmid30867223,
year = {2019},
author = {Thormann, V and Glaser, LV and Rothkegel, MC and Borschiwer, M and Bothe, M and Fuchs, A and Meijsing, SH},
title = {Expanding the repertoire of glucocorticoid receptor target genes by engineering genomic response elements.},
journal = {Life science alliance},
volume = {2},
number = {2},
pages = {},
doi = {10.26508/lsa.201800283},
pmid = {30867223},
issn = {2575-1077},
abstract = {The glucocorticoid receptor (GR), a hormone-activated transcription factor, binds to a myriad of genomic binding sites yet seems to regulate a much smaller number of genes. Genome-wide analysis of GR binding and gene regulation has shown that the likelihood of GR-dependent regulation increases with decreased distance of its binding to the transcriptional start site of a gene. To test if we can adopt this knowledge to expand the repertoire of GR target genes, we used CRISPR/Cas-mediated homology-directed repair to add a single GR-binding site directly upstream of the transcriptional start site of each of four genes. To our surprise, we found that the addition of a single GR-binding site can be enough to convert a gene into a GR target. The gain of GR-dependent regulation was observed for two of four genes analyzed and coincided with acquired GR binding at the introduced binding site. However, the gene-specific gain of GR-dependent regulation could not be explained by obvious differences in chromatin accessibility between converted genes and their non-converted counterparts. Furthermore, by introducing GR-binding sequences with different nucleotide compositions, we show that activation can be facilitated by distinct sequences without obvious differences in activity between the GR-binding sequence variants we tested. The approach to use genome engineering to build genomic response elements facilitates the generation of cell lines with tailored repertoires of GR-responsive genes and a framework to test and refine our understanding of the cis-regulatory logic of gene regulation by testing if engineered response elements behave as predicted.},
}
@article {pmid30520725,
year = {2018},
author = {OhAinle, M and Helms, L and Vermeire, J and Roesch, F and Humes, D and Basom, R and Delrow, JJ and Overbaugh, J and Emerman, M},
title = {A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
doi = {10.7554/eLife.39823},
pmid = {30520725},
issn = {2050-084X},
support = {P30 CA015704/CA/NCI NIH HHS/United States ; CFAR New Investigator Award, P30 AI027757/AI/NIAID NIH HHS/United States ; DP1 DA039543/DA/NIDA NIH HHS/United States ; P30 CA015704-43/CA/NCI NIH HHS/United States ; P30 DK056465/DK/NIDDK NIH HHS/United States ; R01 AI030927/AI/NIAID NIH HHS/United States ; CCEH Pilot Grant, DK56465/DK/NIDDK NIH HHS/United States ; P30 AI027757/AI/NIAID NIH HHS/United States ; R01 AI30927/AI/NIAID NIH HHS/United States ; R37 AI030927/AI/NIAID NIH HHS/United States ; },
mesh = {Antigens, CD/genetics/immunology ; Antigens, Differentiation/genetics/immunology ; CRISPR-Cas Systems ; Carrier Proteins/genetics/immunology ; Cell Line, Tumor ; Epithelial Cells/drug effects/*immunology/virology ; GPI-Linked Proteins/genetics/immunology ; Gene Editing/*methods ; Gene Expression Regulation ; Genetic Vectors/chemistry/immunology ; HEK293 Cells ; HIV-1/drug effects/*genetics/growth &amp; development/immunology ; *Host-Pathogen Interactions ; Humans ; Interferon-alpha/pharmacology ; Lentivirus/genetics/metabolism ; Myxovirus Resistance Proteins/genetics/immunology ; Nuclear Proteins/deficiency/*genetics/immunology ; Phosphotransferases (Alcohol Group Acceptor)/deficiency/*genetics/immunology ; Receptors, CCR5/genetics/immunology ; Receptors, CXCR4/genetics/immunology ; Signal Transduction ; THP-1 Cells ; Viral Tropism/genetics ; Virus Assembly/drug effects ; Virus Replication/drug effects ; },
abstract = {Interferon (IFN) inhibits HIV replication by inducing antiviral effectors. To comprehensively identify IFN-induced HIV restriction factors, we assembled a CRISPR sgRNA library of Interferon Stimulated Genes (ISGs) into a modified lentiviral vector that allows for packaging of sgRNA-encoding genomes in trans into budding HIV-1 particles. We observed that knockout of Zinc Antiviral Protein (ZAP) improved the performance of the screen due to ZAP-mediated inhibition of the vector. A small panel of IFN-induced HIV restriction factors, including MxB, IFITM1, Tetherin/BST2 and TRIM5alpha together explain the inhibitory effects of IFN on the CXCR4-tropic HIV-1 strain, HIV-1LAI, in THP-1 cells. A second screen with a CCR5-tropic primary strain, HIV-1Q23.BG505, described an overlapping, but non-identical, panel of restriction factors. Further, this screen also identifies HIV dependency factors. The ability of IFN-induced restriction factors to inhibit HIV strains to replicate in human cells suggests that these human restriction factors are incompletely antagonized.<br><br>Editorial note: This article has been through an editorial process in which the authors decide how to respond to the issues raised during peer review. The Reviewing Editor's assessment is that all the issues have been addressed (see decision letter).},
}
@article {pmid30332437,
year = {2018},
author = {Morozova, KN and Suldina, LA and Malankhanova, TB and Grigor'eva, EV and Zakian, SM and Kiseleva, E and Malakhova, AA},
title = {Introducing an expanded CAG tract into the huntingtin gene causes a wide spectrum of ultrastructural defects in cultured human cells.},
journal = {PloS one},
volume = {13},
number = {10},
pages = {e0204735},
pmid = {30332437},
issn = {1932-6203},
mesh = {CRISPR-Cas Systems ; Clone Cells/metabolism/ultrastructure ; Endoplasmic Reticulum/ultrastructure ; Gene Knockout Techniques ; HEK293 Cells ; Humans ; Huntingtin Protein/antagonists &amp; inhibitors/*genetics ; Huntington Disease/*genetics/*pathology ; Lysosomes/ultrastructure ; Microscopy, Electron, Transmission ; Mitochondria/ultrastructure ; Mutant Proteins/*genetics ; Mutation ; *Trinucleotide Repeat Expansion ; },
abstract = {Modeling of neurodegenerative diseases in vitro holds great promise for biomedical research. Human cell lines harboring a mutations in disease-causing genes are thought to recapitulate early stages of the development an inherited disease. Modern genome-editing tools allow researchers to create isogenic cell clones with an identical genetic background providing an adequate &quot;healthy&quot; control for biomedical and pharmacological experiments. Here, we generated isogenic mutant cell clones with 150 CAG repeats in the first exon of the huntingtin (HTT) gene using the CRISPR/Cas9 system and performed ultrastructural and morphometric analyses of the internal organization of the mutant cells. Electron microscopy showed that deletion of three CAG triplets or an HTT gene knockout had no significant influence on the cell structure. The insertion of 150 CAG repeats led to substantial changes in quantitative and morphological parameters of mitochondria and increased the association of mitochondria with the smooth and rough endoplasmic reticulum while causing accumulation of small autolysosomes in the cytoplasm. Our data indicate for the first time that expansion of the CAG repeat tract in HTT introduced via the CRISPR/Cas9 technology into a human cell line initiates numerous ultrastructural defects that are typical for Huntington's disease.},
}
@article {pmid30864562,
year = {2019},
author = {Veigl, SJ},
title = {A use/disuse paradigm for CRISPR-Cas systems.},
journal = {Biology &amp; philosophy},
volume = {34},
number = {1},
pages = {13},
doi = {10.1007/s10539-018-9661-z},
pmid = {30864562},
issn = {0169-3867},
}
@article {pmid30353190,
year = {2018},
author = {Neff, EP},
title = {CRISPR-barcoding the mouse.},
journal = {Lab animal},
volume = {47},
number = {11},
pages = {309},
doi = {10.1038/s41684-018-0190-9},
pmid = {30353190},
issn = {1548-4475},
mesh = {Animals ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Mice ; Mutation ; },
}
@article {pmid30353159,
year = {2018},
author = {Parthasarathy, S},
title = {Use the patent system to regulate gene editing.},
journal = {Nature},
volume = {562},
number = {7728},
pages = {486-488},
doi = {10.1038/d41586-018-07108-3},
pmid = {30353159},
issn = {1476-4687},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Clinical Trials as Topic/ethics/legislation &amp; jurisprudence ; Congresses as Topic ; European Union ; Gene Editing/*ethics/*legislation &amp; jurisprudence/statistics &amp; numerical data ; *Government Regulation ; History, 19th Century ; History, 20th Century ; History, 21st Century ; Human Embryonic Stem Cells ; Humans ; Licensure ; Patents as Topic/history/*legislation &amp; jurisprudence/statistics &amp; numerical data ; Swine/genetics ; United States ; },
}
@article {pmid30087231,
year = {2018},
author = {Ibba, G and Piu, C and Uleri, E and Serra, C and Dolei, A},
title = {Disruption by SaCas9 Endonuclease of HERV-Kenv, a Retroviral Gene with Oncogenic and Neuropathogenic Potential, Inhibits Molecules Involved in Cancer and Amyotrophic Lateral Sclerosis.},
journal = {Viruses},
volume = {10},
number = {8},
pages = {},
pmid = {30087231},
issn = {1999-4915},
mesh = {Amyotrophic Lateral Sclerosis/*pathology/therapy ; CRISPR-Cas Systems ; Carcinogenesis/genetics ; Cell Line, Tumor ; DNA-Binding Proteins/genetics ; Endogenous Retroviruses/*genetics/pathogenicity ; Gene Editing ; Gene Expression Regulation ; Humans ; Male ; NF-kappa B/genetics ; Neoplasms/*virology ; Oncogenes/*genetics ; Prostatic Neoplasms ; RNA, Viral ; Serine-Arginine Splicing Factors/genetics ; Staphylococcus aureus/enzymology ; Viral Envelope Proteins/*genetics ; },
abstract = {The human endogenous retrovirus (HERV)-K, human mouse mammary tumor virus like-2 (HML-2) subgroup of HERVs is activated in several tumors and has been related to prostate cancer progression and motor neuron diseases. The cellular splicing factor 2/alternative splicing factor (SF2/ASF) is a positive regulator of gene expression, coded by a potent proto-oncogene, amplified, and abnormally expressed in tumors. TAR DNA-binding protein-43 (TDP-43) is a DNA/RNA-binding protein, negative regulator of alternative splicing, known for causing neurodegeneration, and with complex roles in oncogenesis. We used the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology, with the Cas9 system from Staphylococcus aureus (SaCas9), to disrupt the HERV-K(HML-2)env gene, and evaluated the effects on cultured cells. The tool was tested on human prostate cancer LNCaP cells, whose HERV-Kenv transcription profile is known. It caused HERV-K(HML-2)env disruption (the first reported of a HERV gene), as evaluated by DNA sequencing, and inhibition of env transcripts and proteins. The HERV-K(HML-2)env disruption was found to interfere with important regulators of cell expression and proliferation, involved in manaling, RNA-binding, and alternative splicing, such as epidermal growth factor receptor (EGF-R), nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), SF2/ASF, and TDP-43. These novel findings suggest that HERV-K is not an innocent bystander, they reinforce its links to oncogenesis and motor neuron diseases, and they open potential innovative therapeutic options.},
}
@article {pmid29961307,
year = {2018},
author = {Kim, YK and Nam, SA and Yang, CW},
title = {Applications of kidney organoids derived from human pluripotent stem cells.},
journal = {The Korean journal of internal medicine},
volume = {33},
number = {4},
pages = {649-659},
pmid = {29961307},
issn = {2005-6648},
mesh = {CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Editing ; Humans ; Kidney ; *Kidney Diseases/therapy ; *Organoids ; *Pluripotent Stem Cells ; },
abstract = {The establishment of protocols to differentiate kidney organoids from human pluripotent stem cells provides potential applications of kidney organoids in regenerative medicine. Modeling of renal diseases, drug screening, nephrotoxicity testing of compounds, and regenerative therapy are attractive applications. Although much progress still remains to be made in the development of kidney organoids, recent advances in clustered regularly interspaced short palindromic repeat (CRISPR)-CRISPR-associated system 9 (Cas9) genome editing and three-dimensional bioprinting technologies have contributed to the application of kidney organoids in clinical fields. In this section, we review recent advances in the applications of kidney organoids to kidney disease modelling, drug screening, nephrotoxicity testing, and regenerative therapy.},
}
@article {pmid29906440,
year = {2018},
author = {},
title = {CRISPR Inspirations.},
journal = {Cell},
volume = {173},
number = {7},
pages = {1560-1561},
doi = {10.1016/j.cell.2018.05.055},
pmid = {29906440},
issn = {1097-4172},
mesh = {Bacteriophages/genetics/metabolism ; CRISPR-Cas Systems/*genetics ; Escherichia coli/genetics/metabolism ; Gene Editing ; Haloferax volcanii/genetics/metabolism ; Immunity/genetics ; Streptococcus thermophilus/genetics ; },
}
@article {pmid29906439,
year = {2018},
author = {},
title = {The Ongoing Shakeup in Organelle Biology.},
journal = {Cell},
volume = {173},
number = {7},
pages = {1557-1559},
doi = {10.1016/j.cell.2018.05.054},
pmid = {29906439},
issn = {1097-4172},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Organelles/*metabolism ; Protein Interaction Maps ; Proteins/genetics/metabolism ; },
abstract = {With the complexities of organelle communication and their dynamics under intense investigation, what are the new principles that are emerging, and where is the field headed? Cell's Robert Kruger recently discussed these questions with Erika Holzbaur, Jennifer Lippincott-Schwartz, and Ivan Dikic. Annotated excerpts from this conversation are presented below, and the full conversation is available with the article online.},
}
@article {pmid29812974,
year = {2018},
author = {Luo, JJ and Bian, WP and Liu, Y and Huang, HY and Yin, Q and Yang, XJ and Pei, DS},
title = {CRISPR/Cas9-based genome engineering of zebrafish using a seamless integration strategy.},
journal = {FASEB journal : official publication of the Federation of American Societies for Experimental Biology},
volume = {32},
number = {9},
pages = {5132-5142},
doi = {10.1096/fj.201800077RR},
pmid = {29812974},
issn = {1530-6860},
mesh = {Animals ; Animals, Genetically Modified/genetics ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Editing/methods ; Gene Transfer Techniques ; Genetic Engineering/methods ; Genetic Therapy/methods ; Genome/*genetics ; Promoter Regions, Genetic/genetics ; Zebrafish/*genetics ; },
abstract = {Numerous feasible methods for inserting large fragments of exogenous DNA sequences into the zebrafish genome have been developed, as has genome editing technology using programmable nucleases. However, the coding sequences of targeted endogenous genes are disrupted, and the expression patterns of inserted exogenous genes cannot completely recapitulate those of endogenous genes. Here we describe the establishment of a novel strategy for endogenous promoter-driven and microhomology-mediated end-joining-dependent integration of a donor vector using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9. We successfully integrated mCherry into the final coding sequence of targeted genes to generate seamless transgenic zebrafish lines with high efficiency. This novel seamless transgenesis technique not only maintained the integrity of the endogenous gene but also did not disrupt the function of targeted gene. Therefore, our microhomology-mediated end-joining-mediated transgenesis strategy may have broader applications in gene therapy. Moreover, this novel seamless gene-editing strategy in zebrafish provides a valuable new transgenesis technique, which was driven by endogenous promoters and in vivo animal reporter modes for translational medicine. It is expected to be a standard gene-editing technique in the field of zebrafish, leading to some important breakthroughs for studies in early embryogenesis.-Luo, J.-J., Bian, W.-P., Liu, Y., Huang, H.-Y., Yin, Q., Yang, X.-J., Pei, D.-S. CRISPR/Cas9-based genome engineering of zebrafish using a seamless integration strategy.},
}
@article {pmid29794019,
year = {2018},
author = {Atanasov, KE and Liu, C and Erban, A and Kopka, J and Parker, JE and Alcázar, R},
title = {NLR Mutations Suppressing Immune Hybrid Incompatibility and Their Effects on Disease Resistance.},
journal = {Plant physiology},
volume = {177},
number = {3},
pages = {1152-1169},
pmid = {29794019},
issn = {1532-2548},
mesh = {3-Oxoacyl-(Acyl-Carrier-Protein) Synthase/genetics ; Arabidopsis/genetics/*immunology/*microbiology ; Arabidopsis Proteins/*genetics/immunology ; CRISPR-Cas Systems ; Chimera ; Disease Resistance/*genetics/immunology ; Epistasis, Genetic ; Gene Expression Regulation, Plant ; *Mutation ; NLR Proteins/genetics ; Oomycetes/pathogenicity ; Plant Diseases/*genetics ; Plants, Genetically Modified ; Poland ; Proto-Oncogene Proteins c-myb/genetics ; Quantitative Trait Loci ; Self-Incompatibility in Flowering Plants/genetics/immunology ; Tobacco ; },
abstract = {Genetic divergence between populations can lead to reproductive isolation. Hybrid incompatibilities (HI) represent intermediate points along a continuum toward speciation. In plants, genetic variation in disease resistance (R) genes underlies several cases of HI. The progeny of a cross between Arabidopsis (Arabidopsis thaliana) accessions Landsberg erecta (Ler, Poland) and Kashmir2 (Kas2, central Asia) exhibits immune-related HI. This incompatibility is due to a genetic interaction between a cluster of eight TNL (TOLL/INTERLEUKIN1 RECEPTOR-NUCLEOTIDE BINDING-LEU RICH REPEAT) RPP1 (RECOGNITION OF PERONOSPORA PARASITICA1)-like genes (R1-R8) from Ler and central Asian alleles of a Strubbelig-family receptor-like kinase (SRF3) from Kas2. In characterizing mutants altered in Ler/Kas2 HI, we mapped multiple mutations to the RPP1-like Ler locus. Analysis of these suppressor of Ler/Kas2 incompatibility (sulki) mutants reveals complex, additive and epistatic interactions underlying RPP1-like Ler locus activity. The effects of these mutations were measured on basal defense, global gene expression, primary metabolism, and disease resistance to a local Hyaloperonospora arabidopsidis isolate (Hpa Gw) collected from Gorzów (Gw), where the Landsberg accession originated. Gene expression sectors and metabolic hallmarks identified for HI are both dependent and independent of RPP1-like Ler members. We establish that mutations suppressing immune-related Ler/Kas2 HI do not compromise resistance to Hpa Gw. QTL mapping analysis of Hpa Gw resistance point to RPP7 as the causal locus. This work provides insight into the complex genetic architecture of the RPP1-like Ler locus and immune-related HI in Arabidopsis and into the contributions of RPP1-like genes to HI and defense.},
}
@article {pmid29779948,
year = {2018},
author = {Koren, I and Timms, RT and Kula, T and Xu, Q and Li, MZ and Elledge, SJ},
title = {The Eukaryotic Proteome Is Shaped by E3 Ubiquitin Ligases Targeting C-Terminal Degrons.},
journal = {Cell},
volume = {173},
number = {7},
pages = {1622-1635.e14},
pmid = {29779948},
issn = {1097-4172},
support = {//Wellcome Trust/United Kingdom ; /HHMI/Howard Hughes Medical Institute/United States ; R01 AG011085/AG/NIA NIH HHS/United States ; 201387/Z/16/Z//Wellcome Trust/United Kingdom ; },
mesh = {Amino Acid Motifs ; Animals ; Antigens, Neoplasm/metabolism ; CRISPR-Cas Systems/genetics ; Computational Biology/methods ; Genetic Vectors/genetics/metabolism ; HEK293 Cells ; Humans ; Lentivirus/genetics ; Leupeptins/pharmacology ; Open Reading Frames/genetics ; Peptides/metabolism ; Proteasome Endopeptidase Complex/chemistry/metabolism ; Protein Stability/drug effects ; Protein Subunits/metabolism ; Proteolysis ; Proteome/genetics/*metabolism ; Receptors, Cytokine/genetics/metabolism ; Ubiquitin-Protein Ligases/*metabolism ; },
abstract = {Degrons are minimal elements that mediate the interaction of proteins with degradation machineries to promote proteolysis. Despite their central role in proteostasis, the number of known degrons remains small, and a facile technology to characterize them is lacking. Using a strategy combining global protein stability (GPS) profiling with a synthetic human peptidome, we identify thousands of peptides containing degron activity. Employing CRISPR screening, we establish that the stability of many proteins is regulated through degrons located at their C terminus. We characterize eight Cullin-RING E3 ubiquitin ligase (CRL) complex adaptors that regulate C-terminal degrons, including six CRL2 and two CRL4 complexes, and computationally implicate multiple non-CRLs in end recognition. Proteome analysis revealed that the C termini of eukaryotic proteins are depleted for C-terminal degrons, suggesting an E3-ligase-dependent modulation of proteome composition. Thus, we propose that a series of &quot;C-end rules&quot; operate to govern protein stability and shape the eukaryotic proteome.},
}
@article {pmid29512112,
year = {2018},
author = {Howe, DK and Yeargan, M and Simpson, L and Dangoudoubiyam, S},
title = {Molecular Genetic Manipulation of Sarcocystis neurona.},
journal = {Current protocols in microbiology},
volume = {48},
number = {},
pages = {20D.2.1-20D.2.14},
doi = {10.1002/cpmc.48},
pmid = {29512112},
issn = {1934-8533},
mesh = {Animals ; CRISPR-Cas Systems ; Encephalomyelitis/parasitology/*veterinary ; *Genetic Techniques ; Horse Diseases/parasitology ; Horses ; Sarcocystis/*genetics/physiology ; Transfection/*methods ; },
abstract = {Sarcocystis neurona is a member of the important phylum Apicomplexa and the primary cause of equine protozoal myeloencephalitis (EPM). Moreover, S. neurona is the best-studied species in the genus Sarcocystis, one of the most successful parasite taxa, as virtually all vertebrate animals may be infected by at least one species. Consequently, scientific investigation of S. neurona will aid in the control of EPM and neurologic disease in sea mammals, while also improving our understanding of a prominent branch on the apicomplexan phylogenetic tree. These protocols describe methods that expand the capabilities to study this prominent member of the Apicomplexa. © 2018 by John Wiley &amp; Sons, Inc.},
}
@article {pmid30176395,
year = {2018},
author = {Wu, Y and Chen, T and Liu, Y and Lv, X and Li, J and Du, G and Ledesma-Amaro, R and Liu, L},
title = {CRISPRi allows optimal temporal control of N-acetylglucosamine bioproduction by a dynamic coordination of glucose and xylose metabolism in Bacillus subtilis.},
journal = {Metabolic engineering},
volume = {49},
number = {},
pages = {232-241},
doi = {10.1016/j.ymben.2018.08.012},
pmid = {30176395},
issn = {1096-7184},
mesh = {Acetylglucosamine/*biosynthesis/genetics ; *Bacillus subtilis/genetics/metabolism ; Bacterial Proteins/biosynthesis/genetics ; *CRISPR-Cas Systems ; *Gene Expression Regulation, Bacterial ; Glucose/genetics/*metabolism ; Xylose/genetics/*metabolism ; },
abstract = {Glucose and xylose are the two most abundant sugars in renewable lignocellulose sources; however, typically they cannot be simultaneously utilized due to carbon catabolite repression. N-acetylglucosamine (GlcNAc) is a typical nutraceutical and has many applications in the field of healthcare. Here, we have developed a gene repressor system based on xylose-induced CRISPR interference (CRISPRi) in Bacillus subtilis, aimed at downregulating the expression of three genes (zwf, pfkA, glmM) that control the major competing reactions of GlcNAc synthesis (pentose phosphate pathway (HMP), glycolysis, and peptidoglycan synthesis pathway (PSP)), with the potential to relieve glucose repression and allow the co-utilization of both glucose and xylose. Simultaneous repression of these three genes by CRISPRi improved GlcNAc titer by 13.2% to 17.4 ± 0.47 g/L, with the GlcNAc yield on glucose and xylose showing an 84.1% improvement, reaching 0.42 ± 0.036 g/g. In order to further engineer the synergetic utilization of glucose and xylose, a combinatorial approach was developed based on 27 arrays containing sgRNAs with different repression capacities targeting the three genes. We further optimized the temporal control of the system and found that when 15 g/L xylose was added 6 h after inoculation, the most efficient strain, BNX122, synthesized 20.5 ± 0.85 g/L GlcNAc with a yield of 0.46 ± 0.010 g/g glucose and xylose in shake flask culture. Finally, the GlcNAc titer and productivity in a 3-L fed-batch bioreactor reached 103.1 ± 2.11 g/L and 1.17 ± 0.024 g/L/h, which were 5.0-fold and 2.7-fold of that in shake flask culture, respectively. Taken together, these findings suggest that a CRISPRi-enabled regulation method provides a simple, efficient, and universal way to promote the synergetic utilization of multiple carbon sources by microbial cell factories.},
}
@article {pmid30126863,
year = {2018},
author = {Karlgren, M and Simoff, I and Keiser, M and Oswald, S and Artursson, P},
title = {CRISPR-Cas9: A New Addition to the Drug Metabolism and Disposition Tool Box.},
journal = {Drug metabolism and disposition: the biological fate of chemicals},
volume = {46},
number = {11},
pages = {1776-1786},
doi = {10.1124/dmd.118.082842},
pmid = {30126863},
issn = {1521-009X},
mesh = {Animals ; CRISPR-Cas Systems/*physiology ; Clustered Regularly Interspaced Short Palindromic Repeats/*physiology ; Cytochrome P-450 Enzyme System/metabolism ; Gene Editing/methods ; Humans ; Inactivation, Metabolic/*physiology ; Pharmaceutical Preparations/*metabolism ; },
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated protein 9 (Cas9), i.e., CRISPR-Cas9, has been extensively used as a gene-editing technology during recent years. Unlike earlier technologies for gene editing or gene knockdown, such as zinc finger nucleases and RNA interference, CRISPR-Cas9 is comparably easy to use, affordable, and versatile. Recently, CRISPR-Cas9 has been applied in studies of drug absorption, distribution, metabolism, and excretion (ADME) and for ADME model generation. To date, about 50 papers have been published describing in vitro or in vivo CRISPR-Cas9 gene editing of ADME and ADME-related genes. Twenty of these papers describe gene editing of clinically relevant genes, such as ATP-binding cassette drug transporters and cytochrome P450 drug-metabolizing enzymes. With CRISPR-Cas9, the ADME tool box has been substantially expanded. This new technology allows us to develop better and more predictive in vitro and in vivo ADME models and map previously underexplored ADME genes and gene families. In this mini-review, we give an overview of the CRISPR-Cas9 technology and summarize recent applications of CRISPR-Cas9 within the ADME field. We also speculate about future applications of CRISPR-Cas9 in ADME research.},
}
@article {pmid29695624,
year = {2018},
author = {Vyas, VK and Bushkin, GG and Bernstein, DA and Getz, MA and Sewastianik, M and Barrasa, MI and Bartel, DP and Fink, GR},
title = {New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi.},
journal = {mSphere},
volume = {3},
number = {2},
pages = {},
pmid = {29695624},
issn = {2379-5042},
support = {T32 GM007287/GM/NIGMS NIH HHS/United States ; R15 AI130950/AI/NIAID NIH HHS/United States ; R35 GM118135/GM/NIGMS NIH HHS/United States ; R01 GM035010/GM/NIGMS NIH HHS/United States ; F32 GM108201/GM/NIGMS NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; Candida albicans/genetics ; Candida glabrata/genetics ; DNA Breaks, Double-Stranded ; *DNA End-Joining Repair ; Fungi/*genetics ; Gene Editing/*methods ; Genetic Vectors ; *Mutagenesis ; RNA, Guide/genetics ; Saccharomyces cerevisiae/genetics ; },
abstract = {We have created new vectors for clustered regularly interspaced short palindromic repeat (CRISPR) mutagenesis in Candida albicans, Saccharomyces cerevisiae, Candida glabrata, and Naumovozyma castellii These new vectors permit a comparison of the requirements for CRISPR mutagenesis in each of these species and reveal different dependencies for repair of the Cas9 double-stranded break. Both C. albicans and S. cerevisiae rely heavily on homology-directed repair, whereas C. glabrata and N. castellii use both homology-directed and nonhomologous end-joining pathways. The high efficiency of these vectors permits the creation of unmarked deletions in each of these species and the recycling of the dominant selection marker for serial mutagenesis in prototrophs. A further refinement, represented by the &quot;Unified&quot; Solo vectors, incorporates Cas9, guide RNA, and repair template into a single vector, thus enabling the creation of vector libraries for pooled screens. To facilitate the design of such libraries, we have identified guide sequences for each of these species with updated guide selection algorithms.IMPORTANCE CRISPR-mediated genome engineering technologies have revolutionized genetic studies in a wide range of organisms. Here we describe new vectors and guide sequences for CRISPR mutagenesis in the important human fungal pathogens C. albicans and C. glabrata, as well as in the related yeasts S. cerevisiae and N. castellii The design of these vectors enables efficient serial mutagenesis in each of these species by leaving few, if any, exogenous sequences in the genome. In addition, we describe strategies for the creation of unmarked deletions in each of these species and vector designs that permit the creation of vector libraries for pooled screens. These tools and strategies promise to advance genetic engineering of these medically and industrially important species.},
}
@article {pmid29587177,
year = {2018},
author = {O'Donnell, KA},
title = {Advances in functional genetic screening with transposons and CRISPR/Cas9 to illuminate cancer biology.},
journal = {Current opinion in genetics &amp; development},
volume = {49},
number = {},
pages = {85-94},
doi = {10.1016/j.gde.2018.03.006},
pmid = {29587177},
issn = {1879-0380},
support = {R01 CA207763/CA/NCI NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems/genetics ; DNA Transposable Elements/*genetics ; Early Detection of Cancer ; *Genetic Testing ; Humans ; Mutagenesis, Insertional/*genetics ; Mutation/genetics ; Neoplasms/diagnosis/*genetics/pathology ; },
abstract = {Large-scale genome sequencing studies have identified a wealth of mutations in human tumors and have dramatically advanced the field of cancer genetics. However, the functional consequences of an altered gene in tumor progression cannot always be inferred from mutation status alone. This underscores the critical need for complementary methods to assign functional significance to mutated genes in cancer. Transposons are mobile genetic elements that serve as powerful tools for insertional mutagenesis. Over the last decade, investigators have employed mouse models with on-demand transposon-mediated mutagenesis to perform unbiased genetic screens to identify clinically relevant genes that participate in the pathogenesis of human cancer. Two distinct DNA transposon mutagenesis systems, Sleeping Beauty (SB) and PiggyBac (PB), have been applied extensively in vivo and more recently, in ex vivo settings. These studies have informed our understanding of the genes and pathways that drive cancer initiation, progression, and metastasis. This review highlights the latest progress on cancer gene identification for specific cancer subtypes, as well as new technological advances and incorporation of the CRISPR/Cas9 toolbox into transposon-mediated functional genetic studies.},
}
@article {pmid30856357,
year = {2019},
author = {Le Rhun, A and Escalera-Maurer, A and Bratovič, M and Charpentier, E},
title = {CRISPR-Cas in Streptococcus pyogenes.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-10},
doi = {10.1080/15476286.2019.1582974},
pmid = {30856357},
issn = {1555-8584},
abstract = {The discovery and characterization of the prokaryotic CRISPR-Cas immune system has led to a revolution in genome editing and engineering technologies. Despite the fact that most applications emerged after the discovery of the type II-A CRISPR-Cas9 system of Streptococcus pyogenes, its biological importance in this organism has received little attention. Here, we provide a comprehensive overview of the current knowledge about CRISPR-Cas systems from S. pyogenes. We discuss how the interplay between CRISPR-mediated immunity and horizontal gene transfer might have modeled the evolution of this pathogen. We review the current literature about the CRISPR-Cas systems present in S. pyogenes (types I-C and II-A), and describe their distinctive biochemical and functional features. Finally, we summarize the main biotechnological applications that have arisen from the discovery of the CRISPR-Cas9 system in S. pyogenes.},
}
@article {pmid30853970,
year = {2019},
author = {Parmeciano Di Noto, G and Molina, MC and Quiroga, C},
title = {Insights Into Non-coding RNAs as Novel Antimicrobial Drugs.},
journal = {Frontiers in genetics},
volume = {10},
number = {},
pages = {57},
doi = {10.3389/fgene.2019.00057},
pmid = {30853970},
issn = {1664-8021},
abstract = {Multidrug resistant bacteria are a serious worldwide problem, especially carbapenem-resistant Enterobacteriaceae (such as Klebsiella pneumoniae and Escherichia coli), Acinetobacter baumannii and Pseudomonas aeruginosa. Since the emergence of extensive and pan-drug resistant bacteria there are few antibiotics left to treat patients, thus novel RNA-based strategies are being considered. Here, we examine the current situation of different non-coding RNAs found in bacteria as well as their function and potential application as antimicrobial agents. Furthermore, we discuss the factors that may contribute in the efficient development of RNA-based drugs, the limitations for their implementation and the use of nanocarriers for delivery.},
}
@article {pmid30853940,
year = {2019},
author = {Jaiswal, S and Singh, DK and Shukla, P},
title = {Gene Editing and Systems Biology Tools for Pesticide Bioremediation: A Review.},
journal = {Frontiers in microbiology},
volume = {10},
number = {},
pages = {87},
doi = {10.3389/fmicb.2019.00087},
pmid = {30853940},
issn = {1664-302X},
abstract = {Bioremediation is the degradation potential of microorganisms to dissimilate the complex chemical compounds from the surrounding environment. The genetics and biochemistry of biodegradation processes in datasets opened the way of systems biology. Systemic biology aid the study of interacting parts involved in the system. The significant keys of system biology are biodegradation network, computational biology, and omics approaches. Biodegradation network consists of all the databases and datasets which aid in assisting the degradation and deterioration potential of microorganisms for bioremediation processes. This review deciphers the bio-degradation network, i.e., the databases and datasets (UM-BBD, PAN, PTID, etc.) aiding in assisting the degradation and deterioration potential of microorganisms for bioremediation processes, computational biology and multi omics approaches like metagenomics, genomics, transcriptomics, proteomics, and metabolomics for the efficient functional gene mining and their validation for bioremediation experiments. Besides, the present review also describes the gene editing tools like CRISPR Cas, TALEN, and ZFNs which can possibly make design microbe with functional gene of interest for degradation of particular recalcitrant for improved bioremediation.},
}
@article {pmid30809052,
year = {2019},
author = {Maxmen, A},
title = {Faster, better, cheaper: the rise of CRISPR in disease detection.},
journal = {Nature},
volume = {566},
number = {7745},
pages = {437},
doi = {10.1038/d41586-019-00601-3},
pmid = {30809052},
issn = {1476-4687},
mesh = {CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; *Nucleic Acids ; },
}
@article {pmid30699116,
year = {2019},
author = {Leatham-Jensen, M and Uyehara, CM and Strahl, BD and Matera, AG and Duronio, RJ and McKay, DJ},
title = {Lysine 27 of replication-independent histone H3.3 is required for Polycomb target gene silencing but not for gene activation.},
journal = {PLoS genetics},
volume = {15},
number = {1},
pages = {e1007932},
doi = {10.1371/journal.pgen.1007932},
pmid = {30699116},
issn = {1553-7404},
support = {R01 GM129132/GM/NIGMS NIH HHS/United States ; R35 GM128851/GM/NIGMS NIH HHS/United States ; },
mesh = {Alleles ; Animals ; CRISPR-Cas Systems/genetics ; Chromatin/genetics ; DNA Replication/genetics ; DNA-Binding Proteins/genetics ; Drosophila melanogaster/genetics ; Epigenesis, Genetic/*genetics ; Gene Silencing ; Histone Code/genetics ; Histones/*genetics ; Humans ; Lysine/*genetics ; Methylation ; Polycomb-Group Proteins/*genetics ; Transcriptional Activation/genetics ; },
abstract = {Proper determination of cell fates depends on epigenetic information that is used to preserve memory of decisions made earlier in development. Post-translational modification of histone residues is thought to be a central means by which epigenetic information is propagated. In particular, modifications of histone H3 lysine 27 (H3K27) are strongly correlated with both gene activation and gene repression. H3K27 acetylation is found at sites of active transcription, whereas H3K27 methylation is found at loci silenced by Polycomb group proteins. The histones bearing these modifications are encoded by the replication-dependent H3 genes as well as the replication-independent H3.3 genes. Owing to differential rates of nucleosome turnover, H3K27 acetylation is enriched on replication-independent H3.3 histones at active gene loci, and H3K27 methylation is enriched on replication-dependent H3 histones across silenced gene loci. Previously, we found that modification of replication-dependent H3K27 is required for Polycomb target gene silencing, but it is not required for gene activation. However, the contribution of replication-independent H3.3K27 to these functions is unknown. Here, we used CRISPR/Cas9 to mutate the endogenous replication-independent H3.3K27 to a non-modifiable residue. Surprisingly, we find that H3.3K27 is also required for Polycomb target gene silencing despite the association of H3.3 with active transcription. However, the requirement for H3.3K27 comes at a later stage of development than that found for replication-dependent H3K27, suggesting a greater reliance on replication-independent H3.3K27 in post-mitotic cells. Notably, we find no evidence of global transcriptional defects in H3.3K27 mutants, despite the strong correlation between H3.3K27 acetylation and active transcription.},
}
@article {pmid30668559,
year = {2019},
author = {Zhu, YN and Wang, LZ and Li, CC and Cui, Y and Wang, M and Lin, YJ and Zhao, RP and Wang, W and Xiang, H},
title = {Artificial selection on storage protein 1 possibly contributes to increase of hatchability during silkworm domestication.},
journal = {PLoS genetics},
volume = {15},
number = {1},
pages = {e1007616},
doi = {10.1371/journal.pgen.1007616},
pmid = {30668559},
issn = {1553-7404},
mesh = {Animals ; Bombyx/genetics/growth &amp; development ; CRISPR-Cas Systems ; Domestication ; *Evolution, Molecular ; Extracellular Matrix/genetics ; Gene Knockout Techniques ; Genome, Insect/genetics ; Insect Proteins/*genetics ; Linkage Disequilibrium ; Metamorphosis, Biological/*genetics ; Phylogeny ; *Selection, Genetic ; Transcriptome/genetics ; },
abstract = {Like other domesticates, the efficient utilization of nitrogen resources is also important for the only fully domesticated insect, the silkworm. Deciphering the way in which artificial selection acts on the silkworm genome to improve the utilization of nitrogen resources and to advance human-favored domestication traits, will provide clues from a unique insect model for understanding the general rules of Darwin's evolutionary theory on domestication. Storage proteins (SPs), which belong to a hemocyanin superfamily, basically serve as a source of amino acids and nitrogen during metamorphosis and reproduction in insects. In this study, through blast searching on the silkworm genome and further screening of the artificial selection signature on silkworm SPs, we discovered a candidate domestication gene, i.e., the methionine-rich storage protein 1 (SP1), which is clearly divergent from other storage proteins and exhibits increased expression in the ova of domestic silkworms. Knockout of SP1 via the CRISPR/Cas9 technique resulted in a dramatic decrease in egg hatchability, without obvious impact on egg production, which was similar to the effect in the wild silkworm compared with the domestic type. Larval development and metamorphosis were not affected by SP1 knockout. Comprehensive ova comparative transcriptomes indicated significant higher expression of genes encoding vitellogenin, chorions, and structural components in the extracellular matrix (ECM)-interaction pathway, enzymes in folate biosynthesis, and notably hormone synthesis in the domestic silkworm, compared to both the SP1 mutant and the wild silkworm. Moreover, compared with the wild silkworms, the domestic one also showed generally up-regulated expression of genes enriched in the structural constituent of ribosome and amide, as well as peptide biosynthesis. This study exemplified a novel case in which artificial selection could act directly on nitrogen resource proteins, further affecting egg nutrients and eggshell formation possibly through a hormone signaling mediated regulatory network and the activation of ribosomes, resulting in improved biosynthesis and increased hatchability during domestication. These findings shed new light on both the understanding of artificial selection and silkworm breeding from the perspective of nitrogen and amino acid resources.},
}
@article {pmid30082909,
year = {2019},
author = {Liu, Z and Zhang, W and Phillips, JB and Arora, R and McClellan, S and Li, J and Kim, JH and Sobol, RW and Tan, M},
title = {Immunoregulatory protein B7-H3 regulates cancer stem cell enrichment and drug resistance through MVP-mediated MEK activation.},
journal = {Oncogene},
volume = {38},
number = {1},
pages = {88-102},
doi = {10.1038/s41388-018-0407-9},
pmid = {30082909},
issn = {1476-5594},
support = {R01 CA148629/CA/NCI NIH HHS/United States ; R01 CA149646/CA/NCI NIH HHS/United States ; R01CA149646//U.S. Department of Health &amp; Human Services | NIH | National Cancer Institute (NCI)/International ; CA148629//U.S. Department of Health &amp; Human Services | NIH | Center for Scientific Review (CSR)/International ; },
mesh = {Animals ; B7 Antigens/antagonists &amp; inhibitors/chemistry/genetics/*physiology ; Breast Neoplasms/*metabolism/pathology ; Butadienes/pharmacology/therapeutic use ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Polarity ; Drug Resistance, Neoplasm/*physiology ; Enzyme Activation ; Female ; Humans ; MAP Kinase Kinase Kinases/antagonists &amp; inhibitors/*physiology ; Mice ; Mice, Nude ; Nanog Homeobox Protein/biosynthesis/genetics ; Neoplasm Invasiveness ; Neoplasm Proteins/antagonists &amp; inhibitors/genetics/*physiology ; Neoplastic Stem Cells/*metabolism ; Nitriles/pharmacology/therapeutic use ; Protein Domains ; Protein Interaction Mapping ; Protein Kinase Inhibitors/pharmacology/therapeutic use ; Proto-Oncogene Proteins B-raf/metabolism ; RNA Interference ; RNA, Guide/genetics ; RNA, Small Interfering/pharmacology ; Recombinant Proteins/metabolism ; SOXB1 Transcription Factors/biosynthesis/genetics ; Sequence Deletion ; Spheroids, Cellular ; Transfection ; Up-Regulation ; Vault Ribonucleoprotein Particles/*physiology ; },
abstract = {B7-H3 is a tumor-promoting glycoprotein that is expressed at low levels in most normal tissues, but is overexpressed in various human cancers which is associated with disease progression and poor patient outcome. Although numerous publications have reported the correlation between B7-H3 and cancer progression in many types of cancers, mechanistic studies on how B7-H3 regulates cancer malignancy are rare, and the mechanisms underlying the role of B7-H3 in drug resistance are almost unknown. Here we report a novel finding that upregulation of B7-H3 increases the breast cancer stem cell population and promotes cancer development. Depletion of B7-H3 in breast cancer significantly inhibits the cancer stem cells. By immunoprecipitation and mass spectrometry, we found that B7-H3 is associated with the major vault protein (MVP) and activates MEK through MVP-enhancing B-RAF and MEK interaction. B7-H3 expression increases stem cell population by binding to MVP which regulates the activation of the MAPK kinase pathway. Depletion of MVP blocks the activation of MEK induced by B7-H3 and dramatically inhibits B7-H3 induced stem cells. This study reports novel functions of B7-H3 in regulating breast cancer stem cell enrichment. The novel mechanism for B7-H3-induced stem cell propagation by regulating MVP/MEK signaling axis independent of the classic Ras pathway may have important implications in the development of strategies for overcoming cancer cell resistance to chemotherapy.},
}
@article {pmid29987734,
year = {2018},
author = {Allorent, G and Guglielmino, E and Giustini, C and Courtois, F},
title = {Generation of Mutants of Nuclear-Encoded Plastid Proteins Using CRISPR/Cas9 in the Diatom Phaeodactylum tricornutum.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1829},
number = {},
pages = {367-378},
doi = {10.1007/978-1-4939-8654-5_24},
pmid = {29987734},
issn = {1940-6029},
mesh = {Biolistics/instrumentation/*methods ; *CRISPR-Cas Systems ; Cell Nucleus/genetics ; Chloroplast Proteins/*genetics ; Diatoms/*genetics ; Gene Editing ; Gene Knockout Techniques ; *Mutation ; },
abstract = {Genome modifications in microalgae are becoming a widespread and mandatory tool for research in both fundamental and applied biology. Among genome editing methods in these photosynthetic organisms, CRISPR/Cas9 offers a specific, powerful and efficient tool for genome engineering by inducing mutations in targeted regions of the genome. Here we described a protocol that allows the generation of knockout mutants by CRISPR/Cas9 in the diatom Phaeodactylum tricornutum using biolistic transformation.},
}
@article {pmid29804851,
year = {2018},
author = {Wang, J and Ji, W and Zhu, D and Wang, W and Chen, Y and Zhang, Z and Li, F},
title = {Tfap2b mutation in mice results in patent ductus arteriosus and renal malformation.},
journal = {The Journal of surgical research},
volume = {227},
number = {},
pages = {178-185},
doi = {10.1016/j.jss.2018.02.038},
pmid = {29804851},
issn = {1095-8673},
mesh = {Animals ; Base Sequence/genetics ; CRISPR-Cas Systems/genetics ; Disease Models, Animal ; Ductus Arteriosus, Patent/*genetics ; Exons/genetics ; Female ; Homozygote ; Humans ; Kidney/*abnormalities ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Transgenic ; Mutagenesis ; Sequence Deletion ; Transcription Factor AP-2/*genetics ; },
abstract = {BACKGROUND: Transcription factor TFAP2B is associated with Char syndrome in humans and is characterized by patent ductus arteriosus (PDA) and facial and finger abnormalities. In a previous study, we detected a c.435_438delCCGG TFAP2B mutation in a family with PDA, and no facial dysmorphism or finger abnormalities were observed. This 4-base pair (bp) deletion in exon 2 resulted in a truncated protein of about 21 kDa in cultured cells in vitro. However, it is not clear why c.435_438delCCGG mutation carriers are present with isolated PDA instead of Char syndrome.<br><br>MATERIALS AND METHODS: We successfully established a mouse model bearing Tfap2b c.435_438delCCGG mutation using CRISPR/Cas9 technology. The mutant mice were phenotyped using histological analysis, and the development of ductus smooth muscles in mutant mice was examined by immunohistochemistry.<br><br>RESULTS: The c.435_438delCCGG homozygous mutant mice were characterized by delayed closure of the ductus arteriosus (DA) and renal malformation. Furthermore, the c.435_438delCCGG mutation might result in PDA by affecting the development of ductus arterious smooth muscle cells.<br><br>CONCLUSIONS: Using the c.435_438delCCGG homozygous mice, we verified the nature of the c.435_438delCCGG mutation and established a new and useful animal model to explore the function of Tfap2b and the mechanisms of PDA and renal formation. These findings may be useful for the development of therapies for those rare disorder.},
}
@article {pmid29446996,
year = {2018},
author = {Yang, Y and Wang, Q and Li, Q and Men, K and He, Z and Deng, H and Ji, W and Wei, Y},
title = {Recent Advances in Therapeutic Genome Editing in China.},
journal = {Human gene therapy},
volume = {29},
number = {2},
pages = {136-145},
doi = {10.1089/hum.2017.210},
pmid = {29446996},
issn = {1557-7422},
mesh = {CRISPR-Cas Systems/*genetics ; China ; Gene Editing/*trends ; Genetic Diseases, Inborn/genetics/*therapy ; Genetic Therapy/*trends ; Genome, Human ; Humans ; },
abstract = {Editing of the genome to correct disease-causing mutations is a promising approach for the treatment of human diseases. Recent advances in the development of programmable nuclease-based genome editing tools have substantially improved the ability to make precise changes in the human genome. Genome editing technologies are already being used to correct genetic mutations in affected tissues and cells to treat diseases that are refractory to traditional gene therapies. Chinese scientists have made remarkable breakthroughs in the field of therapeutic genome editing, particularly with the first clinical trial involving the clustered regularly interspaced short palindromic repeats-caspase 9 system that began in China. Herein, current progress toward developing programmable nuclease-based gene therapies is introduced, as well as future prospects and challenges in China.},
}
@article {pmid29338433,
year = {2018},
author = {He, ZY and Zhang, YG and Yang, YH and Ma, CC and Wang, P and Du, W and Li, L and Xiang, R and Song, XR and Zhao, X and Yao, SH and Wei, YQ},
title = {In Vivo Ovarian Cancer Gene Therapy Using CRISPR-Cas9.},
journal = {Human gene therapy},
volume = {29},
number = {2},
pages = {223-233},
doi = {10.1089/hum.2017.209},
pmid = {29338433},
issn = {1557-7422},
mesh = {CRISPR-Cas Systems/genetics ; Cell Proliferation/drug effects ; DNA (Cytosine-5-)-Methyltransferase 1/*genetics/therapeutic use ; Drug Resistance, Neoplasm/genetics ; Female ; Folate Receptor 1/genetics/therapeutic use ; Gene Editing ; Gene Expression Regulation, Neoplastic ; *Gene Transfer Techniques ; *Genetic Therapy ; Humans ; Liposomes/administration &amp; dosage/chemistry ; Ovarian Neoplasms/drug therapy/*genetics/pathology ; Paclitaxel/administration &amp; dosage/adverse effects ; },
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)-caspase 9 (Cas9) genome editing technology holds great promise for the field of human gene therapy. However, a lack of safe and effective delivery systems restricts its biomedical application. Here, a folate receptor-targeted liposome (F-LP) was used to deliver CRISPR plasmid DNA co-expressing Cas9 and single-guide RNA targeting the ovarian cancer-related DNA methyltransferase 1 (DNMT1) gene (gDNMT1). F-LP efficiently bound the gDNMT1 plasmid and formed a stable complex (F-LP/gDNMT1) that was safe for injection. F-LP/gDNMT1 effectively mutated endogenous DNMT1 in vitro, and then expressed the Cas9 endonuclease and downregulated DNMT1 in vivo. The tumor growth of both paclitaxel-sensitive and -resistant ovarian cancers were inhibited by F-LP/gDNMT1, which shows fewer adverse effects than paclitaxel injection. Therefore, CRISPR-Cas9-targeted DNMT1 manipulation may be a potential therapeutic regimen for ovarian cancer, and lipid-mediated delivery systems represent promising delivery vectors of CRISPR-Cas9 technology for precise genome editing therapeutics.},
}
@article {pmid29120617,
year = {2017},
author = {Ma, Y and Wang, M and Li, W and Zhang, Z and Zhang, X and Wu, G and Tan, T and Cui, Z and Zhang, XE},
title = {Live Visualization of HIV-1 Proviral DNA Using a Dual-Color-Labeled CRISPR System.},
journal = {Analytical chemistry},
volume = {89},
number = {23},
pages = {12896-12901},
doi = {10.1021/acs.analchem.7b03584},
pmid = {29120617},
issn = {1520-6882},
mesh = {CRISPR-Associated Protein 9/*genetics ; CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Color ; DNA, Viral/*genetics ; HIV Infections/*diagnostic imaging ; HIV-1/*genetics ; Humans ; Proviruses/*genetics ; Quantum Dots/chemistry ; },
abstract = {HIV latency is one of the major problems in HIV/AIDS cure. Imaging single-copy integrated proviral HIV DNA in host cell has both virology and clinical significance but remains technical challenge. Here, we developed a dual-color labeled CRISPR system to image the HIV-1 integrated proviral DNA in latently infected cells. The pair of CRISPRs was fluorescently labeled with two different color QDs using two alternative bioorthogonal ligation reactions. Integrated HIV-sequences are successfully mapped based on the colocalized signals of QDs in living cells. Compared to the existing zinc finger proteins and TALENs, the CRISPR system is much easier to operate and more efficient in imaging of internal genomic loci. Therefore, the proposed method could be not only a powerful tool for imaging proviral HIV-1, but also a versatile platform to image single genomic loci in living cells.},
}
@article {pmid30722791,
year = {2019},
author = {Gonçalves, E and Behan, FM and Louzada, S and Arnol, D and Stronach, EA and Yang, F and Yusa, K and Stegle, O and Iorio, F and Garnett, MJ},
title = {Structural rearrangements generate cell-specific, gene-independent CRISPR-Cas9 loss of fitness effects.},
journal = {Genome biology},
volume = {20},
number = {1},
pages = {27},
doi = {10.1186/s13059-019-1637-z},
pmid = {30722791},
issn = {1474-760X},
support = {//Wellcome Trust/United Kingdom ; C44943/A22536//Cancer Research UK/United Kingdom ; 206194//Wellcome Trust/United Kingdom ; 098051//Wellcome Trust/United Kingdom ; },
mesh = {*CRISPR-Cas Systems ; Cell Line, Tumor ; *Genomic Structural Variation ; Genomics/*methods ; Humans ; Neoplasms/genetics ; Ploidies ; Software ; *Whole Genome Sequencing ; },
abstract = {BACKGROUND: CRISPR-Cas9 genome editing is widely used to study gene function, from basic biology to biomedical research. Structural rearrangements are a ubiquitous feature of cancer cells and their impact on the functional consequences of CRISPR-Cas9 gene-editing has not yet been assessed.<br><br>RESULTS: Utilizing CRISPR-Cas9 knockout screens for 250 cancer cell lines, we demonstrate that targeting structurally rearranged regions, in particular tandem or interspersed amplifications, is highly detrimental to cellular fitness in a gene-independent manner. In contrast, amplifications caused by whole chromosomal duplication have little to no impact on fitness. This effect is cell line specific and dependent on the ploidy status. We devise a copy-number ratio metric that substantially improves the detection of gene-independent cell fitness effects in CRISPR-Cas9 screens. Furthermore, we develop a computational tool, called Crispy, to account for these effects on a single sample basis and provide corrected gene fitness effects.<br><br>CONCLUSION: Our analysis demonstrates the importance of structural rearrangements in mediating the effect of CRISPR-Cas9-induced DNA damage, with implications for the use of CRISPR-Cas9 gene-editing in cancer cells.},
}
@article {pmid30717767,
year = {2019},
author = {Teng, F and Li, J and Cui, T and Xu, K and Guo, L and Gao, Q and Feng, G and Chen, C and Han, D and Zhou, Q and Li, W},
title = {Enhanced mammalian genome editing by new Cas12a orthologs with optimized crRNA scaffolds.},
journal = {Genome biology},
volume = {20},
number = {1},
pages = {15},
doi = {10.1186/s13059-019-1620-8},
pmid = {30717767},
issn = {1474-760X},
mesh = {Animals ; *CRISPR-Associated Proteins ; *CRISPR-Cas Systems ; Gene Editing/*methods ; Humans ; Mice ; },
abstract = {CRISPR-Cas12a/Cpf1, a single RNA-guided endonuclease system, provides a promising tool for genome engineering. However, only three Cas12a orthologs have been employed for mammalian genome editing, and the editing efficiency as well as targeting coverage still requires improvements. Here, we harness six novel Cas12a orthologs for genome editing in human and mouse cells, some of which utilize simple protospacer adjacent motifs (PAMs) that remarkably increase the targeting range in the genomes. Moreover, we identify optimized CRISPR RNA (crRNA) scaffolds that can increase the genome editing efficiency of Cas12a.},
}
@article {pmid30678704,
year = {2019},
author = {Zhu, S and Cao, Z and Liu, Z and He, Y and Wang, Y and Yuan, P and Li, W and Tian, F and Bao, Y and Wei, W},
title = {Guide RNAs with embedded barcodes boost CRISPR-pooled screens.},
journal = {Genome biology},
volume = {20},
number = {1},
pages = {20},
doi = {10.1186/s13059-019-1628-0},
pmid = {30678704},
issn = {1474-760X},
mesh = {Bacterial Proteins ; Bacterial Toxins ; *CRISPR-Cas Systems ; Gene Targeting ; Genomics/*methods ; HEK293 Cells ; HeLa Cells ; Humans ; *RNA, Guide ; },
abstract = {We report a new method using re-designed guide RNAs with internal barcodes (iBARs) embedded in their loop regions. Our iBAR approach outperforms the conventional method by producing screening results with much lower false-positive and false-negative rates especially with a high multiplicity of infection (MOI). Importantly, the iBAR approach reduces the starting cells at high MOI significantly with greatly improved efficiency and accuracy compared with the canonical CRISPR screens at a low MOI. This new system is particularly useful when the source of cells is limited or when it is difficult to control viral infection for in vivo screening.},
}
@article {pmid30588718,
year = {2019},
author = {Jo, N and Sogabe, Y and Yamada, Y and Ukai, T and Kagawa, H and Mitsunaga, K and Woltjen, K and Yamada, Y},
title = {Platforms of in vivo genome editing with inducible Cas9 for advanced cancer modeling.},
journal = {Cancer science},
volume = {110},
number = {3},
pages = {926-938},
doi = {10.1111/cas.13924},
pmid = {30588718},
issn = {1349-7006},
support = {JP16H06276//Japan Society for the Promotion of Science/ ; //Naito Foundation/ ; //Takeda Science Foundation/ ; JP18cm0106203//Japan Agency for Medical Research and Development/ ; JP18gm1110004//Japan Agency for Medical Research and Development/ ; },
mesh = {Adenoma/*genetics/pathology ; Animals ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Female ; Gene Editing/methods ; Intestinal Neoplasms/*genetics/pathology ; Kidney Neoplasms/*genetics/pathology ; Mice ; Mice, Inbred C57BL ; Mice, Inbred ICR ; Mutation/genetics ; RNA, Guide/*genetics ; Wilms Tumor/*genetics/pathology ; },
abstract = {The emergence of clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 technology has dramatically advanced how we manipulate the genome. Regarding in vivo experiments, Cas9-transgenic animals could provide efficient and complex genome editing. However, this potential has not been fully realized partly due to a lack of convenient platforms and limited examples of successful disease modeling. Here, we devised two doxycycline (Dox)-inducible Cas9 platforms that efficiently enable conditional genome editing at multiple loci in vitro and in vivo. In these platforms, we took advantage of a site-specific multi-segment cloning strategy for rapid and easy integration of multiple single guide (sg)RNAs. We found that a platform containing rtTA at the Rosa26 locus and TRE-Cas9 together with multiple sgRNAs at the Col1a1 locus showed higher efficiency of inducible insertions and deletions (indels) with minimal leaky editing. Using this platform, we succeeded to model Wilms' tumor and the progression of intestinal adenomas with multiple mutations including an activating mutation with a large genomic deletion. Collectively, the established platform should make complicated disease modeling in the mouse easily attainable, extending the range of in vivo experiments in various biological fields including cancer research.},
}
@article {pmid29987710,
year = {2018},
author = {Naim, F and Dugdale, B and Kleidon, J and Brinin, A and Shand, K and Waterhouse, P and Dale, J},
title = {Gene editing the phytoene desaturase alleles of Cavendish banana using CRISPR/Cas9.},
journal = {Transgenic research},
volume = {27},
number = {5},
pages = {451-460},
pmid = {29987710},
issn = {1573-9368},
mesh = {Alleles ; *CRISPR-Cas Systems ; Gene Editing/*methods ; Musa/*genetics ; Oxidoreductases/*genetics ; Plant Proteins/genetics ; Plants, Genetically Modified ; RNA, Guide ; },
abstract = {Bananas are a staple food source and a major export commodity worldwide. The Cavendish dessert banana is a triploid AAA genome type and accounts for around 47% of global production. Being essentially sterile, genetic modification is perhaps the only pathway available to improve this cultivar. In this study, we used the CRISPR/Cas9 gene editing system to deliver a self-cleaving polycistronic guide RNA (gRNA) designed to target exon 1 of the Phytoene desaturase (PDS) gene in the Cavendish cultivar &quot;Williams&quot;. Genotyping of 19 independent events showed a 100% PDS modification rate primarily in the form of insertions (1-105 nt) or deletions (1-55 nt) (indels) at the predicted cleavage site. Tri-allelic disruptive modifications were observed in 63% of plants and resulted in both albinism and dwarfing. Pale green (16%) and wildtype green (21%) phenotypes generally correlated with in-frame indels in at least one of the three PDS alleles. Editing efficiency was dependent on both target site selection and Cas9 abundance. This is the first report of a highly effective CRISPR/Cas9 modification system using a polycistronic gRNA in Cavendish banana. Such an editing platform will be of considerable utility for the development of disease resistance and novel agro-traits in this commercially important cultivar into the future.},
}
@article {pmid29522859,
year = {2018},
author = {Kherraf, ZE and Conne, B and Amiri-Yekta, A and Kent, MC and Coutton, C and Escoffier, J and Nef, S and Arnoult, C and Ray, PF},
title = {Creation of knock out and knock in mice by CRISPR/Cas9 to validate candidate genes for human male infertility, interest, difficulties and feasibility.},
journal = {Molecular and cellular endocrinology},
volume = {468},
number = {},
pages = {70-80},
doi = {10.1016/j.mce.2018.03.002},
pmid = {29522859},
issn = {1872-8057},
mesh = {Animals ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Female ; Gene Knock-In Techniques/*methods ; *Genetic Association Studies ; Humans ; Infertility, Male/*genetics ; Male ; Mice, Inbred C57BL ; Mice, Knockout ; Mutation/genetics ; Nucleotide Motifs/genetics ; },
abstract = {High throughput sequencing (HTS) and CRISPR/Cas9 are two recent technologies that are currently revolutionizing biological and clinical research. Both techniques are complementary as HTS permits to identify new genetic variants and genes involved in various pathologies and CRISPR/Cas9 permits to create animals or cell models to validate the effect of the identified variants, to characterize the pathogeny of the identified variants and the function of the genes of interest and ultimately to provide ways of correcting the molecular defects. We analyzed a cohort of 78 infertile men presenting with multiple morphological anomalies of the sperm flagella (MMAF), a severe form of male infertility. Using whole exome sequencing (WES), homozygous mutations in autosomal candidate genes were identified in 63% of the tested subjects. We decided to produce by CRISPR/cas9 four knock-out (KO) and one knock-in (KI) mouse lines to confirm these results and to increase our understanding of the physiopathology associated with these genetic variations. Overall 31% of the live pups obtained presented a mutational event in one of the targeted regions. All identified events were insertions or deletions localized near the PAM sequence. Surprisingly we observed a high rate of germline mosaicism as 30% of the F1 displayed a different mutation than the parental event characterized on somatic tissue (tail), indicating that CRISPR/Cas9 mutational events kept happening several cell divisions after the injection. Overall, we created mouse models for 5 distinct loci and in each case homozygous animals could be obtained in approximately 6 months. These results demonstrate that the combined use of WES and CRISPR/Cas9 is an efficient and timely strategy to identify and validate mutations responsible for infertility phenotypes in human.},
}
@article {pmid29367726,
year = {2018},
author = {Sakuma, T and Yamamoto, T},
title = {Genome editing for dissecting and curing human genetic diseases.},
journal = {Journal of human genetics},
volume = {63},
number = {2},
pages = {105},
doi = {10.1038/s10038-017-0380-0},
pmid = {29367726},
issn = {1435-232X},
mesh = {*CRISPR-Cas Systems ; *Gene Editing ; Genetic Diseases, Inborn/*therapy ; *Genetic Therapy ; *Genome, Human ; Humans ; },
}
@article {pmid29325827,
year = {2018},
author = {Nødvig, CS and Hoof, JB and Kogle, ME and Jarczynska, ZD and Lehmbeck, J and Klitgaard, DK and Mortensen, UH},
title = {Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli.},
journal = {Fungal genetics and biology : FG &amp; B},
volume = {115},
number = {},
pages = {78-89},
doi = {10.1016/j.fgb.2018.01.004},
pmid = {29325827},
issn = {1096-0937},
mesh = {Aspergillus/*genetics ; CRISPR-Cas Systems/*genetics ; *DNA Breaks, Double-Stranded ; Gene Deletion ; Gene Editing/*methods ; Gene Targeting ; Genetic Vectors ; Oligonucleotides/genetics ; RNA, Transfer/genetics ; },
abstract = {CRISPR-Cas9 technologies are revolutionizing fungal gene editing. Here we show that survival of specific Cas9/sgRNA mediated DNA double strand breaks (DSBs) depends on the non-homologous end-joining, NHEJ, DNA repair pathway and we use this observation to develop a tool, TAPE, to assess protospacer efficiency in Aspergillus nidulans. Moreover, we show that in NHEJ deficient strains, highly efficient marker-free gene targeting can be performed. Indeed, we show that even single-stranded oligo nucleotides efficiently work as repair templates of specific Cas9/sgRNA induced DNA DSBs in A. nidulans, A. niger, and in A. oryzae indicating that this type of repair may be wide-spread in filamentous fungi. Importantly, we demonstrate that by using single-stranded oligo nucleotides for CRISPR-Cas9 mediated gene editing it is possible to introduce specific point mutations as well gene deletions at efficiencies approaching 100%. The efficiency of the system invites for multiplexing and we have designed a vector system with the capacity of delivering Cas9 and multiple sgRNAs based on polymerase III promoters and tRNA spacers. We show that it is possible to introduce two point mutations and one gene insertion in one transformation experiment with a very high efficiency. Our system is compatible with future high-throughput gene-editing experiments.},
}
@article {pmid28203699,
year = {2018},
author = {Yan, J and Chuai, G and Zhou, C and Zhu, C and Yang, J and Zhang, C and Gu, F and Xu, H and Wei, J and Liu, Q},
title = {Benchmarking CRISPR on-target sgRNA design.},
journal = {Briefings in bioinformatics},
volume = {19},
number = {4},
pages = {721-724},
doi = {10.1093/bib/bbx001},
pmid = {28203699},
issn = {1477-4054},
mesh = {Benchmarking/*methods ; *CRISPR-Cas Systems ; Computer Simulation ; *Gene Editing ; Humans ; RNA, Guide/*genetics ; },
abstract = {CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-based gene editing has been widely implemented in various cell types and organisms. A major challenge in the effective application of the CRISPR system is the need to design highly efficient single-guide RNA (sgRNA) with minimal off-target cleavage. Several tools are available for sgRNA design, while limited tools were compared. In our opinion, benchmarking the performance of the available tools and indicating their applicable scenarios are important issues. Moreover, whether the reported sgRNA design rules are reproducible across different sgRNA libraries, cell types and organisms remains unclear. In our study, a systematic and unbiased benchmark of the sgRNA predicting efficacy was performed on nine representative on-target design tools, based on six benchmark data sets covering five different cell types. The benchmark study presented here provides novel quantitative insights into the available CRISPR tools.},
}
@article {pmid28132023,
year = {2017},
author = {Lu, XJ and Sun, HM and Xu, Y and Yu, X and Gu, B},
title = {The applications and advances of CRISPR-Cas9 in medical research.},
journal = {Briefings in functional genomics},
volume = {16},
number = {1},
pages = {1-3},
doi = {10.1093/bfgp/elw036},
pmid = {28132023},
issn = {2041-2657},
mesh = {*Biomedical Research ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Genetic Therapy ; Humans ; Models, Biological ; },
}
@article {pmid30537986,
year = {2018},
author = {Chen, N and Zhao, G and Yan, X and Lv, Z and Yin, H and Zhang, S and Song, W and Li, X and Li, L and Du, Z and Jia, L and Zhou, L and Li, W and Hoffman, AR and Hu, JF and Cui, J},
title = {A novel FLI1 exonic circular RNA promotes metastasis in breast cancer by coordinately regulating TET1 and DNMT1.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {218},
doi = {10.1186/s13059-018-1594-y},
pmid = {30537986},
issn = {1474-760X},
support = {I01 BX002905/BX/BLRD VA/United States ; BX002905/VA/VA/United States ; },
mesh = {Breast Neoplasms/*metabolism ; CRISPR-Cas Systems ; DNA (Cytosine-5-)-Methyltransferase 1/metabolism ; DNA Methylation ; *Gene Expression Regulation, Neoplastic ; Humans ; Mixed Function Oxygenases/metabolism ; Neoplasm Metastasis ; Proto-Oncogene Protein c-fli-1/*metabolism ; Proto-Oncogene Proteins/metabolism ; },
abstract = {BACKGROUND: Friend leukemia virus integration 1 (FLI1), an ETS transcription factor family member, acts as an oncogenic driver in hematological malignancies and promotes tumor growth in solid tumors. However, little is known about the mechanisms underlying the activation of this proto-oncogene in tumors.<br><br>RESULTS: Immunohistochemical staining showed that FLI1 is aberrantly overexpressed in advanced stage and metastatic breast cancers. Using a CRISPR Cas9-guided immunoprecipitation assay, we identify a circular RNA in the FLI1 promoter chromatin complex, consisting of FLI1 exons 4-2-3, referred to as FECR1.Overexpression of FECR1 enhances invasiveness of MDA-MB231 breast cancer cells. Notably, FECR1 utilizes a positive feedback mechanism to activate FLI1 by inducing DNA hypomethylation in CpG islands of the promoter. FECR1 binds to the FLI1 promoter in cis and recruits TET1, a demethylase that is actively involved in DNA demethylation. FECR1 also binds to and downregulates in trans DNMT1, a methyltransferase that is essential for the maintenance of DNA methylation.<br><br>CONCLUSIONS: These data suggest that FECR1 circular RNA acts as an upstream regulator to control breast cancer tumor growth by coordinating the regulation of DNA methylating and demethylating enzymes. Thus, FLI1 drives tumor metastasis not only through the canonical oncoprotein pathway, but also by using epigenetic mechanisms mediated by its exonic circular RNA.},
}
@article {pmid30501614,
year = {2018},
author = {Zhang, Y and Massel, K and Godwin, ID and Gao, C},
title = {Applications and potential of genome editing in crop improvement.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {210},
doi = {10.1186/s13059-018-1586-y},
pmid = {30501614},
issn = {1474-760X},
mesh = {CRISPR-Cas Systems ; Crops, Agricultural/*genetics ; *Gene Editing ; *Plant Breeding ; Transcription Activator-Like Effector Nucleases ; Zinc Finger Nucleases ; },
abstract = {Genome-editing tools provide advanced biotechnological techniques that enable the precise and efficient targeted modification of an organism's genome. Genome-editing systems have been utilized in a wide variety of plant species to characterize gene functions and improve agricultural traits. We describe the current applications of genome editing in plants, focusing on its potential for crop improvement in terms of adaptation, resilience, and end-use. In addition, we review novel breakthroughs that are extending the potential of genome-edited crops and the possibilities of their commercialization. Future prospects for integrating this revolutionary technology with conventional and new-age crop breeding strategies are also discussed.},
}
@article {pmid30477585,
year = {2018},
author = {Chong, ZS and Ohnishi, S and Yusa, K and Wright, GJ},
title = {Pooled extracellular receptor-ligand interaction screening using CRISPR activation.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {205},
pmid = {30477585},
issn = {1474-760X},
support = {206194//Wellcome Trust/United Kingdom ; },
mesh = {CRISPR-Cas Systems ; Genomics/*methods ; Humans ; Ligands ; Receptors, Cell Surface/*analysis ; },
abstract = {Extracellular interactions between cell surface receptors are necessary for signaling and adhesion but identifying them remains technically challenging. We describe a cell-based genome-wide approach employing CRISPR activation to identify receptors for a defined ligand. We show receptors for high-affinity antibodies and low-affinity ligands can be unambiguously identified when used in pools or as individual binding probes. We apply this technique to identify ligands for the adhesion G-protein-coupled receptors and show that the Nogo myelin-associated inhibitory proteins are ligands for ADGRB1. This method will enable extracellular receptor-ligand identification on a genome-wide scale.},
}
@article {pmid30442181,
year = {2018},
author = {Ji, X and Si, X and Zhang, Y and Zhang, H and Zhang, F and Gao, C},
title = {Conferring DNA virus resistance with high specificity in plants using virus-inducible genome-editing system.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {197},
pmid = {30442181},
issn = {1474-760X},
mesh = {Arabidopsis ; *CRISPR-Cas Systems ; *Disease Resistance ; *Geminiviridae ; Gene Editing/*methods ; Tobacco ; },
abstract = {The CRISPR/Cas9 system has recently been engineered to confer resistance to geminiviruses in plants. However, we show here that the usefulness of this antiviral strategy is undermined by off-target effects identified by deep sequencing in Arabidopsis. We construct two virus-inducible CRISPR/Cas9 vectors that efficiently inhibit beet severe curly top virus (BSCTV) accumulation in both transient assays (Nicotiana benthamiana) and transgenic lines (Arabidopsis). Deep sequencing detects no off-target effect in candidate sites of the transgenic Arabidopsis. This kind of virus-inducible genome-editing system should be widely applicable for generating virus-resistant plants without off-target costs.},
}
@article {pmid29625148,
year = {2018},
author = {Wang, Q and Liu, S and Liu, Z and Ke, Z and Li, C and Yu, X and Chen, S and Guo, D},
title = {Genome scale screening identification of SaCas9/gRNAs for targeting HIV-1 provirus and suppression of HIV-1 infection.},
journal = {Virus research},
volume = {250},
number = {},
pages = {21-30},
doi = {10.1016/j.virusres.2018.04.002},
pmid = {29625148},
issn = {1872-7492},
mesh = {*CRISPR-Cas Systems ; Gene Editing ; Genetic Therapy ; Genetic Vectors ; *Genome, Viral ; HIV Infections/therapy ; HIV-1/*genetics ; Humans ; Jurkat Cells ; Lentivirus/genetics ; Proviruses/*genetics ; *RNA, Guide ; Staphylococcus aureus/genetics ; Virion/genetics ; },
abstract = {The CRISPR/Cas9 gene-editing approach has been widely used in anti-HIV-1 gene therapy research. However, the major challenges facing the therapeutic application of CRISPR/Cas9 are the precise genome cleavage efficacy and efficient delivery of Cas9/gRNA specifically to the HIV-infected cells. Recently, a small size Cas9 from Staphylococcus aureus (SaCas9) has shown promise in genome editing in eukaryotic cells, suggesting a potential usage in blocking HIV-1 infection by targeting the HIV-1 genome. Here, we designed 43 guide RNAs (gRNAs) against the HIV-1 genome, thereby identifying 8 gRNAs that efficiently and specifically disrupt the target DNA by SaCas9. In addition, we found the selected gRNAs induce SaCas9 to disrupt the latent HIV-1 provirus and suppress HIV-1 proviral reactivation in latently infected Jurkat C11 cells. We further confirmed that the dual or triple gRNAs in an all-in-one lentiviral vector could reduce viral production in TZM-bl cells as well as in Jurkat T cells. Moreover, we did not detect any off-target cleavages in the predicted sites, suggesting that through all-in-one lentiviral vector-mediated HIV-1 genome editing, the selected SaCas9/gRNAs can provide an alternative and flexible strategy for anti-HIV gene therapy.},
}
@article {pmid30840895,
year = {2019},
author = {Mogila, I and Kazlauskiene, M and Valinskyte, S and Tamulaitiene, G and Tamulaitis, G and Siksnys, V},
title = {Genetic Dissection of the Type III-A CRISPR-Cas System Csm Complex Reveals Roles of Individual Subunits.},
journal = {Cell reports},
volume = {26},
number = {10},
pages = {2753-2765.e4},
doi = {10.1016/j.celrep.2019.02.029},
pmid = {30840895},
issn = {2211-1247},
abstract = {The type III-A Csm complex of Streptococcus thermophilus (StCsm) provides immunity against invading nucleic acids through the coordinated action of three catalytic domains: RNase (Csm3), ssDNase (Cas10-HD), and cyclic oligoadenylates synthase (Cas10-Palm). The matured StCsm complex is composed of Cas10:Csm2:Csm3:Csm4:Csm5 subunits and 40-nt CRISPR RNA (crRNA). We have carried out gene disruptions for each subunit and isolated deletion complexes to reveal the role of individual subunits in complex assembly and function. We show that the Cas10-Csm4 subcomplex binds the 5'-handle of crRNA and triggers Csm3 oligomerization to form a padlock for crRNA binding. We demonstrate that Csm5 plays a key role in target RNA binding while Csm2 ensures RNA cleavage at multiple sites by Csm3. Finally, guided by deletion analysis, we engineered a minimal Csm complex containing only the Csm3, Csm4, and Cas10 subunits and crRNA and demonstrated that it retains all three catalytic activities, thus paving the way for practical applications.},
}
@article {pmid30838976,
year = {2019},
author = {Wegner, M and Diehl, V and Bittl, V and de Bruyn, R and Wiechmann, S and Matthess, Y and Hebel, M and Hayes, MG and Schaubeck, S and Benner, C and Heinz, S and Bremm, A and Dikic, I and Ernst, A and Kaulich, M},
title = {Circular synthesized CRISPR/Cas gRNAs for functional interrogations in the coding and noncoding genome.},
journal = {eLife},
volume = {8},
number = {},
pages = {},
doi = {10.7554/eLife.42549},
pmid = {30838976},
issn = {2050-084X},
support = {IIIL5-518/17.004//Hessisches Ministerium für Wissenschaft und Kunst/ ; EXC115/2//Deutsche Forschungsgemeinschaft/ ; IIIL5-519/03/03.001//Hessisches Ministerium für Wissenschaft und Kunst/ ; EXC147/2//Deutsche Forschungsgemeinschaft/ ; },
abstract = {Current technologies to generate CRISPR/Cas gene perturbation reagents are labor intense and require multiple ligation and cloning steps. Furthermore, increasing gRNA sequence diversity negatively affects gRNA distribution, leading to libraries of heterogeneous quality. Here, we present a rapid and cloning-free mutagenesis technology to efficiently generate covalently-closed-circular-synthesized (3Cs) CRISPR/Cas gRNA reagents that uncouples sequence diversity from sequence distribution. We demonstrate fidelity and performance of 3Cs reagents by tailored targeting of all human deubiquitinating enzymes (DUBs) and identify their essentiality for cell fitness. To explore high-content screening, we aimed at generating the up-to-date largest gRNA library to simultaneously interrogate the coding and noncoding human genome and identify genes, predicted promoter flanking regions, transcription factor and CTCF binding sites linked to doxorubicin resistance. Our 3Cs technology enables fast and robust generation of bias-free gene perturbation libraries with yet unmatched diversities and should be considered an alternative to established technologies.},
}
@article {pmid30837341,
year = {2019},
author = {Nasko, DJ and Ferrell, BD and Moore, RM and Bhavsar, JD and Polson, SW and Wommack, KE},
title = {CRISPR Spacers Indicate Preferential Matching of Specific Virioplankton Genes.},
journal = {mBio},
volume = {10},
number = {2},
pages = {},
doi = {10.1128/mBio.02651-18},
pmid = {30837341},
issn = {2150-7511},
abstract = {Viral infection exerts selection pressure on marine microbes, as virus-induced cell lysis causes 20 to 50% of cell mortality, resulting in fluxes of biomass into oceanic dissolved organic matter. Archaeal and bacterial populations can defend against viral infection using the clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) system, which relies on specific matching between a spacer sequence and a viral gene. If a CRISPR spacer match to any gene within a viral genome is equally effective in preventing lysis, no viral genes should be preferentially matched by CRISPR spacers. However, if there are differences in effectiveness, certain viral genes may demonstrate a greater frequency of CRISPR spacer matches. Indeed, homology search analyses of bacterioplankton CRISPR spacer sequences against virioplankton sequences revealed preferential matching of replication proteins, nucleic acid binding proteins, and viral structural proteins. Positive selection pressure for effective viral defense is one parsimonious explanation for these observations. CRISPR spacers from virioplankton metagenomes preferentially matched methyltransferase and phage integrase genes within virioplankton sequences. These virioplankton CRISPR spacers may assist infected host cells in defending against competing phage. Analyses also revealed that half of the spacer-matched viral genes were unknown, some genes matched several spacers, and some spacers matched multiple genes, a many-to-many relationship. Thus, CRISPR spacer matching may be an evolutionary algorithm, agnostically identifying those genes under stringent selection pressure for sustaining viral infection and lysis. Investigating this subset of viral genes could reveal those genetic mechanisms essential to virus-host interactions and provide new technologies for optimizing CRISPR defense in beneficial microbes.IMPORTANCE The CRISPR-Cas system is one means by which bacterial and archaeal populations defend against viral infection which causes 20 to 50% of cell mortality in the ocean. We tested the hypothesis that certain viral genes are preferentially targeted for the initial attack of the CRISPR-Cas system on a viral genome. Using CASC, a pipeline for CRISPR spacer discovery, and metagenome data from oceanic microbes and viruses, we found a clear subset of viral genes with high match frequencies to CRISPR spacers. Moreover, we observed a many-to-many relationship of spacers and viral genes. These high-match viral genes were involved in nucleotide metabolism, DNA methylation, and viral structure. It is possible that CRISPR spacer matching is an evolutionary algorithm pointing to those viral genes most important to sustaining infection and lysis. Studying these genes may advance the understanding of virus-host interactions in nature and provide new technologies for leveraging CRISPR-Cas systems in beneficial microbes.},
}
@article {pmid30835493,
year = {2019},
author = {Chen, K and Wang, Y and Zhang, R and Zhang, H and Gao, C},
title = {CRISPR/Cas Genome Editing and Precision Plant Breeding in Agriculture.},
journal = {Annual review of plant biology},
volume = {},
number = {},
pages = {},
doi = {10.1146/annurev-arplant-050718-100049},
pmid = {30835493},
issn = {1545-2123},
abstract = {Enhanced agricultural production through innovative breeding technology is urgently needed to increase access to nutritious foods worldwide. Recent advances in CRISPR/Cas genome editing enable efficient targeted modification in most crops, thus promising to accelerate crop improvement. Here, we review advances in CRISPR/Cas9 and its variants and examine their applications in plant genome editing and related manipulations. We highlight base-editing tools that enable targeted nucleotide substitutions and describe the various delivery systems, particularly DNA-free methods, that have linked genome editing with crop breeding. We summarize the applications of genome editing for trait improvement, development of fine-tuning gene regulation, strategies for breeding virus resistance, and the use of high-throughput mutant libraries. We outline future perspectives for genome editing in plant synthetic biology and domestication, advances in delivery systems, editing specificity, homology-directed repair, and gene drives. Finally, we discuss the challenges and opportunities for precision plant breeding and its bright future in agriculture. Expected final online publication date for the Annual Review of Plant Biology Volume 70 is April 29, 2019. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.},
}
@article {pmid30834930,
year = {2019},
author = {van Sluijs, L and van Houte, S and van der Oost, J and Brouns, SJJ and Buckling, A and Westra, ER},
title = {Addiction systems antagonize bacterial adaptive immunity.},
journal = {FEMS microbiology letters},
volume = {},
number = {},
pages = {},
doi = {10.1093/femsle/fnz047},
pmid = {30834930},
issn = {1574-6968},
abstract = {CRISPR-Cas systems provide adaptive immunity against mobile genetic elements, but employment of this resistance mechanism is often reported with a fitness cost for the host. Whether or not CRISPR-Cas systems are important barriers for the horizontal spread of conjugative plasmids, which play a crucial role in the spread of antibiotic resistance, will depend on the fitness costs of employing CRISPR-based defences and the benefits of resisting conjugative plasmids. To estimate these costs and benefits we measured bacterial fitness associated with plasmid immunity using Escherichia coli and the conjugative plasmid pOX38-Cm. We find that CRISPR-mediated immunity fails to confer a fitness benefit in the absence of antibiotics, despite the large fitness cost associated with carrying the plasmid in this context. Similar to many other conjugative plasmids, pOX38-Cm carries a CcdAB toxin-antitoxin (TA) addiction system. These addiction systems encode long-lived toxins and short-lived anti-toxins, resulting in toxic effects following the loss of the TA genes from the bacterial host. Our data suggest that the lack of a fitness benefit associated with CRISPR-mediated defence is due to expression of the TA system before plasmid detection and degradation. As most antibiotic resistance plasmids encode TA systems this could have important consequences for the role of CRISPR-Cas systems in limiting the spread of antibiotic resistance.},
}
@article {pmid30833733,
year = {2019},
author = {Fu, BXH and Smith, JD and Fuchs, RT and Mabuchi, M and Curcuru, J and Robb, GB and Fire, AZ},
title = {Target-dependent nickase activities of the CRISPR-Cas nucleases Cpf1 and Cas9.},
journal = {Nature microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41564-019-0382-0},
pmid = {30833733},
issn = {2058-5276},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR) machineries are prokaryotic immune systems that have been adapted as versatile gene editing and manipulation tools. We found that CRISPR nucleases from two families, Cpf1 (also known as Cas12a) and Cas9, exhibit differential guide RNA (gRNA) sequence requirements for cleavage of the two strands of target DNA in vitro. As a consequence of the differential gRNA requirements, both Cas9 and Cpf1 enzymes can exhibit potent nickase activities on an extensive class of mismatched double-stranded DNA (dsDNA) targets. These properties allow the production of efficient nickases for a chosen dsDNA target sequence, without modification of the nuclease protein, using gRNAs with a variety of patterns of mismatch to the intended DNA target. In parallel to the nicking activities observed with purified Cas9 in vitro, we observed sequence-dependent nicking for both perfectly matched and partially mismatched target sequences in a Saccharomyces cerevisiae system. Our findings have implications for CRISPR spacer acquisition, off-target potential of CRISPR gene editing/manipulation, and tool development using homology-directed nicking.},
}
@article {pmid30828340,
year = {2019},
author = {Muñoz, IV and Sarrocco, S and Malfatti, L and Baroncelli, R and Vannacci, G},
title = {CRISPR-Cas for Fungal Genome Editing: A New Tool for the Management of Plant Diseases.},
journal = {Frontiers in plant science},
volume = {10},
number = {},
pages = {135},
doi = {10.3389/fpls.2019.00135},
pmid = {30828340},
issn = {1664-462X},
}
@article {pmid30823430,
year = {2019},
author = {Loureiro, A and da Silva, GJ},
title = {CRISPR-Cas: Converting A Bacterial Defence Mechanism into A State-of-the-Art Genetic Manipulation Tool.},
journal = {Antibiotics (Basel, Switzerland)},
volume = {8},
number = {1},
pages = {},
doi = {10.3390/antibiotics8010018},
pmid = {30823430},
issn = {2079-6382},
abstract = {Bacteriophages are pervasive viruses that infect bacteria, relying on their genetic machinery to replicate. In order to protect themselves from this kind of invader, bacteria developed an ingenious adaptive defence system, clustered regularly interspaced short palindromic repeats (CRISPR). Researchers soon realised that a specific type of CRISPR system, CRISPR-Cas9, could be modified into a simple and efficient genetic engineering technology, with several improvements over currently used systems. This discovery set in motion a revolution in genetics, with new and improved CRISPR systems being used in plenty of in vitro and in vivo experiments in recent years. This review illustrates the mechanisms behind CRISPR-Cas systems as a means of bacterial immunity against phage invasion and how these systems were engineered to originate new genetic manipulation tools. Newfound CRISPR-Cas technologies and the up-and-coming applications of these systems on healthcare and other fields of science are also discussed.},
}
@article {pmid30822746,
year = {2019},
author = {Lin, P and Pu, Q and Shen, G and Li, R and Guo, K and Zhou, C and Liang, H and Jiang, J and Wu, M},
title = {CdpR Inhibits CRISPR-Cas Adaptive Immunity to Lower Anti-viral Defense while Avoiding Self-Reactivity.},
journal = {iScience},
volume = {13},
number = {},
pages = {55-68},
doi = {10.1016/j.isci.2019.02.005},
pmid = {30822746},
issn = {2589-0042},
abstract = {CRISPR-Cas systems as adaptive immunity in bacteria and archaea battle against bacteriophages. However, little is known how CRISPR-Cas systems are precisely regulated to effectively eliminate intruders while not inducing self-reactivity. Here, we identify intrinsic negative modulator of CRISPR-Cas that influences interference and adaptation functions. LasI/RhlI-derived autoinducers activate cas operon by enhancing the binding of virulence factor regulator (Vfr) cis-response elements to cas1 promoter, whereas CdpR represses this intracellular signaling and blocks transcription of cas operon. Importantly, inhibition of Vfr reduces cas1 expression and impairs immunization and immune memory mediated by CRISPR-Cas, leading to more severe phage infection but lower self-targeting activities. In addition, CdpR-mediated LasI/RhlI/Vfr intracellular signaling represses cleavage of bacterial endogenous sequences by impeding Cas3 RNA cleavage activity. Thus, CdpR renders important inhibitory effects on CRISPR-Cas systems to avoid possible self-reactivity but potentially heightening infection risk. Our study provides insight into fine regulation of CRISPR-Cas systems for maintaining homeostasis.},
}
@article {pmid30820491,
year = {2019},
author = {Lam, TJ and Ye, Y},
title = {CRISPRs for Strain Tracking and Their Application to Microbiota Transplantation Data Analysis.},
journal = {The CRISPR journal},
volume = {2},
number = {1},
pages = {41-50},
doi = {10.1089/crispr.2018.0046},
pmid = {30820491},
issn = {2573-1599},
support = {R01 AI108888/AI/NIAID NIH HHS/United States ; R01 AI143254/AI/NIAID NIH HHS/United States ; },
abstract = {CRISPR-Cas systems are adaptive immune systems naturally found in bacteria and archaea. Prokaryotes use these immune systems to defend against invaders, which include phages, plasmids, and other mobile genetic elements. Relying on the integration of spacers derived from invader sequences (protospacers) into CRISPR loci (forming spacers flanked by repeats), CRISPR-Cas systems are able to store the memory of past immunological encounters. While CRISPR-Cas systems have evolved in response to invading mobile genetic elements, invaders have also developed mechanisms to avoid detection. As a result of an arms race between CRISPR-Cas systems and their targets, CRISPR arrays typically undergo rapid turnover of spacers through the acquisition and loss events. Additionally, microbiomes of different individuals rarely share spacers. Here, we present a computational pipeline, CRISPRtrack, for strain tracking based on CRISPR spacer content, and we applied it to fecal transplantation microbiome data to study the retention of donor strains in recipients. Our results demonstrate the potential use of CRISPRs as a simple yet effective tool for donor-strain tracking in fecal transplantation and as a general purpose tool for quantifying microbiome similarity.},
}
@article {pmid30816277,
year = {2019},
author = {Wan, H and Li, J and Chang, S and Lin, S and Tian, Y and Tian, X and Wang, M and Hu, J},
title = {Probing the Behaviour of Cas1-Cas2 upon Protospacer Binding in CRISPR-Cas Systems using Molecular Dynamics Simulations.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {3188},
doi = {10.1038/s41598-019-39616-1},
pmid = {30816277},
issn = {2045-2322},
support = {31600591//National Natural Science Foundation of China (National Science Foundation of China)/ ; },
abstract = {Adaptation in CRISPR-Cas systems enables the generation of an immunological memory to defend against invading viruses. This process is driven by foreign DNA spacer (termed protospacer) selection and integration mediated by Cas1-Cas2 protein. Recently, different states of Cas1-Cas2, in its free form and in complex with protospacer DNAs, were solved by X-ray crystallography. In this paper, molecular dynamics (MD) simulations are employed to study crystal structures of one free and two protospacer-bound Cas1-Cas2 complexes. The simulated results indicate that the protospacer binding markedly increases the system stability, in particular when the protospacer containing the PAM-complementary sequence. The hydrogen bond and binding free energy calculations explain that PAM recognition introduces more specific interactions to increase the cleavage activity of Cas1. By using principal component analysis (PCA) and intramolecular angle calculation, this study observes two dominant slow motions associated with the binding of Ca1-Cas2 to the protospacer and potential target DNAs respectively. The comparison of DNA structural deformation further implies a cooperative conformational change of Cas1-Cas2 and protospacer for the target DNA capture. We propose that this cooperativity is the intrinsic requirement of the CRISPR integration complex formation. This study provides some new insights into the understanding of CRISPR-Cas adaptation.},
}
@article {pmid30814678,
year = {2019},
author = {Guo, M and Zhang, K and Zhu, Y and Pintilie, GD and Guan, X and Li, S and Schmid, MF and Ma, Z and Chiu, W and Huang, Z},
title = {Coupling of ssRNA cleavage with DNase activity in type III-A CRISPR-Csm revealed by cryo-EM and biochemistry.},
journal = {Cell research},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41422-019-0151-x},
pmid = {30814678},
issn = {1748-7838},
support = {31825008//National Natural Science Foundation of China (National Science Foundation of China)/ ; },
abstract = {The type III CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated genes) systems are bacterially encoded adaptive immune systems for defense against invading nucleic acids. They accomplish this task through the coordinated cleavage of invading substrates of single-stranded RNA and DNA (ssDNA and ssRNA) by the Csm (type III-A) or Cmr (type III-B) effector complexes. The ssRNA is complementarily bound to the CRISPR RNA (crRNA). However, the structural basis for the DNase and RNase activation of the Csm nucleoprotein complex is largely unknown. Here we report cryo-EM structures of the Csm-crRNA complex, with or without target ssRNA, at near-atomic resolution. Our cryo-EM maps allow us to build atomic models of the key macromolecular components, including Cas10, Csm2, Csm3, Csm4, crRNA and the invading ssRNA. Our structure resolves unambiguously the stoichiometry and tertiary structures of the Csm protein complex and the interactions between protein components and the crRNA/ssRNA. Interestingly, the new atomic structures of the Csm proteins presented here are similar to those of previously known Csm proteins in other species despite their low sequence similarity. Our combined structural and biochemical data suggest that ssRNA cleavage is preferentially carried out near its 5'-end, that the extent of interactions among the ssRNA, crRNA and the protein components regulates the DNase activity of the Csm complex, and that the 3' flanking sequence of ssRNA activates the Cas10 DNase activity allosterically.},
}
@article {pmid30814462,
year = {2019},
author = {Yoshida, H and Fukushima, Y and Goto, M and Tsuyuki, Y and Takahashi, T},
title = {Analysis of the type II-A CRISPR-Cas system in Streptococcus canis isolated from diseased companion animals and one human patient in Japan.},
journal = {Japanese journal of infectious diseases},
volume = {},
number = {},
pages = {},
doi = {10.7883/yoken.JJID.2018.492},
pmid = {30814462},
issn = {1884-2836},
abstract = {We determined the whole genome sequence (WGS) of Streptococcus canis strain TA4 harboring the M-like protein gene (scm), which was isolated from a human patient presenting with bacteremia. The potential of type II-A CRISPR array-based typing was explored and the genetic lineage between spacer genogroups and scm prevalence/polymorphisms in the isolates from 19 diseased companion animals and the human patient was elucidated. The CRISPRFinder/CRISPRCasFinder detected the type II-A locus with the same repeat sequences in TA4 and another WGS of Sc isolated from a cow with mastitis. An optimized PCR-based amplification method was used to sequence the region covering the locus around the leader and terminal repeat sequences. From the 20 isolates sequenced, 16 strains (including TA4) were identified with the CRISPR array. We comparatively analyzed the homologous spacer sequences and performed grouping based on the successive common ancestral spacer types. These 16 isolates were grouped into five genogroups (A to E) with scm being absent in genogroup A. We found a relationship between the genogroups C/E and allele type 1 of the deduced M-like protein. These preliminary findings suggest the possibility of CRISPR array-based typing and genetic lineage between the spacer genogroups and scm prevalence/polymorphisms in the isolates.},
}
@article {pmid30810167,
year = {2019},
author = {Lee, HY and Chen, Z and Zhang, C and Yoon, GM},
title = {Targeted Mutagenesis of the OsACS Locus Alters Phosphate Deficiency-Induced Adaptive Responses in Rice Seedlings.},
journal = {Journal of experimental botany},
volume = {},
number = {},
pages = {},
doi = {10.1093/jxb/erz074},
pmid = {30810167},
issn = {1460-2431},
abstract = {Phosphate (Pi) deficiency severely influences the growth and reproduction of plants. To cope with Pi-deficiency, plants initiate morphological and biochemical adaptive responses upon sensing low Pi in the soil and the plant hormone ethylene plays a crucial role during this process. However, how regulation of ethylene biosynthesis influences the Pi-induced adaptive responses remains unclear. Here, we determine the roles of rice ACC synthases (OsACS), the rate-limiting enzymes in ethylene biosynthesis, in response to Pi-deficiency. Through analysis of tissue-specific expressions of OsACS in response to Pi-deficiency and OsACS mutants generated by CRISPR/Cas9 genome-editing, we found that two members of the OsACS family, i.e., OsACS1 and OsACS2, are involved but differed in their importance in controlling the remodeling of root system architecture, transcriptional regulation of Pi-starvation-induced genes, and cellular phosphorus homeostasis. Interestingly, in contrast to the known inhibitory role of ethylene on root elongation, both OsACS mutants, especially OsACS1, almost fail to promote lateral root growth in response to Pi-deficiency, demonstrating a stimulatory role of ethylene in lateral root development under Pi-deficient condition. Together, this study provides new insights into the roles of ethylene in Pi-deficiency response in rice seedlings and the isoform-specific function of OsACS genes in this process.},
}
@article {pmid30809237,
year = {2019},
author = {Sedeek, KEM and Mahas, A and Mahfouz, M},
title = {Plant Genome Engineering for Targeted Improvement of Crop Traits.},
journal = {Frontiers in plant science},
volume = {10},
number = {},
pages = {114},
doi = {10.3389/fpls.2019.00114},
pmid = {30809237},
issn = {1664-462X},
abstract = {To improve food security, plant biology research aims to improve crop yield and tolerance to biotic and abiotic stress, as well as increasing the nutrient contents of food. Conventional breeding systems have allowed breeders to produce improved varieties of many crops; for example, hybrid grain crops show dramatic improvements in yield. However, many challenges remain and emerging technologies have the potential to address many of these challenges. For example, site-specific nucleases such as TALENs and CRISPR/Cas systems, which enable high-efficiency genome engineering across eukaryotic species, have revolutionized biological research and its applications in crop plants. These nucleases have been used in diverse plant species to generate a wide variety of site-specific genome modifications through strategies that include targeted mutagenesis and editing for various agricultural biotechnology applications. Moreover, CRISPR/Cas genome-wide screens make it possible to discover novel traits, expand the range of traits, and accelerate trait development in target crops that are key for food security. Here, we discuss the development and use of various site-specific nuclease systems for different plant genome-engineering applications. We highlight the existing opportunities to harness these technologies for targeted improvement of traits to enhance crop productivity and resilience to climate change. These cutting-edge genome-editing technologies are thus poised to reshape the future of agriculture and food security.},
}
@article {pmid30808944,
year = {2019},
author = {O'Brien, AR and Wilson, LOW and Burgio, G and Bauer, DC},
title = {Unlocking HDR-mediated nucleotide editing by identifying high-efficiency target sites using machine learning.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {2788},
doi = {10.1038/s41598-019-39142-0},
pmid = {30808944},
issn = {2045-2322},
abstract = {Editing individual nucleotides is a crucial component for validating genomic disease association. It is currently hampered by CRISPR-Cas-mediated &quot;base editing&quot; being limited to certain nucleotide changes, and only achievable within a small window around CRISPR-Cas target sites. The more versatile alternative, HDR (homology directed repair), has a 3-fold lower efficiency with known optimization factors being largely immutable in experiments. Here, we investigated the variable efficiency-governing factors on a novel mouse dataset using machine learning. We found the sequence composition of the single-stranded oligodeoxynucleotide (ssODN), i.e. the repair template, to be a governing factor. Furthermore, different regions of the ssODN have variable influence, which reflects the underlying mechanism of the repair process. Our model improves HDR efficiency by 83% compared to traditionally chosen targets. Using our findings, we developed CUNE (Computational Universal Nucleotide Editor), which enables users to identify and design the optimal targeting strategy using traditional base editing or - for-the-first-time - HDR-mediated nucleotide changes.},
}
@article {pmid30803101,
year = {2019},
author = {Zhan, X and Zhang, F and Zhong, Z and Chen, R and Wang, Y and Chang, L and Bock, R and Nie, B and Zhang, J},
title = {Generation of virus-resistant potato plants by RNA genome targeting.},
journal = {Plant biotechnology journal},
volume = {},
number = {},
pages = {},
doi = {10.1111/pbi.13102},
pmid = {30803101},
issn = {1467-7652},
abstract = {CRISPR/Cas systems provide bacteria and archaea with molecular immunity against invading phages and foreign plasmids. The class 2 type VI CRISPR/Cas effector Cas13a is an RNA-targeting CRISPR effector that provides protection against RNA phages. Here we report the repurposing of CRISPR/Cas13a to protect potato plants from a eukaryotic virus, Potato virus Y (PVY). Transgenic potato lines expressing Cas13a/sgRNA (small guide RNA) constructs showed suppressed PVY accumulation and disease symptoms. The levels of viral resistance correlated with the expression levels of the Cas13a/sgRNA construct in the plants. Our data further demonstrate that appropriately designed sgRNAs can specifically interfere with multiple PVY strains, while having no effect on unrelated viruses such as Potato virus A (PVA) or Potato virus S (PVS). Our findings provide a novel and highly efficient strategy for engineering crops with resistances to viral diseases. This article is protected by copyright. All rights reserved.},
}
@article {pmid30797903,
year = {2019},
author = {Thöne, FMB and Kurrle, NS and von Melchner, H and Schnütgen, F},
title = {CRISPR/Cas9-mediated generic protein tagging in mammalian cells.},
journal = {Methods (San Diego, Calif.)},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.ymeth.2019.02.018},
pmid = {30797903},
issn = {1095-9130},
abstract = {Systematic protein localization and protein-protein interaction studies to characterize specific protein functions are most effectively performed using tag-based assays. Ideally, protein tags are introduced into a gene of interest by homologous recombination to ensure expression from endogenous control elements. However, inefficient homologous recombination makes this approach difficult in mammalian cells. Although gene targeting efficiency by homologous recombination increased dramatically with the development of designer endonuclease systems such as CRISPR/Cas9 capable of inducing DNA double-strand breaks with unprecedented accuracy, the strategies still require synthesis or cloning of homology templates for every single gene. Recent developments have shown that endogenous protein tagging can be achieved efficiently in a homology independent manner. Hence, combinations between CRISPR/Cas9 and generic tag-donor plasmids have been used successfully for targeted gene modifications in mammalian cells. Here, we developed a tool kit comprising a CRISPR/Cas9 expression vector with several EGFP encoding plasmids that should enable tagging of almost every protein expressed in mammalian cells. By performing protein-protein interaction and subcellular localization studies of mTORC1 signal transduction pathway-related proteins expressed in HEK293T cells, we show that tagged proteins faithfully reflect the behavior of their native counterparts under physiological conditions.},
}
@article {pmid30795631,
year = {2019},
author = {Bozic, B and Repac, J and Djordjevic, M},
title = {Endogenous Gene Regulation as a Predicted Main Function of Type I-E CRISPR/Cas System in E. coli.},
journal = {Molecules (Basel, Switzerland)},
volume = {24},
number = {4},
pages = {},
doi = {10.3390/molecules24040784},
pmid = {30795631},
issn = {1420-3049},
support = {ON173052//Ministarstvo Prosvete, Nauke i Tehnološkog Razvoja/ ; },
abstract = {CRISPR/Cas is an adaptive bacterial immune system, whose CRISPR array can actively change in response to viral infections. However, Type I-E CRISPR/Cas in E. coli (an established model system), appears not to exhibit such active adaptation, which suggests that it might have functions other than immune response. Through computational analysis, we address the involvement of the system in non-canonical functions. To assess targets of CRISPR spacers, we align them against both E. coli genome and an exhaustive (~230) set of E. coli viruses. We systematically investigate the obtained alignments, such as hit distribution with respect to genome annotation, propensity to target mRNA, the target functional enrichment, conservation of CRISPR spacers and putative targets in related bacterial genomes. We find that CRISPR spacers have a statistically highly significant tendency to target i) host compared to phage genomes, ii) one of the two DNA strands, iii) genomic dsDNA rather than mRNA, iv) transcriptionally active regions, and v) sequences (cis-regulatory elements) with slower turn-over rate compared to CRISPR spacers (trans-factors). The results suggest that the Type I-E CRISPR/Cas system has a major role in transcription regulation of endogenous genes, with a potential to rapidly rewire these regulatory interactions, with targets being selected through naïve adaptation.},
}
@article {pmid30795542,
year = {2019},
author = {Brane, AC and Tollefsbol, TO},
title = {Targeting Telomeres and Telomerase: Studies in Aging and Disease Utilizing CRISPR/Cas9 Technology.},
journal = {Cells},
volume = {8},
number = {2},
pages = {},
doi = {10.3390/cells8020186},
pmid = {30795542},
issn = {2073-4409},
support = {R01 CA178441//National Institutes of Health/ ; R01 CA204346//National Institutes of Health/ ; },
abstract = {Telomeres and telomerase provide a unique and important avenue of study in improving both life expectancy and quality of life due to their close association with aging and disease. While major advances in our understanding of these two biological mediators have characterized the last two decades, previous studies have been limited by the inability to affect change in real time within living cells. The last three years, however, have witnessed a huge step forward to overcome this limitation. The advent of the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system has led to a wide array of targeted genetic studies that are already being employed to modify telomeres and telomerase, as well as the genes that affect them. In this review, we analyze studies utilizing the technology to target and modify telomeres, telomerase, and their closely associated genes. We also discuss how these studies can provide insight into the biology and mechanisms that underlie aging, cancer, and other diseases.},
}
@article {pmid30794791,
year = {2019},
author = {Almendros, C and Kieper, SN and Brouns, SJJ},
title = {CRISPR-Cas Systems Reduced to a Minimum.},
journal = {Molecular cell},
volume = {73},
number = {4},
pages = {641-642},
doi = {10.1016/j.molcel.2019.02.005},
pmid = {30794791},
issn = {1097-4164},
abstract = {In two recent studies in Molecular Cell, Wright et al. (2019) report complete spacer integration by a Cas1 mini-integrase and Edraki et al. (2019) describe accurate genome editing by a small Cas9 ortholog with less stringent PAM requirements.},
}
@article {pmid30794581,
year = {2019},
author = {Babačić, H and Mehta, A and Merkel, O and Schoser, B},
title = {CRISPR-cas gene-editing as plausible treatment of neuromuscular and nucleotide-repeat-expansion diseases: A systematic review.},
journal = {PloS one},
volume = {14},
number = {2},
pages = {e0212198},
doi = {10.1371/journal.pone.0212198},
pmid = {30794581},
issn = {1932-6203},
abstract = {INTRODUCTION: The system of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (cas) is a new technology that allows easier manipulation of the genome. Its potential to edit genes opened a new door in treatment development for incurable neurological monogenic diseases (NMGDs). The aim of this systematic review was to summarise the findings on the current development of CRISPR-cas for therapeutic purposes in the most frequent NMGDs and provide critical assessment.<br><br>METHODS AND DATA ACQUISITION: We searched the MEDLINE and EMBASE databases, looking for original studies on the use of CRISPR-cas to edit pathogenic variants in models of the most frequent NMGDs, until end of 2017. We included all the studies that met the following criteria: 1. Peer-reviewed study report with explicitly described experimental designs; 2. In vitro, ex vivo, or in vivo study using human or other animal biological systems (including cells, tissues, organs, organisms); 3. focusing on CRISPR as the gene-editing method of choice; and 5. featured at least one NMGD.<br><br>RESULTS: We obtained 404 papers from MEDLINE and 513 from EMBASE. After removing the duplicates, we screened 490 papers by title and abstract and assessed them for eligibility. After reading 50 full-text papers, we finally selected 42 for the review.<br><br>DISCUSSION: Here we give a systematic summary on the preclinical development of CRISPR-cas for therapeutic purposes in NMGDs. Furthermore, we address the clinical interpretability of the findings, giving a comprehensive overview of the current state of the art. Duchenne's muscular dystrophy (DMD) paves the way forward, with 26 out of 42 studies reporting different strategies on DMD gene editing in different models of the disease. Most of the strategies aimed for permanent exon skipping by deletion with CRISPR-cas. Successful silencing of the mHTT gene with CRISPR-cas led to successful reversal of the neurotoxic effects in the striatum of mouse models of Huntington's disease. Many other strategies have been explored, including epigenetic regulation of gene expression, in cellular and animal models of: myotonic dystrophy, Fraxile X syndrome, ataxias, and other less frequent dystrophies. Still, before even considering the clinical application of CRISPR-cas, three major bottlenecks need to be addressed: efficacy, safety, and delivery of the systems. This requires a collaborative approach in the research community, while having ethical considerations in mind.},
}
@article {pmid30793202,
year = {2019},
author = {Jabre, I and Reddy, ASN and Kalyna, M and Chaudhary, S and Khokhar, W and Byrne, LJ and Wilson, CM and Syed, NH},
title = {Does co-transcriptional regulation of alternative splicing mediate plant stress responses?.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gkz121},
pmid = {30793202},
issn = {1362-4962},
abstract = {Plants display exquisite control over gene expression to elicit appropriate responses under normal and stress conditions. Alternative splicing (AS) of pre-mRNAs, a process that generates two or more transcripts from multi-exon genes, adds another layer of regulation to fine-tune condition-specific gene expression in animals and plants. However, exactly how plants control splice isoform ratios and the timing of this regulation in response to environmental signals remains elusive. In mammals, recent evidence indicate that epigenetic and epitranscriptome changes, such as DNA methylation, chromatin modifications and RNA methylation, regulate RNA polymerase II processivity, co-transcriptional splicing, and stability and translation efficiency of splice isoforms. In plants, the role of epigenetic modifications in regulating transcription rate and mRNA abundance under stress is beginning to emerge. However, the mechanisms by which epigenetic and epitranscriptomic modifications regulate AS and translation efficiency require further research. Dynamic changes in the chromatin landscape in response to stress may provide a scaffold around which gene expression, AS and translation are orchestrated. Finally, we discuss CRISPR/Cas-based strategies for engineering chromatin architecture to manipulate AS patterns (or splice isoforms levels) to obtain insight into the epigenetic regulation of AS.},
}
@article {pmid30788786,
year = {2019},
author = {Shi, S and Liang, Y and Ang, EL and Zhao, H},
title = {Delta Integration CRISPR-Cas (Di-CRISPR) in Saccharomyces cerevisiae.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1927},
number = {},
pages = {73-91},
doi = {10.1007/978-1-4939-9142-6_6},
pmid = {30788786},
issn = {1940-6029},
abstract = {Despite the advances made in genetic engineering of Saccharomyces cerevisiae, the multicopy genomic integration of large biochemical pathways remains a challenge. Here, we developed a Di-CRISPR (delta integration CRISPR-Cas) platform based on cleavage of the delta sites by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated systems (Cas) to enable unprecedented high-efficiency, multicopy, markerless integrations of large biochemical pathways into the S. cerevisiae genome. Detailed protocols are provided on the entire workflow which includes pDi-CRISPR plasmid and donor DNA construction, Di-CRISPR-mediated integration and analysis of integration efficiencies and copy numbers through flow cytometry and quantitative polymerase chain reaction (qPCR).},
}
@article {pmid30787936,
year = {2019},
author = {Charrier, A and Vergne, E and Dousset, N and Richer, A and Petiteau, A and Chevreau, E},
title = {Efficient Targeted Mutagenesis in Apple and First Time Edition of Pear Using the CRISPR-Cas9 System.},
journal = {Frontiers in plant science},
volume = {10},
number = {},
pages = {40},
doi = {10.3389/fpls.2019.00040},
pmid = {30787936},
issn = {1664-462X},
abstract = {Targeted genome engineering has emerged as an alternative to classical plant breeding and transgenic methods to improve crop plants. Among other methods (zinc finger nucleases or TAL effector nucleases) the CRISPR-Cas system proved to be the most effective, convenient and least expensive method. In this study, we optimized the conditions of application of this system on apple and explored its feasibility on pear. As a proof of concept, we chose to knock-out the Phytoene Desaturase (PDS) and Terminal Flower 1 (TFL1) genes. To improve the edition efficiency, two different single guide RNAs (gRNAs) were associated to the Cas9 nuclease for each target gene. These gRNAs were placed under the control of the U3 and U6 apple promoters. Characteristic albino phenotype was obtained for 85% of the apple transgenic lines targeted in MdPDS gene. Early flowering was observed in 93% of the apple transgenic lines targeted in MdTFL1.1 gene and 9% of the pear transgenic lines targeted in PcTFL1.1. Sequencing of the target zones in apple and pear CRISPR-PDS and CRISPR-TFL1.1 transgenic lines showed that the two gRNAs induced mutations but at variable frequencies. In most cases, Cas9 nuclease cut the DNA in the twenty targeted base pairs near the protospacer adjacent motif and insertions were more frequent than deletions or substitutions. The most frequent edition profile of PDS as well as TFL1.1 genes was chimeric biallelic. Analysis of a sample of potential off-target sequences of the CRISPR-TFL1.1 construct indicated the absence of edition in cases of three mismatches. In addition, transient transformation with the CRISPR-PDS construct produced two T-DNA free edited apple lines. Our overall results indicate that, despite the frequent occurrence of chimerism, the CRISPR-Cas 9 system is a powerful and precise method to induce targeted mutagenesis in the first generation of apple and pear transgenic lines.},
}
@article {pmid30787394,
year = {2019},
author = {Lampi, Y and Van Looveren, D and Vranckx, LS and Thiry, I and Bornschein, S and Debyser, Z and Gijsbers, R},
title = {Targeted editing of the PSIP1 gene encoding LEDGF/p75 protects cells against HIV infection.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {2389},
doi = {10.1038/s41598-019-38718-0},
pmid = {30787394},
issn = {2045-2322},
support = {P30 AI027763/AI/NIAID NIH HHS/United States ; },
abstract = {To fulfill a productive infection cycle the human immunodeficiency virus (HIV) relies on host-cell factors. Interference with these co-factors holds great promise in protecting cells against HIV infection. LEDGF/p75, encoded by the PSIP1 gene, is used by the integrase (IN) protein in the pre-integration complex of HIV to bind host-cell chromatin facilitating proviral integration. LEDGF/p75 depletion results in defective HIV replication. However, as part of its cellular function LEDGF/p75 tethers cellular proteins to the host-cell genome. We used site-specific editing of the PSIP1 locus using CRISPR/Cas to target the aspartic acid residue in position 366 and mutated it to asparagine (D366N) to disrupt the interaction with HIV IN but retain LEDGF/p75 cellular function. The resulting cell lines demonstrated successful disruption of the LEDGF/p75 HIV-IN interface without affecting interaction with cellular binding partners. In line with LEDGF/p75 depleted cells, D366N cells did not support HIV replication, in part due to decreased integration efficiency. In addition, we confirm the remaining integrated provirus is more silent. Taken together, these results support the potential of site-directed CRISPR/Cas9 mediated knock-in to render cells more resistant to HIV infection and provides an additional strategy to protect patient-derived T-cells against HIV-1 infection as part of cell-based therapy.},
}
@article {pmid30785668,
year = {2019},
author = {Zhang, T and Zhao, Y and Ye, J and Cao, X and Xu, C and Chen, B and An, H and Jiao, Y and Zhang, F and Yang, X and Zhou, G},
title = {Establishing CRISPR/Cas13a immune system conferring RNA virus resistance in both dicot and monocot plants.},
journal = {Plant biotechnology journal},
volume = {},
number = {},
pages = {},
doi = {10.1111/pbi.13095},
pmid = {30785668},
issn = {1467-7652},
abstract = {Besides its powerful capability for genome editing, the clustered, regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) (CRISPR/Cas) systems, has been exploited to combat virus infection in eukaryotic organisms (Zaidi et al., 2016). By harnessing CRISPR/Cas system, its compelling inhibiting activities against DNA viruses (Ali et al., 2015; Baltes et al., 2015; Ji et al., 2015) or RNA viruses (Aman et al., 2018; Zhang et al., 2018) were reported in many cases. Moreover, due to the facts that the eukaryotic viruses themselves do not equip the ability to counter this prokaryotic immune defense, by utilization of such strategy, we could establish effective control and eradiation strategy against the eukaryotic virus. This article is protected by copyright. All rights reserved.},
}
@article {pmid30779874,
year = {2019},
author = {Rouet, R and Christ, D},
title = {Efficient Intracellular Delivery of CRISPR-Cas Ribonucleoproteins through Receptor Mediated Endocytosis.},
journal = {ACS chemical biology},
volume = {},
number = {},
pages = {},
doi = {10.1021/acschembio.9b00116},
pmid = {30779874},
issn = {1554-8937},
abstract = {We recently reported a new delivery system harnessing surface receptors for targeted uptake of CRISPR-Cas9 ribonucleoprotein into mammalian cells (Rouet et al., JACS 2018). For this purpose, Cas9 protein was labeled with the small molecule ligand ASGRL, specific for the asialoglycoprotein receptor, enabling endosomal uptake of the ribonucleoprotein into human cells expressing the receptor. However, detailed mechanistic insights had remained unknown and editing efficiency low. Here we investigate the mechanism of endosomal escape as mediated by the ppTG21 endosomolytic peptide and outline the development of novel Cas9 or Cas12a ribonucleoprotein complexes with increased editing efficiency.},
}
@article {pmid30773816,
year = {2019},
author = {Krupovic, M and Makarova, KS and Wolf, YI and Medvedeva, S and Prangishvili, D and Forterre, P and Koonin, EV},
title = {Integrated Mobile Genetic Elements in Thaumarchaeota.},
journal = {Environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1462-2920.14564},
pmid = {30773816},
issn = {1462-2920},
abstract = {To explore the diversity of mobile genetic elements (MGE) associated with archaea of the phylum Thaumarchaeota, we exploited the property of most MGE to integrate into the genomes of their hosts. Integrated MGE (iMGE) were identified in 20 thaumarchaeal genomes amounting to 2 Mbp of mobile thaumarchaeal DNA. These iMGE group into five major classes: (i) proviruses, (ii) casposons, (iii) insertion sequence-like transposons, (iv) integrative-conjugative elements, and (v) cryptic integrated elements. The majority of the iMGE belong to the latter category and might represent novel families of viruses or plasmids. The identified proviruses are related to tailed viruses of the order Caudovirales and to tailless icosahedral viruses with the double jelly-roll capsid proteins. The thaumarchaeal iMGE are all connected within a gene sharing network, highlighting pervasive gene exchange between MGE occupying the same ecological niche. The thaumarchaeal mobilome carries multiple auxiliary metabolic genes, including multicopper oxidases and ammonia monooxygenase subunit C, and stress response genes, such as those for universal stress response proteins (UspA). Thus, iMGE might make important contributions to the fitness and adaptation of their hosts. We identified several iMGE carrying type I-B CRISPR-Cas systems and spacers matching other thaumarchaeal iMGE, suggesting antagonistic interactions between coexisting MGE and symbiotic relationships with the hosts. This article is protected by copyright. All rights reserved.},
}
@article {pmid30770599,
year = {2019},
author = {Liu, CY and Wang, HC},
title = {The fibroblast of radicular cyst facilitate osteoclastogenesis via the autocrine of Fibronectin containing extra domain A.},
journal = {Oral diseases},
volume = {},
number = {},
pages = {},
doi = {10.1111/odi.13064},
pmid = {30770599},
issn = {1601-0825},
abstract = {OBJECTIVE: To investigate the alternative spliced isoforms of Fibronectin (FN) in the stroma of radicular cysts; and analyze the associations between these isoforms and the osteoclastogenic effects of fibroblasts.<br><br>METHODS AND MATERIALS: The specimens of radicular cysts were stained with immunohistochemistry, and the associations between each FN isoform and clinical parameters were assessed. The fibroblasts isolated from cysts or jaw bone were cultured to induce the Trap+MNCs. In the conditioned medium, the Fibronectin containing extra domain A (EDA+FN) were neutralized by antibody IST-9, and the EDA exon of fibroblasts were knockout by CRISPR/Cas system, for assessing the osteolastogenic effects. The mRNA level of FN isoforms and the osteoclastogenesis related genes were analyzed by quantitive PCR.<br><br>RESULTS: EDA+FN staining was positively associate with the size of the lesions (P<0.05). In contrast with the controls, the ratio of EDA+FN/total FN in the fibroblasts from radicular cysts was significantly higher (P<0.05), and positively associate with Trap+MNCs counting, it was consistent with increased expression of COX-2, IL-6, IL-17 and the RANKL/OPG (P<0.05). The Trap+MNCs counting and osteoclastogenesis related genes were decreased by IST-9 blocking and EDA exon knockout in fibroblasts, but the blockage of the interaction between EDA+FN and pre-osteoclasts exhibited little effects on Trap+MNCs formation.<br><br>CONCLUSION: The microenvironment of the fibrous capsule of radicular cysts facilitate the splicing of EDA exon, it endues EDA+FN with autocrine effects on fibroblast itself, and increases the expression of osteoclastogenesis related genes, by which the osteoclastogenesis in radicular cysts could be initiated. This article is protected by copyright. All rights reserved.},
}
@article {pmid30766726,
year = {2019},
author = {Goeckel, ME and Basgall, EM and Lewis, IC and Goetting, SC and Yan, Y and Halloran, M and Finnigan, GC},
title = {Modulating CRISPR gene drive activity through nucleocytoplasmic localization of Cas9 in S. cerevisiae.},
journal = {Fungal biology and biotechnology},
volume = {6},
number = {},
pages = {2},
doi = {10.1186/s40694-019-0065-x},
pmid = {30766726},
issn = {2054-3085},
support = {P20 GM103418/GM/NIGMS NIH HHS/United States ; },
abstract = {Background: The bacterial CRISPR/Cas genome editing system has provided a major breakthrough in molecular biology. One use of this technology is within a nuclease-based gene drive. This type of system can install a genetic element within a population at unnatural rates. Combatting of vector-borne diseases carried by metazoans could benefit from a delivery system that bypasses traditional Mendelian laws of segregation. Recently, laboratory studies in fungi, insects, and even mice, have demonstrated successful propagation of CRISPR gene drives and the potential utility of this type of mechanism. However, current gene drives still face challenges including evolved resistance, containment, and the consequences of application in wild populations. Additional research into molecular mechanisms that would allow for control, titration, and inhibition of drive systems is needed.<br><br>Results: In this study, we use artificial gene drives in budding yeast to explore mechanisms to modulate nuclease activity of Cas9 through its nucleocytoplasmic localization. We examine non-native nuclear localization sequences (both NLS and NES) on Cas9 fusion proteins in vivo through fluorescence microscopy and genomic editing. Our results demonstrate that mutational substitutions to nuclear signals and combinatorial fusions can both modulate the level of gene drive activity within a population of cells.<br><br>Conclusions: These findings have implications for control of traditional nuclease-dependent editing and use of gene drive systems within other organisms. For instance, initiation of a nuclear export mechanism to Cas9 could serve as a molecular safeguard within an active gene drive to reduce or eliminate editing.},
}
@article {pmid30763533,
year = {2019},
author = {Rostøl, JT and Marraffini, L},
title = {(Ph)ighting Phages: How Bacteria Resist Their Parasites.},
journal = {Cell host &amp; microbe},
volume = {25},
number = {2},
pages = {184-194},
doi = {10.1016/j.chom.2019.01.009},
pmid = {30763533},
issn = {1934-6069},
support = {DP1 GM128184/GM/NIGMS NIH HHS/United States ; },
abstract = {Bacteria are under constant attack from bacteriophages (phages), bacterial parasites that are the most abundant biological entity on earth. To resist phage infection, bacteria have evolved an impressive arsenal of anti-phage systems. Recent advances have significantly broadened and deepened our understanding of how bacteria battle phages, spearheaded by new systems like CRISPR-Cas. This review aims to summarize bacterial anti-phage mechanisms, with an emphasis on the most recent developments in the field.},
}
@article {pmid30762876,
year = {2019},
author = {Scaltriti, E and Carminati, D and Cortimiglia, C and Ramoni, R and Sørensen, KI and Giraffa, G and Zago, M},
title = {Survey on the CRISPR arrays in Lactobacillus helveticus genomes.},
journal = {Letters in applied microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/lam.13128},
pmid = {30762876},
issn = {1472-765X},
abstract = {Lactobacillus helveticus is a homofermentative thermophilic LAB that is mainly used in the manufacture of Swiss type and long-ripened Italian hard cheeses. In this study, the presence of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) were analysed in 25 L. helveticus genomes and identified in 23 of these genomes. A total of 40 CRISPR loci were identified and classified into five main families based on CRISPR repeats: Ldbu1, Lsal1, Lhel1, Lhel2 and a new repeat family named Lhel3. Spacers had a size between 30 and 40 bp whereas repeats have an average size of 30 bp, with three longer repeats. The analysis displayed the presence of conserved spacers in 23 out of the 40 CRISPR loci. A geographical distribution of L. helveticus isolates with similar CRISPR spacer array profiles were not observed. Based on the presence of the signature protein Cas3, all CRISPR loci belonged to Type I. This analysis demonstrated a great CRISPR array variability within L. helveticus, which could be a useful tool for genotypic strain differentiation. A next step will be to understand the possible role of CRISPR/Cas system for the resistance of L. helveticus to phage infection. This article is protected by copyright. All rights reserved.},
}
@article {pmid30761103,
year = {2019},
author = {Broecker, F and Moelling, K},
title = {Evolution of Immune Systems From Viruses and Transposable Elements.},
journal = {Frontiers in microbiology},
volume = {10},
number = {},
pages = {51},
doi = {10.3389/fmicb.2019.00051},
pmid = {30761103},
issn = {1664-302X},
abstract = {Virus-derived sequences and transposable elements constitute a substantial portion of many cellular genomes. Recent insights reveal the intimate evolutionary relationship between these sequences and various cellular immune pathways. At the most basic level, superinfection exclusion may be considered a prototypical virus-mediated immune system that has been described in both prokaryotes and eukaryotes. More complex immune mechanisms fully or partially derived from mobile genetic elements include CRISPR-Cas of prokaryotes and the RAG1/2 system of vertebrates, which provide immunological memory of foreign genetic elements and generate antibody and T cell receptor diversity, respectively. In this review, we summarize the current knowledge on the contribution of mobile genetic elements to the evolution of cellular immune pathways. A picture is emerging in which the various cellular immune systems originate from and are spread by viruses and transposable elements. Immune systems likely evolved from simple superinfection exclusion to highly complex defense strategies.},
}
@article {pmid30759237,
year = {2019},
author = {Dorsey, BW and Huang, L and Mondragón, A},
title = {Structural organization of a Type III-A CRISPR effector subcomplex determined by X-ray crystallography and cryo-EM.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gkz079},
pmid = {30759237},
issn = {1362-4962},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated Cas proteins provide an immune-like response in many prokaryotes against extraneous nucleic acids. CRISPR-Cas systems are classified into different classes and types. Class 1 CRISPR-Cas systems form multi-protein effector complexes that includes a guide RNA (crRNA) used to identify the target for destruction. Here we present crystal structures of Staphylococcus epidermidis Type III-A CRISPR subunits Csm2 and Csm3 and a 5.2 Å resolution single-particle cryo-electron microscopy (cryo-EM) reconstruction of an in vivo assembled effector subcomplex including the crRNA. The structures help to clarify the quaternary architecture of Type III-A effector complexes, and provide details on crRNA binding, target RNA binding and cleavage, and intermolecular interactions essential for effector complex assembly. The structures allow a better understanding of the organization of Type III-A CRISPR effector complexes as well as highlighting the overall similarities and differences with other Class 1 effector complexes.},
}
@article {pmid30755626,
year = {2019},
author = {Fernandes, LGV and Guaman, LP and Vasconcellos, SA and Heinemann, MB and Picardeau, M and Nascimento, ALTO},
title = {Gene silencing based on RNA-guided catalytically inactive Cas9 (dCas9): a new tool for genetic engineering in Leptospira.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {1839},
doi = {10.1038/s41598-018-37949-x},
pmid = {30755626},
issn = {2045-2322},
abstract = {Leptospirosis is a worldwide zoonosis caused by pathogenic bacteria of the genus Leptospira, which also includes free-living saprophyte strains. Many aspects of leptospiral basic biology and virulence mechanisms remain unexplored mainly due to the lack of effective genetic tools available for these bacteria. Recently, the type II CRISPR/Cas system from Streptococcus pyogenes has been widely used as an efficient genome engineering tool in bacteria by inducing double-strand breaks (DSBs) in the desired genomic targets caused by an RNA-guided DNA endonuclease called Cas9, and the DSB repair associated machinery. In the present work, plasmids expressing heterologous S. pyogenes Cas9 in L. biflexa cells were generated, and the enzyme could be expressed with no apparent toxicity to leptospiral cells. However, L. biflexa cells were unable to repair RNA-guided Cas9-induced DSBs. Thus, we used a catalytically dead Cas9 (dCas9) to obtain gene silencing rather than disruption, in a strategy called CRISPR interference (CRISPRi). We demonstrated complete gene silencing in L. biflexa cells when both dCas9 and single-guide RNA (sgRNA) targeting the coding strand of the β-galactosidase gene were expressed simultaneously. Furthermore, when the system was applied for silencing the dnaK gene, no colonies were recovered, indicating that DnaK protein is essential in Leptospira. In addition, flagellar motor switch FliG gene silencing resulted in reduced bacterial motility. To the best of our knowledge, this is the first work applying the CRISPRi system in Leptospira and spirochetes in general, expanding the tools available for understanding leptospiral biology.},
}
@article {pmid30745359,
year = {2019},
author = {Malfacini, D and Patt, J and Annala, S and Harpsøe, K and Eryilmaz, F and Reher, R and Crüsemann, M and Hanke, W and Zhang, H and Tietze, D and Gloriam, DE and Bräuner-Osborne, H and Strømgaard, K and König, GM and Inoue, A and Gomeza, J and Kostenis, E},
title = {Rational design of a heterotrimeric G protein α subunit with artificial inhibitor sensitivity.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.007250},
pmid = {30745359},
issn = {1083-351X},
abstract = {Transmembrane signals initiated by a range of extracellular stimuli converge on members of the Gq family of heterotrimeric G proteins, which relay these signals in target cells. Gq family G proteins comprise Gq, G11, G14, and G16, which upon activation mediate their cellular effects via inositol lipid-dependent and -independent signaling to control fundamental processes in mammalian physiology. To date, highly specific inhibition of Gq/11/14 signaling can be achieved only with FR900359 (FR) and YM-254890 (YM), two naturally occurring cyclic depsipeptides. To further development of FR or YM mimics for other Gα subunits, we here set out to rationally design Gα16 proteins with artificial FR/YM sensitivity by introducing an engineered depsipeptide binding site. Thereby we permit control of G16 function through ligands that are inactive on the wild type protein. Using CRISPR/Cas9-generated Gαq/Gα11-null cells and loss- and gain-of-function mutagenesis along with label-free whole-cell biosensing, we determined the molecular coordinates for FR/YM inhibition of Gq and transplanted these to FR/YM-insensitive G16. Intriguingly, despite having close structural similarity, FR and YM yielded biologically distinct activities: it was more difficult to perturb Gq inhibition by FR and easier to install FR inhibition onto G16 than perturb or install inhibition with YM. A unique hydrophobic network utilized by FR accounted for these unexpected discrepancies. Our results suggest that non-Gq/11/14 proteins should be amenable to inhibition by FR scaffold-based inhibitors, provided that these inhibitors mimic the interaction of FR with Gα proteins harboring engineered FR-binding sites.},
}
@article {pmid30742049,
year = {2019},
author = {McKenzie, RE and Almendros, C and Vink, JNA and Brouns, SJJ},
title = {Using CAPTURE to detect spacer acquisition in native CRISPR arrays.},
journal = {Nature protocols},
volume = {14},
number = {3},
pages = {976-990},
doi = {10.1038/s41596-018-0123-5},
pmid = {30742049},
issn = {1750-2799},
abstract = {CRISPR-Cas systems are able to acquire immunological memories (spacers) from bacteriophages and plasmids in order to survive infection; however, this often occurs at low frequency within a population, which can make it difficult to detect. Here we describe CAPTURE (CRISPR adaptation PCR technique using reamplification and electrophoresis), a versatile and adaptable protocol to detect spacer-acquisition events by electrophoresis imaging with high-enough sensitivity to identify spacer acquisition in 1 in 105 cells. Our method harnesses two simple PCR steps, separated by automated electrophoresis and extraction of size-selected DNA amplicons, thus allowing the removal of unexpanded arrays from the sample pool and enabling 1,000-times more sensitive detection of new spacers than alternative PCR protocols. CAPTURE is a straightforward method that requires only 1 d to enable the detection of spacer acquisition in all native CRISPR systems and facilitate studies aimed both at unraveling the mechanism of spacer integration and more sensitive tracing of integration events in natural ecosystems.},
}
@article {pmid30738385,
year = {2019},
author = {Emmert, AS and Vuong, SM and Shula, C and Lindquist, D and Yuan, W and Hu, YC and Mangano, FT and Goto, J},
title = {Characterization of a novel rat model of X-linked hydrocephalus by CRISPR-mediated mutation in L1cam.},
journal = {Journal of neurosurgery},
volume = {},
number = {},
pages = {1-14},
doi = {10.3171/2018.10.JNS181015},
pmid = {30738385},
issn = {1933-0693},
abstract = {OBJECTIVEEmergence of CRISPR/Cas9 genome editing provides a robust method for gene targeting in a variety of cell types, including fertilized rat embryos. The authors used this method to generate a transgenic rat L1cam knockout model of X-linked hydrocephalus (XLH) with human genetic etiology. The object of this study was to use diffusion tensor imaging (DTI) in studying perivascular white matter tract injury in the rat model and to characterize its pathological definition in histology.METHODSTwo guide RNAs designed to disrupt exon 4 of the L1cam gene on the X chromosome were injected into Sprague-Dawley rat embryos. Following embryo transfer into pseudopregnant females, rats were born and their DNA was sequenced for evidence of L1cam mutation. The mutant and control wild-type rats were monitored for growth and hydrocephalus phenotypes. Their macro- and microbrain structures were studied with T2-weighted MRI, DTI, immunohistochemistry, and transmission electron microscopy (TEM).RESULTSThe authors successfully obtained 2 independent L1cam knockout alleles and 1 missense mutant allele. Hemizygous male mutants from all 3 alleles developed hydrocephalus and delayed development. Significant reductions in fractional anisotropy and axial diffusivity were observed in the corpus callosum, external capsule, and internal capsule at 3 months of age. The mutant rats did not show reactive gliosis by then but exhibited hypomyelination and increased extracellular fluid in the corpus callosum.CONCLUSIONSThe CRISPR/Cas9-mediated genome editing system can be harnessed to efficiently disrupt the L1cam gene in rats for creation of a larger XLH animal model than previously available. This study provides evidence that the early pathology of the periventricular white matter tracts in hydrocephalus can be detected in DTI. Furthermore, TEM-based morphometric analysis of the corpus callosum elucidates the underlying cytopathological changes accompanying hydrocephalus-derived variations in DTI. The CRISPR/Cas9 system offers opportunities to explore novel surgical and imaging techniques on larger mammalian models.},
}
@article {pmid30737174,
year = {2019},
author = {Uribe, RV and van der Helm, E and Misiakou, MA and Lee, SW and Kol, S and Sommer, MOA},
title = {Discovery and Characterization of Cas9 Inhibitors Disseminated across Seven Bacterial Phyla.},
journal = {Cell host &amp; microbe},
volume = {25},
number = {2},
pages = {233-241.e5},
doi = {10.1016/j.chom.2019.01.003},
pmid = {30737174},
issn = {1934-6069},
abstract = {CRISPR-Cas systems in bacteria and archaea provide immunity against bacteriophages and plasmids. To overcome CRISPR immunity, phages have acquired anti-CRISPR genes that reduce CRISPR-Cas activity. Using a synthetic genetic circuit, we developed a high-throughput approach to discover anti-CRISPR genes from metagenomic libraries based on their functional activity rather than sequence homology or genetic context. We identified 11 DNA fragments from soil, animal, and human metagenomes that circumvent Streptococcus pyogenes Cas9 activity in our selection strain. Further in vivo and in vitro characterization of a subset of these hits validated the activity of four anti-CRISPRs. Notably, homologs of some of these anti-CRISPRs were detected in seven different phyla, namely Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, Cyanobacteria, Spirochaetes, and Balneolaeota, and have high sequence identity suggesting recent horizontal gene transfer. Thus, anti-CRISPRs against type II-A CRISPR-Cas systems are widely distributed across bacterial phyla, suggesting a more complex ecological role than previously appreciated.},
}
@article {pmid30735951,
year = {2019},
author = {Lee, HS and Lee, SH and Park, Y},
title = {Enhancement of androgen transcriptional activation assay based on genome edited glucocorticoid knock out human prostate cancer cell line.},
journal = {Environmental research},
volume = {171},
number = {},
pages = {437-443},
doi = {10.1016/j.envres.2019.01.027},
pmid = {30735951},
issn = {1096-0953},
abstract = {Endocrine-disrupting chemicals (EDCs) interfere with the biological activity of hormones. Among EDC's, (anti-)androgenic compounds potentially cause several androgen-related diseases. To improve the accuracy of an in vitro transactivation assay (TA) for detection of (anti-)androgenic compounds, We established the glucocorticoid receptor (GR) knockout 22Rv1/MMTV cell line by using an RNA-guided engineered nuclease (RGEN)-derived CRISPR/Cas system. The 22Rv1/MMTV GRKO cell line was characterized and validated by androgen receptor (AR)-mediated TA assay compared with the AR-TA assay using 22Rv1/MMTV. In conclusion, the AR-TA assay with the 22Rv1/MMTV GRKO cell line was more accurate, excluding the misleading signals derived from glucocorticoids or equivalent chemicals, and might be an effective method for screening potential (anti-)androgenic compounds.},
}
@article {pmid30733471,
year = {2019},
author = {Wang, J and Goh, KM and Salem, DR and Sani, RK},
title = {Genome analysis of a thermophilic exopolysaccharide-producing bacterium - Geobacillus sp. WSUCF1.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {1608},
doi = {10.1038/s41598-018-36983-z},
pmid = {30733471},
issn = {2045-2322},
support = {1736255//National Science Foundation (NSF)/ ; 1736255//National Science Foundation (NSF)/ ; },
abstract = {Geobacillus sp. WSUCF1 is a Gram-positive, spore-forming, aerobic and thermophilic bacterium, isolated from a soil sample obtained from a compost facility. Strain WSUCF1 demonstrated EPS producing capability using different sugars as the carbon source. The whole-genome analysis of WSUCF1 was performed to disclose the essential genes correlated with nucleotide sugar precursor biosynthesis, assembly of monosaccharide units, export of the polysaccharide chain, and regulation of EPS production. Both the biosynthesis pathway and export mechanism of EPS were proposed based on functional annotation. Additionally, the genome description of strain WSUCF1 suggests sophisticated systems for its adaptation under thermophilic conditions. The presence of genes associated with CRISPR-Cas system, quorum quenching lactonase, polyketide synthesis and arsenic resistance makes this strain a potential candidate for various applications in biotechnology and biomedicine. The present study indicates that strain WSUCF1 has promise as a thermophilic EPS producer for a broad range of industrial applications. To the best of our knowledge, this is the first report on genome analysis of a thermophilic Geobacillus species focusing on its EPS biosynthesis and transportation, which will likely pave the way for both enhanced yield and tailor-made EPS production by thermophilic bacteria.},
}
@article {pmid30731369,
year = {2019},
author = {Tang, B and Gong, T and Zhou, X and Lu, M and Zeng, J and Peng, X and Wang, S and Li, Y},
title = {Deletion of cas3 gene in Streptococcus mutans affects biofilm formation and increases fluoride sensitivity.},
journal = {Archives of oral biology},
volume = {99},
number = {},
pages = {190-197},
doi = {10.1016/j.archoralbio.2019.01.016},
pmid = {30731369},
issn = {1879-1506},
abstract = {OBJECTIVE: The goal of this study was to analyze the impact of cas3 gene on the biofilm formation and virulence gene expression in S. mutans, since our previous studies have found a connection between CRISPR/Cas systems and biofilm formation in S. mutans.<br><br>METHODS: The cas3 gene in-frame deletion strains of S. mutans UA159 was constructed by a two-step transformation procedure and the cas3 mutant strain was complemented in trans. The biofilm biomass was measured by crystal violet staining, and the synthesis of exopolysaccharides (EPS) was measured by the anthrone-sulfuric method. Biofilm analysis and structural imaging was using confocal laser scanning microscope (CLSM) and scanning electron microscope (SEM) assays. The fluorescence in situ hybridization (FISH) was used to analyze the spatiotemporal interactions between S. mutans and Streptococcus sanguinis. Fluoride sensitivity was determined using fluoride tolerance assays. The expression of biofilm formation related genes was evaluated by qRT-PCR.<br><br>RESULTS: Our results showed that S. mutans cas3 deletion strain formed less biofilm and became less competitive when it was co-cultured with S. sanguinis under fluoride treatment. The expression levels of virulence genes including vicR, gtfC, smu0630 and comDE were significantly downregulated.<br><br>CONCLUSIONS: The cas3 gene in S. mutans could regulate biofilm formation and fluoride resistance, consequently affecting S. mutans competitiveness in a dual-species biofilm model under fluoride treatment. These results also provide a potential strategy for enhancing fluoride specificity, with cas3 gene as a potential genetic target in the modulation of oral microecology and the treatment of dental caries.},
}
@article {pmid30730208,
year = {2019},
author = {Finkler, M and Ott, A},
title = {Bead-based assay for spatiotemporal gene expression control in cell-free transcription-translation systems.},
journal = {BioTechniques},
volume = {66},
number = {1},
pages = {29-33},
doi = {10.2144/btn-2018-0097},
pmid = {30730208},
issn = {1940-9818},
abstract = {Cell-free gene expression has applications in synthetic biology, biotechnology and biomedicine. In this technique gene expression regulation plays an important role. Transcription factors do not completely suppress expression while other methods for expression control, for example CRISPR/Cas, often require important biochemical modifications. Here we use an all Escherichia coli-based cell-free expression system and present a bead-based method to instantly start and, at a later stage, completely stop gene expression. Magnetic beads coated with DNA of the gene of interest trigger gene expression. The expression stops if we remove the bead-bound DNA as well as transcribed mRNA by hybridization to bead-bound ssDNA. Our method is a simple way to control expression duration very accurately in time and space.},
}
@article {pmid30724156,
year = {2019},
author = {Xue, C and Sashital, DG},
title = {Mechanisms of Type I-E and I-F CRISPR-Cas Systems in Enterobacteriaceae.},
journal = {EcoSal Plus},
volume = {8},
number = {2},
pages = {},
doi = {10.1128/ecosalplus.ESP-0008-2018},
pmid = {30724156},
issn = {2324-6200},
support = {R01 GM115874/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas systems provide bacteria and archaea with adaptive immunity against invasion by bacteriophages and other mobile genetic elements. Short fragments of invader DNA are stored as immunological memories within CRISPR (clustered regularly interspaced short palindromic repeat) arrays in the host chromosome. These arrays provide a template for RNA molecules that can guide CRISPR-associated (Cas) proteins to specifically neutralize viruses upon subsequent infection. Over the past 10 years, our understanding of CRISPR-Cas systems has benefited greatly from a number of model organisms. In particular, the study of several members of the Gram-negative Enterobacteriaceae family, especially Escherichia coli and Pectobacterium atrosepticum, have provided significant insights into the mechanisms of CRISPR-Cas immunity. In this review, we provide an overview of CRISPR-Cas systems present in members of the Enterobacteriaceae. We also detail the current mechanistic understanding of the type I-E and type I-F CRISPR-Cas systems that are commonly found in enterobacteria. Finally, we discuss how phages can escape or inactivate CRISPR-Cas systems and the measures bacteria can enact to counter these types of events.},
}
@article {pmid30722720,
year = {2019},
author = {Common, J and Westra, ER},
title = {CRISPR evolution and bacteriophage persistence in the context of population bottlenecks.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-7},
doi = {10.1080/15476286.2019.1578608},
pmid = {30722720},
issn = {1555-8584},
abstract = {Population bottlenecks often cause strong reductions in genetic diversity and alter population structure. In the context of host-parasite interactions, bottlenecks could in theory benefit either the host or the pathogen. We predicted that bottlenecking of bacterial populations that evolve CRISPR immunity against bacteriophages (phage) would benefit the pathogen, because CRISPR spacer diversity can rapidly drive phages extinct. To test this, we bottlenecked populations of bacteria and phage, tracking phage persistence and the evolution of bacterial resistance mechanisms. Contrary to our prediction, bottlenecking worked in the advantage of the host. With some possible exceptions, this effect was not caused by CRISPR immunity. This host benefit is consistent with a dilution effect disproportionately affecting phage. This study provides further insight into how bottlenecking influences bacteria-phage dynamics, the role of dilution in bacteria-phage interactions, and the evolution of host immune systems.},
}
@article {pmid30717668,
year = {2019},
author = {McDonald, ND and Regmi, A and Morreale, DP and Borowski, JD and Boyd, EF},
title = {CRISPR-Cas systems are present predominantly on mobile genetic elements in Vibrio species.},
journal = {BMC genomics},
volume = {20},
number = {1},
pages = {105},
doi = {10.1186/s12864-019-5439-1},
pmid = {30717668},
issn = {1471-2164},
support = {IOS-1656688//National Science Foundation/ ; 5T32GM008550//National Institutes of Health/ ; P20GM103446//National Institutes of Health/ ; },
abstract = {BACKGROUND: Bacteria are prey for many viruses that hijack the bacterial cell in order to propagate, which can result in bacterial cell lysis and death. Bacteria have developed diverse strategies to counteract virus predation, one of which is the clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR associated (Cas) proteins immune defense system. Species within the bacterial family Vibrionaceae are marine organisms that encounter large numbers of phages. Our goal was to determine the significance of CRISPR-Cas systems as a mechanism of defense in this group by investigating their prevalence, phylogenetic distribution, and genome context.<br><br>RESULTS: Herein, we describe all the CRISPR-Cas system types and their distribution within the family Vibrionaceae. In Vibrio cholerae genomes, we identified multiple variant type I-F systems, which were also present in 41 additional species. In a large number of Vibrio species, we identified a mini type I-F system comprised of tniQcas5cas7cas6f, which was always associated with Tn7-like transposons. The Tn7-like elements, in addition to the CRISPR-Cas system, also contained additional cargo genes such as restriction modification systems and type three secretion systems. A putative hybrid CRISPR-Cas system was identified containing type III-B genes followed by a type I-F cas6f and a type I-F CRISPR that was associated with a prophage in V. cholerae and V. metoecus strains. Our analysis identified CRISPR-Cas types I-C, I-E, I-F, II-B, III-A, III-B, III-D, and the rare type IV systems as well as cas loci architectural variants among 70 species. All systems described contained a CRISPR array that ranged in size from 3 to 179 spacers. The systems identified were present predominantly within mobile genetic elements (MGEs) such as genomic islands, plasmids, and transposon-like elements. Phylogenetic analysis of Cas proteins indicated that the CRISPR-Cas systems were acquired by horizontal gene transfer.<br><br>CONCLUSIONS: Our data show that CRISPR-Cas systems are phylogenetically widespread but sporadic in occurrence, actively evolving, and present on MGEs within Vibrionaceae.},
}
@article {pmid30715580,
year = {2019},
author = {Pérez, L and Soto, E and Farré, G and Juanos, J and Villorbina, G and Bassie, L and Medina, V and Serrato, AJ and Sahrawy, M and Rojas, JA and Romagosa, I and Muñoz, P and Zhu, C and Christou, P},
title = {CRISPR/Cas9 mutations in the rice Waxy/GBSSI gene induce allele-specific and zygosity-dependent feedback effects on endosperm starch biosynthesis.},
journal = {Plant cell reports},
volume = {38},
number = {3},
pages = {417-433},
doi = {10.1007/s00299-019-02388-z},
pmid = {30715580},
issn = {1432-203X},
support = {BIO2014-54426//Ministerio de Economía y Competitividad/ ; IJCI- 2014-19528//Ministerio de Ciencia e Innovación/ ; BIO2014-54441-P//Universitat de Lleida/ ; },
mesh = {Alleles ; CRISPR-Cas Systems/genetics ; Endosperm/metabolism ; Mutation/genetics ; Oryza/genetics/*metabolism ; Starch Synthase/genetics/*metabolism ; Waxes/metabolism ; },
abstract = {KEY MESSAGE: Induced mutations in the waxy locus in rice endosperm did not abolish GBSS activity completely. Compensatory mechanisms in endosperm and leaves caused a major reprogramming of the starch biosynthetic machinery. The mutation of genes in the starch biosynthesis pathway has a profound effect on starch quality and quantity and is an important target for plant breeders. Mutations in endosperm starch biosynthetic genes may impact starch metabolism in vegetative tissues such as leaves in unexpected ways due to the complex feedback mechanisms regulating the pathway. Surprisingly this aspect of global starch metabolism has received little attention. We used CRISPR/Cas9 to introduce mutations affecting the Waxy (Wx) locus encoding granule-bound starch synthase I (GBSSI) in rice endosperm. Our specific objective was to develop a mechanistic understanding of how the endogenous starch biosynthetic machinery might be affected at the transcriptional level following the targeted knock out of GBSSI in the endosperm. We found that the mutations reduced but did not abolish GBSS activity in seeds due to partial compensation caused by the upregulation of GBSSII. The GBSS activity in the mutants was 61-71% of wild-type levels, similarly to two irradiation mutants, but the amylose content declined to 8-12% in heterozygous seeds and to as low as 5% in homozygous seeds, accompanied by abnormal cellular organization in the aleurone layer and amorphous starch grain structures. Expression of many other starch biosynthetic genes was modulated in seeds and leaves. This modulation of gene expression resulted in changes in AGPase and sucrose synthase activity that explained the corresponding levels of starch and soluble sugars.},
}
@article {pmid30714208,
year = {2019},
author = {Nasseri, S and Nikkho, B and Parsa, S and Ebadifar, A and Soleimani, F and Rahimi, K and Vahabzadeh, Z and Khadem-Erfan, MB and Rostamzadeh, J and Baban, B and Banafshi, O and Assadollahi, V and Mirzaie, S and Fathi, F},
title = {Generation of Fam83h knockout mice by CRISPR/Cas9-mediated gene engineering.},
journal = {Journal of cellular biochemistry},
volume = {},
number = {},
pages = {},
doi = {10.1002/jcb.28381},
pmid = {30714208},
issn = {1097-4644},
support = {//Medical University of Kurdistan/ ; //Kurdistan University of Medical Sciences/ ; },
abstract = {Family with sequence similarity 83 member H (FAM83H) protein-coding geneplay an essential role in the structural organization, calcification of developing enamel, and keratin cytoskeleton disassembly by recruiting Casein kinase 1 alpha (CSNK1A1) to keratin filaments. In this study, we have applied CRISPR Cas9 nickase (D10A) to knockout (KO) the Fam83h gene in NMRI outbred mice. We generated homozygous Fam83h KO mice (Fam83h Ko/Ko) through a premature termination codon, which was validated by Sanger sequencing in F0 generation. Next, we also bred the FAM83H KO for two generations. Reverse-transcription polymerase chain reaction and Western blot analysis approved the Fam83h KO mice. The Fam83h KO mice had evidence of normal morphology at the cervical loops, secretory and maturation stages, and mandibular molars. In comparison with the normal wild-type mice (Fam83h W/W), the F2 homozygous KO (Fam83h Ko/Ko) had sparse, scruffy coats with small body size and decreased general activity. Also, they had the natural reproductive ability and natural lifespan. In addition, delay in opening the eyes and dry eyes among infant mice were seen. The F1 heterozygous mice looked comparable to the normal wild-type mice (Fam83h W/W), which showed autosomal recessive inheritance of these phenotypes. The KO of FAM83H had controversial effects on the development of teeth and the formation of enamel. The phenotype defect in dental development and the enamel formation were seen in three mice among four generations. It can be concluded that null FAM83H in outbred mice not only showed the reported phenotypes in null inbred mouse but also showed normal lifespan and reproductive ability; dental deficiency in three homozygous mice; and the symptoms that were similar to the symptoms of dry eye syndrome and curly coat dog syndrome in all four evaluated KO generations.},
}
@article {pmid30712070,
year = {2019},
author = {Wang, X and Liu, X and Dong, R and Liang, C and Reichenberger, EJ and Hu, Y},
title = {Genetic Disruption of Anoctamin 5 in Mice Replicates Human Gnathodiaphyseal Dysplasia (GDD).},
journal = {Calcified tissue international},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00223-019-00528-x},
pmid = {30712070},
issn = {1432-0827},
support = {81570958//National Natural Science Foundation of China/ ; 7162075//Natural Science Foundation of Beijing Municipality (CN)/ ; 2013-3-036//High-level Talents of Beijing Health System/ ; 2015-1098//Scientific Foundation for the Returned Overseas Chinese Scholars, State Education Ministry/ ; },
abstract = {Gnathodiaphyseal dysplasia (GDD; OMIM#166260) is a rare skeletal disorder which is mainly characterized by cemento-osseous lesions in mandibles, bone fragility, bowing and diaphyseal sclerosis of tubular bones. GDD is caused by point mutations in Anoctamin-5 (ANO5); however, the disease mechanisms remain unclear. Here we generated Ano5-knockout (KO) mice using a CRISPR/Cas 9 approach to study loss of function aspects of GDD mutations. Homozygous Ano5 knockout mice (Ano5-/-) replicate some typical traits of human GDD including massive jawbones, bowing tibia, sclerosis and cortical thickening of femoral and tibial diaphyses. Serum alkaline phosphatase (ALP) levels were elevated in Ano5-/- mice as in GDD patients. Calvaria-derived Ano5-/- osteoblast cultures show increased osteoblastogenesis, which is consistent with our previous in vitro observations. Bone matrix is hypermineralized, and the expression of bone formation-related factors is enhanced in Ano5-/- mice, suggesting that the osteogenic anomaly arises from a genetic disruption of Ano5. We believe this new mouse model will shed more light on the development of skeletal abnormalities in GDD on a cellular and molecular level.},
}
@article {pmid30710419,
year = {2019},
author = {Cunningham-Bryant, D and Sun, J and Fernandez, B and Zalatan, J},
title = {CRISPR-Cas-Mediated Chemical Control of Transcriptional Dynamics in Yeast.},
journal = {Chembiochem : a European journal of chemical biology},
volume = {},
number = {},
pages = {},
doi = {10.1002/cbic.201800823},
pmid = {30710419},
issn = {1439-7633},
abstract = {Synthetic CRISPR-Cas transcription factors enable the construction of complex gene expression programs, and chemically-inducible systems allow precise control over the expression dynamics. To provide additional modes of regulatory control, we have constructed a chemically-inducible CRISPR activation (CRISPRa) system in yeast that is mediated by recruitment to MS2-functionalized guide RNAs. We use reporter gene assays to systematically map the dose-dependence, time-dependence, and reversibility of the system. Because the recruitment function is encoded at the level of the guide RNA, it is straightforward to target multiple genes and independently regulate expression dynamics at individual targets. This approach provides a new method to engineer sophisticated, multi-gene programs with precise control over the dynamics of gene expression.},
}
@article {pmid30710124,
year = {2019},
author = {Conklin, BR},
title = {On the road to a gene drive in mammals.},
journal = {Nature},
volume = {566},
number = {7742},
pages = {43-45},
doi = {10.1038/d41586-019-00185-y},
pmid = {30710124},
issn = {1476-4687},
mesh = {Animals ; Automobile Driving ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Female ; *Gene Drive Technology ; Mammals ; Mice ; },
}
@article {pmid30709780,
year = {2019},
author = {Heler, R and Wright, AV and Vucelja, M and Doudna, JA and Marraffini, LA},
title = {Spacer Acquisition Rates Determine the Immunological Diversity of the Type II CRISPR-Cas Immune Response.},
journal = {Cell host &amp; microbe},
volume = {25},
number = {2},
pages = {242-249.e3},
doi = {10.1016/j.chom.2018.12.016},
pmid = {30709780},
issn = {1934-6069},
abstract = {CRISPR-Cas systems provide acquired immunity in prokaryotes. Upon infection, short sequences from the phage genome, known as spacers, are inserted between the CRISPR repeats. Spacers are transcribed into small RNA molecules that guide nucleases to their targets. The forces that shape the distribution of newly acquired spacers, which is observed to be uneven, are poorly understood. We studied the spacer patterns that arise after phage infection of Staphylococcus aureus harboring the Streptococcus pyogenes type II-A CRISPR-Cas system. We observed that spacer patterns are established early during the CRISPR-Cas immune response and correlate with spacer acquisition rates, but not with spacer targeting efficiency. The rate of spacer acquisition depended on sequence elements within the spacer, which in turn determined the abundance of different spacers within the adapted population. Our results reveal how the two main forces of the CRISPR-Cas immune response, acquisition and targeting, affect the generation of immunological diversity.},
}
@article {pmid30709766,
year = {2019},
author = {Kumar, S and Dangi, AK and Shukla, P and Baishya, D and Khare, SK},
title = {Thermozymes: Adaptive strategies and tools for their biotechnological applications.},
journal = {Bioresource technology},
volume = {278},
number = {},
pages = {372-382},
doi = {10.1016/j.biortech.2019.01.088},
pmid = {30709766},
issn = {1873-2976},
abstract = {In today's scenario of global climate change, there is a colossal demand for sustainable industrial processes and enzymes from thermophiles. Plausibly, thermozymes are an important toolkit, as they are known to be polyextremophilic in nature. Small genome size and diverse molecular conformational modifications have been implicated in devising adaptive strategies. Besides, the utilization of chemical technology and gene editing attributions according to mechanical necessities are the additional key factor for efficacious bioprocess development. Microbial thermozymes have been extensively used in waste management, biofuel, food, paper, detergent, medicinal and pharmaceutical industries. To understand the strength of enzymes at higher temperatures different models utilize X-ray structures of thermostable proteins, machine learning calculations, neural networks, but unified adaptive measures are yet to be totally comprehended. The present review provides a recent updates on thermozymes and various interdisciplinary applications including the aspects of thermophiles bioengineering utilizing synthetic biology and gene editing tools.},
}
@article {pmid30709710,
year = {2019},
author = {Wright, AV and Wang, JY and Burstein, D and Harrington, LB and Paez-Espino, D and Kyrpides, NC and Iavarone, AT and Banfield, JF and Doudna, JA},
title = {A Functional Mini-Integrase in a Two-Protein-type V-C CRISPR System.},
journal = {Molecular cell},
volume = {73},
number = {4},
pages = {727-737.e3},
doi = {10.1016/j.molcel.2018.12.015},
pmid = {30709710},
issn = {1097-4164},
support = {//Howard Hughes Medical Institute/United States ; S10 OD018174/OD/NIH HHS/United States ; S10 OD020062/OD/NIH HHS/United States ; },
abstract = {CRISPR-Cas immunity requires integration of short, foreign DNA fragments into the host genome at the CRISPR locus, a site consisting of alternating repeat sequences and foreign-derived spacers. In most CRISPR systems, the proteins Cas1 and Cas2 form the integration complex and are both essential for DNA acquisition. Most type V-C and V-D systems lack the cas2 gene and have unusually short CRISPR repeats and spacers. Here, we show that a mini-integrase comprising the type V-C Cas1 protein alone catalyzes DNA integration with a preference for short (17- to 19-base-pair) DNA fragments. The mini-integrase has weak specificity for the CRISPR array. We present evidence that the Cas1 proteins form a tetramer for integration. Our findings support a model of a minimal integrase with an internal ruler mechanism that favors shorter repeats and spacers. This minimal integrase may represent the function of the ancestral Cas1 prior to Cas2 adoption.},
}
@article {pmid30706492,
year = {2019},
author = {Khumsupan, P and Donovan, S and McCormick, AJ},
title = {CRISPR/Cas in Arabidopsis: overcoming challenges to accelerate improvements in crop photosynthetic efficiencies.},
journal = {Physiologia plantarum},
volume = {},
number = {},
pages = {},
doi = {10.1111/ppl.12937},
pmid = {30706492},
issn = {1399-3054},
support = {//UK Biotechnology and Biological Sciences Research Council East of Scotland Bioscience Doctoral Training Partnership/ ; //Darwin Trust of Edinburgh/ ; },
abstract = {The rapid and widespread adoption of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas technologies has allowed genetic editing in plants to enter a revolutionary new era. In this mini review, we highlight the current CRISPR/Cas tools available in plants and the use of Arabidopsis thaliana as a model to guide future improvements in crop yields, such as enhancing photosynthetic potential. We also outline the current socio-political landscape for CRISPR/Cas research and highlight the growing need for governments to better facilitate research into plant genetic-editing technologies.},
}
@article {pmid30706388,
year = {2019},
author = {Sandoval, IM and Collier, TJ and Manfredsson, FP},
title = {Design and Assembly of CRISPR/Cas9 Lentiviral and rAAV Vectors for Targeted Genome Editing.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1937},
number = {},
pages = {29-45},
doi = {10.1007/978-1-4939-9065-8_2},
pmid = {30706388},
issn = {1940-6029},
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR/Cas) system has emerged as an extremely useful tool for biological research and as a potential technology for gene therapy approaches. CRISPR/Cas mediated genome editing can be used to easily and efficiently modify endogenous genes in a large variety of cells and organisms. Furthermore, a modified version of the Cas9 nuclease has been developed that can be used for regulation of endogenous gene expression and labeling of genomic loci, among other applications. This chapter provides an introduction to the basis of the technology and a detail protocol for the most classic application: gene inactivation by CRISPR/Cas9 nuclease system from Streptococcus pyogenes. This workflow can be easily adapted for other CRISPR systems and applications.},
}
@article {pmid30705275,
year = {2019},
author = {Zhang, W and Ding, W and Li, YX and Tam, C and Bougouffa, S and Wang, R and Pei, B and Chiang, H and Leung, P and Lu, Y and Sun, J and Fu, H and Bajic, VB and Liu, H and Webster, NS and Qian, PY},
title = {Marine biofilms constitute a bank of hidden microbial diversity and functional potential.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {517},
doi = {10.1038/s41467-019-08463-z},
pmid = {30705275},
issn = {2041-1723},
abstract = {Recent big data analyses have illuminated marine microbial diversity from a global perspective, focusing on planktonic microorganisms. Here, we analyze 2.5 terabases of newly sequenced datasets and the Tara Oceans metagenomes to study the diversity of biofilm-forming marine microorganisms. We identify more than 7,300 biofilm-forming 'species' that are undetected in seawater analyses, increasing the known microbial diversity in the oceans by more than 20%, and provide evidence for differentiation across oceanic niches. Generation of a gene distribution profile reveals a functional core across the biofilms, comprised of genes from a variety of microbial phyla that may play roles in stress responses and microbe-microbe interactions. Analysis of 479 genomes reconstructed from the biofilm metagenomes reveals novel biosynthetic gene clusters and CRISPR-Cas systems. Our data highlight the previously underestimated ocean microbial diversity, and allow mining novel microbial lineages and gene resources.},
}
@article {pmid30705093,
year = {2019},
author = {Bourkas, MEC and Arshad, H and Al-Azzawi, ZAM and Halgas, O and Shikiya, RA and Mehrabian, M and Schmitt-Ulms, G and Bartz, JC and Watts, JC},
title = {Engineering a murine cell line for the stable propagation of hamster prions.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.007135},
pmid = {30705093},
issn = {1083-351X},
abstract = {Prions are infectious protein aggregates that cause several fatal neurodegenerative diseases. Prion research has been hindered by a lack of cellular paradigms for studying the replication of prions from different species. Although hamster prions have been widely used to study prion replication in animals and within in vitro amplification systems, they have proven challenging to propagate in cultured cells. Since the murine catecholaminergic cell line CAD5 is susceptible to a diverse range of mouse prion strains, we hypothesized that it might also be capable of propagating non-mouse prions. Here, using CRISPR/Cas9-mediated genome engineering, we demonstrate that CAD5 cells lacking endogenous mouse PrP expression (CAD5-PrP-/- cells) can be chronically infected with hamster prions following stable expression of hamster PrP. When exposed to the 263K, HY, or 139H hamster prion strains, these cells stably propagated high levels of protease-resistant PrP. Hamster prion replication required absence of mouse PrP, and hamster PrP inhibited the propagation of mouse prions. Cellular homogenates from 263K-infected cells exhibited prion seeding activity in the RT-QuIC assay and were infectious to naïve cells expressing hamster PrP. Interestingly, murine N2a neuroblastoma cells ablated for endogenous PrP expression were susceptible to mouse prions, but not hamster prions upon expression of cognate PrP, suggesting that CAD5 cells either possess cellular factors that enhance or lack factors that restrict the diversity of prion strains that can be propagated. We conclude that transfected CAD5-PrP-/- cells may be a useful tool for assessing the biology of prion strains and dissecting the mechanism of prion replication.},
}
@article {pmid30700876,
year = {2019},
author = {Braun, M and Meacham, D},
title = {UN could lead debate on gene editing.},
journal = {Nature},
volume = {565},
number = {7741},
pages = {567},
doi = {10.1038/d41586-019-00324-5},
pmid = {30700876},
issn = {1476-4687},
mesh = {*CRISPR-Cas Systems ; *Gene Editing ; Genome, Human ; Humans ; United Nations ; },
}
@article {pmid30699972,
year = {2019},
author = {Hadidi, A},
title = {Next-Generation Sequencing and CRISPR/Cas13 Editing in Viroid Research and Molecular Diagnostics.},
journal = {Viruses},
volume = {11},
number = {2},
pages = {},
doi = {10.3390/v11020120},
pmid = {30699972},
issn = {1999-4915},
abstract = {Viroid discovery as well as the economic significance of viroids and biological properties are presented. Next-generation sequencing (NGS) technologies combined with informatics have been applied to viroid research and diagnostics for almost a decade. NGS provides highly efficient, rapid, low-cost high-throughput sequencing of viroid genomes and of the 21⁻24 nt vd-sRNAs generated by the RNA silencing defense of the host. NGS has been utilized in various viroid studies which are presented. The discovery during the last few years that prokaryotes have heritable adaptive immunity mediated through clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated Cas proteins, have led to transformative advances in molecular biology, notably genome engineering and most recently molecular diagnostics. The potential application of the CRISPR-Cas13a system for engineering viroid interference in plants is suggested by targeting specific motifs of three economically important viroids. The CRISPR-Cas13 system has been utilized recently for the accurate detection of human RNA viruses by visual read out in 90 min or less and by paper-based assay. Multitarget RNA tests by this technology have a good potential for application as a rapid and accurate diagnostic assay for known viroids. The CRISPR/Cas system will work only for known viroids in contrast to NGS, but it should be much faster.},
}
@article {pmid30698726,
year = {2019},
author = {Heitzeneder, S and Sotillo, E and Shern, JF and Sindiri, S and Xu, P and Jones, R and Pollak, M and Noer, PR and Lorette, J and Fazli, L and Alag, A and Meltzer, P and Lau, C and Conover, CA and Oxvig, C and Sorensen, PH and Maris, JM and Khan, J and Mackall, CL},
title = {Pregnancy-Associated Plasma Protein-A (PAPP-A) in Ewing Sarcoma: Role in Tumor Growth and Immune Evasion.},
journal = {Journal of the National Cancer Institute},
volume = {},
number = {},
pages = {},
doi = {10.1093/jnci/djy209},
pmid = {30698726},
issn = {1460-2105},
abstract = {Background: Ewing sarcoma (EWS) manifests one of the lowest somatic mutation rates of any cancer, leading to a scarcity of druggable mutations and neoantigens. Immunotherapeutics targeting differentially expressed cell surface antigens could provide therapeutic benefit for such tumors. Pregnancy-associated plasma protein A (PAPP-A) is a cell membrane-associated proteinase produced by the placenta that promotes fetal growth by inducing insulinlike growth factor (IGF) signaling.<br><br>Methods: By comparing RNA expression of cell surface proteins in EWS (n = 120) versus normal tissues (n = 42), we comprehensively characterized the surfaceome of EWS to identify highly differentially expressed molecules. Using CRISPR/Cas-9 and anti-PAPP-A antibodies, we investigated biological roles for PAPP-A in EWS in vitro and in vivo in NSG xenograft models and performed RNA-sequencing on PAPPA knockout clones (n = 5) and controls (n = 3). All statistical tests were two-sided.<br><br>Results: EWS surfaceome analysis identified 11 highly differentially overexpressed genes, with PAPPA ranking second in differential expression. In EWS cell lines, genetic knockout of PAPPA and treatment with anti-PAPP-A antibodies revealed an essential survival role by regulating local IGF-1 bioavailability. MAb-mediated PAPPA inhibition diminished EWS growth in orthotopic xenografts (leg area mm2 at day 49 IgG2a control (CTRL) [n = 14], mean = 397.0, SD = 86.1 vs anti-PAPP-A [n = 14], mean = 311.7, SD = 155.0; P = .03; median OS anti-PAPP-A = 52.5 days, 95% CI = 46.0 to 63.0 days vs IgG2a = 45.0 days, 95% CI = 42.0 to 52.0 days; P = .02) and improved the efficacy of anti-IGF-1R treatment (leg area mm2 at day 49 anti-PAPP-A + anti-IGF-1R [n = 15], mean = 217.9, SD = 148.5 vs IgG2a-CTRL; P < .001; median OS anti-PAPP-A + anti-IGF1R = 63.0 days, 95% CI = 52.0 to 67.0 days vs IgG2a-CTRL; P < .001). Unexpectedly, PAPPA knockout in EWS cell lines induced interferon (IFN)-response genes, including proteins associated with antigen processing/presentation. Consistently, gene expression profiles in PAPPA-low EWS tumors were enriched for immune response pathways.<br><br>Conclusion: This work provides a comprehensive characterization of the surfaceome of EWS, credentials PAPP-A as a highly differentially expressed therapeutic target, and discovers a novel link between IGF-1 signaling and immune evasion in cancer, thus implicating shared mechanisms of immune evasion between EWS and the placenta.},
}
@article {pmid30697727,
year = {2019},
author = {Karimian, A and Azizian, K and Parsian, H and Rafieian, S and Shafiei-Irannejad, V and Kheyrollah, M and Yousefi, M and Majidinia, M and Yousefi, B},
title = {CRISPR/Cas9 technology as a potent molecular tool for gene therapy.},
journal = {Journal of cellular physiology},
volume = {},
number = {},
pages = {},
doi = {10.1002/jcp.27972},
pmid = {30697727},
issn = {1097-4652},
abstract = {Clustered regularly interspaced short palindromic repeats/CRISPR-associated nuclease 9 (CRISPR-Cas9) is an RNA-guided gene editing tool which offers several advantageous characteristics in comparison with the conventional methods (e.g., zinc finger nucleases and transcription activator-like effector nucleases) such as cost-effectiveness, flexibility, and being easy-to-use. Despite some limitations such as efficient delivery and safety, CRISPR-Cas9 is still the most convenient tool for gene editing purposes. Due to the potential capability of the CRISPR-Cas9 system in genome editing and correction of casual mutations, it can be considered as a possible therapeutic system in the treatment of disorders associated with the genome mutations and in particular cancer treatment. In this review, we will discuss CRISPR-Cas-based gene editing along with its classifications and mechanism of action. Furthermore, the therapeutic application of the CRISPR-Cas9 system in mutational disorders, delivery systems, as well as its advantages and limitations with a special emphasis on cancer treatment will be discussed.},
}
@article {pmid30696428,
year = {2019},
author = {Cho, EY and Ryu, JY and Lee, HAR and Hong, SH and Park, HS and Hong, KS and Park, SG and Kim, HP and Yoon, TJ},
title = {Lecithin nano-liposomal particle as a CRISPR/Cas9 complex delivery system for treating type 2 diabetes.},
journal = {Journal of nanobiotechnology},
volume = {17},
number = {1},
pages = {19},
doi = {10.1186/s12951-019-0452-8},
pmid = {30696428},
issn = {1477-3155},
abstract = {BACKGROUND: Protein-based Cas9 in vivo gene editing therapeutics have practical limitations owing to their instability and low efficacy. To overcome these obstacles and improve stability, we designed a nanocarrier primarily consisting of lecithin that can efficiently target liver disease and encapsulate complexes of Cas9 with a single-stranded guide RNA (sgRNA) ribonucleoprotein (Cas9-RNP) through polymer fusion self-assembly.<br><br>RESULTS: In this study, we optimized an sgRNA sequence specifically for dipeptidyl peptidase-4 gene (DPP-4) to modulate the function of glucagon-like peptide 1. We then injected our nanocarrier Cas9-RNP complexes directly into type 2 diabetes mellitus (T2DM) db/db mice, which disrupted the expression of DPP-4 gene in T2DM mice with remarkable efficacy. The decline in DPP-4 enzyme activity was also accompanied by normalized blood glucose levels, insulin response, and reduced liver and kidney damage. These outcomes were found to be similar to those of sitagliptin, the current chemical DPP-4 inhibition therapy drug which requires recurrent doses.<br><br>CONCLUSIONS: Our results demonstrate that a nano-liposomal carrier system with therapeutic Cas9-RNP has great potential as a platform to improve genomic editing therapies for human liver diseases.},
}
@article {pmid30693619,
year = {2019},
author = {Nedorezova, DD and Fakhardo, AF and Nemirich, DV and Bryushkova, EA and Kolpashchikov, DM},
title = {Towards DNA Nanomachines for Cancer Treatment: Achieving Selective and Efficient Cleavage of Folded RNA.},
journal = {Angewandte Chemie (International ed. in English)},
volume = {},
number = {},
pages = {},
doi = {10.1002/anie.201900829},
pmid = {30693619},
issn = {1521-3773},
support = {08-08//Government Council on Grants, Russian Federation/ ; CBET 1706802//National science foundation/ ; CCF 1423219//National Science Foundation/ ; 18-34-00898//Russian Foundation for Basic Research/ ; },
abstract = {Despite decades of effort, gene therapy (GT) has failed to deliver clinically significant anticancer treatment, owing in part to low selectivity, low efficiency, and poor accessibility of folded RNA targets. Herein, we propose to solve these common problems of GT agents by using a DNA nanotechnology approach. We designed a deoxyribozyme-based DNA machine that can i) recognize the sequence of a cancer biomarker with high selectivity, ii) tightly bind a structured fragment of a housekeeping gene mRNA, and iii) cleave it with efficiency greater than that of a traditional DZ-based cleaving agent. An important advantage of the DNA nanomachine over other gene therapy approaches (antisense, siRNA, and CRISPR/cas) is its ability to cleave a housekeeping gene mRNA after being activated by a cancer marker RNA, which can potentially increase the efficiency of anticancer gene therapy. The DNA machine could become a prototype platform for a new type of anticancer GT agent.},
}
@article {pmid30693009,
year = {2018},
author = {Metje-Sprink, J and Menz, J and Modrzejewski, D and Sprink, T},
title = {DNA-Free Genome Editing: Past, Present and Future.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1957},
doi = {10.3389/fpls.2018.01957},
pmid = {30693009},
issn = {1664-462X},
abstract = {Genome Editing using engineered endonuclease (GEEN) systems rapidly took over the field of plant science and plant breeding. So far, Genome Editing techniques have been applied in more than fifty different plants; including model species like Arabidopsis; main crops like rice, maize or wheat as well as economically less important crops like strawberry, peanut and cucumber. These techniques have been used for basic research as proof-of-concept or to investigate gene functions in most of its applications. However, several market-oriented traits have been addressed including enhanced agronomic characteristics, improved food and feed quality, increased tolerance to abiotic and biotic stress and herbicide tolerance. These technologies are evolving at a tearing pace and especially the field of CRISPR based Genome Editing is advancing incredibly fast. CRISPR-Systems derived from a multitude of bacterial species are being used for targeted Gene Editing and many modifications have already been applied to the existing CRISPR-Systems such as (i) alter their protospacer adjacent motif (ii) increase their specificity (iii) alter their ability to cut DNA and (iv) fuse them with additional proteins. Besides, the classical transformation system using Agrobacteria tumefaciens or Rhizobium rhizogenes, other transformation technologies have become available and additional methods are on its way to the plant sector. Some of them are utilizing solely proteins or protein-RNA complexes for transformation, making it possible to alter the genome without the use of recombinant DNA. Due to this, it is impossible that foreign DNA is being incorporated into the host genome. In this review we will present the recent developments and techniques in the field of DNA-free Genome Editing, its advantages and pitfalls and give a perspective on technologies which might be available in the future for targeted Genome Editing in plants. Furthermore, we will discuss these techniques in the light of existing- and potential future regulations.},
}
@article {pmid30692669,
year = {2019},
author = {Rostøl, JT and Marraffini, LA},
title = {Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity.},
journal = {Nature microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41564-018-0353-x},
pmid = {30692669},
issn = {2058-5276},
support = {DP1 GM128184/GM/NIGMS NIH HHS/United States ; },
abstract = {Type III-A CRISPR-Cas systems employ the Cas10-Csm complex to destroy bacteriophages and plasmids, using a guide RNA to locate complementary RNA molecules from the invader and trigger an immune response that eliminates the infecting DNA. In addition, these systems possess the non-specific RNase Csm6, which provides further protection for the host. While the role of Csm6 in immunity during phage infection has been determined, how this RNase is used against plasmids is unclear. Here, we show that Staphylococcus epidermidis Csm6 is required for immunity when transcription across the plasmid target is infrequent, leading to impaired target recognition and inefficient DNA degradation by the Cas10-Csm complex. In these conditions, Csm6 causes growth arrest in the host and prevents further plasmid replication through the indiscriminate degradation of host and plasmid transcripts. In contrast, when plasmid target sequences are efficiently transcribed, Csm6 is dispensable and DNA degradation by Cas10 is sufficient for anti-plasmid immunity. Csm6 therefore provides robustness to the type III-A CRISPR-Cas immune response against difficult targets for the Cas10-Csm complex.},
}
@article {pmid30691656,
year = {2019},
author = {Patterson, A and Tokmina-Lukaszewska, M and Bothner, B},
title = {Probing Cascade complex composition and stability using native mass spectrometry techniques.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {87-116},
doi = {10.1016/bs.mie.2018.10.018},
pmid = {30691656},
issn = {1557-7988},
abstract = {Adaptive prokaryotic immune systems rely on clustered regularly interspaced short palindromic repeats and their associated genes to provide the components necessary to clear infection by foreign genetic elements. These immune systems are based on highly specific nucleases that bind DNA or RNA and, upon sequence recognition, degrade the bound nucleic acid. Because of their specificity, CRISPR-Cas systems are being co-opted to edit genes in eukaryotic cells. While the general function of these systems is well understood, an understanding of mechanistic details to facilitate engineering and application to this new arena remains a topic of intense study. Here, we present two methods that have been successfully used to study the structure and mechanism of the Type IE CRISPR system, Cascade, from Escherichia coli. We provide the protocol for a typical native mass spectrometry experiment which, because it allows for analysis of a protein complex without disruption of the noncovalent interactions within the complex, can be used to determine complex composition, architecture, and relative affinity between subunits. We, also, provide the protocol for intact protein hydrogen-deuterium exchange mass spectrometry, which provides insight into the overall conformational stability of the complex and changes in complex stability based on conditions such as substrate binding. Investigating the solution-phase structure, stability, and dynamics of these complexes improves the overall understanding of the mechanism facilitating engineered adjustments to function or utility.},
}
@article {pmid30691655,
year = {2019},
author = {Phan, PT and Schelling, M and Xue, C and Sashital, DG},
title = {Fluorescence-based methods for measuring target interference by CRISPR-Cas systems.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {61-85},
doi = {10.1016/bs.mie.2018.10.027},
pmid = {30691655},
issn = {1557-7988},
abstract = {Type I, II, and V CRISPR-Cas systems are RNA-guided dsDNA targeting defense mechanisms found in bacteria and archaea. During CRISPR interference, Cas effectors use CRISPR-derived RNAs (crRNAs) as guides to bind complementary sequences in foreign dsDNA, leading to the cleavage and destruction of the DNA target. Mutations within the target or in the protospacer adjacent motif can reduce the level of CRISPR interference, although the level of defect is dependent on the type and position of the mutation, as well as the guide sequence of the crRNA. Given the importance of Cas effectors in host defense and for biotechnology tools, there has been considerable interest in developing sensitive methods for detecting Cas effector activity through CRISPR interference. In this chapter, we describe an in vivo fluorescence-based method for monitoring plasmid interference in Escherichia coli. This approach uses a green fluorescent protein reporter to monitor varying plasmid levels within bacterial colonies, or to measure the rate of plasmid-loss in bacterial populations over time. We demonstrate the use of this simple plasmid-loss assay for both chromosomally integrated and plasmid-borne CRISPR-Cas systems.},
}
@article {pmid30691654,
year = {2019},
author = {Dillard, KE and Schaub, JM and Brown, MW and Saifuddin, FA and Xiao, Y and Hernandez, E and Dahlhauser, SD and Anslyn, EV and Ke, A and Finkelstein, IJ},
title = {Sortase-mediated fluorescent labeling of CRISPR complexes.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {43-59},
doi = {10.1016/bs.mie.2018.10.031},
pmid = {30691654},
issn = {1557-7988},
support = {F31 GM125201/GM/NIGMS NIH HHS/United States ; K99 GM097177/GM/NIGMS NIH HHS/United States ; R00 GM097177/GM/NIGMS NIH HHS/United States ; R01 GM120554/GM/NIGMS NIH HHS/United States ; },
abstract = {Fluorescent labeling of proteins is a critical requirement for single-molecule imaging studies. Many protein labeling strategies require harsh conditions or large epitopes that can inactivate the target protein, either by decreasing the protein's enzymatic activity or by blocking protein-protein interactions. Here, we provide a detailed protocol to efficiently label CRISPR-Cas complexes with a small fluorescent peptide via sortase-mediated transpeptidation. The sortase tag consists of just a few amino acids that are specifically recognized at either the N- or the C-terminus, making this strategy advantageous when the protein is part of a larger complex. Sortase is active at high ionic strength, 4°C, and with a broad range of organic fluorophores. We discuss the design, optimization, and single-molecule fluorescent imaging of CRISPR-Cas complexes on DNA curtains. Sortase-mediated transpeptidation is a versatile addition to the protein labeling toolkit.},
}
@article {pmid30691653,
year = {2019},
author = {Fagerlund, RD and Ferguson, TJ and Maxwell, HWR and Opel-Reading, HK and Krause, KL and Fineran, PC},
title = {Reconstitution of CRISPR adaptation in vitro and its detection by PCR.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {411-433},
doi = {10.1016/bs.mie.2018.10.024},
pmid = {30691653},
issn = {1557-7988},
abstract = {CRISPR adaptation is the initial step in CRISPR-Cas immunity and involves the acquisition of foreign invading DNA. Acquisition is facilitated by the almost universally conserved proteins Cas1 and Cas2, which form an adaptation complex. The Cas1-Cas2 complex binds fragments of invading DNA, completes final processing, and catalyzes integration into specific host loci called CRISPR arrays. Structural and biochemical studies from reconstituted complexes have provided mechanistic insight into how CRISPR adaptation occurs; however, these studies have been limited to a narrow subset of CRISPR-Cas types and may not be representative of the other types. Here we describe methods for the purification of the type I-F CRISPR adaptation complex (Cas1:Cas2-3) from Pectobacterium atrosepticum, purification of the DNA architectural protein integration host factor (IHF), and a sensitive PCR-based in vitro integration assay. This assay could easily be used to investigate mechanisms of CRISPR adaptation in other CRISPR-Cas systems, including the roles of accessory proteins.},
}
@article {pmid30691652,
year = {2019},
author = {Nayeemul Bari, SM and Hatoum-Aslan, A},
title = {CRISPR-Cas10 assisted editing of virulent staphylococcal phages.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {385-409},
doi = {10.1016/bs.mie.2018.10.023},
pmid = {30691652},
issn = {1557-7988},
abstract = {Phages are the most abundant entities in the biosphere and profoundly impact the bacterial populations within and around us. They attach to a specific host, inject their DNA, hijack the host's cellular processes, and replicate exponentially while destroying the host. Historically, phages have been exploited as powerful antimicrobials, and phage-derived proteins have constituted the basis for numerous biotechnological applications. Only in recent years have metagenomic studies revealed that phage genomes harbor a rich reservoir of genetic diversity, which might afford further therapeutic and/or biotechnological value. Nevertheless, functions for the majority of phage genes remain unknown, and due to their swift and destructive replication cycle, many phages are intractable by current genetic engineering techniques. Whether to advance the basic understanding of phage biology or to tap into their potential applications, efficient methods for phage genetic engineering are needed. Recent reports have shown that CRISPR-Cas systems, a class of prokaryotic immune systems that protect against phage infection, can be harnessed to engineer diverse phages. In this chapter, we describe methods to genetically manipulate virulent phages using CRISPR-Cas10, a Type III-A CRISPR-Cas system native to Staphylococcus epidermidis. A method for engineering phages that infect a CRISPR-less Staphylococcus aureus host is also described. Both approaches have proved successful in isolating desired phage mutants with 100% efficiency, demonstrating that CRISPR-Cas10 constitutes a powerful tool for phage genetic engineering. The relatively widespread presence of Type III CRISPR-Cas systems in bacteria and archaea imply that similar strategies may be used to manipulate the genomes of diverse prokaryotic viruses.},
}
@article {pmid30691650,
year = {2019},
author = {Mekler, V and Kuznedelov, K and Minakhin, L and Murugan, K and Sashital, DG and Severinov, K},
title = {CRISPR-Cas molecular beacons as tool for studies of assembly of CRISPR-Cas effector complexes and their interactions with DNA.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {337-363},
doi = {10.1016/bs.mie.2018.10.026},
pmid = {30691650},
issn = {1557-7988},
abstract = {CRISPR-Cas systems protect prokaryotic cells from invading phages and plasmids by recognizing and cleaving foreign nucleic acid sequences specified by CRISPR RNA spacer sequences. Several CRISPR-Cas systems have been widely used as tool for genetic engineering. In DNA-targeting CRISPR-Cas nucleoprotein effector complexes, the CRISPR RNA forms a hybrid with the complementary strand of foreign DNA, displacing the noncomplementary strand to form an R-loop. The DNA interrogation and R-loop formation involve several distinct steps the molecular details of which are not fully understood. This chapter describes a recently developed fluorometric Cas beacon assay that may be used for measuring of specific affinity of various CRISPR-Cas complexes for unlabeled target DNA and model DNA probes. The Cas beacon approach also can provide a sensitive method for monitoring the kinetics of assembly of CRISPR-Cas complexes.},
}
@article {pmid30691647,
year = {2019},
author = {Xiao, Y and Ke, A},
title = {Reconstitution and biochemical characterization of ribonucleoprotein complexes in Type I-E CRISPR-Cas systems.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {27-41},
doi = {10.1016/bs.mie.2018.11.003},
pmid = {30691647},
issn = {1557-7988},
abstract = {Type I CRISPR-Cas, the most prevalent CRISPR system, features a sequential target searching and degradation process. First, the multisubunit surveillance complex Cascade recognizes the matching dsDNA target flanked by protospacer adjacent motif (PAM), promotes the heteroduplex formation between CRISPR RNA (crRNA) and the target strand (TS) DNA, and displaces the nontarget strand (NTS) DNA, resulting in R-loop formation. The helicase-nuclease fusion enzyme Cas3 is then specifically recruited to Cascade/R-loop, nicks, and processively degrades the DNA target. Here, by using Type I-E CRISPR-Cas system from Thermobifida fusca, we provide protocols for the biochemical reconstitution of the Cascade/R-loop and Cascade/R-loop/Cas3 complexes that allowed for high-resolution structure determination and mechanism investigation. The procedures may be applicable for structural and mechanistic investigations of other Type I CRISPR-Cas systems, and may serve as a reference for the study of other multicomponent protein-nucleic acid complexes.},
}
@article {pmid30691646,
year = {2019},
author = {Hand, TH and Das, A and Li, H},
title = {Directed evolution studies of a thermophilic Type II-C Cas9.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {265-288},
doi = {10.1016/bs.mie.2018.10.029},
pmid = {30691646},
issn = {1557-7988},
support = {R01 GM099604/GM/NIGMS NIH HHS/United States ; },
abstract = {Though making up nearly half of the known CRISPR-Cas9 family of enzymes, the Type II-C CRISPR-Cas9 has been underexplored for their molecular mechanisms and potential in safe gene editing applications. In comparison with the more popular Type II-A CRISPR-Cas9, the Type II-C enzymes are generally smaller in size and utilize longer base pairing in identification of their DNA substrates. These characteristics suggest easier portability and potentially less off-targets for Type II-C in gene editing applications. We describe identification and biochemical characterization of a thermophilic Type II-C CRISPR-Cas from Acidothermus cellulolyticus (AceCas9). We describe several library-based methods that enabled us to identify the PAM sequence and elements critical to protospacer mismatch surveillance of AceCas9.},
}
@article {pmid30691644,
year = {2019},
author = {Karvelis, T and Young, JK and Siksnys, V},
title = {A pipeline for characterization of novel Cas9 orthologs.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {219-240},
doi = {10.1016/bs.mie.2018.10.021},
pmid = {30691644},
issn = {1557-7988},
abstract = {In recent years, Cas9 has revolutionized the genome-editing field and enabled a broad range of applications from basic biology to biotechnology and medicine. Cas9 specificity is dictated by base pairing of the guide RNA to the complementary DNA strand, however to initiate hybridization, a short protospacer adjacent motif (PAM) sequence is required in the vicinity of the target sequence. The PAM is recognized by the Cas9 protein and varies between Cas9s. There are thousands of type II CRISPR-Cas9 sequences available in sequence databases. To characterize the PAM recognition diversity provided by Cas9 orthologs, we developed a phylogeny-guided bioinformatics approach and streamlined our experimental procedures for Cas9 expression and RNP complex assembly using cell lysates and in vitro translation mixtures. This approach could be easily adapted for the characterization of other CRISPR-Cas nucleases that require PAM sequences and generate double-strand breaks following target recognition.},
}
@article {pmid30691642,
year = {2019},
author = {Park, KH and An, Y and Woo, EJ},
title = {In vitro assembly of thermostable Csm complex in CRISPR-Cas type III/A system.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {173-189},
doi = {10.1016/bs.mie.2018.10.025},
pmid = {30691642},
issn = {1557-7988},
abstract = {The CRISPR-Cas system is the prokaryotic immune response that destroys invading foreign nucleic acids. Based on the architecture and distinct mechanism of targeting, the CRISPR-Cas system is classified into six types (I-VI). The Csm complex belongs to the type III system and consists of five subunits (Cas10 and Csm2-5) and a crRNA. The Csm complex targets RNA and RNA-dependent single-strand DNA. Here, we present a protocol for in vitro reconstitution of a Csm complex from a hyperthermophilic archaeon Thermococcus onnurineus NA1 (ToCsm complex). The method consists of coexpression and copurification of the subunits, in vitro synthesis of the crRNA and assembly of the ToCsm complex. Purification with heat treatment and affinity and size exclusion chromatography resulted in homogeneous Cas10/Csm4 and Csm2/Csm5 binary complexes, while in vitro transcription with the T7 promoter enabled synthesis of the crRNA. Addition of each component in the presence of the crRNA with a molar ratio of Cas10/Csm4:Csm3:Csm2/Csm5:crRNA=1:3:2:1 yielded an assembled functional Csm complex. This protocol for reconstitution of the Csm complex is presumably applicable to other thermostable effector complexes, which would allow biochemical, structural, or functional studies of the CRISPR-Cas type III/A system in vitro.},
}
@article {pmid30691641,
year = {2019},
author = {Turkowyd, B and Müller-Esparza, H and Climenti, V and Steube, N and Endesfelder, U and Randau, L},
title = {Live-cell single-particle tracking photoactivated localization microscopy of Cascade-mediated DNA surveillance.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {133-171},
doi = {10.1016/bs.mie.2018.11.001},
pmid = {30691641},
issn = {1557-7988},
abstract = {Type I CRISPR-Cas systems utilize small CRISPR RNA (crRNA) molecules to scan DNA strands for target regions. Different crRNAs are bound by several CRISPR-associated (Cas) protein subunits that form the stable ribonucleoprotein complex Cascade. The Cascade-mediated DNA surveillance process requires a sufficient degree of base-complementarity between crRNA and target sequences and relies on the recognition of small DNA motifs, termed protospacer adjacent motifs. Recently, super-resolution microscopy and single-particle tracking methods have been developed to follow individual protein complexes in live cells. Here, we described how this technology can be adapted to visualize the DNA scanning process of Cascade assemblies in Escherichia coli cells. The activity of recombinant Type I-Fv Cascade complexes of Shewanella putrefaciens CN-32 serves as a model system that facilitates comparative studies for many of the diverse CRISPR-Cas systems.},
}
@article {pmid30691640,
year = {2019},
author = {Wade, JT},
title = {High-throughput determination of in vivo DNA sequence preferences for Cas protein binding using Library-ChIP.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {117-132},
doi = {10.1016/bs.mie.2018.10.019},
pmid = {30691640},
issn = {1557-7988},
abstract = {The specificity of CRISPR-Cas systems for nucleic acid targets is determined by a combination of binding and cleavage. Understanding the mechanisms by which Cas proteins specifically select their targets is critical for the development of CRISPR-Cas systems for biotechnology applications. Moreover, the specificity of CRISPR-Cas systems plays an important role in prokaryote evolution due to its role in distinguishing self from nonself. Here, I describe Library-ChIP, a high-throughput method for measuring Cas protein occupancy at many DNA sequence variants in a native prokaryotic host. Library-ChIP can be used to identify the determinants of specificity for Cas protein binding to nucleic acid targets.},
}
@article {pmid30691639,
year = {2019},
author = {Nethery, MA and Barrangou, R},
title = {Predicting and visualizing features of CRISPR-Cas systems.},
journal = {Methods in enzymology},
volume = {616},
number = {},
pages = {1-25},
doi = {10.1016/bs.mie.2018.10.016},
pmid = {30691639},
issn = {1557-7988},
abstract = {Pervasive application of CRISPR-Cas systems in genome editing has prompted an increase in both interest and necessity to further elucidate existing systems as well as discover putative novel systems. The ubiquity and power of current computational platforms have made in silico approaches to CRISPR-Cas identification and characterization accessible to a wider audience and increasingly amenable for processing extensive data sets. Here, we describe in silico methods for predicting and visualizing notable features of CRISPR-Cas systems, including Cas domain determination, CRISPR array visualization, and inference of the protospacer-adjacent motif. The efficiency of these tools enables rapid exploration of CRISPR-Cas diversity across prokaryotic genomes and supports scalable analysis of large genomic data sets.},
}
@article {pmid30691408,
year = {2019},
author = {Yamada, S and Shibasaki, M and Murase, K and Watanabe, T and Aikawa, C and Nozawa, T and Nakagawa, I},
title = {Phylogenetic relationship of prophages is affected by CRISPR selection in Group A Streptococcus.},
journal = {BMC microbiology},
volume = {19},
number = {1},
pages = {24},
doi = {10.1186/s12866-019-1393-y},
pmid = {30691408},
issn = {1471-2180},
support = {25293370//Japan Society for the Promotion of Science/ ; 16K08775//Japan Society for the Promotion of Science/ ; 16H05188//Japan Society for the Promotion of Science/ ; 17fk0108117h0201//Japan Agency for Medical Research and Development/ ; 18fk0108073h0001//Japan Agency for Medical Research and Development/ ; 17fm0208030h0001//Japan Agency for Medical Research and Development/ ; },
abstract = {BACKGROUND: Group A Streptococcus (GAS) is a major human pathogen, which is associated with a wide spectrum of invasive diseases, such as pharyngitis, scarlet fever, rheumatic fever, and streptococcal toxic shock syndrome (STSS). It is hypothesized that differences in GAS pathogenicity are related to the acquisition of diverse bacteriophages (phages). Nevertheless, the GAS genome also harbors clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (cas) genes, which play an important role in eliminating foreign DNA, including those of phages. However, the structure of prophages in GAS strains is mosaic, and the phylogenetic relationship between prophages and CRISPR is not clear. In this study, we analyzed CRISPR and prophage structure using 118 complete genome sequences of GAS strains to elucidate the relationship between two genomic elements. Additionally, phylogenetic and M-type analyses were performed.<br><br>RESULTS: Of the 118 GAS strains, 80 harbored type I-C and/or II-A CRISPR/cas loci. A total of 553 spacer sequences were identified from CRISPR/cas loci and sorted into 229 patterns. We identified and classified 373 prophages into 14 groups. Some prophage groups shared a common integration site, and were related to M-type. We further investigated the correlation between spacer sequences and prophages. Of the 229 spacer sequence patterns, 203 were similar to that of other GAS prophages. No spacer showed similarity with that of a specific prophage group with mutL integration site. Moreover, the average number of prophages in strains with type II-A CRISPR was significantly less than that in type I-C CRISPR and non-CRISPR strains. However, there was no statistical difference between the average number of prophages in type I-C strains and that in non-CRISPR strains.<br><br>CONCLUSIONS: Our results indicated that type II-A CRISPR may play an important role in eliminating phages and that the prophage integration site may be an important criterion for the acceptance of foreign DNA by GAS. M type, spacer sequence, and prophage group data were correlated with the phylogenetic relationships of GAS. Therefore, we hypothesize that genetic characteristics and/or phylogenetic relationships of GAS may be estimated by analyzing its spacer sequences.},
}
@article {pmid30688548,
year = {2019},
author = {Arbabi, A and Liu, A and Ameri, H},
title = {Gene Therapy for Inherited Retinal Degeneration.},
journal = {Journal of ocular pharmacology and therapeutics : the official journal of the Association for Ocular Pharmacology and Therapeutics},
volume = {},
number = {},
pages = {},
doi = {10.1089/jop.2018.0087},
pmid = {30688548},
issn = {1557-7732},
abstract = {Inherited retinal degeneration (IRD), a group of rare retinal diseases that primarily lead to the progressive loss of retinal photoreceptor cells, can be inherited in all modes of inheritance: autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), and mitochondrial. Based on the pattern of inheritance of the dystrophy, retinal gene therapy has 2 main strategies. AR, XL, and AD IRDs with haploinsufficiency can be treated by inserting a functional copy of the gene using either viral or nonviral vectors (gene augmentation). Different types of viral vectors and nonviral vectors are used to transfer plasmid DNA both in vitro and in vivo. AD IRDs with gain-of-function mutations or dominant-negative mutations can be treated by disrupting the mutant allele with (and occasionally without) gene augmentation. This review article aims to provide an overview of ocular gene therapy for treating IRDs using gene augmentation with viral or nonviral vectors or gene disruption through different gene-editing tools, especially with the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system.},
}
@article {pmid30686760,
year = {2019},
author = {Ronai, I and Griffiths, PE},
title = {The Case for Basic Biological Research.},
journal = {Trends in molecular medicine},
volume = {25},
number = {2},
pages = {65-69},
doi = {10.1016/j.molmed.2018.12.003},
pmid = {30686760},
issn = {1471-499X},
abstract = {The majority of biomedical and biological research relies on a few molecular biology techniques. Here we show that eight key molecular biology techniques would not exist without basic biological research. We also find that the scientific reward system does not sufficiently value basic biological research into molecular mechanisms.},
}
@article {pmid30684544,
year = {2019},
author = {Rawat, K and Das, S and Vivek Vinod, BS and Vekariya, U and Garg, T and Dasgupta, A and Tripathi, RK},
title = {Targeted depletion of BTF3a in macrophages activates autophagic pathway to eliminate Mycobacterium tuberculosis.},
journal = {Life sciences},
volume = {220},
number = {},
pages = {21-31},
doi = {10.1016/j.lfs.2019.01.035},
pmid = {30684544},
issn = {1879-0631},
mesh = {Autophagosomes/pathology ; Autophagy/drug effects ; Caseins/metabolism ; Humans ; Macrophages/metabolism ; Mycobacterium tuberculosis/*drug effects/metabolism ; Nuclear Proteins/*genetics/*metabolism ; THP-1 Cells/drug effects ; Transcription Factors/*genetics/*metabolism ; },
abstract = {AIMS: β casein fragment peptide (54-59) downregulates Basic Transcription factor 3a (BTF3a) in macrophages and exhibits enhanced clearance of M. bovis BCG and several other intracellular pathogens. However, the direct effect of BTF3a downregulation on Mycobacterium tuberculosis (Mtb) survival and the probable pathways involved have not yet been studied. Therefore, the present study was undertaken to deduce the antimycobacterial significance of BTF3a in human macrophages.<br><br>MAIN METHODS: CRISPR/Cas 9 gRNA was designed to downregulate BTF3a in THP1 derived macrophages. Fold change in BTF3a, p62 and Lamp 1 expression was evaluated through immune blot analysis. CFU assay was done to enumerate the intracellular burden of Mtb H37Rv. LC3B-II turnover and Lamp 1 expression was checked through immunoblotting and also visualized through confocal microscopy. Colocalization of Mtb H37Rv with LC3B, Lysotracker and Rab 7 was visualized through confocal microscopy.<br><br>KEY FINDINGS: The current study identifies BTF3a as a critical host factor assisting intracellular survival of Mtb. In THP1 derived macrophages, infection with Mtb H37Rv resulted in upregulation of BTF3a and targeted depletion of BTF3a resulted in augmented Mtb clearance. Furthermore, BTF3a knockdown demonstrated increased autophagy flux and ameliorated the lysosomal targeting of Mtb containing autophagosomes for lysosomal degradation.<br><br>SIGNIFICANCE: Deep understanding of macrophage-Mtb interactions and their roles in the pathogenesis can offer exciting new therapeutic targets for alternative host-specific adjunct therapies in tuberculosis treatment. The present study highlights a novel and significant role of BTF3a in curbing the intracellular survival of Mtb through modulation of autophagy and lysosome biogenesis.},
}
@article {pmid30683865,
year = {2019},
author = {Tan, J and Zhang, F and Karcher, D and Bock, R},
title = {Engineering of high-precision base editors for site-specific single nucleotide replacement.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {439},
doi = {10.1038/s41467-018-08034-8},
pmid = {30683865},
issn = {2041-1723},
mesh = {APOBEC-1 Deaminase/chemistry/*genetics/metabolism ; Amino Acid Transport Systems, Basic/genetics/metabolism ; Base Sequence ; CRISPR-Associated Protein 9/chemistry/*genetics/metabolism ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Cytidine/genetics/metabolism ; Gene Editing/*methods ; Genetic Engineering/methods ; Isoenzymes/chemistry/genetics/metabolism ; Mutagenesis, Site-Directed ; RNA, Guide/genetics/metabolism ; Saccharomyces cerevisiae/enzymology/*genetics ; Saccharomyces cerevisiae Proteins/genetics/metabolism ; Sensitivity and Specificity ; Thymidine/genetics/metabolism ; },
abstract = {RNA-guided nucleases of the CRISPR/Cas type can be repurposed as programmable nucleotide deaminases to mediate targeted nucleotide substitutions. Such base editors have enormous potential in genome editing, gene therapy and precision breeding. However, current editors suffer from limited specificity in that they edit different and/or multiple bases within a larger sequence window. Using cytidine deaminase base editors that elicit C-to-T mutations, we show here that high editing precision can be achieved by engineering the connection between the deaminase domain and the Cas domain of the editor. By systematically testing different linker sequences and removing non-essential sequences from the deaminase, we obtain high-precision base editors with narrow activity windows that can selectively edit a single cytidine at a specific position with high accuracy and efficiency. These base editors will enable the use of genome editing in applications where single-nucleotide changes are required and off-target editing of adjacent nucleotides is not tolerable.},
}
@article {pmid30682820,
year = {2019},
author = {Mantravadi, PK and Kalesh, KA and Dobson, RCJ and Hudson, AO and Parthasarathy, A},
title = {The Quest for Novel Antimicrobial Compounds: Emerging Trends in Research, Development, and Technologies.},
journal = {Antibiotics (Basel, Switzerland)},
volume = {8},
number = {1},
pages = {},
doi = {10.3390/antibiotics8010008},
pmid = {30682820},
issn = {2079-6382},
support = {R15GM120653//National Institutes of Health/ ; },
abstract = {Pathogenic antibiotic resistant bacteria pose one of the most important health challenges of the 21st century. The overuse and abuse of antibiotics coupled with the natural evolutionary processes of bacteria has led to this crisis. Only incremental advances in antibiotic development have occurred over the last 30 years. Novel classes of molecules, such as engineered antibodies, antibiotic enhancers, siderophore conjugates, engineered phages, photo-switchable antibiotics, and genome editing facilitated by the CRISPR/Cas system, are providing new avenues to facilitate the development of antimicrobial therapies. The informatics revolution is transforming research and development efforts to discover novel antibiotics. The explosion of nanotechnology and micro-engineering is driving the invention of antimicrobial materials, enabling the cultivation of &quot;uncultivable&quot; microbes and creating specific and rapid diagnostic technologies. Finally, a revival in the ecological aspects of microbial disease management, the growth of prebiotics, and integrated management based on the &quot;One Health&quot; model, provide additional avenues to manage this health crisis. These, and future scientific and technological developments, must be coupled and aligned with sound policy and public awareness to address the risks posed by rising antibiotic resistance.},
}
@article {pmid30674877,
year = {2019},
author = {Spence, EF and Dube, S and Uezu, A and Locke, M and Soderblom, EJ and Soderling, SH},
title = {In vivo proximity proteomics of nascent synapses reveals a novel regulator of cytoskeleton-mediated synaptic maturation.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {386},
doi = {10.1038/s41467-019-08288-w},
pmid = {30674877},
issn = {2041-1723},
support = {MH103374/NH/NIH HHS/United States ; NS059957/NH/NIH HHS/United States ; F31NS092402/NH/NIH HHS/United States ; },
mesh = {Actin Capping Proteins/genetics/metabolism ; Animals ; Biotin ; CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Cytoskeletal Proteins/metabolism ; Cytoskeleton/*metabolism ; Dendritic Spines/metabolism ; Excitatory Postsynaptic Potentials/*physiology ; GTPase-Activating Proteins ; Gene Expression Regulation ; HEK293 Cells ; Humans ; Mice, Inbred C57BL ; Microfilament Proteins/genetics/metabolism ; Microtubules/metabolism ; Neurogenesis/genetics/physiology ; Neurons/metabolism ; Proteome/genetics/*metabolism ; *Proteomics ; Synapses/genetics/*metabolism ; },
abstract = {Excitatory synapse formation during development involves the complex orchestration of both structural and functional alterations at the postsynapse. However, the molecular mechanisms that underlie excitatory synaptogenesis are only partially resolved, in part because the internal machinery of developing synapses is largely unknown. To address this, we apply a chemicogenetic approach, in vivo biotin identification (iBioID), to discover aspects of the proteome of nascent synapses. This approach uncovered sixty proteins, including a previously uncharacterized protein, CARMIL3, which interacts in vivo with the synaptic cytoskeletal regulator proteins SrGAP3 (or WRP) and actin capping protein. Using new CRISPR-based approaches, we validate that endogenous CARMIL3 is localized to developing synapses where it facilitates the recruitment of capping protein and is required for spine structural maturation and AMPAR recruitment associated with synapse unsilencing. Together these proteomic and functional studies reveal a previously unknown mechanism important for excitatory synapse development in the developing perinatal brain.},
}
@article {pmid30673818,
year = {2019},
author = {Huang, TK and Puchta, H},
title = {CRISPR/Cas-mediated gene targeting in plants: finally a turn for the better for homologous recombination.},
journal = {Plant cell reports},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00299-019-02379-0},
pmid = {30673818},
issn = {1432-203X},
support = {MOST 106-2917-I-564-007-A1//Ministry of Science and Technology, Taiwan/ ; 100334243 SophGenTom//Bundesministerium für Forschung und Technologie/ ; },
abstract = {KEY MESSAGE: We summarize recent progress of CRISPR/Cas9-mediated gene targeting in plants, provide recommendations for designing gene-targeting vectors and highlight the potential of new technologies applicable to plants. Gene targeting (GT) is a tool of urgent need for plant biotechnology and breeding. It is based on homologous recombination that is able to precisely introduce desired modifications within a target locus. However, its low efficiency in higher plants is a major barrier for its application. Using site-specific nucleases, such as the recent CRISPR/Cas system, GT has become applicable in plants, via the induction of double-strand breaks, although still at a too low efficiency for most practical applications in crops. Recently, a variety of promising new improvements regarding the efficiency of GT has been reported by several groups. It turns out that GT can be enhanced by cell-type-specific expression of Cas nucleases, by the use of self-amplified GT-vector DNA or by manipulation of DNA repair pathways. Here, we highlight the most recent progress of GT in plants. Moreover, we provide suggestions on how to use the technology efficiently, based on the mechanisms of DNA repair, and highlight several of the newest GT strategies in yeast or mammals that are potentially applicable to plants. Using the full potential of GT technology will definitely help us pave the way in enhancing crop yields and food safety for an ecologically friendly agriculture.},
}
@article {pmid30673632,
year = {2019},
author = {van Beljouw, SPB and van der Els, S and Martens, KJA and Kleerebezem, M and Bron, PA and Hohlbein, J},
title = {Evaluating single-particle tracking by photo-activation localization microscopy (sptPALM) in Lactococcus lactis.},
journal = {Physical biology},
volume = {},
number = {},
pages = {},
doi = {10.1088/1478-3975/ab0162},
pmid = {30673632},
issn = {1478-3975},
abstract = {Lactic acid bacteria (LAB) are frequently used in food fermentation and are invaluable for the taste and nutritional value of the fermentation end-product. To gain a better understanding of underlying biochemical and microbiological mechanisms and cell-to-cell variability in LABs, single-molecule techniques such as single-particle tracking photo-activation localization microscopy (sptPALM) hold great promises but are not yet employed due to the lack of detailed protocols and suitable assays.&#13; Here, we qualitatively test various fluorescent proteins including variants that are photoactivatable and therefore suitable for sptPALM measurements in Lactococcus lactis, a key LAB for the dairy industry. In particular, we fused PAmCherry2 to dCas9 allowing the successful tracking of single dCas9 proteins, whilst the dCas9 chimeras bound to specific guide RNAs retained their gene silencing ability in vivo. The diffusional information of the dCas9 without any targets showed different mechanistic states of dCas9: freely diffusing, bound to DNA, or transiently interacting with DNA. The capability of performing sptPALM with dCas9 in L. lactis can lead to a better, general understanding of CRISPR-Cas systems as well as paving the way for CRISPR-Cas based interrogations of cellular functions in LABs.&amp;#13.},
}
@article {pmid30670702,
year = {2019},
author = {Strecker, J and Jones, S and Koopal, B and Schmid-Burgk, J and Zetsche, B and Gao, L and Makarova, KS and Koonin, EV and Zhang, F},
title = {Engineering of CRISPR-Cas12b for human genome editing.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {212},
doi = {10.1038/s41467-018-08224-4},
pmid = {30670702},
issn = {2041-1723},
support = {DP1 HL141201/HL/NHLBI NIH HHS/United States ; R01 HG009761/HG/NHGRI NIH HHS/United States ; R01 MH110049/MH/NIMH NIH HHS/United States ; },
mesh = {Bacillus/genetics/*metabolism ; Bacterial Proteins/genetics/*metabolism ; *CRISPR-Cas Systems ; Cell Line ; Deoxyribonucleases/genetics/*metabolism ; *Gene Editing ; *Genome, Human ; Humans ; Models, Molecular ; Mutation ; Protein Conformation ; T-Lymphocytes ; },
abstract = {The type-V CRISPR effector Cas12b (formerly known as C2c1) has been challenging to develop for genome editing in human cells, at least in part due to the high temperature requirement of the characterized family members. Here we explore the diversity of the Cas12b family and identify a promising candidate for human gene editing from Bacillus hisashii, BhCas12b. However, at 37 °C, wild-type BhCas12b preferentially nicks the non-target DNA strand instead of forming a double strand break, leading to lower editing efficiency. Using a combination of approaches, we identify gain-of-function mutations for BhCas12b that overcome this limitation. Mutant BhCas12b facilitates robust genome editing in human cell lines and ex vivo in primary human T cells, and exhibits greater specificity compared to S. pyogenes Cas9. This work establishes a third RNA-guided nuclease platform, in addition to Cas9 and Cpf1/Cas12a, for genome editing in human cells.},
}
@article {pmid30669982,
year = {2019},
author = {Li, R and Liu, C and Zhao, R and Wang, L and Chen, L and Yu, W and Zhang, S and Sheng, J and Shen, L},
title = {CRISPR/Cas9-Mediated SlNPR1 mutagenesis reduces tomato plant drought tolerance.},
journal = {BMC plant biology},
volume = {19},
number = {1},
pages = {38},
doi = {10.1186/s12870-018-1627-4},
pmid = {30669982},
issn = {1471-2229},
support = {31371847//National Natural Science Foundation of China/ ; 31571893//National Natural Science Foundation of China/ ; },
mesh = {Adaptation, Physiological/genetics ; CRISPR-Cas Systems ; *Droughts ; *Genes, Plant ; Lycopersicon esculentum/*genetics/physiology ; Mutagenesis ; Stress, Physiological/genetics ; },
abstract = {BACKGROUND: NPR1, nonexpressor of pathogenesis-related gene 1, is a master regulator involved in plant defense response to pathogens, and its regulatory mechanism in the defense pathway has been relatively clear. However, information about the function of NPR1 in plant response to abiotic stress is still limited. Tomato is the fourth most economically crop worldwide and also one of the best-characterized model plants employed in genetic studies. Because of the lack of a stable tomato NPR1 (SlNPR1) mutant, little is known about the function of SlNPR1 in tomato response to biotic and abiotic stresses.<br><br>RESULTS: Here we isolated SlNPR1 from tomato 'Ailsa Craig' and generated slnpr1 mutants using the CRISPR/Cas9 system. Analysis of the cis-acting elements indicated that SlNPR1 might be involved in tomato plant response to drought stress. Expression pattern analysis showed that SlNPR1 was expressed in all plant tissues, and it was strongly induced by drought stress. Thus, we investigated the function of SlNPR1 in tomato-plant drought tolerance. Results showed that slnpr1 mutants exhibited reduced drought tolerance with increased stomatal aperture, higher electrolytic leakage, malondialdehyde (MDA) and hydrogen peroxide (H2O2) levels, and lower activity levels of antioxidant enzymes, compared to wild type (WT) plants. The reduced drought tolerance of slnpr1 mutants was further reflected by the down-regulated expression of drought related key genes, including SlGST, SlDHN, and SlDREB.<br><br>CONCLUSIONS: Collectively, the data suggest that SlNPR1 is involved in regulating tomato plant drought response. These results aid in further understanding the molecular basis underlying SlNPR1 mediation of tomato drought sensitivity.},
}
@article {pmid30669273,
year = {2019},
author = {Grandvaux, N and McCormick, C},
title = {CSV2018: The 2nd Symposium of the Canadian Society for Virology.},
journal = {Viruses},
volume = {11},
number = {1},
pages = {},
doi = {10.3390/v11010079},
pmid = {30669273},
issn = {1999-4915},
support = {CIHR-MPL-158413//Canadian Institutes of Health Research/Canada ; Conference Grant//Dalhousie Medical Research Foundation/ ; },
abstract = {The 2nd Symposium of the Canadian Society for Virology (CSV2018) was held in June 2018 in Halifax, Nova Scotia, Canada, as a featured event marking the 200th anniversary of Dalhousie University. CSV2018 attracted 175 attendees from across Canada and around the world, more than double the number that attended the first CSV symposium two years earlier. CSV2018 provided a forum to discuss a wide range of topics in virology including human, veterinary, plant, and microbial pathogens. Invited keynote speakers included David Kelvin (Dalhousie University and Shantou University Medical College) who provided a historical perspective on influenza on the 100th anniversary of the 1918 pandemic; Sylvain Moineau (Université Laval) who described CRISPR-Cas systems and anti-CRISPR proteins in warfare between bacteriophages and their host microbes; and Kate O'Brien (then from Johns Hopkins University, now relocated to the World Health Organization where she is Director of Immunization, Vaccines and Biologicals), who discussed the underlying viral etiology for pneumonia in the developing world, and the evidence for respiratory syncytial virus (RSV) as a primary cause. Reflecting a strong commitment of Canadian virologists to science communication, CSV2018 featured the launch of Halifax's first annual Soapbox Science event to enable public engagement with female scientists, and the live-taping of the 499th episode of the This Week in Virology (TWIV) podcast, hosted by Vincent Racaniello (Columbia University) and science writer Alan Dove. TWIV featured interviews of CSV co-founders Nathalie Grandvaux (Université de Montréal) and Craig McCormick (Dalhousie University), who discussed the origins and objectives of the new society; Ryan Noyce (University of Alberta), who discussed technical and ethical considerations of synthetic virology; and Kate O'Brien, who discussed vaccines and global health. Finally, because CSV seeks to provide a better future for the next generation of Canadian virologists, the symposium featured a large number of oral and poster presentations from trainees and closed with the awarding of presentation prizes to trainees, followed by a tour of the Halifax Citadel National Historic Site and an evening of entertainment at the historic Alexander Keith's Brewery.},
}
@article {pmid30668910,
year = {2019},
author = {Koopal, B and Kruis, AJ and Claassens, NJ and Nobrega, FL and van der Oost, J},
title = {Incorporation of a Synthetic Amino Acid into dCas9 Improves Control of Gene Silencing.},
journal = {ACS synthetic biology},
volume = {8},
number = {2},
pages = {216-222},
doi = {10.1021/acssynbio.8b00347},
pmid = {30668910},
issn = {2161-5063},
abstract = {The CRISPR-Cas9 nuclease has been repurposed as a tool for gene repression (CRISPRi). This catalytically dead Cas9 (dCas9) variant inhibits transcription by blocking either initiation or elongation by the RNA polymerase complex. Conditional control of dCas9-mediated repression has been achieved with inducible promoters that regulate the expression of the dcas9 gene. However, as dCas9-mediated gene silencing is very efficient, even slightly leaky dcas9 expression leads to significant background levels of repression of the target gene. In this study, we report on the development of optimized control of dCas9-mediated silencing through additional regulation at the translation level. We have introduced the TAG stop codon in the dcas9 gene in order to insert a synthetic amino acid, l-biphenylalanine (BipA), at a permissive site in the dCas9 protein. In the absence of BipA, a nonfunctional, truncated dCas9 is produced, but when BipA is present, the TAG codon is translated resulting in a functional, full-length dCas9 protein. This synthetic, BipA-containing dCas9 variant (dCas9-BipA) could still fully repress gene transcription. Comparison of silencing mediated by dCas9 to dCas9-BipA revealed a 14-fold reduction in background repression by the latter system. The here developed proof-of-principle system thus reduces unwanted background levels of gene silencing, allowing for tight and timed control of target gene expression.},
}
@article {pmid30664678,
year = {2019},
author = {Yin, H and Xue, W and Anderson, DG},
title = {CRISPR-Cas: a tool for cancer research and therapeutics.},
journal = {Nature reviews. Clinical oncology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41571-019-0166-8},
pmid = {30664678},
issn = {1759-4782},
abstract = {In the past decade, the development of a genome-editing technology mediated by CRISPR has made genetic engineering easier than ever, both in vitro and in vivo. CRISPR systems have enabled important advances in cancer research by accelerating the development of study models or as a tool in genetic screening studies, including those aiming to discover and validate therapeutic targets. In this Review, we discuss these applications as well as new potential uses of CRISPR to assist in cancer detection or the development of anticancer therapies.},
}
@article {pmid30664650,
year = {2019},
author = {Campagne, A and Lee, MK and Zielinski, D and Michaud, A and Le Corre, S and Dingli, F and Chen, H and Shahidian, LZ and Vassilev, I and Servant, N and Loew, D and Pasmant, E and Postel-Vinay, S and Wassef, M and Margueron, R},
title = {BAP1 complex promotes transcription by opposing PRC1-mediated H2A ubiquitylation.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {348},
doi = {10.1038/s41467-018-08255-x},
pmid = {30664650},
issn = {2041-1723},
mesh = {Animals ; B-Lymphocytes/cytology/*metabolism ; CRISPR-Cas Systems ; Cell Cycle Proteins/*genetics/metabolism ; Cell Line, Tumor ; Drosophila melanogaster ; Gene Editing ; Haploidy ; HeLa Cells ; Histones/genetics/*metabolism ; Humans ; Polycomb Repressive Complex 1/genetics/metabolism ; *Protein Processing, Post-Translational ; Repressor Proteins/genetics/metabolism ; Sf9 Cells ; Spodoptera ; Transcription Factors/genetics/metabolism ; Transcriptional Activation ; Tumor Suppressor Proteins/*genetics/metabolism ; Ubiquitin Thiolesterase/*genetics/metabolism ; Ubiquitination ; },
abstract = {In Drosophila, a complex consisting of Calypso and ASX catalyzes H2A deubiquitination and has been reported to act as part of the Polycomb machinery in transcriptional silencing. The mammalian homologs of these proteins (BAP1 and ASXL1/2/3, respectively), are frequently mutated in various cancer types, yet their precise functions remain unclear. Using an integrative approach based on isogenic cell lines generated with CRISPR/Cas9, we uncover an unanticipated role for BAP1 in gene activation. This function requires the assembly of an enzymatically active BAP1-associated core complex (BAP1.com) containing one of the redundant ASXL proteins. We investigate the mechanism underlying BAP1.com-mediated transcriptional regulation and show that it does not participate in Polycomb-mediated silencing. Instead, our results establish that the function of BAP1.com is to safeguard transcriptionally active genes against silencing by the Polycomb Repressive Complex 1.},
}
@article {pmid30661951,
year = {2019},
author = {Jackson, SA and Birkholz, N and Malone, LM and Fineran, PC},
title = {Imprecise Spacer Acquisition Generates CRISPR-Cas Immune Diversity through Primed Adaptation.},
journal = {Cell host &amp; microbe},
volume = {25},
number = {2},
pages = {250-260.e4},
doi = {10.1016/j.chom.2018.12.014},
pmid = {30661951},
issn = {1934-6069},
abstract = {Many prokaryotes possess CRISPR-Cas adaptive immune systems to defend against viruses and invading mobile genetic elements. CRISPR-Cas immunity relies on genetic memories, termed spacers, for sequence-specific recognition of infections. The diversity of spacers within host populations is important for immune resilience, but we have limited understanding of how CRISPR diversity is generated. Type I CRISPR-Cas systems use existing spacers to enhance the acquisition of new spacers through primed CRISPR adaptation (priming). Here, we present a pathway to priming that is stimulated by imprecisely acquired (slipped) spacers. Slipped spacers are less effective for immunity but increase priming compared with canonical spacers. The benefits of slipping depend on the relative rates of phage mutation and adaptation during defense. We propose that slipped spacers provide a route to increase population-level spacer diversity that pre-empts phage escape mutant proliferation and that the trade-off between adaptation and immunity is important in diverse CRISPR-Cas systems.},
}
@article {pmid30659180,
year = {2019},
author = {Profumo, V and Forte, B and Percio, S and Rotundo, F and Doldi, V and Ferrari, E and Fenderico, N and Dugo, M and Romagnoli, D and Benelli, M and Valdagni, R and Dolfini, D and Zaffaroni, N and Gandellini, P},
title = {LEADeR role of miR-205 host gene as long noncoding RNA in prostate basal cell differentiation.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {307},
doi = {10.1038/s41467-018-08153-2},
pmid = {30659180},
issn = {2041-1723},
mesh = {CRISPR-Cas Systems ; Cell Differentiation ; Cell Line, Tumor ; Cells, Cultured ; Epithelial Cells/metabolism ; Gene Editing ; Humans ; Male ; MicroRNAs/*genetics ; Promoter Regions, Genetic ; Prostate/*cytology/metabolism ; RNA, Long Noncoding/*genetics ; Ribonuclease III/metabolism ; Transcriptome ; },
abstract = {Though miR-205 function has been largely characterized, the nature of its host gene, MIR205HG, is still completely unknown. Here, we show that only lowly expressed alternatively spliced MIR205HG transcripts act as de facto pri-miRNAs, through a process that involves Drosha to prevent unfavorable splicing and directly mediate miR-205 excision. Notably, MIR205HG-specific processed transcripts revealed to be functional per se as nuclear long noncoding RNA capable of regulating differentiation of human prostate basal cells through control of the interferon pathway. At molecular level, MIR205HG directly binds the promoters of its target genes, which have an Alu element in proximity of the Interferon-Regulatory Factor (IRF) binding site, and represses their transcription likely buffering IRF1 activity, with the ultimate effect of preventing luminal differentiation. As MIR205HG functions autonomously from (albeit complementing) miR-205 in preserving the basal identity of prostate epithelial cells, it warrants reannotation as LEADeR (Long Epithelial Alu-interacting Differentiation-related RNA).},
}
@article {pmid30656391,
year = {2019},
author = {Plavec, TV and Berlec, A},
title = {Engineering of lactic acid bacteria for delivery of therapeutic proteins and peptides.},
journal = {Applied microbiology and biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00253-019-09628-y},
pmid = {30656391},
issn = {1432-0614},
support = {J4-9327//Javna Agencija za Raziskovalno Dejavnost RS/ ; },
abstract = {Lactic acid bacteria (LAB) have a long-term history of use in food industry and are becoming attractive for use in therapy on account of their safety, intrinsic beneficial health effects, and considerable biotechnological potential. The established systems for engineering are combined with novel approaches, such as CRISPR-Cas, to enable the use of LAB as vectors for delivery of various therapeutic molecules. The latter are either secreted or surface displayed and can be used for the treatment or prevention of numerous conditions: inflammatory bowel diseases, infections, autoimmune diseases, and even cancer. This review presents some recent data on engineering of LAB, with the emphasis on the most commonly used genera Lactococcus and Lactobacillus. Their use for the delivery of therapeutic proteins is discussed, while a special focus is given to the delivery of therapeutic peptides. Therapeutically relevant improvements of engineered LAB, such as containment systems, ability to visualize bacteria, or target specific host cells are also addressed. Future engineering of LAB for therapy will adopt the capabilities of synthetic biology, with first examples already emerging.},
}
@article {pmid30655519,
year = {2019},
author = {Díez-Villaseñor, C and Rodriguez-Valera, F},
title = {CRISPR analysis suggests that small circular single-stranded DNA smacoviruses infect Archaea instead of humans.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {294},
doi = {10.1038/s41467-018-08167-w},
pmid = {30655519},
issn = {2041-1723},
abstract = {Smacoviridae is a family of small (~2.5 Kb) CRESS-DNA (Circular Rep Encoding Single-Stranded (ss) DNA) viruses. These viruses have been found in faeces, were thought to infect eukaryotes and are suspected to cause gastrointestinal disease in humans. CRISPR-Cas systems are adaptive immune systems in prokaryotes, wherein snippets of genomes from invaders are stored as spacers that are interspersed between a repeated CRISPR sequence. Here we report several spacer sequences in the faecal archaeon Candidatus Methanomassiliicoccus intestinalis matching smacoviruses, implicating the archaeon as a firm candidate for a host. This finding may be relevant to understanding the potential origin of smacovirus-associated human diseases. Our results support that CRESS-DNA viruses can infect non-eukaryotes, which would mean that smacoviruses are the viruses with the smallest genomes to infect prokaryotes known to date. A probable target strand bias suggests that, in addition to double-stranded DNA, the CRISPR-Cas system can target ssDNA.},
}
@article {pmid30654914,
year = {2019},
author = {Li, Y and Li, S and Wang, J and Liu, G},
title = {CRISPR/Cas Systems towards Next-Generation Biosensing.},
journal = {Trends in biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tibtech.2018.12.005},
pmid = {30654914},
issn = {1879-3096},
abstract = {Beyond its remarkable genome editing ability, the CRISPR/Cas9 effector has also been utilized in biosensing applications. The recent discovery of the collateral RNA cleavage activity of the Cas13a effector has sparked even greater interest in developing novel biosensing technologies for nucleic acid detection and promised significant advances in CRISPR diagnostics. Now, along with the discovery of Cas12 collateral cleavage activities on single-stranded DNA (ssDNA), several CRISPR/Cas systems have been established for detecting various targets, including bacteria, viruses, cancer mutations, and others. Based on key Cas effectors, we provide a detailed classification of CRISPR/Cas biosensing systems and propose their future utility. As the field continues to mature, CRISPR/Cas systems have the potential to become promising candidates for next-generation diagnostic biosensing platforms.},
}
@article {pmid30654190,
year = {2019},
author = {Moses, C and Nugent, F and Waryah, CB and Garcia-Bloj, B and Harvey, AR and Blancafort, P},
title = {Activating PTEN Tumor Suppressor Expression with the CRISPR/dCas9 System.},
journal = {Molecular therapy. Nucleic acids},
volume = {14},
number = {},
pages = {287-300},
doi = {10.1016/j.omtn.2018.12.003},
pmid = {30654190},
issn = {2162-2531},
support = {R01 CA170370/CA/NCI NIH HHS/United States ; R01 DA036906/DA/NIDA NIH HHS/United States ; },
abstract = {PTEN expression is lost in many cancers, and even small changes in PTEN activity affect susceptibility and prognosis in a range of highly aggressive malignancies, such as melanoma and triple-negative breast cancer (TNBC). Loss of PTEN expression occurs via multiple mechanisms, including mutation, transcriptional repression and epigenetic silencing. Transcriptional repression of PTEN contributes to resistance to inhibitors used in the clinic, such as B-Raf inhibitors in BRAF mutant melanoma. We aimed to activate PTEN expression using the CRISPR system, specifically dead (d) Cas9 fused to the transactivator VP64-p65-Rta (VPR). dCas9-VPR was directed to the PTEN proximal promoter by single-guide RNAs (sgRNAs), in cancer cells that exhibited low levels of PTEN expression. The dCas9-VPR system increased PTEN expression in melanoma and TNBC cell lines, without transcriptional regulation at predicted off-target sgRNA binding sites. PTEN activation significantly repressed downstream oncogenic pathways, including AKT, mTOR, and MAPK signaling. BRAF V600E mutant melanoma cells transduced with dCas9-VPR displayed reduced migration, as well as diminished colony formation in the presence of B-Raf inhibitors, PI3K/mTOR inhibitors, and with combined PI3K/mTOR and B-Raf inhibition. CRISPR-mediated targeted activation of PTEN may provide an alternative therapeutic approach for highly aggressive cancers that are refractory to current treatments.},
}
@article {pmid30652832,
year = {2018},
author = {Węgleński, P},
title = {[Gene editing].},
journal = {Postepy biochemii},
volume = {64},
number = {1},
pages = {9-12},
doi = {10.18388/pb.2018_99},
pmid = {30652832},
issn = {0032-5422},
abstract = {Development of the gene engineering techniques has raised worries that they will be used for construction of organism endangering humans and environment. In 1975 at the Asilomar conference, geneticists from many countries decided that genetic engineering brings more benefits than threats. In last years a new CRISPR-Cas technique emerged . It allows to make the precise changes in genomes, e.g. to inactivate particular genes or to replace mutated genes by their wild-type alleles. Inactivation in mice of genes corresponding to those whose mutations cause the genetic diseases in man allows to get model organisms for studying the etiology of given disease and for working out the methods of its curing. This technique can be applied for repairing genes whose mutations result in metabolic diseases and cancer. Some voices were raised that the technique can be potentially used for the &quot;improvement&quot; of man, what would create many ethical and social problems. Geneticists, ethicists and lawyers gathered in 2015 at the Washington conference, discussed these problems and proposed rules for their solving.},
}
@article {pmid30652289,
year = {2019},
author = {Sander, JD},
title = {Gene Editing in Sorghum Through Agrobacterium.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1931},
number = {},
pages = {155-168},
doi = {10.1007/978-1-4939-9039-9_11},
pmid = {30652289},
issn = {1940-6029},
abstract = {The application of CRISPR/Cas to introduce targeted genomic edits is powering research and discovery across the genetic frontier. Applying CRISPR/Cas in sorghum can facilitate the study of gene function and unlock our understanding of this robust crop that serves as a staple for some of the most food insecure regions on the planet. When paired with recent advances in sorghum tissue culture and Agrobacteria technology, CRISPR/Cas can be used to introduce desirable changes and natural genetic variations directly into agriculturally relevant sorghum lines facilitating product development. This chapter describes CRISPR/Cas gene editing and provides high-level strategies and expectations for applying this technology using Agrobacterium in sorghum.},
}
@article {pmid30648020,
year = {2019},
author = {García-Zea, JA and de la Herrán, R and Robles Rodríguez, F and Navajas-Pérez, R and Ruiz Rejón, C},
title = {Detection and variability analyses of CRISPR-like loci in the H. pylori genome.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6221},
doi = {10.7717/peerj.6221},
pmid = {30648020},
issn = {2167-8359},
abstract = {Helicobacter pylori is a human pathogenic bacterium with a high genomic plasticity. Although the functional CRISPR-Cas system has not been found in its genome, CRISPR-like loci have been recently identified. In this work, 53 genomes from different geographical areas are analyzed for the search and analysis of variability of this type of structure. We confirm the presence of a locus that was previously described in the VlpC gene in al lgenomes, and we characterize new CRISPR-like loci in other genomic locations. By studying the variability and gene location of these loci, the evolution and the possible roles of these sequences are discussed. Additionally, the usefulness of this type of sequences as a phylogenetic marker has been demonstrated, associating the different strains by geographical area.},
}
@article {pmid30647128,
year = {2019},
author = {Alimov, I and Menon, S and Cochran, N and Maher, R and Wang, Q and Alford, J and Concannon, JB and Yang, Z and Harrington, E and Llamas, L and Lindeman, A and Hoffman, G and Schuhmann, T and Russ, C and Reece-Hoyes, J and Canham, SM and Cai, X},
title = {Bile acid analogues are activators of Pyrin inflammasome.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.005103},
pmid = {30647128},
issn = {1083-351X},
abstract = {Bile acids are critical metabolites in the gastrointestinal tract which contribute to maintaining intestinal immune homeostasis through crosstalk with the gut microbiota. The conversion of bile acids by the gut microbiome is now recognized as a factor affecting both host metabolism and immune responses, but its physiological roles remain unclear. We conducted a screen for microbiome metabolites that would function as inflammasome activators and herein report the identification of 12-oxo-lithocholic acid, (BAA485), a potential microbiome-derived bile acid metabolite. We demonstrate the more potent analog 11-oxo-12S-hydroxy lithocholic acid methyl ester (BAA473) can induce secretion of interleukin-18 (IL18) through activation of the inflammasome in both myeloid and intestinal epithelial cells. Using a genome-wide clustered regularly interspaced short palindromic repeats (CRISPR) screen with compound induced pyroptosis in THP-1 cells, we identified inflammasome activation by BAA473 is Pyrin-dependent (MEFV). To our knowledge, the bile acid analogues BAA485 and BAA473 are the first small molecule activators of the Pyrin inflammasome. We surmise that Pyrin inflammasome activation through microbiota-modified bile acid metabolites such as BAA473 and BAA485 plays a role in gut microbiota regulated intestinal immune response. The discovery of these two bioactive compounds may help further unveil the importance of Pyrin in gut homeostasis and autoimmune diseases.},
}
@article {pmid30643127,
year = {2019},
author = {Nakamura, M and Srinivasan, P and Chavez, M and Carter, MA and Dominguez, AA and La Russa, M and Lau, MB and Abbott, TR and Xu, X and Zhao, D and Gao, Y and Kipniss, NH and Smolke, CD and Bondy-Denomy, J and Qi, LS},
title = {Anti-CRISPR-mediated control of gene editing and synthetic circuits in eukaryotic cells.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {194},
doi = {10.1038/s41467-018-08158-x},
pmid = {30643127},
issn = {2041-1723},
mesh = {Bacteriophages/*genetics ; CRISPR-Cas Systems/*genetics ; Cell Culture Techniques ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Eukaryotic Cells ; Gene Editing/*methods ; Gene Regulatory Networks/*genetics ; Genetic Vectors/genetics ; HEK293 Cells ; Humans ; Induced Pluripotent Stem Cells ; Intravital Microscopy/methods ; Lentivirus/genetics ; Microscopy, Fluorescence/methods ; Time-Lapse Imaging/methods ; Transduction, Genetic/methods ; Transfection/methods ; },
abstract = {Repurposed CRISPR-Cas molecules provide a useful tool set for broad applications of genomic editing and regulation of gene expression in prokaryotes and eukaryotes. Recent discovery of phage-derived proteins, anti-CRISPRs, which serve to abrogate natural CRISPR anti-phage activity, potentially expands the ability to build synthetic CRISPR-mediated circuits. Here, we characterize a panel of anti-CRISPR molecules for expanded applications to counteract CRISPR-mediated gene activation and repression of reporter and endogenous genes in various cell types. We demonstrate that cells pre-engineered with anti-CRISPR molecules become resistant to gene editing, thus providing a means to generate &quot;write-protected&quot; cells that prevent future gene editing. We further show that anti-CRISPRs can be used to control CRISPR-based gene regulation circuits, including implementation of a pulse generator circuit in mammalian cells. Our work suggests that anti-CRISPR proteins should serve as widely applicable tools for synthetic systems regulating the behavior of eukaryotic cells.},
}
@article {pmid30642460,
year = {2019},
author = {Javed, MR and Noman, M and Shahid, M and Ahmed, T and Khurshid, M and Rashid, MH and Ismail, M and Sadaf, M and Khan, F},
title = {Current situation of biofuel production and its enhancement by CRISPR/Cas9-mediated genome engineering of microbial cells.},
journal = {Microbiological research},
volume = {219},
number = {},
pages = {1-11},
doi = {10.1016/j.micres.2018.10.010},
pmid = {30642460},
issn = {1618-0623},
mesh = {Bacteria/*genetics/metabolism ; *Biofuels ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Fungi/*genetics/metabolism ; Gene Editing/*methods ; Genetic Engineering/*methods ; Genome, Bacterial/genetics ; Genome, Fungal/genetics ; Renewable Energy ; },
abstract = {Geopolitical and economic factors have motivated the scientific community to utilize renewable energy resources. In addition to the modifications in major steps and processes of biofuel production, manipulation of microbial genome engineering tools is essential in order to find sustainable solution of continuous depletion of fossil-fuels. Recently, the CRISPR (clustered regularly interspaced short palindromic repeat)/Cas9 (CRISPR-associated nuclease 9), a prokaryotic molecular immunity system, has emerged as a novel technology for targeted genomic engineering. This genetic machinery seems to be a groundbreaking discovery to engineer the microbial genomes for desired traits such as enhancing the biofuel tolerance, inhibitor tolerance and thermotolerance as well as modifying the cellulases and hemicelluloses enzymes. In this review, a summary of different generations of biofuels, integrated processes of bioconversion of raw materials into biofuels and role of microbes in biofuel production has been presented. However, the ultimate focus of the review is on major discoveries of CRISPR/Cas9-mediated genome editing in microorganisms and exploitation of these discoveries for enhanced biofuel production.},
}
@article {pmid30639735,
year = {2019},
author = {Gürtler, S and Wolke, C and Otto, O and Heise, N and Scholz, F and Laporte, A and Elsner, M and Jörns, A and Weinert, S and Döring, M and Jansing, S and Gardemann, A and Lendeckel, U and Schild, L},
title = {Tafazzin-dependent cardiolipin composition in C6 glioma cells correlates with changes in mitochondrial and cellular functions, and cellular proliferation.},
journal = {Biochimica et biophysica acta. Molecular and cell biology of lipids},
volume = {1864},
number = {4},
pages = {452-465},
doi = {10.1016/j.bbalip.2019.01.006},
pmid = {30639735},
issn = {1879-2618},
abstract = {The mitochondrial phospholipid cardiolipin (CL) has been implicated with mitochondrial morphology, function and, more recently, with cellular proliferation. Tafazzin, an acyltransferase with key functions in CL remodeling determining actual CL composition, affects mitochondrial oxidative phosphorylation. Here, we show that the CRISPR-Cas9 mediated knock-out of tafazzin (Taz) is associated with substantial alterations of various mitochondrial and cellular characteristics in C6 glioma cells. The knock-out of tafazzin substantially changed the profile of fatty acids incorporated in CL and the distribution of molecular CL species. Taz knock-out was further associated with decreased capacity of oxidative phosphorylation that mainly originates from impaired complex I associated energy metabolism in C6 glioma cells. The lack of tafazzin switched energy metabolism from oxidative phosphorylation to glycolysis indicated by lower respiration rates, membrane potential and higher levels of mitochondria-derived reactive oxygen species but keeping the cellular ATP content unchanged. The impact of tafazzin on mitochondria was also indicated by altered morphology and arrangement in tafazzin deficient C6 glioma cells. In the cells we observed tafazzin-dependent changes in the distribution of cellular fatty acids as an indication of altered lipid metabolism as well as in stability/morphology. Most impressive is the dramatic reduction in cell proliferation in tafazzin deficient C6 glioma cells that is not mediated by reactive oxygen species. Our data clearly indicate that defects in CL phospholipid remodeling trigger a cascade of events including modifications in CL linked to subsequent alterations in mitochondrial and cellular functions.},
}
@article {pmid30639408,
year = {2019},
author = {Takeshita, D and Sato, M and Inanaga, H and Numata, T},
title = {Crystal Structures of Csm2 and Csm3 in the Type III-A CRISPR-Cas Effector Complex.},
journal = {Journal of molecular biology},
volume = {431},
number = {4},
pages = {748-763},
doi = {10.1016/j.jmb.2019.01.009},
pmid = {30639408},
issn = {1089-8638},
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR) loci and CRISPR-associated (Cas) genes encode CRISPR RNAs (crRNA) and Cas proteins, respectively, which play important roles in the adaptive immunity system (CRISPR-Cas system) in prokaryotes. The crRNA and Cas proteins form ribonucleoprotein effector complexes to capture and degrade invading genetic materials with base complementarity to the crRNA guide sequences. The Csm complex, a type III-A effector complex, comprises five Cas proteins (Csm1-Csm5) and a crRNA, which co-transcriptionally degrades invading DNA and RNA. Here we report the crystal structures of the Staphylococcus epidermidis Csm2 (SeCsm2) and Thermoplasma volcanium Csm3 (TvCsm3) at 2.4- and 2.7-Å resolutions, respectively. SeCsm2 adopts a monomeric globular fold by itself, in striking contrast to the previously reported Thermotoga maritima Csm2, which adopted an extended conformation and formed a dimeric structure. We propose that the globular monomeric form is the bona fide structure of Csm2. TvCsm3 forms a filamentous structure in the crystals. The molecular arrangement of TvCsm3 is similar to that of the stacked Cmr4 proteins in the Cmr complex, suggesting the functionally relevant architecture of the present Csm3 structure. We constructed model structures of the Csm complex, which revealed that Csm3 binds the crRNA and periodically deforms the crRNA-target duplex by a similar mechanism to that of Cmr4 in the Cmr complex. The model and mutational analysis suggest that the conserved lysine residue of Csm2 is important for target RNA binding, and Csm2 stabilizes the active structure of the Csm complex to facilitate the reaction.},
}
@article {pmid30639240,
year = {2019},
author = {Swarts, DC and Jinek, M},
title = {Mechanistic Insights into the cis- and trans-Acting DNase Activities of Cas12a.},
journal = {Molecular cell},
volume = {73},
number = {3},
pages = {589-600.e4},
doi = {10.1016/j.molcel.2018.11.021},
pmid = {30639240},
issn = {1097-4164},
abstract = {CRISPR-Cas12a (Cpf1) is an RNA-guided DNA-cutting nuclease that has been repurposed for genome editing. Upon target DNA binding, Cas12a cleaves both the target DNA in cis and non-target single-stranded DNAs (ssDNAs) in trans. To elucidate the molecular basis for both DNase cleavage modes, we performed structural and biochemical studies on Francisella novicida Cas12a. We show that guide RNA-target strand DNA hybridization conformationally activates Cas12a, triggering its trans-acting, non-specific, single-stranded DNase activity. In turn, cis cleavage of double-stranded DNA targets is a result of protospacer adjacent motif (PAM)-dependent DNA duplex unwinding, electrostatic stabilization of the displaced non-target DNA strand, and ordered sequential cleavage of the non-target and target DNA strands. Cas12a releases the PAM-distal DNA cleavage product and remains bound to the PAM-proximal DNA cleavage product in a catalytically competent, trans-active state. Together, these results provide a revised model for the molecular mechanisms of both the cis- and the trans-acting DNase activities of Cas12a enzymes, enabling their further exploitation as genome editing tools.},
}
@article {pmid30637337,
year = {2018},
author = {Bayer, K and Jahn, MT and Slaby, BM and Moitinho-Silva, L and Hentschel, U},
title = {Marine Sponges as Chloroflexi Hot Spots: Genomic Insights and High-Resolution Visualization of an Abundant and Diverse Symbiotic Clade.},
journal = {mSystems},
volume = {3},
number = {6},
pages = {},
doi = {10.1128/mSystems.00150-18},
pmid = {30637337},
issn = {2379-5077},
abstract = {Members of the widespread bacterial phylum Chloroflexi can dominate high-microbial-abundance (HMA) sponge microbiomes. In the Sponge Microbiome Project, Chloroflexi sequences amounted to 20 to 30% of the total microbiome of certain HMA sponge genera with the classes/clades SAR202, Caldilineae, and Anaerolineae being the most prominent. We performed metagenomic and single-cell genomic analyses to elucidate the functional gene repertoire of Chloroflexi symbionts of Aplysina aerophoba. Eighteen draft genomes were reconstructed and placed into phylogenetic context of which six were investigated in detail. Common genomic features of Chloroflexi sponge symbionts were related to central energy and carbon converting pathways, amino acid and fatty acid metabolism, and respiration. Clade-specific metabolic features included a massively expanded genomic repertoire for carbohydrate degradation in Anaerolineae and Caldilineae genomes, but only amino acid utilization by SAR202. While Anaerolineae and Caldilineae import cofactors and vitamins, SAR202 genomes harbor genes encoding components involved in cofactor biosynthesis. A number of features relevant to symbiosis were further identified, including CRISPR-Cas systems, eukaryote-like repeat proteins, and secondary metabolite gene clusters. Chloroflexi symbionts were visualized in the sponge extracellular matrix at ultrastructural resolution by the fluorescence in situ hybridization-correlative light and electron microscopy (FISH-CLEM) method. Carbohydrate degradation potential was reported previously for &quot;Candidatus Poribacteria&quot; and SAUL, typical symbionts of HMA sponges, and we propose here that HMA sponge symbionts collectively engage in degradation of dissolved organic matter, both labile and recalcitrant. Thus, sponge microbes may not only provide nutrients to the sponge host, but they may also contribute to dissolved organic matter (DOM) recycling and primary productivity in reef ecosystems via a pathway termed the sponge loop. IMPORTANCEChloroflexi represent a widespread, yet enigmatic bacterial phylum with few cultivated members. We used metagenomic and single-cell genomic approaches to characterize the functional gene repertoire of Chloroflexi symbionts in marine sponges. The results of this study suggest clade-specific metabolic specialization and that Chloroflexi symbionts have the genomic potential for dissolved organic matter (DOM) degradation from seawater. Considering the abundance and dominance of sponges in many benthic environments, we predict that the role of sponge symbionts in biogeochemical cycles is larger than previously thought.},
}
@article {pmid30635671,
year = {2019},
author = {Schuster, JA and Vogel, RF and Ehrmann, MA},
title = {Characterization and distribution of CRISPR-Cas systems in Lactobacillus sakei.},
journal = {Archives of microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00203-019-01619-x},
pmid = {30635671},
issn = {1432-072X},
support = {18552 N//AiF/ ; },
abstract = {Clustered regularly interspaced palindromic repeats (CRISPR)-Cas (CRISPR-associated) structures, known as prokaryotes 'immune system', have been successfully applied for genetic engineering and genotyping purposes for a variety of microorganisms. Here we investigated 50 Lactobacillus (L.) sakei genomes and found 13 of them as CRISPR-Cas positive. The majority of positive genomes contain type II-A system, which appears to be widespread across food born lactic acid bacteria. However, a type II-C system with low similarity in Cas protein sequence to related II-C structures is rarely present in the genomes. We depicted a correlation between prophages integrated in the genomes and the presence/absence of CRISPR-Cas systems and identified the novel protospacer adjunction motifs (PAMs) (a/g)AAA for the II-A and (g/a)(c/t)AC for the II-C system including the corresponding tracrRNAs, creating the basis for the development of new Cas-mediated genome editing tools. Moreover, we performed a PCR screening for 81 selected L. sakei isolates and identified 25 (31%) isolates as CRISPR-Cas positive with hypervariable spacer content. Comparative sequence analysis of 33 repeat-spacer arrays resulted in 18 CRISPR genotypes, revealing insights into evolutionary relationships between different strains and illustrating possible applications for the research and development of starter cultures, e.g., the usage for strain differentiation in assertiveness experiments or the development of bacteriophage-resistant strains.},
}
@article {pmid30633905,
year = {2019},
author = {Oakes, BL and Fellmann, C and Rishi, H and Taylor, KL and Ren, SM and Nadler, DC and Yokoo, R and Arkin, AP and Doudna, JA and Savage, DF},
title = {CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification.},
journal = {Cell},
volume = {176},
number = {1-2},
pages = {254-267.e16},
doi = {10.1016/j.cell.2018.11.052},
pmid = {30633905},
issn = {1097-4172},
support = {DP2 EB018658/EB/NIBIB NIH HHS/United States ; K99 GM118909/GM/NIGMS NIH HHS/United States ; R00 GM118909/GM/NIGMS NIH HHS/United States ; },
abstract = {The ability to engineer natural proteins is pivotal to a future, pragmatic biology. CRISPR proteins have revolutionized genome modification, yet the CRISPR-Cas9 scaffold is not ideal for fusions or activation by cellular triggers. Here, we show that a topological rearrangement of Cas9 using circular permutation provides an advanced platform for RNA-guided genome modification and protection. Through systematic interrogation, we find that protein termini can be positioned adjacent to bound DNA, offering a straightforward mechanism for strategically fusing functional domains. Additionally, circular permutation enabled protease-sensing Cas9s (ProCas9s), a unique class of single-molecule effectors possessing programmable inputs and outputs. ProCas9s can sense a wide range of proteases, and we demonstrate that ProCas9 can orchestrate a cellular response to pathogen-associated protease activity. Together, these results provide a toolkit of safer and more efficient genome-modifying enzymes and molecular recorders for the advancement of precision genome engineering in research, agriculture, and biomedicine.},
}
@article {pmid30628160,
year = {2019},
author = {Hai, L and Szwarc, MM and Lanza, DG and Heaney, JD and Lydon, JP},
title = {Using CRISPR/Cas9 engineering to generate a mouse with a conditional knockout allele for the promyelocytic leukemia zinc finger transcription factor.},
journal = {Genesis (New York, N.Y. : 2000)},
volume = {},
number = {},
pages = {e23281},
doi = {10.1002/dvg.23281},
pmid = {30628160},
issn = {1526-968X},
support = {P30 CA125123//National Institutes of Health/ ; HD042311//National Institutes of Health/ ; P30 CA125123//National Institutes of Health Cancer Center Grant/ ; U42 HG0063521//Knockout Mouse Project (KOMP3)/ ; R01 HD042311/HD/NICHD NIH HHS/United States ; U42 HG0063521//Knockout Mouse Project/ ; HD042311//National Institutes of Health/National Institute of Child Health and Human Development/ ; },
abstract = {The promyelocytic leukemia zinc finger (PLZF) transcription factor mediates a wide-range of biological processes. Accordingly, perturbation of PLZF function results in a myriad of physiologic defects, the most conspicuous of which is abnormal skeletal patterning. Although whole body knockout of Plzf in the mouse (Plzf KO) has significantly expanded our understanding of Plzf function in vivo, a conditional knockout mouse model that enables tissue or cell-type specific ablation of Plzf has not been developed. Therefore, we used CRISPR/Cas 9 gene editing to generate a mouse model in which exon 2 of the murine Plzf gene is specifically flanked (or floxed) by LoxP sites (Plzf f/f). Crossing our Plzf f/f mouse with a global cre-driver mouse to generate the Plzf d/d bigenic mouse, we demonstrate that exon 2 of the Plzf gene is ablated in the Plzf d/d bigenic. Similar to the previously reported Plzf KO mouse, the Plzf d/d mouse exhibits a severe defect in skeletal patterning of the hindlimb, indicating that the Plzf f/f mouse functions as designed. Therefore, studies in this short technical report demonstrate that the Plzf f/f mouse will be useful to investigators who wish to explore the role of the Plzf transcription factor in a specific tissue or cell-type.},
}
@article {pmid30622340,
year = {2019},
author = {Domenici, G and Aurrekoetxea-Rodríguez, I and Simões, BM and Rábano, M and Lee, SY and Millán, JS and Comaills, V and Oliemuller, E and López-Ruiz, JA and Zabalza, I and Howard, BA and Kypta, RM and Vivanco, MD},
title = {A Sox2-Sox9 signalling axis maintains human breast luminal progenitor and breast cancer stem cells.},
journal = {Oncogene},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41388-018-0656-7},
pmid = {30622340},
issn = {1476-5594},
support = {PI14/01328//Ministry of Economy and Competitiveness | Instituto de Salud Carlos III (Institute of Health Carlos III)/ ; SAF2017-84934-R//Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness)/ ; SAF2017-90604-REDT//Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness)/ ; SAF2017-84092-R//Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness)/ ; },
abstract = {Increased cancer stem cell content during development of resistance to tamoxifen in breast cancer is driven by multiple signals, including Sox2-dependent activation of Wnt signalling. Here, we show that Sox2 increases and estrogen reduces the expression of the transcription factor Sox9. Gain and loss of function assays indicate that Sox9 is implicated in the maintenance of human breast luminal progenitor cells. CRISPR/Cas knockout of Sox9 reduces growth of tamoxifen-resistant breast tumours in vivo. Mechanistically, Sox9 acts downstream of Sox2 to control luminal progenitor cell content and is required for expression of the cancer stem cell marker ALDH1A3 and Wnt signalling activity. Sox9 is elevated in breast cancer patients after endocrine therapy failure. This new regulatory axis highlights the relevance of SOX family transcription factors as potential therapeutic targets in breast cancer.},
}
@article {pmid30621855,
year = {2019},
author = {Homanics, GE},
title = {Gene-edited CRISPy Critters for alcohol research.},
journal = {Alcohol (Fayetteville, N.Y.)},
volume = {74},
number = {},
pages = {11-19},
doi = {10.1016/j.alcohol.2018.03.001},
pmid = {30621855},
issn = {1873-6823},
support = {R37 AA010422/AA/NIAAA NIH HHS/United States ; U01 AA020889/AA/NIAAA NIH HHS/United States ; },
abstract = {Genetically engineered animals are powerful tools that have provided invaluable insights into mechanisms of alcohol action and alcohol-use disorder. Traditionally, production of gene-targeted animals was a tremendously expensive, time consuming, and technically demanding undertaking. However, the recent advent of facile methods for editing the genome at very high efficiency is revolutionizing how these animals are made. While pioneering approaches to create gene-edited animals first used zinc finger nucleases and subsequently used transcription activator-like effector nucleases, these approaches have been largely supplanted in an extremely short period of time with the recent discovery and precocious maturation of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system. CRISPR uses a short RNA sequence to guide a non-specific CRISPR-associated nuclease (Cas) to a precise, single location in the genome. Because the CRISPR/Cas system can be cheaply, rapidly, and easily reprogrammed to target nearly any genomic locus of interest simply by recoding the sequence of the guide RNA, this gene-editing system has been rapidly adopted by numerous labs around the world. With CRISPR/Cas, it is now possible to perform gene editing directly in early embryos from every species of animals that is of interest to the alcohol field. Techniques have been developed that enable the rapid production of animals in which a gene has been inactivated (knockout) or modified to harbor specific nucleotide changes (knockins). This system has also been used to insert specific DNA sequences such as reporter or recombinase genes into specific loci of interest. Genetically engineered animals created with the CRISPR/Cas system (CRISPy Critters) are being produced at an astounding pace. Animal production is no longer a significant bottleneck to new discoveries. CRISPy animal studies are just beginning to appear in the alcohol literature, but their use is expected to explode in the near future. CRISPy mice, rats, and other model organisms are sure to facilitate advances in our understanding of alcohol-use disorder.},
}
@article {pmid30619231,
year = {2018},
author = {Berges, M and Michel, AM and Lassek, C and Nuss, AM and Beckstette, M and Dersch, P and Riedel, K and Sievers, S and Becher, D and Otto, A and Maaß, S and Rohde, M and Eckweiler, D and Borrero-de Acuña, JM and Jahn, M and Neumann-Schaal, M and Jahn, D},
title = {Iron Regulation in Clostridioides difficile.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {3183},
doi = {10.3389/fmicb.2018.03183},
pmid = {30619231},
issn = {1664-302X},
abstract = {The response to iron limitation of several bacteria is regulated by the ferric uptake regulator (Fur). The Fur-regulated transcriptional, translational and metabolic networks of the Gram-positive, pathogen Clostridioides difficile were investigated by a combined RNA sequencing, proteomic, metabolomic and electron microscopy approach. At high iron conditions (15 μM) the C. difficile fur mutant displayed a growth deficiency compared to wild type C. difficile cells. Several iron and siderophore transporter genes were induced by Fur during low iron (0.2 μM) conditions. The major adaptation to low iron conditions was observed for the central energy metabolism. Most ferredoxin-dependent amino acid fermentations were significantly down regulated (had, etf, acd, grd, trx, bdc, hbd). The substrates of these pathways phenylalanine, leucine, glycine and some intermediates (phenylpyruvate, 2-oxo-isocaproate, 3-hydroxy-butyryl-CoA, crotonyl-CoA) accumulated, while end products like isocaproate and butyrate were found reduced. Flavodoxin (fldX) formation and riboflavin biosynthesis (rib) were enhanced, most likely to replace the missing ferredoxins. Proline reductase (prd), the corresponding ion pumping RNF complex (rnf) and the reaction product 5-aminovalerate were significantly enhanced. An ATP forming ATPase (atpCDGAHFEB) of the F0F1-type was induced while the formation of a ATP-consuming, proton-pumping V-type ATPase (atpDBAFCEKI) was decreased. The [Fe-S] enzyme-dependent pyruvate formate lyase (pfl), formate dehydrogenase (fdh) and hydrogenase (hyd) branch of glucose utilization and glycogen biosynthesis (glg) were significantly reduced, leading to an accumulation of glucose and pyruvate. The formation of [Fe-S] enzyme carbon monoxide dehydrogenase (coo) was inhibited. The fur mutant showed an increased sensitivity to vancomycin and polymyxin B. An intensive remodeling of the cell wall was observed, Polyamine biosynthesis (spe) was induced leading to an accumulation of spermine, spermidine, and putrescine. The fur mutant lost most of its flagella and motility. Finally, the CRISPR/Cas and a prophage encoding operon were downregulated. Fur binding sites were found upstream of around 20 of the regulated genes. Overall, adaptation to low iron conditions in C. difficile focused on an increase of iron import, a significant replacement of iron requiring metabolic pathways and the restructuring of the cell surface for protection during the complex adaptation phase and was only partly directly regulated by Fur.},
}
@article {pmid30616324,
year = {2018},
author = {Wang, YD and Liang, QF and Li, ZY and Zhao, CY},
title = {[Application of clustered regularly interspaced short palindromic repeats- associated protein 9 gene editing technology for treatment of HBV infection].},
journal = {Zhonghua gan zang bing za zhi = Zhonghua ganzangbing zazhi = Chinese journal of hepatology},
volume = {26},
number = {11},
pages = {860-864},
doi = {10.3760/cma.j.issn.1007-3418.2018.11.012},
pmid = {30616324},
issn = {1007-3418},
mesh = {CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; *Gene Editing ; Hepatitis B/*therapy ; *Hepatitis B virus ; Virus Replication ; },
abstract = {A lack of effective drugs and technical means to eradicate hepatitis B virus (HBV) is a bottleneck that limits the ability to fully cure HBV infection. Recently, genome-editing technology based on clustered regularly interspaced short palindromic repeats -associated protein 9 is an emerging technique for editing specific gene loci, which can specifically target HBV covalently closed circular DNA, effectively inhibits HBV DNA replication and regulates HBV functional protein expression, and is expected to become a powerful gene therapy tool for the complete eradication of HBV. Considering this, it has become the focus of attention for scholars at home and abroad that how to use clustered regularly interspaced short palindromic repeats -associated protein 9 to accomplish modification of HBV genomes for complete eradication of HBV. This paper summarizes the latest progress based on the latest research results at home and abroad in the application of clustered regularly interspaced short palindromic repeats -associated protein 9 gene editing technology in anti-HBV infection treatment, and expounds its potential and challenges as a radical cure for HBV infection.},
}
@article {pmid30615645,
year = {2019},
author = {Price, MA and Cruz, R and Baxter, S and Escalettes, F and Rosser, SJ},
title = {CRISPR-Cas9 In Situ engineering of subtilisin E in Bacillus subtilis.},
journal = {PloS one},
volume = {14},
number = {1},
pages = {e0210121},
doi = {10.1371/journal.pone.0210121},
pmid = {30615645},
issn = {1932-6203},
abstract = {CRISPR-Cas systems have become widely used across all fields of biology as a genome engineering tool. With its recent demonstration in the Gram positive industrial workhorse Bacillus subtilis, this tool has become an attractive option for rapid, markerless strain engineering of industrial production hosts. Previously described strategies for CRISPR-Cas9 genome editing in B. subtilis have involved chromosomal integrations of Cas9 and single guide RNA expression cassettes, or construction of large plasmids for simultaneous transformation of both single guide RNA and donor DNA. Here we use a flexible, co-transformation approach where the single guide RNA is inserted in a plasmid for Cas9 co-expression, and the donor DNA is supplied as a linear PCR product observing an editing efficiency of 76%. This allowed multiple, rapid rounds of in situ editing of the subtilisin E gene to incorporate a salt bridge triad present in the Bacillus clausii thermotolerant homolog, M-protease. A novel subtilisin E variant was obtained with increased thermotolerance and activity.},
}
@article {pmid30613384,
year = {2018},
author = {Conboy, I and Murthy, N and Etienne, J and Robinson, Z},
title = {Making gene editing a therapeutic reality.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
doi = {10.12688/f1000research.16106.1},
pmid = {30613384},
issn = {2046-1402},
support = {R01 EB023776/EB/NIBIB NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Gene Editing/*methods ; Genetic Therapy/*methods ; Humans ; Muscular Dystrophy, Duchenne/genetics ; Myotonic Dystrophy/genetics ; },
abstract = {This review discusses current bottlenecks in making CRISPR-Cas9-mediated genome editing a therapeutic reality and it outlines recent strategies that aim to overcome these hurdles as well as the scope of current clinical trials that pioneer the medical translation of CRISPR-Cas9. Additionally, this review outlines the specifics of disease-modifying gene editing in recessive versus dominant genetic diseases with the focus on genetic myopathies that are exemplified by Duchenne muscular dystrophy and myotonic dystrophies.},
}
@article {pmid30611840,
year = {2019},
author = {Li, J and Handler, AM},
title = {CRISPR/Cas9-mediated gene editing in an exogenous transgene and an endogenous sex determination gene in the Caribbean fruit fly, Anastrepha suspensa.},
journal = {Gene},
volume = {691},
number = {},
pages = {160-166},
doi = {10.1016/j.gene.2018.12.055},
pmid = {30611840},
issn = {1879-0038},
mesh = {Animals ; CRISPR-Cas Systems ; DNA End-Joining Repair ; Female ; Gene Editing/*methods ; *Genes, Insect ; Germ-Line Mutation ; Green Fluorescent Proteins/genetics/metabolism ; Male ; Phenotype ; Sequence Deletion ; Tephritidae/genetics/*growth &amp; development ; *Transgenes ; },
abstract = {CRISPR/Cas9-mediated gene-editing, using injected Cas9 protein, was achieved in the Caribbean fruit fly, Anastrepha suspensa, by initially targeting an exogenous transgene, polyubiquitin-regulated EGFP (PUb-EGFP), for heritable non-homologous end-joining (NHEJ) knock-outs using an individual sgRNA. Multiple deletion mutations, ranging from two to five nts proximal to the target site, were identified phenotypically by the loss of green fluorescence in transgenic flies that were also marked with PUb-DsRed. This represented a relatively high efficiency rate of 29% for germ-line mutations. Similar conditions were then used to target an endogenous sex-determination gene, As-transformer-2 (Astra-2), using two sgRNAs that targeted independent exon sequences 671 bp apart. Somatic mutations were identified phenotypically in G0 adult flies at a frequency of 81% based upon intersexual genital morphology, expected to occur only in XX females since Astra-2 knock-outs by dsRNA do not have a phenotypic effect in XY males. Consistent with this expectation, twelve types of short indels, ranging from -15 nts to +5 nts, were identified proximal to the 5' sgRNA-1 target site in intersexual adults. However, the 3' sgRNA-2 target was only associated with a single 774 bp deletion extending from the sgRNA-1 target site to 100 bp downstream of the sgRNA-2 target. This is encouraging for the eventual use of dual target sites for homology-directed repair (HDR) insertions, but suggests that the sgRNA-2 target site tested may not be optimal for Astra-2 HDR modification.},
}
@article {pmid30610648,
year = {2019},
author = {Park, J and Choi, S and Park, S and Yoon, J and Park, AY and Choe, S},
title = {DNA-Free Genome Editing via Ribonucleoprotein (RNP) Delivery of CRISPR/Cas in Lettuce.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1917},
number = {},
pages = {337-354},
doi = {10.1007/978-1-4939-8991-1_25},
pmid = {30610648},
issn = {1940-6029},
abstract = {CRISPR/Cas9 nuclease system is getting popular in precise genome editing of both eukaryotic and prokaryotic systems due to its accuracy, programmability, and relative ease of use. CRISPR/Cas systems can be delivered into live cells via plasmid DNA, RNA, and ribonucleoprotein (RNP). Of these, the RNP method is of special interest due to enzymatic action in shorter time and controllability over their activity. In addition, because RNP does not involve DNA, none of unwanted DNA footprints are left in the host genome. Previously, we demonstrated that plant protoplasts can be transfected with functional RNPs and the whole plants can be regenerated from an engineered protoplast. Relative to the published methods, the revised protocols described here should help increase the success rate of whole plant regeneration by reducing damages to the naked protoplast cells.},
}
@article {pmid30610633,
year = {2019},
author = {Lee, K and Zhu, H and Yang, B and Wang, K},
title = {An Agrobacterium-Mediated CRISPR/Cas9 Platform for Genome Editing in Maize.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1917},
number = {},
pages = {121-143},
doi = {10.1007/978-1-4939-8991-1_10},
pmid = {30610633},
issn = {1940-6029},
abstract = {Precise genome engineering can be efficiently made using the revolutionary tool named CRISPR/Cas (clustered regularly interspaced short palindromic repeat/CRISPR-associated protein) systems. Adapted from the bacterial immune system, CRISPR/Cas systems can generate highly specific double-strand breaks (DSBs) at the target site, and desired sequence modifications can be introduced during the DSB repair process, such as nonhomologous end-joining (NHEJ) or homology-directed repair (HDR) pathways. CRISPR/Cas9 is the most widely used genome editing tool for targeted mutagenesis, precise sequence modification, transcriptional reprogramming, epigenome editing, disease treatment, and many more. The ease of use and high specificity make CRISPR/Cas9 a great tool not only for basic researches but also for crop trait improvements, such as higher grain yield, better tolerance to abiotic stresses, enhanced disease resistance, and better nutritional contents. In this protocol, we present a step-by-step guide to the CRISPR/Cas9-mediated targeted mutagenesis in maize Hi II genotype. Detailed procedures will guide through the essential steps including gRNA design, CRISPR/Cas9 vector construction, Agrobacterium-mediated maize immature embryo transformation, and molecular analysis of the transgenic plants to identify desired mutant lines.},
}
@article {pmid30607331,
year = {2018},
author = {Bayat, H and Naderi, F and Khan, AH and Memarnejadian, A and Rahimpour, A},
title = {The Impact of CRISPR-Cas System on Antiviral Therapy.},
journal = {Advanced pharmaceutical bulletin},
volume = {8},
number = {4},
pages = {591-597},
doi = {10.15171/apb.2018.067},
pmid = {30607331},
issn = {2228-5881},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein nuclease (Cas) is identified as an adaptive immune system in archaea and bacteria. Type II of this system, CRISPR-Cas9, is the most versatile form that has enabled facile and efficient targeted genome editing. Viral infections have serious impacts on global health and conventional antiviral therapies have not yielded a successful solution hitherto. The CRISPR-Cas9 system represents a promising tool for eliminating viral infections. In this review, we highlight 1) the recent progress of CRISPR-Cas technology in decoding and diagnosis of viral outbreaks, 2) its applications to eliminate viral infections in both pre-integration and provirus stages, and 3) various delivery systems that are employed to introduce the platform into target cells.},
}
@article {pmid30606466,
year = {2019},
author = {Liu, L and Yin, M and Wang, M and Wang, Y},
title = {Phage AcrIIA2 DNA Mimicry: Structural Basis of the CRISPR and Anti-CRISPR Arms Race.},
journal = {Molecular cell},
volume = {73},
number = {3},
pages = {611-620.e3},
doi = {10.1016/j.molcel.2018.11.011},
pmid = {30606466},
issn = {1097-4164},
abstract = {CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins) systems provide prokaryotic cells with adaptive immunity against invading bacteriophages. Bacteriophages counteract bacterial responses by encoding anti-CRISPR inhibitor proteins (Acr). However, the structural basis for their inhibitory actions remains largely unknown. Here, we report the crystal structure of the AcrIIA2-SpyCas9-sgRNA (single-guide RNA) complex at 3.3 Å resolution. We show that AcrIIA2 binds SpyCas9 at a position similar to the target DNA binding region. More specifically, AcrIIA2 interacts with the protospacer adjacent motif (PAM) recognition residues of Cas9, preventing target double-stranded DNA (dsDNA) detection. Thus, phage-encoded AcrIIA2 appears to act as a DNA mimic that blocks subsequent dsDNA binding by virtue of its highly acidic residues, disabling bacterial Cas9 by competing with target dsDNA binding with a binding motif distinct from AcrIIA4. Our study provides a more detailed mechanistic understanding of AcrIIA2-mediated inhibition of SpyCas9, the most widely used genome-editing tool, opening new avenues for improved regulatory precision during genome editing.},
}
@article {pmid30598579,
year = {2018},
author = {Araújo, T and Khayat, A and Quintana, L and Calcagno, D and Mourão, R and Modesto, A and Paiva, J and Lima, A and Moreira, F and Oliveira, E and Souza, M and Othman, M and Liehr, T and Abdelhay, E and Gomes, R and Santos, S and Assumpção, P},
title = {Piwi like RNA-mediated gene silencing 1 gene as a possible major player in gastric cancer.},
journal = {World journal of gastroenterology},
volume = {24},
number = {47},
pages = {5338-5350},
doi = {10.3748/wjg.v24.i47.5338},
pmid = {30598579},
issn = {2219-2840},
mesh = {Argonaute Proteins/genetics/*metabolism ; CRISPR-Cas Systems ; Carcinogenesis/genetics ; Cell Line, Tumor ; Cell Movement/genetics ; Cell Proliferation/genetics ; Gene Expression Profiling ; *Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; Humans ; Neoplasm Invasiveness/genetics ; Signal Transduction/*genetics ; Stomach Neoplasms/*genetics/pathology ; },
abstract = {AIM: To establish a permanent piwi like RNA-mediated gene silencing 1 (PIWIL1) gene knockout in AGP01 gastric cancer cell line using CRISPR-Cas9 system and analyze phenotypic modifications as well as gene expression alterations.<br><br>METHODS: CRISPR-Cas9 system used was purchased from Dharmacon GE Life Sciences (Lafayette, CO, United States) and permanent knockout was performed according to manufacturer's recommendations. Wound-healing assay was performed to investigate the effect of PIWIL1 knockout on migration capability of cells and Boyden chamber invasion assay was performed to investigate the effect on invasion capability. For the gene expression analysis, a one-color microarray-based gene expression analysis kit (Agilent Technologies, Santa Clara, CA, United States) was used according to the protocol provided by the manufacturer.<br><br>RESULTS: PIWIL1 gene knockout caused a significant decrease in AGP01 migration capacity as well as a significant decrease in cell invasiveness. Moreover, functional analysis based on grouping of all differentially expressed mRNAs identified a total of 35 genes (5 up-regulated and 30 down-regulated) encoding proteins involved in cellular invasion and migration. According to current literature, 9 of these 35 genes (DOCK2, ZNF503, PDE4D, ABL1, ABL2, LPAR1, SMAD2, WASF3 and DACH1) are possibly related to the mechanisms used by PIWIL1 to promote carcinogenic effects related to migration and invasion, since their functions are consistent with the changes observed (being up- or down-regulated after knockout).<br><br>CONCLUSION: Taken together, these data reinforce the idea that PIWIL1 plays a crucial role in the signaling pathway of gastric cancer, regulating several genes involved in migration and invasion processes; therefore, its use as a therapeutic target may generate promising results in the treatment of gastric cancer.},
}
@article {pmid30595438,
year = {2019},
author = {Jiang, F and Liu, JJ and Osuna, BA and Xu, M and Berry, JD and Rauch, BJ and Nogales, E and Bondy-Denomy, J and Doudna, JA},
title = {Temperature-Responsive Competitive Inhibition of CRISPR-Cas9.},
journal = {Molecular cell},
volume = {73},
number = {3},
pages = {601-610.e5},
doi = {10.1016/j.molcel.2018.11.016},
pmid = {30595438},
issn = {1097-4164},
support = {P01 GM051487/GM/NIGMS NIH HHS/United States ; R35 GM127018/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas immune systems utilize RNA-guided nucleases to protect bacteria from bacteriophage infection. Bacteriophages have in turn evolved inhibitory &quot;anti-CRISPR&quot; (Acr) proteins, including six inhibitors (AcrIIA1-AcrIIA6) that can block DNA cutting and genome editing by type II-A CRISPR-Cas9 enzymes. We show here that AcrIIA2 and its more potent homolog, AcrIIA2b, prevent Cas9 binding to DNA by occluding protein residues required for DNA binding. Cryo-EM-determined structures of AcrIIA2 or AcrIIA2b bound to S. pyogenes Cas9 reveal a mode of competitive inhibition of DNA binding that is distinct from other known Acrs. Differences in the temperature dependence of Cas9 inhibition by AcrIIA2 and AcrIIA2b arise from differences in both inhibitor structure and the local inhibitor-binding environment on Cas9. These findings expand the natural toolbox for regulating CRISPR-Cas9 genome editing temporally, spatially, and conditionally.},
}
@article {pmid30594894,
year = {2019},
author = {Fang, L and Hung, SSC and Yek, J and El Wazan, L and Nguyen, T and Khan, S and Lim, SY and Hewitt, AW and Wong, RCB},
title = {A Simple Cloning-free Method to Efficiently Induce Gene Expression Using CRISPR/Cas9.},
journal = {Molecular therapy. Nucleic acids},
volume = {14},
number = {},
pages = {184-191},
doi = {10.1016/j.omtn.2018.11.008},
pmid = {30594894},
issn = {2162-2531},
abstract = {Gain-of-function studies often require the tedious cloning of transgene cDNA into vectors for overexpression beyond the physiological expression levels. The rapid development of CRISPR/Cas technology presents promising opportunities to address these issues. Here, we report a simple, cloning-free method to induce gene expression at an endogenous locus using CRISPR/Cas9 activators. Our strategy utilizes synthesized sgRNA expression cassettes to direct a nuclease-null Cas9 complex fused with transcriptional activators (VP64, p65, and Rta) for site-specific induction of endogenous genes. This strategy allows rapid initiation of gain-of-function studies in the same day. Using this approach, we tested two CRISPR activation systems, dSpCas9VPR and dSaCas9VPR, for induction of multiple genes in human and rat cells. Our results showed that both CRISPR activators allow efficient induction of six different neural development genes (CRX, RORB, RAX, OTX2, ASCL1, and NEUROD1) in human cells, whereas the rat cells exhibit more variable and less-efficient levels of gene induction, as observed in three different genes (Ascl1, Neurod1, Nrl). Altogether, this study provides a simple method to efficiently activate endogenous gene expression using CRISPR/Cas9 activators, which can be applied as a rapid workflow to initiate gain-of-function studies for a range of molecular- and cell-biology disciplines.},
}
@article {pmid30587106,
year = {2018},
author = {Hwang, GH and Park, J and Lim, K and Kim, S and Yu, J and Yu, E and Kim, ST and Eils, R and Kim, JS and Bae, S},
title = {Web-based design and analysis tools for CRISPR base editing.},
journal = {BMC bioinformatics},
volume = {19},
number = {1},
pages = {542},
doi = {10.1186/s12859-018-2585-4},
pmid = {30587106},
issn = {1471-2105},
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Editing/*methods ; Humans ; Internet/*instrumentation ; },
abstract = {BACKGROUND: As a result of its simplicity and high efficiency, the CRISPR-Cas system has been widely used as a genome editing tool. Recently, CRISPR base editors, which consist of deactivated Cas9 (dCas9) or Cas9 nickase (nCas9) linked with a cytidine or a guanine deaminase, have been developed. Base editing tools will be very useful for gene correction because they can produce highly specific DNA substitutions without the introduction of any donor DNA, but dedicated web-based tools to facilitate the use of such tools have not yet been developed.<br><br>RESULTS: We present two web tools for base editors, named BE-Designer and BE-Analyzer. BE-Designer provides all possible base editor target sequences in a given input DNA sequence with useful information including potential off-target sites. BE-Analyzer, a tool for assessing base editing outcomes from next generation sequencing (NGS) data, provides information about mutations in a table and interactive graphs. Furthermore, because the tool runs client-side, large amounts of targeted deep sequencing data (< 1 GB) do not need to be uploaded to a server, substantially reducing running time and increasing data security. BE-Designer and BE-Analyzer can be freely accessed at http://www.rgenome.net/be-designer/ and http://www.rgenome.net/be-analyzer /, respectively.<br><br>CONCLUSION: We develop two useful web tools to design target sequence (BE-Designer) and to analyze NGS data from experimental results (BE-Analyzer) for CRISPR base editors.},
}
@article {pmid30586440,
year = {2018},
author = {Cheleuitte-Nieves, C and Gulvik, CA and McQuiston, JR and Humrighouse, BW and Bell, ME and Villarma, A and Fischetti, VA and Westblade, LF and Lipman, NS},
title = {Genotypic differences between strains of the opportunistic pathogen Corynebacterium bovis isolated from humans, cows, and rodents.},
journal = {PloS one},
volume = {13},
number = {12},
pages = {e0209231},
doi = {10.1371/journal.pone.0209231},
pmid = {30586440},
issn = {1932-6203},
abstract = {Corynebacterium bovis is an opportunistic bacterial pathogen shown to cause eye and prosthetic joint infections as well as abscesses in humans, mastitis in dairy cattle, and skin disease in laboratory mice and rats. Little is known about the genetic characteristics and genomic diversity of C. bovis because only a single draft genome is available for the species. The overall aim of this study was to sequence and compare the genome of C. bovis isolates obtained from different species, locations, and time points. Whole-genome sequencing was conducted on 20 C. bovis isolates (six human, four bovine, nine mouse and one rat) using the Illumina MiSeq platform and submitted to various comparative analysis tools. Sequencing generated high-quality contigs (over 2.53 Mbp) that were comparable to the only reported assembly using C. bovis DSM 20582T (97.8 ± 0.36% completeness). The number of protein-coding DNA sequences (2,174 ± 12.4) was similar among all isolates. A Corynebacterium genus neighbor-joining tree was created, which revealed Corynebacterium falsenii as the nearest neighbor to C. bovis (95.87% similarity), although the reciprocal comparison shows Corynebacterium jeikeium as closest neighbor to C. falsenii. Interestingly, the average nucleotide identity demonstrated that the C. bovis isolates clustered by host, with human and bovine isolates clustering together, and the mouse and rat isolates forming a separate group. The average number of genomic islands and putative virulence factors were significantly higher (p<0.001) in the mouse and rat isolates as compared to human/bovine isolates. Corynebacterium bovis' pan-genome contained a total of 3,067 genes of which 1,354 represented core genes. The known core genes of all isolates were primarily related to ''metabolism&quot; and ''information storage/processing.&quot; However, most genes were classified as ''function unknown&quot; or &quot;unclassified&quot;. Surprisingly, no intact prophages were found in any isolate; however, almost all isolates had at least one complete CRISPR-Cas system.},
}
@article {pmid30583753,
year = {2018},
author = {Caux, F},
title = {[What's new in research?].},
journal = {Annales de dermatologie et de venereologie},
volume = {145 Suppl 7},
number = {},
pages = {VIIS17-VIIS23},
doi = {10.1016/S0151-9638(18)31285-7},
pmid = {30583753},
issn = {0151-9638},
abstract = {A traditional lecture given during the annual meeting of the French Society of Dermatology in Paris summarizes the highlights of the scientific literature over the past year. In the current article the selection of the 2017-2018 period retains the following areas of interest: role of microbiome in the response to anti-PD-1 and in autoimmunity, PI3Kδ inhibitors in autoimmune bullous diseases, diagnostic and therapeutic applications of CRISPR/Cas, arrival of CAR-T cells therapy into clinical practice, gene therapy successes, use of targeted therapies in genodermatoses and integration of genetics in primary care. © 2018 Elsevier Masson SAS. All rights reserved.},
}
@article {pmid30583736,
year = {2018},
author = {Häcker, I and Schetelig, MF},
title = {Molecular tools to create new strains for mosquito sexing and vector control.},
journal = {Parasites &amp; vectors},
volume = {11},
number = {Suppl 2},
pages = {645},
doi = {10.1186/s13071-018-3209-6},
pmid = {30583736},
issn = {1756-3305},
mesh = {Aedes/*genetics/physiology ; Animals ; Animals, Genetically Modified ; DNA Transposable Elements/genetics ; Female ; Gene Editing ; Humans ; Infertility, Male ; Male ; Mosquito Control/*methods ; Mosquito Vectors/*genetics/physiology ; Mutagenesis, Site-Directed ; Yellow Fever/*prevention &amp; control/transmission ; },
abstract = {Vector control programs based on population reduction by matings with mass-released sterile insects require the release of only male mosquitoes, as the release of females, even if sterile, would increase the number of biting and potentially disease-transmitting individuals. While small-scale releases demonstrated the applicability of sterile males releases to control the yellow fever mosquito Aedes aegypti, large-scale programs for mosquitoes are currently prevented by the lack of efficient sexing systems in any of the vector species.Different approaches of sexing are pursued, including classical genetic and mechanical methods of sex separation. Another strategy is the development of transgenic sexing systems. Such systems already exist in other insect pests. Genome modification tools could be used to apply similar strategies to mosquitoes. Three major tools to modify mosquito genomes are currently used: transposable elements, site-specific recombination systems, and genome editing via TALEN or CRISPR/Cas. All three can serve the purpose of developing sexing systems and vector control strains in mosquitoes in two ways: first, via their use in basic research. A better understanding of mosquito biology, including the sex-determining pathways and the involved genes can greatly facilitate the development of sexing strains. Moreover, basic research can help to identify other regulatory elements and genes potentially useful for the construction of transgenic sexing systems. Second, these genome modification tools can be used to apply the gained knowledge to build and test mosquito sexing strains for vector control.},
}
@article {pmid30583622,
year = {2018},
author = {Qiu, JR and Su, YK and Song, ZQ and Fang, XS and Li, JY and Zhang, J and Wang, JH},
title = {[Directing construction of CRISPR/Cas9 vector of SmPAL1 in Salvia miltiorrhiza by target efficiency detection in vitro].},
journal = {Zhongguo Zhong yao za zhi = Zhongguo zhongyao zazhi = China journal of Chinese materia medica},
volume = {43},
number = {21},
pages = {4226-4230},
doi = {10.19540/j.cnki.cjcmm.20180726.007},
pmid = {30583622},
issn = {1001-5302},
abstract = {To construct CRISPR/Cas9 vectors for the editing of SmPAL1 in the phenylpropane metabolic pathway of Salvia miltiorrhiza, CIRSPR/Cas9 target sites of SmPAL1 were designed by online software. Its target efficiencies were detected in vitro by enzyme digestion and sequences with highly efficiency were constructed into CRISPR/Cas9 vectors. Three possible CRISPR target sequences (SmPAL1-g1, SmPAL1-g2, SmPAL1-g3) were designed and the enzyme digestion efficiencies were 53.3%, 76.6% and 10.0%. SmPAL1-g1 and SmPAL1-g2 were constructed into vector VK005-03 named as VK005-03-g1 and VK005-03-g2. The results of sequencing showed that the two CRISPR/Cas target sequences were all constructed into VK005-03. Here we first laid the foundation for the study of SmPAL1 and provided an effective strategy for the screening of sgRNA.},
}
@article {pmid30583530,
year = {2018},
author = {da Silva Duarte, V and Giaretta, S and Campanaro, S and Treu, L and Armani, A and Tarrah, A and Oliveira de Paula, S and Giacomini, A and Corich, V},
title = {A Cryptic Non-Inducible Prophage Confers Phage-Immunity on the Streptococcus thermophilus M17PTZA496.},
journal = {Viruses},
volume = {11},
number = {1},
pages = {},
doi = {10.3390/v11010007},
pmid = {30583530},
issn = {1999-4915},
support = {Fapemig//Fundação de Amparo à Pesquisa do Estado de Minas Gerais/ ; CAPES//Coordenacão de Aperfeiçoamento de Pessoal de Nível Superior/ ; CNPq//Conselho Nacional de Desenvolvimento Científico e Tecnológico/ ; SisNANO/MCTI//Sistema Nacional de Laboratórios em Nanotecnologias/Ministério da ciência, tecnologia e Informação/ ; },
abstract = {Streptococcus thermophilus is considered one of the most important species for the dairy industry. Due to their diffusion in dairy environments, bacteriophages can represent a threat to this widely used bacterial species. Despite the presence of a CRISPR-Cas system in the S. thermophilus genome, some lysogenic strains harbor cryptic prophages that can increase the phage-host resistance defense. This characteristic was identified in the dairy strain S. thermophilus M17PTZA496, which contains two integrated prophages 51.8 and 28.3 Kb long, respectively. In the present study, defense mechanisms, such as a lipoprotein-encoding gene and Siphovirus Gp157, the last associated to the presence of a noncoding viral DNA element, were identified in the prophage M17PTZA496 genome. The ability to overexpress genes involved in these defense mechanisms under specific stressful conditions, such as phage attack, has been demonstrated. Despite the addition of increasing amounts of Mitomycin C, M17PTZA496 was found to be non-inducible. However, the transcriptional activity of the phage terminase large subunit was detected in the presence of the antagonist phage vB_SthS-VA460 and of Mitomycin C. The discovery of an additional immune mechanism, associated with bacteriophage-insensitive strains, is of utmost importance, for technological applications and industrial processes. To our knowledge, this is the first study reporting the capability of a prophage integrated into the S. thermophilus genome expressing different phage defense mechanisms. Bacteriophages are widespread entities that constantly threaten starter cultures in the dairy industry. In cheese and yogurt manufacturing, the lysis of Streptococcus thermophilus cultures by viral attacks can lead to huge economic losses. Nowadays S. thermophilus is considered a well-stablished model organism for the study of natural adaptive immunity (CRISPR-Cas) against phage and plasmids, however, the identification of novel bacteriophage-resistance mechanisms, in this species, is strongly desirable. Here, we demonstrated that the presence of a non-inducible prophage confers phage-immunity to an S. thermophilus strain, by the presence of ltp and a viral noncoding region. S. thermophilus M17PTZA496 arises as an unconventional model to study phage resistance and potentially represents an alternative starter strain for dairy productions.},
}
@article {pmid30575746,
year = {2018},
author = {Sanson, KR and Hanna, RE and Hegde, M and Donovan, KF and Strand, C and Sullender, ME and Vaimberg, EW and Goodale, A and Root, DE and Piccioni, F and Doench, JG},
title = {Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5416},
doi = {10.1038/s41467-018-07901-8},
pmid = {30575746},
issn = {2041-1723},
mesh = {CRISPR-Associated Protein 9 ; *CRISPR-Cas Systems ; *Genomic Library ; Streptococcus pyogenes ; },
abstract = {The creation of genome-wide libraries for CRISPR knockout (CRISPRko), interference (CRISPRi), and activation (CRISPRa) has enabled the systematic interrogation of gene function. Here, we show that our recently-described CRISPRko library (Brunello) is more effective than previously published libraries at distinguishing essential and non-essential genes, providing approximately the same perturbation-level performance improvement over GeCKO libraries as GeCKO provided over RNAi. Additionally, we present genome-wide libraries for CRISPRi (Dolcetto) and CRISPRa (Calabrese), and show in negative selection screens that Dolcetto, with fewer sgRNAs per gene, outperforms existing CRISPRi libraries and achieves comparable performance to CRISPRko in detecting essential genes. We also perform positive selection CRISPRa screens and demonstrate that Calabrese outperforms the SAM approach at identifying vemurafenib resistance genes. We further compare CRISPRa to genome-scale libraries of open reading frames (ORFs). Together, these libraries represent a suite of genome-wide tools to efficiently interrogate gene function with multiple modalities.},
}
@article {pmid30575740,
year = {2018},
author = {Zabaleta, N and Barberia, M and Martin-Higueras, C and Zapata-Linares, N and Betancor, I and Rodriguez, S and Martinez-Turrillas, R and Torella, L and Vales, A and Olagüe, C and Vilas-Zornoza, A and Castro-Labrador, L and Lara-Astiaso, D and Prosper, F and Salido, E and Gonzalez-Aseguinolaza, G and Rodriguez-Madoz, JR},
title = {CRISPR/Cas9-mediated glycolate oxidase disruption is an efficacious and safe treatment for primary hyperoxaluria type I.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5454},
doi = {10.1038/s41467-018-07827-1},
pmid = {30575740},
issn = {2041-1723},
mesh = {Alcohol Oxidoreductases/*antagonists &amp; inhibitors/genetics ; Animals ; *CRISPR-Cas Systems ; Disease Models, Animal ; Gene Editing ; Genetic Therapy/*methods ; HEK293 Cells ; Humans ; Hyperoxaluria, Primary/*therapy ; Male ; Mice ; Nephrocalcinosis/prevention &amp; control ; Oxalates/*urine ; },
abstract = {CRISPR/Cas9 technology offers novel approaches for the development of new therapies for many unmet clinical needs, including a significant number of inherited monogenic diseases. However, in vivo correction of disease-causing genes is still inefficient, especially for those diseases without selective advantage for corrected cells. We reasoned that substrate reduction therapies (SRT) targeting non-essential enzymes could provide an attractive alternative. Here we evaluate the therapeutic efficacy of an in vivo CRISPR/Cas9-mediated SRT to treat primary hyperoxaluria type I (PH1), a rare inborn dysfunction in glyoxylate metabolism that results in excessive hepatic oxalate production causing end-stage renal disease. A single systemic administration of an AAV8-CRISPR/Cas9 vector targeting glycolate oxidase, prevents oxalate overproduction and kidney damage, with no signs of toxicity in Agxt1-/- mice. Our results reveal that CRISPR/Cas9-mediated SRT represents a promising therapeutic option for PH1 that can be potentially applied to other metabolic diseases caused by the accumulation of toxic metabolites.},
}
@article {pmid30573681,
year = {2019},
author = {Ogawa, S and Matsuoka, Y and Takada, M and Matsui, K and Yamane, F and Kubota, E and Yasuhara, S and Hieda, K and Kanayama, N and Hatano, N and Tokumitsu, H and Magari, M},
title = {Interleukin 34 (IL-34) cell-surface localization regulated by the molecular chaperone 78-kDa glucose-regulated protein facilitates the differentiation of monocytic cells.},
journal = {The Journal of biological chemistry},
volume = {294},
number = {7},
pages = {2386-2396},
doi = {10.1074/jbc.RA118.006226},
pmid = {30573681},
issn = {1083-351X},
abstract = {Interleukin 34 (IL-34) constitutes a cytokine that shares a common receptor, colony-stimulating factor-1 receptor (CSF-1R), with CSF-1. We recently identified a novel type of monocytic cell termed follicular dendritic cell-induced monocytic cells (FDMCs), whose differentiation depended on CSF-1R signaling through the IL-34 produced from a follicular dendritic cell line, FL-Y. Here, we report the functional mechanisms of the IL-34-mediated CSF-1R signaling underlying FDMC differentiation. CRIPSR/Cas9-mediated knockout of the Il34 gene confirmed that the ability of FL-Y cells to induce FDMCs completely depends on the IL-34 expressed by FL-Y cells. Transwell culture experiments revealed that FDMC differentiation requires a signal from a membrane-anchored form of IL-34 on the FL-Y cell surface, but not from a secreted form, in a direct interaction between FDMC precursor cells and FL-Y cells. Furthermore, flow cytometric analysis using an anti-IL-34 antibody indicated that IL-34 was also expressed on the FL-Y cell surface. Thus, we explored proteins interacting with IL-34 in FL-Y cells. Mass spectrometry analysis and pulldown assay identified that IL-34 was associated with the molecular chaperone 78-kDa glucose-regulated protein (GRP78) in the plasma membrane fraction of FL-Y cells. Consistent with this finding, GRP78-heterozygous FL-Y cells expressed a lower level of IL-34 protein on their cell surface and exhibited a reduced competency to induce FDMC differentiation compared with the original FL-Y cells. These results indicated a novel GRP78-dependent localization and specific function of IL-34 in FL-Y cells related to monocytic cell differentiation.},
}
@article {pmid30572690,
year = {2018},
author = {Aman, R and Mahas, A and Butt, H and Aljedaani, F and Mahfouz, M},
title = {Engineering RNA Virus Interference via the CRISPR/Cas13 Machinery in Arabidopsis.},
journal = {Viruses},
volume = {10},
number = {12},
pages = {},
doi = {10.3390/v10120732},
pmid = {30572690},
issn = {1999-4915},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) systems are key immune mechanisms helping prokaryotic species fend off RNA and DNA viruses. CRISPR/Cas9 has broad applications in basic research and biotechnology and has been widely used across eukaryotic species for genome engineering and functional analysis of genes. The recently developed CRISPR/Cas13 systems target RNA rather than DNA and thus offer new potential for transcriptome engineering and combatting RNA viruses. Here, we used CRISPR/LshCas13a to stably engineer Arabidopsis thaliana for interference against the RNA genome of Turnip mosaic virus (TuMV). Our data demonstrate that CRISPR RNAs (crRNAs) guiding Cas13a to the sequences encoding helper component proteinase silencing suppressor (HC-Pro) or GFP target 2 (GFP-T2) provide better interference compared to crRNAs targeting other regions of the TuMV RNA genome. This work demonstrates the exciting potential of CRISPR/Cas13 to be used as an antiviral strategy to obstruct RNA viruses, and encourages the search for more robust and effective Cas13 variants or CRISPR systems that can target RNA.},
}
@article {pmid30572386,
year = {2018},
author = {Liang, WJ and Cui, CC and Duan, GC and Liu, HY and Xu, YK and Xi, YL and Yang, HY and Chen, SY},
title = {[Identification and evaluation on methods with upstream flank sequences of CRISPR1, regarding Escherichia coli and Shigella].},
journal = {Zhonghua liu xing bing xue za zhi = Zhonghua liuxingbingxue zazhi},
volume = {39},
number = {12},
pages = {1607-1610},
doi = {10.3760/cma.j.issn.0254-6450.2018.12.013},
pmid = {30572386},
issn = {0254-6450},
support = {2013ZX10004607//National Science and Technology Major Project of China/ ; XTCX-2015-PY4//Henan Innovation Center of Molecular Diagnosis and Laboratory Medicine/ ; XYBSKYZZ201805//Doctor Initiated Project Xinxiang Medical University/ ; },
mesh = {Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; DNA, Bacterial/*genetics ; Escherichia coli/*genetics/isolation &amp; purification ; Genotype ; Humans ; Molecular Sequence Data ; Sequence Analysis, DNA ; Shigella/classification/*genetics/isolation &amp; purification ; },
abstract = {Objective: To analyze the effect of the identification and evaluation of Escherichia (E.) coli and Shigella, based on the upstream flanking sequences of CRISPR1. Methods: Both CRISPR and cas sequences were obtained through the BLAST with repeating sequences against the publicly complete genome in GenBank that related to E. coli and Shigella. Clustal X was used to perform multi-sequences alignment of the flanking sequences. PCR method was used to amplify the upstream flanking sequences of CRISPR1 in order to appraise the effect of identification and evaluation of upstream flanking sequences on E. coli and Shigella, which were based on the upstream flanking sequences of CRISPR1. Results: The results showed that 73.4% of the strains containing the I-E CRISPR/Cas that belonged to the phylogroups A, B1, D while 8.4% strains carried the I-F CRISPR/Cas. Another 17.2% of the strains owned CRISPR3-4 (non-CRISPR/Cas) only belonged to the phylogroups B2. All the Shigella strains carried I-E CRISPR/Cas. More than 99% of similarity the CRISPR1 upstream-flanking sequences was seen in E. coli (except B2) and Shigella and E. coli (B2). Both sensitivity and specificity were greater than 91% after PCR amplification in the region to identify the E.coli and Shigella. Conclusion: The upstream of CRISPR1 could achieve a preliminary identification effect on E.coli and Shigella.},
}
@article {pmid30571788,
year = {2018},
author = {Chakraborty, S and von Mentzer, A and Begum, YA and Manzur, M and Hasan, M and Ghosh, AN and Hossain, MA and Camilli, A and Qadri, F},
title = {Phenotypic and genomic analyses of bacteriophages targeting environmental and clinical CS3-expressing enterotoxigenic Escherichia coli (ETEC) strains.},
journal = {PloS one},
volume = {13},
number = {12},
pages = {e0209357},
doi = {10.1371/journal.pone.0209357},
pmid = {30571788},
issn = {1932-6203},
support = {R01 AI055058/AI/NIAID NIH HHS/United States ; },
abstract = {Diarrhea due to infection of enterotoxigenic Escherichia coli (ETEC) is of great concern in several low and middle-income countries. ETEC infection is considered to be the most common cause of diarrhea in Bangladesh and is mainly spread through contaminated water and food. ETEC pathogenesis is mediated by the expression of enterotoxins and colonization factors (CFs) that target the intestinal mucosa. ETEC can survive for extended time periods in water, where they are likely to be attacked by bacteriophages. Antibiotic resistance is common amongst enteric pathogens and therefore is the use of bacteriophages (phage) as a therapeutic tool an interesting approach. This study was designed to identify novel phages that specifically target ETEC virulence factors. In total, 48 phages and 195 ETEC isolates were collected from water sources and stool samples. Amongst the identified ETEC specific phages, an enterobacteria phage T7, designated as IMM-002, showed a significant specificity towards colonization factor CS3-expressing ETEC isolates. Antibody-blocking and phage-neutralization assays revealed that CS3 is used as a host receptor for the IMM-002 phage. The bacterial CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR-associated) defence mechanism can invoke immunity against phages. Genomic analyses coupled with plaque assay experiments indicate that the ETEC CRISPR-Cas system is involved in the resistance against the CS3-specific phage (IMM-002) and the previously identified CS7-specific phage (IMM-001). As environmental water serves as a reservoir for ETEC, it is important to search for new antimicrobial agents such as phages in environmental water as well as the human gut. A better understanding of how the interplay between ETEC-specific phages and ETEC isolates affects the ETEC diversity, both in environmental ecosystems and within the host, is important for the development of new treatments for ETEC infections.},
}
@article {pmid30569414,
year = {2018},
author = {Dadheech, N and James Shapiro, AM},
title = {Human Induced Pluripotent Stem Cells in the Curative Treatment of Diabetes and Potential Impediments Ahead.},
journal = {Advances in experimental medicine and biology},
volume = {},
number = {},
pages = {},
doi = {10.1007/5584_2018_305},
pmid = {30569414},
issn = {0065-2598},
abstract = {The successful landmark discovery of mouse and human inducible pluripotential stem cells (iPSC's) by Takahashi and Yamanaka in 2006 and 2007 has triggered a revolution in the potential generation of self-compatible cells for regenerative medicine, and further opened up a new avenue for &quot;disease in dish&quot; drug screening of self-target cells (Neofytou et al. 2015). The introduction of four 'Yamanaka' transcription factors through viral or other transfection of mature cells can induce pluripotency and acquired plasticity. These factors include transduction with octamer-binding transcription factor-4 (Oct-4), nanog homeobox (Nanog), sex-determining region Y-box-2 (Sox-2) and MYC protooncogene (cMyc). Such cells become iPSC's (Takahashi and Yamanaka 2006). These reprogrammed cells exhibit increased telomerase activity and have a hypomethylated gene promotor region similar to embryonic stem cells (ESC's). These milestone discoveries have generated immense hope that diseases such as diabetes could be treated and effectively cured by transplantation of self-compatible, personalized autologous stem cell transplantation of β-cells that release physiological insulin under glycemic control (Maehr et al. 2009; Park et al. 2008) (Fig. 1). Diabetes is a profligate disease of disordered glucose metabolism resulting from an absolute or relative deficiency of insulin, the consequences of which lead to immense socio-economic societal burden. While there are many different types of diabetes, the two major types (type 1 diabetes (T1DM) and type 2 diabetes (T2DM) are caused respectively by immune-mediated destruction (T1DM) or malfunctioning (T2DM) insulin-producing β-cells within the endocrine pancreas, the islets of Langerhans (Atkinson et al. 2011; Holman et al. 2015; You and Henneberg 2016). Almost 425 million people are affected by the global burden of diabetes, and this is predicted to increase by 48% (629 million) by 2045 (International Diabetes Federation Atlas 8th Ed 2018). Whole pancreas or islet cell transplantation offer an effective alternative to injected insulin, but both require lifelong potent immunosuppression to control both allo-and autoimmunity. Whole pancreas transplantation involves invasive complex surgery and is associated with greater morbidity and occasional mortality, while islet transplantation involves a minimally invasive intraportal hepatic infusion. Generally, whole pancreas transplantation provides greater metabolic reserve, but this may be matched by cumulative multiple islet infusions to achieve insulin independence. An additional challenge of islet transplantation is progressive loss of complete insulin independence over time, which may be multifactorial, the dominant factor however being ineffective control of autoimmunity. Both whole pancreas and islet transplantation are restricted to patients at risk of severe hypoglycemia that cannot be stabilized by alternate means, or in recipients that are already immunosuppressed in order to sustain a kidney or other solid organ transplant. The risks of chronic immunosuppression and the scarcity of human organ donors mean that both of these transplantation therapies cannot presently be extended to the broader diabetic population (Shapiro 2011; Shapiro et al. 2006). Recent progress in xenotransplantation of multiple knock-out 'humanized' pig islets could offer one potential solution, perhaps aided by clustered regularly interspaced short palindromic repeats/CRISPR associated-9 (CRISPR/Cas-9) gene editing approaches, but this remains to be proven in practice. Human stem cell derived new β-cell products could effectively address the global supply challenge for broad application across all forms of diabetes, but recurrent autoimmunity may still remain an insurmountable challenge. Considerable progress in the generation of human stem cell derived SC-β cells from ESC, iPS and other adult cell sources such as mesenchymal stem cells (MSCs) offer huge hope that a personalized, 'syngeneic' cell could be transplanted without risk of alloimmunity, thereby securing sufficient supply to meet future global demand (Cito et al. 2018). Fig. 1 Schematic representation of inducible pluripotent stem cell (iPSC) generation from somatic cells and their application in the patient-specific iPSC-based personalized-medicine based diabetes therapy. Disease-free iPSCs may be potentially generated from healthy individual- or diabetic patient-derived somatic cells using reprogramming with viral, DNA-, RNA-, protein-, miRNA-, or small molecule-mediated reprogramming systems. iPSC's derived from patients can be further differentiated into insulin-secreting pancreatic for transplantation into patients with diabetes for cell-based therapy.},
}
@article {pmid30568213,
year = {2018},
author = {Knoepfler, P},
title = {Gene editing: sloppy definitions mislead.},
journal = {Nature},
volume = {564},
number = {7736},
pages = {345},
doi = {10.1038/d41586-018-07802-2},
pmid = {30568213},
issn = {1476-4687},
mesh = {CRISPR-Cas Systems ; *Gene Editing ; *Genome ; },
}
@article {pmid30566855,
year = {2018},
author = {Li, B and Zeng, C and Li, W and Zhang, X and Luo, X and Zhao, W and Zhang, C and Dong, Y},
title = {Synthetic Oligonucleotides Inhibit CRISPR-Cpf1-Mediated Genome Editing.},
journal = {Cell reports},
volume = {25},
number = {12},
pages = {3262-3272.e3},
doi = {10.1016/j.celrep.2018.11.079},
pmid = {30566855},
issn = {2211-1247},
support = {R01 HL136652/HL/NHLBI NIH HHS/United States ; },
abstract = {Previously, researchers discovered a series of anti-CRISPR proteins that inhibit CRISPR-Cas activity, such as Cas9 and Cpf1 (Cas12a). Herein, we constructed crRNA variants consisting of chemically modified DNA-crRNA and RNA-crRNA duplexes and identified that phosphorothioate (PS)-modified DNA-crRNA duplex completely blocked the function of Cpf1. More important, without prehybridization, these PS-modified DNA oligonucleotides showed the ability to suppress DNA double-strand breaks induced by two Cpf1 orthologs, AsCpf1 and LbCpf1. Time-dependent inhibitory effects were validated in multiple loci of different human cells. Further studies demonstrated that PS-modified DNA oligonucleotides were able to serve as Cpf1 inhibitors in a sequence-independent manner. Mechanistic studies indicate that PS-modified DNA oligonucleotides hinder target DNA binding and recognition by Cpf1. Consequently, these synthetic DNA molecules expand the sources of CRISPR inhibitors, providing a platform to inactivate Cpf1-mediated genome editing.},
}
@article {pmid30560399,
year = {2019},
author = {Hryhorowicz, M and Grześkowiak, B and Mazurkiewicz, N and Śledziński, P and Lipiński, D and Słomski, R},
title = {Improved Delivery of CRISPR/Cas9 System Using Magnetic Nanoparticles into Porcine Fibroblast.},
journal = {Molecular biotechnology},
volume = {61},
number = {3},
pages = {173-180},
doi = {10.1007/s12033-018-0145-9},
pmid = {30560399},
issn = {1559-0305},
support = {INNOMED/I/17/NCBR/2014//Narodowe Centrum Badań i Rozwoju/ ; },
abstract = {Genetically modified pigs play an important role in agriculture and biomedical research; hence, new efficient methods are needed to obtain genetically engineered cells and animals. The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas (CRISPR-associated) system represents an effective genome editing tool. It consists of two key molecules: single guide RNA (sgRNA) and the Cas9 endonuclease that can be introduced into the cells as one plasmid. Typical delivery methods for CRISPR/Cas9 components are limited by low transfection efficiency or toxic effects on cells. Here, we describe the use of magnetic nanoparticles and gradient magnetic field to improve delivery of CRISPR/Cas9 constructs into porcine fetal fibroblasts. Polyethylenimine-coated nanoparticles with magnetic iron oxide core were used to form magnetic plasmid DNA lipoplexes. CRISPR/Cas9 construct was prepared to induce site-specific cutting at the porcine H11 locus. Quantitative assessment of genomic cleavage by sequence trace decomposition demonstrated that the magnetofection efficiency was more than 3.5 times higher compared to the classic lipofection method. The Tracking of Indels by Decomposition web tool precisely determined the spectrum of indels that occurred. Simultaneously, no additional cytotoxicity associated with the utilization of magnetic nanoparticles was observed. Our results indicate that magnetofection enables effective delivery of the CRISPR/Cas9 construct into porcine fetal fibroblasts with low cell toxicity.},
}
@article {pmid30559443,
year = {2018},
author = {Becker, JR and Cuella-Martin, R and Barazas, M and Liu, R and Oliveira, C and Oliver, AW and Bilham, K and Holt, AB and Blackford, AN and Heierhorst, J and Jonkers, J and Rottenberg, S and Chapman, JR},
title = {The ASCIZ-DYNLL1 axis promotes 53BP1-dependent non-homologous end joining and PARP inhibitor sensitivity.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5406},
doi = {10.1038/s41467-018-07855-x},
pmid = {30559443},
issn = {2041-1723},
support = {//Wellcome Trust/United Kingdom ; },
mesh = {Animals ; BRCA1 Protein/*genetics ; Breast Neoplasms/genetics/pathology ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cytoplasmic Dyneins/*metabolism ; DNA Breaks, Double-Stranded ; DNA End-Joining Repair/*genetics ; Female ; Genomic Instability/genetics ; HEK293 Cells ; Humans ; MCF-7 Cells ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Poly(ADP-ribose) Polymerase Inhibitors/*pharmacology ; Transcription Factors/*metabolism ; Tumor Suppressor p53-Binding Protein 1/*genetics ; },
abstract = {53BP1 controls a specialized non-homologous end joining (NHEJ) pathway that is essential for adaptive immunity, yet oncogenic in BRCA1 mutant cancers. Intra-chromosomal DNA double-strand break (DSB) joining events during immunoglobulin class switch recombination (CSR) require 53BP1. However, in BRCA1 mutant cells, 53BP1 blocks homologous recombination (HR) and promotes toxic NHEJ, resulting in genomic instability. Here, we identify the protein dimerization hub-DYNLL1-as an organizer of multimeric 53BP1 complexes. DYNLL1 binding stimulates 53BP1 oligomerization, and promotes 53BP1's recruitment to, and interaction with, DSB-associated chromatin. Consequently, DYNLL1 regulates 53BP1-dependent NHEJ: CSR is compromised upon deletion of Dynll1 or its transcriptional regulator Asciz, or by mutation of DYNLL1 binding motifs in 53BP1; furthermore, Brca1 mutant cells and tumours are rendered resistant to poly-ADP ribose polymerase (PARP) inhibitor treatments upon deletion of Dynll1 or Asciz. Thus, our results reveal a mechanism that regulates 53BP1-dependent NHEJ and the therapeutic response of BRCA1-deficient cancers.},
}
@article {pmid30558714,
year = {2018},
author = {Faure, JD and Napier, JA},
title = {Europe's first and last field trial of gene-edited plants?.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
doi = {10.7554/eLife.42379},
pmid = {30558714},
issn = {2050-084X},
support = {BBS/E/C/000I0420//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {On 5 June this year the first field trial of a CRISPR-Cas-9 gene-edited crop began at Rothamsted Research in the UK, having been approved by the UK Department for Environment, Food &amp; Rural Affairs. However, in late July 2018, after the trial had started, the European Court of Justice ruled that techniques such as gene editing fall within the European Union's 2001 GMO directive, meaning that our gene-edited Camelina plants should be considered as genetically modified (GM). Here we describe our experience of running this trial and the legal transformation of our plants. We also consider the future of European plant research using gene-editing techniques, which now fall under the burden of GM regulation, and how this will likely impede translation of publicly funded basic research.},
}
@article {pmid30555080,
year = {2018},
author = {Turner, AN and Andersen, RS and Bookout, IE and Brashear, LN and Davis, JC and Gahan, DM and Davis, JC and Gotham, JP and Hijaz, BA and Kaushik, AS and Mcgill, JB and Miller, VL and Moseley, ZP and Nowell, CL and Patel, RK and Rodgers, MC and Patel, RK and Shihab, YA and Walker, AP and Glover, SR and Foster, SD and Challa, AK},
title = {Analysis of novel domain-specific mutations in the zebrafish ndr2/cyclops gene generated using CRISPR-Cas9 RNPs.},
journal = {Journal of genetics},
volume = {97},
number = {5},
pages = {1315-1325},
pmid = {30555080},
issn = {0973-7731},
mesh = {Amino Acid Sequence ; Animals ; Base Sequence ; Binding Sites/genetics ; *CRISPR-Cas Systems ; Embryo, Nonmammalian/embryology/metabolism ; Holoprosencephaly/genetics ; Intracellular Signaling Peptides and Proteins/chemistry/*genetics ; Models, Molecular ; *Mutation ; Phenotype ; Protein Domains ; Ribonucleoproteins/*genetics/metabolism ; Zebrafish/embryology/genetics/metabolism ; Zebrafish Proteins/chemistry/*genetics ; },
abstract = {Nodal-related protein (ndr2) is amember of the transforming growth factor type β superfamily of factors and is required for ventral midline patterning of the embryonic central nervous system in zebrafish. In humans, mutations in the gene encoding nodal cause holoprosencephaly and heterotaxy. Mutations in the ndr2 gene in the zebrafish (Danio rerio) lead to similar phenotypes, including loss of the medial floor plate, severe deficits in ventral forebrain development and cyclopia. Alleles of the ndr2 gene have been useful in studying patterning of ventral structures of the central nervous system. Fifteen different ndr2 alleles have been reported in zebrafish, of which eight were generated using chemical mutagenesis, four were radiation-induced and the remaining alleles were obtained via random insertion, gene targeting (TALEN) or unknown methods. Therefore, most mutation sites were random and could not be predicted a priori. Using the CRISPR-Cas9 system from Streptococcus pyogenes, we targeted distinct regions in all three exons of zebrafish ndr2 and observed cyclopia in the injected (G0) embryos.We show that the use of sgRNA-Cas9 ribonucleoprotein (RNP) complexes can cause penetrant cyclopic phenotypes in injected (G0) embryos. Targeted polymerase chain reaction amplicon analysis using Sanger sequencing showed that most of the alleles had small indels resulting in frameshifts. The sequence information correlates with the loss of ndr2 activity. In this study, we validate multiple CRISPR targets using an in vitro nuclease assay and in vivo analysis using embryos. We describe one specific mutant allele resulting in the loss of conserved terminal cysteine-coding sequences. This study is another demonstration of the utility of the CRISPR-Cas9 system in generating domain-specific mutations and provides further insights into the structure-function of the ndr2 gene.},
}
@article {pmid30548045,
year = {2018},
author = {Tong, Y and Weber, T and Lee, SY},
title = {CRISPR/Cas-based genome engineering in natural product discovery.},
journal = {Natural product reports},
volume = {},
number = {},
pages = {},
doi = {10.1039/c8np00089a},
pmid = {30548045},
issn = {1460-4752},
abstract = {Covering: up to February, 2018This review briefly introduces and summarizes current knowledge about the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) - CRISPR/Cas system and how it was engineered to become one of the most important and versatile genome editing techniques that are currently revolutionizing the whole field of molecular biology. It aims to highlight and discuss the applications and remaining challenges of CRISPR/Cas (mainly focusing on CRISPR/SpCas9)-based genome editing in natural product discovery. The organisms covered include bacteria such as Streptomyces, Corynebacteria, and Myxobacteria; filamentous fungi such as Aspergillus, Beauveria, and Ganoderma; microalgae; and some plants. As closing remarks, the prospects of using CRISPR/Cas in natural product discovery will be discussed.},
}
@article {pmid30546095,
year = {2019},
author = {Fineran, PC},
title = {CRISPR-Cas impedes archaeal mating.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {2-3},
doi = {10.1038/s41564-018-0326-0},
pmid = {30546095},
issn = {2058-5276},
}
@article {pmid30545858,
year = {2018},
author = {Dzau, VJ and McNutt, M and Bai, C},
title = {Wake-up call from Hong Kong.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6420},
pages = {1215},
doi = {10.1126/science.aaw3127},
pmid = {30545858},
issn = {1095-9203},
mesh = {*CRISPR-Cas Systems ; Gene Editing/*ethics/*standards ; *Genome, Human ; Hong Kong ; Humans ; Stakeholder Participation ; },
}
@article {pmid30544778,
year = {2018},
author = {Mayo-Muñoz, D and He, F and Jørgensen, JB and Madsen, PK and Bhoobalan-Chitty, Y and Peng, X},
title = {Anti-CRISPR-Based and CRISPR-Based Genome Editing of Sulfolobus islandicus Rod-Shaped Virus 2.},
journal = {Viruses},
volume = {10},
number = {12},
pages = {},
doi = {10.3390/v10120695},
pmid = {30544778},
issn = {1999-4915},
abstract = {Genetic engineering of viruses has generally been challenging. This is also true for archaeal rod-shaped viruses, which carry linear double-stranded DNA genomes with hairpin ends. In this paper, we describe two different genome editing approaches to mutate the Sulfolobus islandicus rod-shaped virus 2 (SIRV2) using the archaeon Sulfolobus islandicus LAL14/1 and its derivatives as hosts. The anti-CRISPR (Acr) gene acrID1, which inhibits CRISPR-Cas subtype I-D immunity, was first used as a selection marker to knock out genes from SIRV2M, an acrID1-null mutant of SIRV2. Moreover, we harnessed the endogenous CRISPR-Cas systems of the host to knock out the accessory genes consecutively, which resulted in a genome comprised solely of core genes of the 11 SIRV members. Furthermore, infection of this series of knockout mutants in the CRISPR-null host of LAL14/1 (Δarrays) confirmed the non-essentiality of the deleted genes and all except the last deletion mutant propagated as efficiently as the WT SIRV2. This suggested that the last gene deleted, SIRV2 gp37, is important for the efficient viral propagation. The generated viral mutants will be useful for future functional studies including searching for new Acrs and the approaches described in this case are applicable to other viruses.},
}
@article {pmid30523088,
year = {2018},
author = {Normile, D},
title = {For China, a CRISPR first goes too far.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6419},
pages = {1091},
doi = {10.1126/science.362.6419.1091},
pmid = {30523088},
issn = {1095-9203},
mesh = {*Bioethical Issues ; *CRISPR-Cas Systems ; China ; Disease Resistance/*genetics ; Gene Editing/*ethics ; HIV Infections/genetics ; Humans ; *Public Policy ; },
}
@article {pmid30523087,
year = {2018},
author = {Cohen, J},
title = {What now for human genome editing?.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6419},
pages = {1090-1092},
doi = {10.1126/science.362.6419.1090},
pmid = {30523087},
issn = {1095-9203},
mesh = {*Bioethical Issues ; *CRISPR-Cas Systems ; China ; Disease Resistance ; Gene Editing/*ethics ; *Genome, Human ; HIV Infections/genetics ; Humans ; *Social Control, Formal ; },
}
@article {pmid30523077,
year = {2019},
author = {Yan, WX and Hunnewell, P and Alfonse, LE and Carte, JM and Keston-Smith, E and Sothiselvam, S and Garrity, AJ and Chong, S and Makarova, KS and Koonin, EV and Cheng, DR and Scott, DA},
title = {Functionally diverse type V CRISPR-Cas systems.},
journal = {Science (New York, N.Y.)},
volume = {363},
number = {6422},
pages = {88-91},
doi = {10.1126/science.aav7271},
pmid = {30523077},
issn = {1095-9203},
abstract = {Type V CRISPR-Cas systems are distinguished by a single RNA-guided RuvC domain-containing effector, Cas12. Although effectors of subtypes V-A (Cas12a) and V-B (Cas12b) have been studied in detail, the distinct domain architectures and diverged RuvC sequences of uncharacterized Cas12 proteins suggest unexplored functional diversity. Here, we identify and characterize Cas12c, -g, -h, and -i. Cas12c, -h, and -i demonstrate RNA-guided double-stranded DNA (dsDNA) interference activity. Cas12i exhibits markedly different efficiencies of CRISPR RNA spacer complementary and noncomplementary strand cleavage resulting in predominant dsDNA nicking. Cas12g is an RNA-guided ribonuclease (RNase) with collateral RNase and single-strand DNase activities. Our study reveals the functional diversity emerging along different routes of type V CRISPR-Cas evolution and expands the CRISPR toolbox.},
}
@article {pmid30540754,
year = {2018},
author = {Ramanagoudr-Bhojappa, R and Carrington, B and Ramaswami, M and Bishop, K and Robbins, GM and Jones, M and Harper, U and Frederickson, SC and Kimble, DC and Sood, R and Chandrasekharappa, SC},
title = {Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility.},
journal = {PLoS genetics},
volume = {14},
number = {12},
pages = {e1007821},
doi = {10.1371/journal.pgen.1007821},
pmid = {30540754},
issn = {1553-7404},
mesh = {Animals ; CRISPR-Cas Systems ; DNA Damage ; Fanconi Anemia/*genetics/physiopathology ; Female ; Fertility/genetics/physiology ; Frameshift Mutation ; Gene Knockout Techniques ; Humans ; Male ; Phenotype ; RNA Splicing/genetics ; Sex Determination Processes/genetics/physiology ; Sexual Development/genetics/physiology ; Zebrafish/*genetics/growth &amp; development/physiology ; Zebrafish Proteins/genetics/physiology ; },
abstract = {Fanconi Anemia (FA) is a genomic instability syndrome resulting in aplastic anemia, developmental abnormalities, and predisposition to hematological and other solid organ malignancies. Mutations in genes that encode proteins of the FA pathway fail to orchestrate the repair of DNA damage caused by DNA interstrand crosslinks. Zebrafish harbor homologs for nearly all known FA genes. We used multiplexed CRISPR/Cas9-mediated mutagenesis to generate loss-of-function mutants for 17 FA genes: fanca, fancb, fancc, fancd1/brca2, fancd2, fance, fancf, fancg, fanci, fancj/brip1, fancl, fancm, fancn/palb2, fanco/rad51c, fancp/slx4, fancq/ercc4, fanct/ube2t, and two genes encoding FA-associated proteins: faap100 and faap24. We selected two indel mutations predicted to cause premature truncations for all but two of the genes, and a total of 36 mutant lines were generated for 19 genes. Generating two independent mutant lines for each gene was important to validate their phenotypic consequences. RT-PCR from homozygous mutant fish confirmed the presence of transcripts with indels in all genes. Interestingly, 4 of the indel mutations led to aberrant splicing, which may produce a different protein than predicted from the genomic sequence. Analysis of RNA is thus critical in proper evaluation of the consequences of the mutations introduced in zebrafish genome. We used fluorescent reporter assay, and western blots to confirm loss-of-function for several mutants. Additionally, we developed a DEB treatment assay by evaluating morphological changes in embryos and confirmed that homozygous mutants from all the FA genes that could be tested (11/17), displayed hypersensitivity and thus were indeed null alleles. Our multiplexing strategy helped us to evaluate 11 multiple gene knockout combinations without additional breeding. Homozygous zebrafish for all 19 single and 11 multi-gene knockouts were adult viable, indicating FA genes in zebrafish are generally not essential for early development. None of the mutant fish displayed gross developmental abnormalities except for fancp-/- fish, which were significantly smaller in length than their wildtype clutch mates. Complete female-to-male sex reversal was observed in knockouts for 12/17 FA genes, while partial sex reversal was seen for the other five gene knockouts. All adult females were fertile, and among the adult males, all were fertile except for the fancd1 mutants and one of the fancj mutants. We report here generation and characterization of zebrafish knockout mutants for 17 FA disease-causing genes, providing an integral resource for understanding the pathophysiology associated with the disrupted FA pathway.},
}
@article {pmid30523254,
year = {2018},
author = {Yamaguchi, H and Hopf, FW and Li, SB and de Lecea, L},
title = {In vivo cell type-specific CRISPR knockdown of dopamine beta hydroxylase reduces locus coeruleus evoked wakefulness.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5211},
pmid = {30523254},
issn = {2041-1723},
support = {R01 AG047671/AG/NIA NIH HHS/United States ; R01 MH087592/MH/NIMH NIH HHS/United States ; R01 MH102638/MH/NIMH NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Dopamine beta-Hydroxylase/*genetics/metabolism ; Electric Stimulation ; Female ; Locus Coeruleus/cytology/*metabolism/physiology ; Male ; Mice ; Mice, Knockout ; Mice, Transgenic ; NIH 3T3 Cells ; Neurons/metabolism/physiology ; Norepinephrine/metabolism ; Sleep/genetics/physiology ; Wakefulness/*genetics/physiology ; },
abstract = {Locus coeruleus (LC) neurons in the brainstem have long been associated with attention and arousal. Optogenetic stimulation of LC-NE neurons induces immediate sleep-to-wake transitions. However, LC neurons also secrete other neurotransmitters in addition to NE. To interrogate the role of NE derived from the LC in regulating wakefulness, we applied in vivo cell type-specific CRISPR/Cas9 technology to disrupt the dopamine beta hydroxylase (dbh) gene selectively in adult LC-NE neurons. Unilateral dbh gene disruption abolished immediate arousal following optogenetic stimulation of LC. Bilateral LC-specific dbh disruption significantly reduced NE concentration in LC projection areas and reduced wake length even in the presence of salient stimuli. These results suggest that NE may be crucial for the awakening effect of LC stimulation and serve as proof-of-principle that CRISPR gene editing in adult neurons can be used to interrogate gene function within genetically-defined neuronal circuitry associated with complex behaviors.},
}
@article {pmid30530241,
year = {2018},
author = {Goh, YJ and Barrangou, R},
title = {Harnessing CRISPR-Cas systems for precision engineering of designer probiotic lactobacilli.},
journal = {Current opinion in biotechnology},
volume = {56},
number = {},
pages = {163-171},
doi = {10.1016/j.copbio.2018.11.009},
pmid = {30530241},
issn = {1879-0429},
abstract = {Our evolving understanding on the mechanisms underlying the health-promoting attributes of probiotic lactobacilli, together with an expanding genome editing toolbox have made this genus an ideal chassis for the development of living therapeutics. The rising adoption of CRISPR-based technologies for prokaryotic engineering has demonstrated precise, efficient and scalable genome editing and tunable transcriptional regulation that can be translated into next-generation development of probiotic lactobacilli with enhanced robustness and designer functionalities. Here, we discuss how these tools in conjunction with the naturally abundant and diverse native CRISPR-Cas systems can be harnessed for Lactobacillus cell surface engineering and the delivery of biotherapeutics.},
}
@article {pmid30530202,
year = {2019},
author = {Cheng, R and Gong, L and Li, Z and Liang, YK},
title = {Rice BIG gene is required for seedling viability.},
journal = {Journal of plant physiology},
volume = {232},
number = {},
pages = {39-50},
doi = {10.1016/j.jplph.2018.11.006},
pmid = {30530202},
issn = {1618-1328},
mesh = {Blotting, Western ; CRISPR-Cas Systems ; Cell Death/physiology ; Chlorophyll/metabolism ; Gene Knockdown Techniques ; Genes, Plant/genetics/*physiology ; Lipid Peroxidation ; Oryza/*genetics/metabolism/physiology ; Phylogeny ; Plant Proteins/*genetics/physiology ; Seedlings/*genetics/metabolism/physiology ; Sequence Analysis, DNA ; },
abstract = {Arabidopsis BIG (AtBIG) gene encodes an enormous protein that is required for auxin transport. Loss of AtBIG function not only profoundly changes plant architecture but also alters plant adaptability to environmental stimuli. A putative homolog of AtBIG exists in the rice genome, but no function has been ascribed to it. In this study, we focus on the characterization of the gene structure and function of OsBIG. Sequence and phylogenetic analysis shows that the homologs of OsBIG have high amino acid conservation in several domains across species. Transgenic rice plants in which the expression of OsBIG was disrupted through the CRISPR/Cas9 system-mediated genome editing were used for phenotypic analysis. The Osbig/- plants show high levels of cell death, enhanced electrolyte leakage and membrane lipid peroxidation, and reduced chlorophyll content, which likely accounted for the seedling lethality. Moreover, gene expression between Osbig/- and wild-type plants analyzed by RNA-seq indicates that a number of metabolic and hormonal pathways including ribosome, DNA replication, photosynthesis, and chlorophyll metabolism were significantly perturbed by OsBIG deficiency. In summary, OsBIG gene is integral to the normal growth and development in rice.},
}
@article {pmid30526490,
year = {2018},
author = {Li, X and Ma, Y and Liang, S and Tian, Y and Yin, S and Xie, S and Xie, H},
title = {Comparative genomics of 84 Pectobacterium genomes reveals the variations related to a pathogenic lifestyle.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {889},
pmid = {30526490},
issn = {1471-2164},
support = {BAIC07//Earmarked Fund for Beijing Innovation Consortium of Agriculture Research System/ ; },
abstract = {BACKGROUND: Pectobacterium spp. are necrotrophic bacterial plant pathogens of the family Pectobacteriaceae, responsible for a wide spectrum of diseases of important crops and ornamental plants including soft rot, blackleg, and stem wilt. P. carotovorum is a genetically heterogeneous species consisting of three valid subspecies, P. carotovorum subsp. brasiliense (Pcb), P. carotovorum subsp. carotovorum (Pcc), and P. carotovorum subsp. odoriferum (Pco).<br><br>RESULTS: Thirty-two P. carotovorum strains had their whole genomes sequenced, including the first complete genome of Pco and another circular genome of Pcb, as well as the high-coverage genome sequences for 30 additional strains covering Pcc, Pcb, and Pco. In combination with 52 other publicly available genome sequences, the comparative genomics study of P. carotovorum and other four closely related species P. polaris, P. parmentieri, P. atrosepticum, and Candidatus P. maceratum was conducted focusing on CRISPR-Cas defense systems and pathogenicity determinants. Our analysis identified two CRISPR-Cas types (I-F and I-E) in Pectobacterium, as well as another I-C type in Dickeya that is not found in Pectobacterium. The core pathogenicity factors (e.g., plant cell wall-degrading enzymes) were highly conserved, whereas some factors (e.g., flagellin, siderophores, polysaccharides, protein secretion systems, and regulatory factors) were varied among these species and/or subspecies. Notably, a novel type of T6SS as well as the sorbitol metabolizing srl operon was identified to be specific to Pco in Pectobacterium.<br><br>CONCLUSIONS: This study not only advances the available knowledge about the genetic differentiation of individual subspecies of P. carotovorum, but also delineates the general genetic features of P. carotovorum by comparison with its four closely related species, thereby substantially enriching the extent of information now available for functional genomic investigations about Pectobacterium.},
}
@article {pmid30526040,
year = {2018},
author = {Shabbir, MA and Wu, Q and Shabbir, MZ and Sajid, A and Ahmed, S and Sattar, A and Tang, Y and Li, J and Maan, MK and Hao, H and Yuan, Z},
title = {The CRISPR-cas system promotes antimicrobial resistance in Campylobacter jejuni.},
journal = {Future microbiology},
volume = {13},
number = {},
pages = {1757-1774},
doi = {10.2217/fmb-2018-0234},
pmid = {30526040},
issn = {1746-0921},
abstract = {AIM: The purpose of current study is to find out relationship between cas9 gene and antimicrobial resistance in Campylobacter jejuni NCTC11168.<br><br>MATERIALS &amp; METHODS: The involvement of the cas9 gene in antimicrobial resistance of C. jejuni was determined by assessment of minimum inhibitory concentration, clustered regularly interspaced short palindromic repeats (CRISPR)-cas gene expression in standard strains, in vitro resistance development and transcriptome analysis of a cas9 deletion mutant and wild strains.<br><br>RESULTS: Increased expression of CRISPR-related genes was observed in standard strains. We also observed that Δcas9 mutant strain is more sensitive to antibiotics than its wild strain. Transcriptome analysis revealed that cas9 gene regulate several genes to promote antimicrobial resistance in C. jejuni.<br><br>CONCLUSION: CRISPR-cas system plays role in the enhancement of antimicrobial resistance in C. jejuni.},
}
@article {pmid30520985,
year = {2019},
author = {Toymentseva, AA and Altenbuchner, J},
title = {New CRISPR-Cas9 vectors for genetic modifications of Bacillus species.},
journal = {FEMS microbiology letters},
volume = {366},
number = {1},
pages = {},
doi = {10.1093/femsle/fny284},
pmid = {30520985},
issn = {1574-6968},
abstract = {Genetic manipulation is a fundamental procedure for the study of gene and operon functions and new characteristics acquisition. Modern CRISPR-Cas technology allows genome editing more precisely and increases the efficiency of transferring mutations in a variety of hard to manipulate organisms. Here, we describe new CRISPR-Cas vectors for genetic modifications in bacillary species. Our plasmids are single CRISPR-Cas plasmids comprising all components for genome editing and should be functional in a broad host range. They are highly efficient (up to 97%) and precise. The employment and delivery of these plasmids to bacillary strains can be easily achieved by conjugation from Escherichia coli. During our research we also demonstrated the absence of compatibility between CRISPR-Cas system and non-homologous end joining in Bacillus subtilis.},
}
@article {pmid30520167,
year = {2018},
author = {Zhou, Q and Zhan, H and Liao, X and Fang, L and Liu, Y and Xie, H and Yang, K and Gao, Q and Ding, M and Cai, Z and Huang, W and Liu, Y},
title = {A revolutionary tool: CRISPR technology plays an important role in construction of intelligentized gene circuits.},
journal = {Cell proliferation},
volume = {},
number = {},
pages = {e12552},
doi = {10.1111/cpr.12552},
pmid = {30520167},
issn = {1365-2184},
support = {81772737//National Natural Science Foundation of China/ ; 2017A020215120//Guangdong Provincial Department of Science and Technology/ ; 2016031638//High Level University's Medical Discipline Construction project/ ; JCYJ20170413161749433//Shenzhen Municipal Government of China/ ; JSGG20160301161836370//Shenzhen Municipal Government of China/ ; 2014CB745201//National Key Basic Research Program of China (973 Program)/ ; SZSM201412018//Sanming Project of Shenzhen Health and Family Planning Commission/ ; SZSM201512037//Sanming Project of Shenzhen Health and Family Planning Commission/ ; },
abstract = {With the development of synthetic biology, synthetic gene circuits have shown great applied potential in medicine, biology, and as commodity chemicals. An ultimate challenge in the construction of gene circuits is the lack of effective, programmable, secure and sequence-specific gene editing tools. The clustered regularly interspaced short palindromic repeat (CRISPR) system, a CRISPR-associated RNA-guided endonuclease Cas9 (CRISPR-associated protein 9)-targeted genome editing tool, has recently been applied in engineering gene circuits for its unique properties-operability, high efficiency and programmability. The traditional single-targeted therapy cannot effectively distinguish tumour cells from normal cells, and gene therapy for single targets has poor anti-tumour effects, which severely limits the application of gene therapy. Currently, the design of gene circuits using tumour-specific targets based on CRISPR/Cas systems provides a new way for precision cancer therapy. Hence, the application of intelligentized gene circuits based on CRISPR technology effectively guarantees the safety, efficiency and specificity of cancer therapy. Here, we assessed the use of synthetic gene circuits and if the CRISPR system could be used, especially artificial switch-inducible Cas9, to more effectively target and treat tumour cells. Moreover, we also discussed recent advances, prospectives and underlying challenges in CRISPR-based gene circuit development.},
}
@article {pmid30518723,
year = {2019},
author = {Ayabe, S and Nakashima, K and Yoshiki, A},
title = {Off- and on-target effects of genome editing in mouse embryos.},
journal = {The Journal of reproduction and development},
volume = {65},
number = {1},
pages = {1-5},
doi = {10.1262/jrd.2018-128},
pmid = {30518723},
issn = {1348-4400},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas-based genome editing technology has enabled manipulation of the embryonic genome. Unbiased whole genome sequencing comparing parents to progeny has revealed that the rate of Cas9-induced mutagenesis in mouse embryos is indistinguishable from the background rate of de novo mutation. However, establishing the best practice to confirm on-target alleles of interest remains a challenge. We believe that improvement in editing strategies and screening methods for founder mice will contribute to the generation of quality-controlled animals, thereby ensuring reproducibility of results in animal studies and advancing the 3Rs (replacement, reduction, and refinement).},
}
@article {pmid30518324,
year = {2018},
author = {Nishihara, M and Higuchi, A and Watanabe, A and Tasaki, K},
title = {Application of the CRISPR/Cas9 system for modification of flower color in Torenia fournieri.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {331},
pmid = {30518324},
issn = {1471-2229},
support = {15H04453//Japanese Society for the Promotion of Science/ ; 16K18654//Japanese Society for the Promotion of Science/ ; },
mesh = {CRISPR-Associated Protein 9 ; *CRISPR-Cas Systems ; Color ; Flowers/anatomy &amp; histology/*genetics ; Gene Editing/*methods ; Genes, Plant/genetics ; Lamiales/anatomy &amp; histology/*genetics ; Plants, Genetically Modified ; Sequence Analysis, DNA ; },
abstract = {BACKGROUND: CRISPR/Cas9 technology is one of the most powerful and useful tools for genome editing in various living organisms. In higher plants, the system has been widely exploited not only for basic research, such as gene functional analysis, but also for applied research such as crop breeding. Although the CRISPR/Cas9 system has been used to induce mutations in genes involved in various plant developmental processes, few studies have been performed to modify the color of ornamental flowers. We therefore attempted to use this system to modify flower color in the model plant torenia (Torenia fournieri L.).<br><br>RESULTS: We attempted to induce mutations in the torenia flavanone 3-hydroxylase (F3H) gene, which encodes a key enzyme involved in flavonoid biosynthesis. Application of the CRISPR/Cas9 system successfully generated pale blue (almost white) flowers at a high frequency (ca. 80% of regenerated lines) in transgenic torenia T0 plants. Sequence analysis of PCR amplicons by Sanger and next-generation sequencing revealed the occurrence of mutations such as base substitutions and insertions/deletions in the F3H target sequence, thus indicating that the obtained phenotype was induced by the targeted mutagenesis of the endogenous F3H gene.<br><br>CONCLUSIONS: These results clearly demonstrate that flower color modification by genome editing with the CRISPR/Cas9 system is easily and efficiently achievable. Our findings further indicate that this system may be useful for future research on flower pigmentation and/or functional analyses of additional genes in torenia.},
}
@article {pmid30504842,
year = {2018},
author = {Rice, CM and Davies, LC and Subleski, JJ and Maio, N and Gonzalez-Cotto, M and Andrews, C and Patel, NL and Palmieri, EM and Weiss, JM and Lee, JM and Annunziata, CM and Rouault, TA and Durum, SK and McVicar, DW},
title = {Tumour-elicited neutrophils engage mitochondrial metabolism to circumvent nutrient limitations and maintain immune suppression.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5099},
doi = {10.1038/s41467-018-07505-2},
pmid = {30504842},
issn = {2041-1723},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cells, Cultured ; Flow Cytometry ; Immunoblotting ; Immunohistochemistry ; Mice ; Mice, Knockout ; Microscopy, Confocal ; Mitochondria/*metabolism ; Neutrophils/metabolism/*physiology ; Oxidation-Reduction ; Oxidative Phosphorylation ; Oxidative Stress ; Reactive Oxygen Species/metabolism ; Signal Transduction/physiology ; },
abstract = {Neutrophils are a vital component of immune protection, yet in cancer they may promote tumour progression, partly by generating reactive oxygen species (ROS) that disrupts lymphocyte functions. Metabolically, neutrophils are often discounted as purely glycolytic. Here we show that immature, c-Kit+ neutrophils subsets can engage in oxidative mitochondrial metabolism. With limited glucose supply, oxidative neutrophils use mitochondrial fatty acid oxidation to support NADPH oxidase-dependent ROS production. In 4T1 tumour-bearing mice, mitochondrial fitness is enhanced in splenic neutrophils and is driven by c-Kit signalling. Concordantly, tumour-elicited oxidative neutrophils are able to maintain ROS production and T cell suppression when glucose utilisation is restricted. Consistent with these findings, peripheral blood neutrophils from patients with cancer also display increased immaturity, mitochondrial content and oxidative phosphorylation. Together, our data suggest that the glucose-restricted tumour microenvironment induces metabolically adapted, oxidative neutrophils to maintain local immune suppression.},
}
@article {pmid30504723,
year = {2018},
author = {Xiao, Z and Wan, J and Nur, AA and Dou, P and Mankin, H and Liu, T and Ouyang, Z},
title = {Targeting CD44 by CRISPR-Cas9 in Multi-Drug Resistant Osteosarcoma Cells.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {51},
number = {4},
pages = {1879-1893},
doi = {10.1159/000495714},
pmid = {30504723},
issn = {1421-9778},
mesh = {Adolescent ; Adult ; Antibiotics, Antineoplastic/pharmacology/therapeutic use ; Bone Neoplasms/drug therapy/*genetics/pathology ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Child ; Child, Preschool ; Doxorubicin/pharmacology/therapeutic use ; *Drug Resistance, Neoplasm ; Female ; *Gene Expression Regulation, Neoplastic ; Humans ; Hyaluronan Receptors/*genetics ; Infant ; Male ; Neoplasm Invasiveness/genetics/pathology/prevention &amp; control ; Osteosarcoma/drug therapy/*genetics/pathology ; Young Adult ; },
abstract = {BACKGROUND/AIMS: Drug resistance is the main difficulty for the current treatment for osteosarcoma. Cluster of differentiation 44 (CD44) is a receptor for hyaluronic acid (HA) and HA-binding has been proven to participate in various biological tumor activities, including tumor progression, metastasis and drug resistance. In this study, we aimed to determine the effects of CD44 on migration, invasion, proliferation, and the drug-sensitivity of osteosarcoma.<br><br>METHODS: 96 human osteosarcoma tissues from 56 patients were collected to evaluate the expression of CD44 in osteosarcoma tissue by immunohistochemistry. CRISPR-Cas9 system was used to specifically silence CD44 in drug-resistant cell lines (KHOSR2 and U-2OSR2). The migration and invasion activities of cells was demonstrated by wound healing and transwell invasion assay. The proliferation speed of the cells was detected under 3D cell culture condition. Drug resistance of cells was detected by MTT and drug uptake assay.<br><br>RESULTS: The immunohistochemistry results demonstrated that a high level of CD44 may predict poor survival and higher potential of metastasis, recurrence and drug resistance in patients with osteosarcoma. After knocking-out of CD44 by the CRISPR-Cas9 system, not only the migration and invasion activities of osteosarcoma cells were significantly inhibited, but the drug sensitivity was also enhanced.<br><br>CONCLUSION: CD44 silencing could inhibit the development of osteosarcoma migration, invasion, proliferation and ameliorate drug resistance to current treatment in osteosarcoma. This study applies new strategy to target CD44, which may improve the prognosis of osteosarcoma.},
}
@article {pmid30503774,
year = {2019},
author = {Wang, L and Mo, CY and Wasserman, MR and Rostøl, JT and Marraffini, LA and Liu, S},
title = {Dynamics of Cas10 Govern Discrimination between Self and Non-self in Type III CRISPR-Cas Immunity.},
journal = {Molecular cell},
volume = {73},
number = {2},
pages = {278-290.e4},
doi = {10.1016/j.molcel.2018.11.008},
pmid = {30503774},
issn = {1097-4164},
support = {DP1 GM128184/GM/NIGMS NIH HHS/United States ; F32 GM128271/GM/NIGMS NIH HHS/United States ; R00 GM107365/GM/NIGMS NIH HHS/United States ; },
abstract = {Adaptive immune systems must accurately distinguish between self and non-self in order to defend against invading pathogens while avoiding autoimmunity. Type III CRISPR-Cas systems employ guide RNA to recognize complementary RNA targets, which triggers the degradation of both the invader's transcripts and their template DNA. These systems can broadly eliminate foreign targets with multiple mutations but circumvent damage to the host genome. To explore the molecular basis for these features, we use single-molecule fluorescence microscopy to study the interaction between a type III-A ribonucleoprotein complex and various RNA substrates. We find that Cas10-the DNase effector of the complex-displays rapid conformational fluctuations on foreign RNA targets, but is locked in a static configuration on self RNA. Target mutations differentially modulate Cas10 dynamics and tune the CRISPR interference activity in vivo. These findings highlight the central role of the internal dynamics of CRISPR-Cas complexes in self versus non-self discrimination and target specificity.},
}
@article {pmid30503773,
year = {2019},
author = {Jia, N and Mo, CY and Wang, C and Eng, ET and Marraffini, LA and Patel, DJ},
title = {Type III-A CRISPR-Cas Csm Complexes: Assembly, Periodic RNA Cleavage, DNase Activity Regulation, and Autoimmunity.},
journal = {Molecular cell},
volume = {73},
number = {2},
pages = {264-277.e5},
doi = {10.1016/j.molcel.2018.11.007},
pmid = {30503773},
issn = {1097-4164},
support = {S10 RR029205/RR/NCRR NIH HHS/United States ; P41 GM103310/GM/NIGMS NIH HHS/United States ; F32 GM128271/GM/NIGMS NIH HHS/United States ; R01 GM104962/GM/NIGMS NIH HHS/United States ; P30 CA008748/CA/NCI NIH HHS/United States ; U19 CA179564/CA/NCI NIH HHS/United States ; P30 GM124165/GM/NIGMS NIH HHS/United States ; DP1 GM128184/GM/NIGMS NIH HHS/United States ; },
abstract = {Type ΙΙΙ CRISPR-Cas systems provide robust immunity against foreign RNA and DNA by sequence-specific RNase and target RNA-activated sequence-nonspecific DNase and RNase activities. We report on cryo-EM structures of Thermococcus onnurineus CsmcrRNA binary, CsmcrRNA-target RNA and CsmcrRNA-target RNAanti-tag ternary complexes in the 3.1 Å range. The topological features of the crRNA 5'-repeat tag explains the 5'-ruler mechanism for defining target cleavage sites, with accessibility of positions -2 to -5 within the 5'-repeat serving as sensors for avoidance of autoimmunity. The Csm3 thumb elements introduce periodic kinks in the crRNA-target RNA duplex, facilitating cleavage of the target RNA with 6-nt periodicity. Key Glu residues within a Csm1 loop segment of CsmcrRNA adopt a proposed autoinhibitory conformation suggestive of DNase activity regulation. These structural findings, complemented by mutational studies of key intermolecular contacts, provide insights into CsmcrRNA complex assembly, mechanisms underlying RNA targeting and site-specific periodic cleavage, regulation of DNase cleavage activity, and autoimmunity suppression.},
}
@article {pmid30503210,
year = {2019},
author = {You, L and Ma, J and Wang, J and Artamonova, D and Wang, M and Liu, L and Xiang, H and Severinov, K and Zhang, X and Wang, Y},
title = {Structure Studies of the CRISPR-Csm Complex Reveal Mechanism of Co-transcriptional Interference.},
journal = {Cell},
volume = {176},
number = {1-2},
pages = {239-253.e16},
doi = {10.1016/j.cell.2018.10.052},
pmid = {30503210},
issn = {1097-4172},
abstract = {Csm, a type III-A CRISPR-Cas interference complex, is a CRISPR RNA (crRNA)-guided RNase that also possesses target RNA-dependent DNase and cyclic oligoadenylate (cOA) synthetase activities. However, the structural features allowing target RNA-binding-dependent activation of DNA cleavage and cOA generation remain unknown. Here, we report the structure of Csm in complex with crRNA together with structures of cognate or non-cognate target RNA bound Csm complexes. We show that depending on complementarity with the 5' tag of crRNA, the 3' anti-tag region of target RNA binds at two distinct sites of the Csm complex. Importantly, the interaction between the non-complementary anti-tag region of cognate target RNA and Csm1 induces a conformational change at the Csm1 subunit that allosterically activates DNA cleavage and cOA generation. Together, our structural studies provide crucial insights into the mechanistic processes required for crRNA-meditated sequence-specific RNA cleavage, RNA target-dependent non-specific DNA cleavage, and cOA generation.},
}
@article {pmid30503205,
year = {2018},
author = {Stella, S and Mesa, P and Thomsen, J and Paul, B and Alcón, P and Jensen, SB and Saligram, B and Moses, ME and Hatzakis, NS and Montoya, G},
title = {Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.},
journal = {Cell},
volume = {175},
number = {7},
pages = {1856-1871.e21},
doi = {10.1016/j.cell.2018.10.045},
pmid = {30503205},
issn = {1097-4172},
abstract = {Cas12a, also known as Cpf1, is a type V-A CRISPR-Cas RNA-guided endonuclease that is used for genome editing based on its ability to generate specific dsDNA breaks. Here, we show cryo-EM structures of intermediates of the cleavage reaction, thus visualizing three protein regions that sense the crRNA-DNA hybrid assembly triggering the catalytic activation of Cas12a. Single-molecule FRET provides the thermodynamics and kinetics of the conformational activation leading to phosphodiester bond hydrolysis. These findings illustrate why Cas12a cuts its target DNA and unleashes unspecific cleavage activity, degrading ssDNA molecules after activation. In addition, we show that other crRNAs are able to displace the R-loop inside the protein after target DNA cleavage, terminating indiscriminate ssDNA degradation. We propose a model whereby the conformational activation of the enzyme results in indiscriminate ssDNA cleavage. The displacement of the R-loop by a new crRNA molecule will reset Cas12a specificity, targeting new DNAs.},
}
@article {pmid30502320,
year = {2019},
author = {Wang, M and Sintim, HO},
title = {Discriminating cyclic from linear nucleotides - CRISPR/Cas-related cyclic hexaadenosine monophosphate as a case study.},
journal = {Analytical biochemistry},
volume = {567},
number = {},
pages = {21-26},
doi = {10.1016/j.ab.2018.11.022},
pmid = {30502320},
issn = {1096-0309},
abstract = {Nucleic acids exist in biological systems as linear and cyclic forms and in most cases the biology of the cyclic form is different from the linear form of exactly the same sequence. Case examples are cyclic nucleotides, second messengers in both prokaryotes and eukaryotes whereby the cyclic forms account for their interesting biological profiles and the actions of the cyclic nucleotides are terminated upon phosphodiesterase hydrolysis into linear forms. For mono and dinucleotides, it has been shown that vast conformational changes that accompany the hydrolysis of the cyclized form allow for discrimination between the cyclized and linear forms. As the ring size increases, it becomes difficult to use conformational or structural differences alone to discriminate between cyclic and linear nucleotides. Here we reveal that for the recently discovered CRISPR/Cas-related cyclic hexaadenosine monophosphate, it is possible to discriminate between the cyclized and linear forms. The structures of c-HexaAMP and linear form are different in acidic media and this structural difference facilitated a simple and practical detection platform for this interesting and new bacterial immunity-related molecule, and we also demonstrate that it is possible to distinguish between linear and cyclized polynucleotides using simple spectroscopic techniques, such as CD and fluorescence-based methods.},
}
@article {pmid30501735,
year = {2018},
author = {Li, WY and Gao, QP and Liu, H},
title = {[CRISPR/Cas9 System and Its Advances in Gene Therapy of Hematologic Diseases--Review].},
journal = {Zhongguo shi yan xue ye xue za zhi},
volume = {26},
number = {6},
pages = {1863-1867},
doi = {10.7534/j.issn.1009-2137.2018.06.048},
pmid = {30501735},
issn = {1009-2137},
mesh = {*CRISPR-Cas Systems ; *Gene Editing ; Genetic Therapy ; Hematologic Diseases/*therapy ; Humans ; Molecular Biology ; },
abstract = {In recent years, with the development of gene editing technology, the site-specific genome can be modified. The curability of genetic disease may be achieved by the use of gene editing techniques. As the simplicity, high specificity and economical efficiency, much attention has been paid to the CRISPR/Cas9 system, which was been widely used in research of molecular biology and other fields of life science. In this review, the mechanism for CR1SPR/Cas9 system and the progress of gene therapy, such as for hemophilia, betathalassaemia and chronic myeloid leukemia were summarized briefly.},
}
@article {pmid30515147,
year = {2018},
author = {Lima, ARJ and Siqueira, AS and de Vasconcelos, JM and Pereira, JS and de Azevedo, JSN and Moraes, PHG and Aguiar, DCF and de Lima, CPS and Vianez-Júnior, JLSG and Nunes, MRT and Xavier, LP and Dall'Agnol, LT and Goncalves, EC},
title = {Insights Into Limnothrix sp. Metabolism Based on Comparative Genomics.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {2811},
pmid = {30515147},
issn = {1664-302X},
abstract = {Currently only four genome sequences for Limnothrix spp. are publicly available, and information on the genetic properties of cyanobacteria belonging to this genus is limited. In this study, we report the draft genome of Limnothrix sp. CACIAM 69d, isolated from the reservoir of a hydroelectric dam located in the Amazon ecosystem, from where cyanobacterial genomic data are still scarce. Comparative genomic analysis of Limnothrix revealed the presence of key enzymes in the cyanobacterial central carbon metabolism and how it is well equipped for environmental sulfur and nitrogen acquisition. Additionally, this work covered the analysis of Limnothrix CRISPR-Cas systems, pathways related to biosynthesis of secondary metabolites and assembly of extracellular polymeric substances and their exportation. A trans-AT PKS gene cluster was identified in two strains, possibly related to the novel toxin Limnothrixin biosynthesis. Overall, the draft genome of Limnothrix sp. CACIAM 69d adds new data to the small Limnothrix genome library and contributes to a growing representativeness of cyanobacterial genomes from the Amazon region. The comparative genomic analysis of Limnothrix made it possible to highlight unique genes for each strain and understand the overall features of their metabolism.},
}
@article {pmid30514786,
year = {2018},
author = {Lee, J and Mir, A and Edraki, A and Garcia, B and Amrani, N and Lou, HE and Gainetdinov, I and Pawluk, A and Ibraheim, R and Gao, XD and Liu, P and Davidson, AR and Maxwell, KL and Sontheimer, EJ},
title = {Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
pmid = {30514786},
issn = {2150-7511},
support = {R01 GM125797/GM/NIGMS NIH HHS/United States ; FDN-15427//CIHR/Canada ; PJT-152918//CIHR/Canada ; },
abstract = {In their natural settings, CRISPR-Cas systems play crucial roles in bacterial and archaeal adaptive immunity to protect against phages and other mobile genetic elements, and they are also widely used as genome engineering technologies. Previously we discovered bacteriophage-encoded Cas9-specific anti-CRISPR (Acr) proteins that serve as countermeasures against host bacterial immunity by inactivating their CRISPR-Cas systems (A. Pawluk, N. Amrani, Y. Zhang, B. Garcia, et al., Cell 167:1829-1838.e9, 2016, https://doi.org/10.1016/j.cell.2016.11.017). We hypothesized that the evolutionary advantages conferred by anti-CRISPRs would drive the widespread occurrence of these proteins in nature (K. L. Maxwell, Mol Cell 68:8-14, 2017, https://doi.org/10.1016/j.molcel.2017.09.002; A. Pawluk, A. R. Davidson, and K. L. Maxwell, Nat Rev Microbiol 16:12-17, 2018, https://doi.org/10.1038/nrmicro.2017.120; E. J. Sontheimer and A. R. Davidson, Curr Opin Microbiol 37:120-127, 2017, https://doi.org/10.1016/j.mib.2017.06.003). We have identified new anti-CRISPRs using the same bioinformatic approach that successfully identified previous Acr proteins (A. Pawluk, N. Amrani, Y. Zhang, B. Garcia, et al., Cell 167:1829-1838.e9, 2016, https://doi.org/10.1016/j.cell.2016.11.017) against Neisseria meningitidis Cas9 (NmeCas9). In this work, we report two novel anti-CRISPR families in strains of Haemophilus parainfluenzae and Simonsiella muelleri, both of which harbor type II-C CRISPR-Cas systems (A. Mir, A. Edraki, J. Lee, and E. J. Sontheimer, ACS Chem Biol 13:357-365, 2018, https://doi.org/10.1021/acschembio.7b00855). We characterize the type II-C Cas9 orthologs from H. parainfluenzae and S. muelleri, show that the newly identified Acrs are able to inhibit these systems, and define important features of their inhibitory mechanisms. The S. muelleri Acr is the most potent NmeCas9 inhibitor identified to date. Although inhibition of NmeCas9 by anti-CRISPRs from H. parainfluenzae and S. muelleri reveals cross-species inhibitory activity, more distantly related type II-C Cas9s are not inhibited by these proteins. The specificities of anti-CRISPRs and divergent Cas9s appear to reflect coevolution of their strategies to combat or evade each other. Finally, we validate these new anti-CRISPR proteins as potent off-switches for Cas9 genome engineering applications.IMPORTANCE As one of their countermeasures against CRISPR-Cas immunity, bacteriophages have evolved natural inhibitors known as anti-CRISPR (Acr) proteins. Despite the existence of such examples for type II CRISPR-Cas systems, we currently know relatively little about the breadth of Cas9 inhibitors, and most of their direct Cas9 targets are uncharacterized. In this work we identify two new type II-C anti-CRISPRs and their cognate Cas9 orthologs, validate their functionality in vitro and in bacteria, define their inhibitory spectrum against a panel of Cas9 orthologs, demonstrate that they act before Cas9 DNA binding, and document their utility as off-switches for Cas9-based tools in mammalian applications. The discovery of diverse anti-CRISPRs, the mechanistic analysis of their cognate Cas9s, and the definition of Acr inhibitory mechanisms afford deeper insight into the interplay between Cas9 orthologs and their inhibitors and provide greater scope for exploiting Acrs for CRISPR-based genome engineering.},
}
@article {pmid30514784,
year = {2018},
author = {Musharova, O and Vyhovskyi, D and Medvedeva, S and Guzina, J and Zhitnyuk, Y and Djordjevic, M and Severinov, K and Savitskaya, E},
title = {Avoidance of Trinucleotide Corresponding to Consensus Protospacer Adjacent Motif Controls the Efficiency of Prespacer Selection during Primed Adaptation.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
pmid = {30514784},
issn = {2150-7511},
support = {R01 GM104071/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR DNA arrays of unique spacers separated by identical repeats ensure prokaryotic immunity through specific targeting of foreign nucleic acids complementary to spacers. New spacers are acquired into a CRISPR array in a process of CRISPR adaptation. Selection of foreign DNA fragments to be integrated into CRISPR arrays relies on PAM (protospacer adjacent motif) recognition, as only those spacers will be functional against invaders. However, acquisition of different PAM-associated spacers proceeds with markedly different efficiency from the same DNA. Here, we used a combination of bioinformatics and experimental approaches to understand factors affecting the efficiency of acquisition of spacers by the Escherichia coli type I-E CRISPR-Cas system, for which two modes of CRISPR adaptation have been described: naive and primed. We found that during primed adaptation, efficiency of spacer acquisition is strongly negatively affected by the presence of an AAG trinucleotide-a consensus PAM-within the sequence being selected. No such trend is observed during naive adaptation. The results are consistent with a unidirectional spacer selection process during primed adaptation and provide a specific signature for identification of spacers acquired through primed adaptation in natural populations.IMPORTANCE Adaptive immunity of prokaryotes depends on acquisition of foreign DNA fragments into CRISPR arrays as spacers followed by destruction of foreign DNA by CRISPR interference machinery. Different fragments are acquired into CRISPR arrays with widely different efficiencies, but the factors responsible are not known. We analyzed the frequency of spacers acquired during primed adaptation in an E. coli CRISPR array and found that AAG motif was depleted from highly acquired spacers. AAG is also a consensus protospacer adjacent motif (PAM) that must be present upstream from the target of the CRISPR spacer for its efficient destruction by the interference machinery. These results are important because they provide new information on the mechanism of primed spacer acquisition. They add to other previous evidence in the field that pointed out to a &quot;directionality&quot; in the capture of new spacers. Our data strongly suggest that the recognition of an AAG PAM by the interference machinery components prior to spacer capture occludes downstream AAG sequences, thus preventing their recognition by the adaptation machinery.},
}
@article {pmid30513193,
year = {2018},
author = {Lainšček, D and Kadunc, L and Manček-Keber, M and Hafner-Bratkovič, I and Romih, R and Jerala, R},
title = {Delivery of an artificial transcription regulator dCas9-VPR by extracellular vesicles for therapeutic gene activation.},
journal = {ACS synthetic biology},
volume = {},
number = {},
pages = {},
doi = {10.1021/acssynbio.8b00192},
pmid = {30513193},
issn = {2161-5063},
abstract = {The CRISPR/Cas system has been developed as a potent tool for genome engineering and transcription regulation. However, the efficiency of its delivery into cells, particularly for therapeutic in vivo applications, remains a major bottleneck. Extracellular vesicles (EVs), released by eukaryotic cells, can mediate the transfer of different molecules, including nucleic acids and proteins. Here we show packaging and delivery of the CRISPR/Cas system via EVs to target cells, combining the advantages of both technological platforms. A GEDEX (genome editing with designed extracellular vesicles) system generated by the producer cells can transfer the designed transcriptional regulator dCas9-VPR complexed with appropriate targeting gRNAs enabling gene transcription activation. We show functional delivery in mammalian cells as well in the animals. By in vivo delivery of dCas9-VPR/sgRNA GEDEX therapeutic efficiency is demonstrated in a mouse model of liver damage counteracted by upregulation of the endogenous hepatocyte growth factor, demonstrating the potentials for therapeutic applications.},
}
@article {pmid30511631,
year = {2018},
author = {Farooq, R and Hussain, K and Nazir, S and Javed, MR and Masood, N},
title = {CRISPR/Cas9; A robust technology for producing genetically engineered plants.},
journal = {Cellular and molecular biology (Noisy-le-Grand, France)},
volume = {64},
number = {14},
pages = {31-38},
pmid = {30511631},
issn = {1165-158X},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing ; Genetic Engineering/*methods ; Mutation/genetics ; Plants, Genetically Modified/*genetics ; Transgenes ; },
abstract = {CRISPR/Cas9 is a technology evolved from modified type II immune system of bacteria and archaea. Exploitation of this bacterial immune system in all eukaryotes including plants may lead to site-specific targeted genome engineering. Genome engineering is objectively utilized to express/silence a trait harbouring gene in the plant genome. In this review, different genetic engineering techniques including classical breeding, RNAi and genetic transformation and synthetic sequence-specific nucleases (zinc finger nucleases; ZFNs and transcription activator-like effector nuclease; TALENs) techniques have been described and compared with advanced genome editing technique CRISPR/Cas9, on the basis of their merits and drawbacks. This revolutionary genome engineering technology has edge over all other approaches because of its simplicity, stability, specificity of the target and multiple genes can be engineered at a time. CRISPR/Cas9 requires only Cas9 endonuclease and single guide RNA, which are directly delivered into plant cells via either vector-mediated stable transformation or transient delivery of ribonucleoproteins (RNPs) and generate double-strand breaks (DSBs) at target site. These DSBs are further repaired by cell endogenous repairing pathways via HDR or NHEJ. The major advantage of CRISPR/Cas9 system is that engineered plants are considered Non-GM; can be achieved using in vitro expressed RNPs transient delivery. Different variants of Cas9 genes cloned in different plasmid vectors can be used to achieve different objectives of genome editing including double-stranded DNA break, single-stranded break, activate/repress the gene expression. Fusion of Cas9 with fluorescent protein can lead to visualize the expression of the CRISPR/Cas9 system. The applications of this technology in plant genome editing to improve different plant traits are comprehensively described.},
}
@article {pmid30510770,
year = {2018},
author = {Teng, F and Cui, T and Feng, G and Guo, L and Xu, K and Gao, Q and Li, T and Li, J and Zhou, Q and Li, W},
title = {Repurposing CRISPR-Cas12b for mammalian genome engineering.},
journal = {Cell discovery},
volume = {4},
number = {},
pages = {63},
pmid = {30510770},
issn = {2056-5968},
abstract = {The prokaryotic CRISPR-Cas adaptive immune systems provide valuable resources to develop genome editing tools, such as CRISPR-Cas9 and CRISPR-Cas12a/Cpf1. Recently, CRISPR-Cas12b/C2c1, a distinct type V-B system, has been characterized as a dual-RNA-guided DNA endonuclease system. Though being active in vitro, its cleavage activity at endogenous genome remains to be explored. Furthermore, the optimal cleavage temperature of the reported Cas12b orthologs is higher than 40 °C, which is unsuitable for mammalian applications. Here, we report the identification of a Cas12b system from the Alicyclobacillus acidiphilus (AaCas12b), which maintains optimal nuclease activity over a wide temperature range (31 °C-59 °C). AaCas12b can be repurposed to engineer mammalian genomes for versatile applications, including single and multiplex genome editing, gene activation, and generation of gene mutant mouse models. Moreover, whole-genome sequencing reveals high specificity and minimal off-target effects of AaCas12b-meditated genome editing. Our findings establish CRISPR-Cas12b as a versatile tool for mammalian genome engineering.},
}
@article {pmid30510202,
year = {2018},
author = {Møller-Olsen, C and Ho, SFS and Shukla, RD and Feher, T and Sagona, AP},
title = {Engineered K1F bacteriophages kill intracellular Escherichia coli K1 in human epithelial cells.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {17559},
pmid = {30510202},
issn = {2045-2322},
support = {BB/N011872/1//Biotechnology and Biological Sciences Research Council (BBSRC)/ ; },
abstract = {Bacterial infections can be treated with bacteriophages that show great specificity towards their bacterial host and can be genetically modified for different applications. However, whether and how bacteriophages can kill intracellular bacteria in human cells remains elusive. Here, using CRISPR/Cas selection, we have engineered a fluorescent bacteriophage specific for E. coli K1, a nosocomial pathogen responsible for urinary tract infections, neonatal meningitis and sepsis. By confocal and live microscopy, we show that engineered bacteriophages K1F-GFP and E. coli EV36-RFP bacteria displaying the K1 capsule, enter human cells via phagocytosis. Importantly, we show that bacteriophage K1F-GFP efficiently kills intracellular E. coli EV36-RFP in T24 human urinary bladder epithelial cells. Finally, we provide evidence that bacteria and bacteriophages are degraded by LC3-associated phagocytosis and xenophagy.},
}
@article {pmid30510171,
year = {2019},
author = {Daly, RA and Roux, S and Borton, MA and Morgan, DM and Johnston, MD and Booker, AE and Hoyt, DW and Meulia, T and Wolfe, RA and Hanson, AJ and Mouser, PJ and Moore, JD and Wunch, K and Sullivan, MB and Wrighton, KC and Wilkins, MJ},
title = {Viruses control dominant bacteria colonizing the terrestrial deep biosphere after hydraulic fracturing.},
journal = {Nature microbiology},
volume = {4},
number = {2},
pages = {352-361},
doi = {10.1038/s41564-018-0312-6},
pmid = {30510171},
issn = {2058-5276},
abstract = {The deep terrestrial biosphere harbours a substantial fraction of Earth's biomass and remains understudied compared with other ecosystems. Deep biosphere life primarily consists of bacteria and archaea, yet knowledge of their co-occurring viruses is poor. Here, we temporally catalogued viral diversity from five deep terrestrial subsurface locations (hydraulically fractured wells), examined virus-host interaction dynamics and experimentally assessed metabolites from cell lysis to better understand viral roles in this ecosystem. We uncovered high viral diversity, rivalling that of peatland soil ecosystems, despite low host diversity. Many viral operational taxonomic units were predicted to infect Halanaerobium, the dominant microorganism in these ecosystems. Examination of clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins (CRISPR-Cas) spacers elucidated lineage-specific virus-host dynamics suggesting active in situ viral predation of Halanaerobium. These dynamics indicate repeated viral encounters and changing viral host range across temporally and geographically distinct shale formations. Laboratory experiments showed that prophage-induced Halanaerobium lysis releases intracellular metabolites that can sustain key fermentative metabolisms, supporting the persistence of microorganisms in this ecosystem. Together, these findings suggest that diverse and active viral populations play critical roles in driving strain-level microbial community development and resource turnover within this deep terrestrial subsurface ecosystem.},
}
@article {pmid30487289,
year = {2019},
author = {Miao, K and Zhang, X and Su, SM and Zeng, J and Huang, Z and Chan, UI and Xu, X and Deng, CX},
title = {Optimizing CRISPR/Cas9 technology for precise correction of the Fgfr3-G374R mutation in achondroplasia in mice.},
journal = {The Journal of biological chemistry},
volume = {294},
number = {4},
pages = {1142-1151},
doi = {10.1074/jbc.RA118.006496},
pmid = {30487289},
issn = {1083-351X},
abstract = {CRISPR/Cas9 is a powerful technology widely used for genome editing, with the potential to be used for correcting a wide variety of deleterious disease-causing mutations. However, the technique tends to generate more indels (insertions and deletions) than precise modifications at the target sites, which might not resolve the mutation and could instead exacerbate the initial genetic disruption. We sought to develop an improved protocol for CRISPR/Cas9 that would correct mutations without unintended consequences. As a case study, we focused on achondroplasia, a common genetic form of dwarfism defined by missense mutation in the Fgfr3 gene that results in glycine to arginine substitution at position 374 in mice in fibroblast growth factor receptor 3 (Fgfr3-G374R), which corresponds to G380R in humans. First, we designed a GFP reporter system that can evaluate the cutting efficiency and specificity of single guide RNAs (sgRNAs). Using the sgRNA selected based on our GFP reporter system, we conducted targeted therapy of achondroplasia in mice. We found that we achieved higher frequency of precise correction of the Fgfr3-G374R mutation using Cas9 protein rather than Cas9 mRNA. We further demonstrated that targeting oligos of 100 and 200 nucleotides precisely corrected the mutation at equal efficiency. We showed that our strategy completely suppressed phenotypes of achondroplasia and whole genome sequencing detected no off-target effects. These data indicate that improved protocols can enable the precise CRISPR/Cas9-mediated correction of individual mutations with high fidelity.},
}
@article {pmid30486613,
year = {2018},
author = {Lee, SH and Kim, S and Hur, JK},
title = {CRISPR and Target-Specific DNA Endonucleases for Efficient DNA Knock-in in Eukaryotic Genomes.},
journal = {Molecules and cells},
volume = {41},
number = {11},
pages = {943-952},
pmid = {30486613},
issn = {0219-1032},
mesh = {Animals ; CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; DNA/*genetics ; DNA Repair ; Deoxyribonuclease I/*metabolism ; Eukaryota/genetics ; Gene Editing ; Gene Knock-In Techniques/*methods ; Genetic Engineering ; Genetic Therapy ; Genome/*genetics ; Humans ; },
abstract = {The discovery and mechanistic understanding of target-specific genome engineering technologies has led to extremely effective and specific genome editing in higher organisms. Target-specific genetic modification technology is expected to have a leading position in future gene therapy development, and has a ripple effect on various basic and applied studies. However, several problems remain and hinder efficient and specific editing of target genomic loci. The issues are particularly critical in precise targeted insertion of external DNA sequences into genomes. Here, we discuss some recent efforts to overcome such problems and present a perspective of future genome editing technologies.},
}
@article {pmid30485515,
year = {2018},
author = {Zhang, Y and Wang, Y and Wang, X and Ji, Y and Cheng, S and Wang, M and Zhang, C and Yu, X and Zhao, R and Zhang, W and Jin, J and Li, T and Zuo, Q and Li, B},
title = {Acetyl-coenzyme A acyltransferase 2 promote the differentiation of sheep precursor adipocytes into adipocytes.},
journal = {Journal of cellular biochemistry},
volume = {},
number = {},
pages = {},
doi = {10.1002/jcb.28080},
pmid = {30485515},
issn = {1097-4644},
support = {//Joint International Research Laboratory of Agriculture and Agri-Product Safety of Ministry of Education of China, Yangzhou University/ ; //Outstanding backbone Teachers of Yangzhou University (2016)/ ; //Institutes of Agricultural Science and Technology Development, Yangzhou University/ ; //The Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions/ ; BE2015362//the Primary Research &amp; Developement Plan of Jiangsu Province/ ; BK20150440//Natural Science Foundation of Jiangsu Province/ ; BK20161331//Natural Science Foundation of Jiangsu Province/ ; },
abstract = {The acetyl CoA acyltransferase 2 (ACAA2) is a key enzyme of the fatty acid oxidation pathway, catalyzing the last step of the mitochondrial beta oxidation, thus playing an important role in the fatty acid metabolism. The purpose of this study was to investigate the effect of knocking out ACAA2 on the expression of genes lipoprteinlipase (LPL), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase, fat mass and obesity-associated gene, adipocyte fatty acid-binding protein (AP2) in precursor adipocytes and their differentiation into adipocytes. The knockout vector was constructed using CRISPR-Cas RNA-guided nuclease technology with an efficiency of 23.80%, and the vector was transfected into precursor adipocyte cells, while an overexpression vector of the ACAA2 gene was also transfected in another group of preadipocytes. Quantitative polymerase chain reaction showed that the expression of the PPAR-γ, LPL, and AP2 was significantly lower in the knockout compared with the overexpression group, while there was no difference in cell growth. After induction of adipocyte precursor cells into adipocytes using dexamethasone, insulin, and IBMX, oil red staining showed a significantly different number of lipid droplets in the knockout group. These results provide a preliminary indication for a possible involvement of the ACAA2 gene in adipocyte differentiation in vitro.},
}
@article {pmid30483283,
year = {2018},
author = {Nadakuduti, SS and Buell, CR and Voytas, DF and Starker, CG and Douches, DS},
title = {Genome Editing for Crop Improvement - Applications in Clonally Propagated Polyploids With a Focus on Potato (Solanum tuberosum L.).},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1607},
pmid = {30483283},
issn = {1664-462X},
abstract = {Genome-editing has revolutionized biology. When coupled with a recently streamlined regulatory process by the U.S. Department of Agriculture and the potential to generate transgene-free varieties, genome-editing provides a new avenue for crop improvement. For heterozygous, polyploid and vegetatively propagated crops such as cultivated potato, Solanum tuberosum Group Tuberosum L., genome-editing presents tremendous opportunities for trait improvement. In potato, traits such as improved resistance to cold-induced sweetening, processing efficiency, herbicide tolerance, modified starch quality and self-incompatibility have been targeted utilizing CRISPR/Cas9 and TALEN reagents in diploid and tetraploid clones. However, limited progress has been made in other such crops including sweetpotato, strawberry, grapes, citrus, banana etc., In this review we summarize the developments in genome-editing platforms, delivery mechanisms applicable to plants and then discuss the recent developments in regulation of genome-edited crops in the United States and The European Union. Next, we provide insight into the challenges of genome-editing in clonally propagated polyploid crops, their current status for trait improvement with future prospects focused on potato, a global food security crop.},
}
@article {pmid30483260,
year = {2018},
author = {Bray, C and Wright, D and Haupt, S and Thomas, S and Stauss, H and Zamoyska, R},
title = {Crispr/Cas Mediated Deletion of PTPN22 in Jurkat T Cells Enhances TCR Signaling and Production of IL-2.},
journal = {Frontiers in immunology},
volume = {9},
number = {},
pages = {2595},
pmid = {30483260},
issn = {1664-3224},
abstract = {A single nucleotide polymorphism, C1858T, in the gene encoding the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) results in one of the strongest genetic traits associated with autoimmune disease outside of the Major Histocompatibility Complex (MHC) genes. However, the consequences of this polymorphism, which introduces an arginine to tryptophan substitution at amino acid 620, for the function of PTPN22 protein is unclear and conflicting results have been obtained in human compared to mouse cells expressing this variant phosphatase. In mouse the variant appears to be a loss-of-function allele resembling a milder form of the null allele, while studies in human cells have reported it to be a gain-of-function mutation. To address whether the phosphatase has distinct functions in mouse vs. human T cells, we used CRISPR gene-editing to generate the first example of human PTPN22-KnockOut (KO) T cells. By comparing isogenic human T cells which express or lack PTPN22, we showed that PTPN22 KO T cells displayed enhanced expression of IL-2 and CD69 upon stimulation with cognate antigen. PTPN22 KO cells also showed increased Erk phosphorylation upon stimulation with weak antigen, but the difference was diminished in response to strong antigen, indicating that PTPN22 plays a more critical role in regulating weak-antigen responses. These data are in keeping with a role for PTPN22 in determining the threshold of stimulation required to activate T cells, a critical function of autoimmune pathogenesis. Our data indicate that PTPN22 has comparable functions in mouse and human T cells, and that the conflicting results in the literature regarding the impact of the point mutation are not due to differences in the activity of PTPN22 itself, but may be related to interactions with other proteins or splice variation.},
}
@article {pmid30479331,
year = {2018},
author = {Zhou, W and Hu, L and Ying, L and Zhao, Z and Chu, PK and Yu, XF},
title = {A CRISPR-Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5012},
pmid = {30479331},
issn = {2041-1723},
mesh = {Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; DNA/*analysis ; Fluorescence ; HEK293 Cells ; Humans ; Nucleic Acid Amplification Techniques/*methods ; Nucleotides/genetics ; },
abstract = {Although polymerase chain reaction (PCR) is the most widely used method for DNA amplification, the requirement of thermocycling limits its non-laboratory applications. Isothermal DNA amplification techniques are hence valuable for on-site diagnostic applications in place of traditional PCR. Here we describe a true isothermal approach for amplifying and detecting double-stranded DNA based on a CRISPR-Cas9-triggered nicking endonuclease-mediated Strand Displacement Amplification method (namely CRISDA). CRISDA takes advantage of the high sensitivity/specificity and unique conformational rearrangements of CRISPR effectors in recognizing the target DNA. In combination with a peptide nucleic acid (PNA) invasion-mediated endpoint measurement, the method exhibits attomolar sensitivity and single-nucleotide specificity in detection of various DNA targets under a complex sample background. Additionally, by integrating the technique with a Cas9-mediated target enrichment approach, CRISDA exhibits sub-attomolar sensitivity. In summary, CRISDA is a powerful isothermal tool for ultrasensitive and specific detection of nucleic acids in point-of-care diagnostics and field analyses.},
}
@article {pmid30478778,
year = {2019},
author = {Ye, C and Chen, J and Cheng, X and Zhou, S and Jiang, S and Xu, J and Zheng, H and Tong, W and Li, G and Tong, G},
title = {Functional analysis of the UL24 protein of suid herpesvirus 1.},
journal = {Virus genes},
volume = {55},
number = {1},
pages = {76-86},
doi = {10.1007/s11262-018-1619-3},
pmid = {30478778},
issn = {1572-994X},
support = {2016YFD0500100//the National Key Research and Development Program of China/ ; NYCYTX-009//China Agriculture Research System/ ; 2015, 1-7//Shanghai Municipal Agriculture Science and Technology Key Project/ ; 2016, 4-2//Shanghai Municipal Agriculture Science and Technology Key Project/ ; },
mesh = {Animals ; CRISPR-Cas Systems ; Cercopithecus aethiops ; DNA, Viral ; Female ; HeLa Cells ; Herpesvirus 1, Suid/*physiology ; Homologous Recombination ; Humans ; Mice ; Mutation ; Protein Transport ; Pseudorabies/metabolism/virology ; RNA, Guide/genetics ; Thymidine Kinase/genetics/metabolism ; Trigeminal Nucleus, Spinal/virology ; Vero Cells ; Viral Load ; Viral Proteins/genetics/*metabolism ; Virulence ; },
abstract = {The UL24 homologous genes are conserved in alphaherpesviruses. However, the proximity of the UL24 gene and the UL23 gene encoding for thymidine kinase (TK) in the genome of suid herpesvirus 1 (SuHV-1) makes it difficult to mutate UL24 without affecting the expression of the TK gene, and thus functional studies of the UL24 gene have lagged behind. In this study, CRISPR/Cas9 and homologous recombination were adopted to generate UL24 and TK mutant viruses. Deletion of either the UL24 or the TK gene resulted in significantly reduced SuHV-1 replication and spread capacity in Vero cells. However, UL24-deleted virus still maintained a certain degree of lethality in mice, while TK-deleted viruses completely lost their lethality in mice. Similarly, neurovirulence of UL24-deleted virus in mice was not significantly affected compared to parental virus. In comparison, infection with the TK-deleted viruses resulted in significantly reduced neurovirulence and complete loss of lethality. In addition, and for the first time, viral UL24 protein was found to be expressed late during SuHV-1 infection; enhanced green fluorescence protein (eGFP) labeled UL24 protein was shown to be localized in the nucleus via heterologous expression. In conclusion, the UL24 gene of SuHV-1 encodes a nuclear-localized viral protein and acts as a minor virulence-associated factor compared to the TK gene.},
}
@article {pmid30478310,
year = {2018},
author = {Chin, HS and Li, MX and Tan, IKL and Ninnis, RL and Reljic, B and Scicluna, K and Dagley, LF and Sandow, JJ and Kelly, GL and Samson, AL and Chappaz, S and Khaw, SL and Chang, C and Morokoff, A and Brinkmann, K and Webb, A and Hockings, C and Hall, CM and Kueh, AJ and Ryan, MT and Kluck, RM and Bouillet, P and Herold, MJ and Gray, DHD and Huang, DCS and van Delft, MF and Dewson, G},
title = {VDAC2 enables BAX to mediate apoptosis and limit tumor development.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4976},
pmid = {30478310},
issn = {2041-1723},
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems/genetics ; Carcinogenesis/*metabolism/*pathology ; Embryonic Development ; HCT116 Cells ; HeLa Cells ; Humans ; Mice, Inbred C57BL ; Mitochondria/metabolism ; Promoter Regions, Genetic/genetics ; Voltage-Dependent Anion Channel 2/*metabolism ; bcl-2 Homologous Antagonist-Killer Protein/metabolism ; bcl-2-Associated X Protein/*metabolism ; },
abstract = {Intrinsic apoptosis is critical to prevent tumor formation and is engaged by many anti-cancer agents to eliminate tumor cells. BAX and BAK, the two essential mediators of apoptosis, are thought to be regulated through similar mechanisms and act redundantly to drive apoptotic cell death. From an unbiased genome-wide CRISPR/Cas9 screen, we identified VDAC2 (voltage-dependent anion channel 2) as important for BAX, but not BAK, to function. Genetic deletion of VDAC2 abrogated the association of BAX and BAK with mitochondrial complexes containing VDAC1, VDAC2, and VDAC3, but only inhibited BAX apoptotic function. Deleting VDAC2 phenocopied the loss of BAX in impairing both the killing of tumor cells by anti-cancer agents and the ability to suppress tumor formation. Together, our studies show that efficient BAX-mediated apoptosis depends on VDAC2, and reveal a striking difference in how BAX and BAK are functionally impacted by their interactions with VDAC2.},
}
@article {pmid30478289,
year = {2019},
author = {Turgeman-Grott, I and Joseph, S and Marton, S and Eizenshtein, K and Naor, A and Soucy, SM and Stachler, AE and Shalev, Y and Zarkor, M and Reshef, L and Altman-Price, N and Marchfelder, A and Gophna, U},
title = {Pervasive acquisition of CRISPR memory driven by inter-species mating of archaea can limit gene transfer and influence speciation.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {177-186},
doi = {10.1038/s41564-018-0302-8},
pmid = {30478289},
issn = {2058-5276},
abstract = {CRISPR-Cas systems provide prokaryotes with sequence-specific immunity against viruses and plasmids based on DNA acquired from these invaders, known as spacers. Surprisingly, many archaea possess spacers that match chromosomal genes of related species, including those encoding core housekeeping genes. By sequencing genomes of environmental archaea isolated from a single site, we demonstrate that inter-species spacers are common. We show experimentally, by mating Haloferax volcanii and Haloferax mediterranei, that spacers are indeed acquired chromosome-wide, although a preference for integrated mobile elements and nearby regions of the chromosome exists. Inter-species mating induces increased spacer acquisition and may result in interactions between the acquisition machinery of the two species. Surprisingly, many of the spacers acquired following inter-species mating target self-replicons along with those originating from the mating partner, indicating that the acquisition machinery cannot distinguish self from non-self under these conditions. Engineering the chromosome of one species to be targeted by the other's CRISPR-Cas reduces gene exchange between them substantially. Thus, spacers acquired during inter-species mating could limit future gene transfer, resulting in a role for CRISPR-Cas systems in microbial speciation.},
}
@article {pmid30477421,
year = {2018},
author = {Zhang, S and Zhang, R and Song, G and Gao, J and Li, W and Han, X and Chen, M and Li, Y and Li, G},
title = {Targeted mutagenesis using the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system in common wheat.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {302},
pmid = {30477421},
issn = {1471-2229},
support = {2016YFD0100500//Ministry of Science and Technology of the People's Republic of China (CN)/ ; 2017GNC10113//Key R&amp;D Programme of Shandong Province/ ; 31601301//the National Natural Science Foundation of China/ ; 31501312//the National Natural Science Foundation of China/ ; ZR2014CM006//the Natural Science Foundation of Shandong Province/ ; 2016YQN01//the Youth Foundation of Shandong Academy of Agricultural Science/ ; 2018ZX0800910B-002//National Science and Technology Major Project of Breeding New Varieties of Genetically Modified Organisms/ ; 31701428//he National Natural Science Foundation of China/ ; CXGC2016C09//the Agricultural Science and Technology Innovation Project of Shandong Academy of Agricultural Sciences/ ; },
mesh = {Agrobacterium tumefaciens/*genetics ; *CRISPR-Cas Systems ; *Gene Targeting ; Genes, Plant ; *Mutagenesis ; Triticum/*genetics ; },
abstract = {BACKGROUND: Recently, the CRISPR/Cas9 system has been widely used to precisely edit plant genomes. Due to the difficulty in Agrobacterium-mediated genetic transformation of wheat, the reported applications in CRISPR/Cas9 system were all based on the biolistic transformation.<br><br>RESULTS: In the present study, we efficiently applied targeted mutagenesis in common wheat (Triticum aestivum L.) protoplasts and transgenic T0 plants using the CRISPR/Cas9 system delivered via Agrobacterium tumefaciens. Seven target sites in three genes (Pinb, waxy and DA1) were selected to construct individual expression vectors. The activities of the sgRNAs were evaluated by transforming the constructed vectors into wheat protoplasts. Mutations in the targets were detected by Illumina sequencing. Genome editing, including insertions or deletions at the target sites, was found in the wheat protoplast cells. The highest mutation efficiency was 6.8% in the DA1 gene. The CRISPR/Cas9 binary vector targeting the DA1 gene was then transformed into common wheat plants by Agrobacterium tumefaciens-mediated transformation, resulting in efficient target gene editing in the T0 generation. Thirteen mutant lines were generated, and the mutation efficiency was 54.17%. Mutations were found in the A and B genomes of the transgenic plants but not in the D genome. In addition, off-target mutations were not detected in regions that were highly homologous to the sgRNA sequences.<br><br>CONCLUSIONS: Our results showed that our Agrobacterium-mediated CRISPR/Cas9 system can be used for targeted mutations and facilitated wheat genetic improvement.},
}
@article {pmid30473704,
year = {2018},
author = {Teague, WJ and Jones, MLM and Hawkey, L and Smyth, IM and Catubig, A and King, SK and Sarila, G and Li, R and Hutson, JM},
title = {FGF10 and the Mystery of Duodenal Atresia in Humans.},
journal = {Frontiers in genetics},
volume = {9},
number = {},
pages = {530},
pmid = {30473704},
issn = {1664-8021},
abstract = {Background: Duodenal atresia (DA) is a congenital obstruction of the duodenum, which affects 1 in 7000 pregnancies and requires major surgery in the 1st days of life. Three morphological DA types are described. In humans, the association between DA and Down syndrome suggests an underlying, albeit elusive, genetic etiology. In mice, interruption of fibroblast growth factor 10 (Fgf10) gene signaling results in DA in 30-50% of embryos, supporting a genetic etiology. This study aims to validate the spectrum of DA in two novel strains of Fgf10 knock-out mice, in preparation for future and translational research. Methods: Two novel CRISPR Fgf10 knock-out mouse strains were derived and embryos generated by heterozygous plug-mating. E15.5-E19.5 embryos were genotyped with respect to Fgf10 and micro-dissected to determine the presence and type of DA. Results: One twenty seven embryos (32 wild-type, 34 heterozygous, 61 null) were analyzed. No wild-type or heterozygous embryos had DA. However, 74% of Fgf10 null embryos had DA (49% type 1, 18% type 2, and 33% type 3). Conclusion: Our CRISPR-derived strains showed higher penetrance of DA due to single-gene deletion of Fgf10 in mice than previously reported. Further, the DA type distribution in these mice more closely reiterated that observed in humans. Future experiments will document RNA and protein expression of FGF10 and its key downstream signaling targets in normal and atretic duodenum. This includes exploitation of modern, high-fidelity developmental tools, e.g., Fgf10flox/+-tomatoflox/flox mice.},
}
@article {pmid30467400,
year = {2018},
author = {Yan, Y and Finnigan, GC},
title = {Development of a multi-locus CRISPR gene drive system in budding yeast.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {17277},
pmid = {30467400},
issn = {2045-2322},
support = {P20 GM103418/GM/NIGMS NIH HHS/United States ; P20 GM103418//U.S. Department of Health &amp; Human Services | NIH | National Institute of General Medical Sciences (NIGMS)/ ; Hatch Project 1013520//USDA | National Institute of Food and Agriculture (NIFA)/ ; },
abstract = {The discovery of CRISPR/Cas gene editing has allowed for major advances in many biomedical disciplines and basic research. One arrangement of this biotechnology, a nuclease-based gene drive, can rapidly deliver a genetic element through a given population and studies in fungi and metazoans have demonstrated the success of such a system. This methodology has the potential to control biological populations and contribute to eradication of insect-borne diseases, agricultural pests, and invasive species. However, there remain challenges in the design, optimization, and implementation of gene drives including concerns regarding biosafety, containment, and control/inhibition. Given the numerous gene drive arrangements possible, there is a growing need for more advanced designs. In this study, we use budding yeast to develop an artificial multi-locus gene drive system. Our minimal setup requires only a single copy of S. pyogenes Cas9 and three guide RNAs to propagate three gene drives. We demonstrate how this system could be used for targeted allele replacement of native genes and to suppress NHEJ repair systems by modifying DNA Ligase IV. A multi-locus gene drive configuration provides an expanded suite of options for complex attributes including pathway redundancy, combatting evolved resistance, and safeguards for control, inhibition, or reversal of drive action.},
}
@article {pmid30466900,
year = {2018},
author = {Monteiro, R and Pires, DP and Costa, AR and Azeredo, J},
title = {Phage Therapy: Going Temperate?.},
journal = {Trends in microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tim.2018.10.008},
pmid = {30466900},
issn = {1878-4380},
abstract = {Strictly lytic phages have been consensually preferred for phage therapy purposes. In contrast, temperate phages have been avoided due to an inherent capacity to mediate transfer of genes between bacteria by specialized transduction - an event that may increase bacterial virulence, for example, by promoting antibiotic resistance. Now, advances in sequencing technologies and synthetic biology are providing new opportunities to explore the use of temperate phages for therapy against bacterial infections. By doing so we can considerably expand our armamentarium against the escalating threat of antibiotic-resistant bacteria.},
}
@article {pmid30466578,
year = {2018},
author = {Pandiarajan, R and Grover, A},
title = {In vivo promoter engineering in plants: Are we ready?.},
journal = {Plant science : an international journal of experimental plant biology},
volume = {277},
number = {},
pages = {132-138},
doi = {10.1016/j.plantsci.2018.10.011},
pmid = {30466578},
issn = {1873-2259},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Genome, Plant/*genetics ; Promoter Regions, Genetic/*genetics ; },
abstract = {Engineering plant promoter sequence for optimal expression of a gene has been a long standing goal for plant scientists. In recent times, Sequence Specific Nucleases (SSNs) like CRISPR/Cas9 are enabling researchers to achieve this goal, in vivo in the genome. It is well known that SSNs have met with unprecedented success in rapid transgene free crop improvement largely by targeting the coding sequence. Here, we discuss the strategies being employed by plant scientists in targeting SSNs to non-coding promoter regions/Cis Regulatory Elements (CRE). We collectively refer all such endeavors as in vivo promoter engineering (IPE). We further classify the IPE efforts into CRE addition, CRE deletion/disruption, promoter swap/insertion and targeted promoter polymorphism. Till date, IPE has proven useful in altering plant architecture in tomato, developing resistance against Xanthomonas sp in rice and citrus, and engineering drought tolerance in maize. However it is quite challenging to achieve predictable changes in gene expression using IPE at this point. In future years, data generated from high throughput techniques to investigate non coding genome may immensely augment the efforts in this direction. As IPE does not involve addition of the transgene for modifying crop traits, it will be relatively more conducive to public acceptance in crop improvement programs.},
}
@article {pmid30466456,
year = {2018},
author = {Wong, NK and Huang, CL and Islam, R and Yip, SP},
title = {Long non-coding RNAs in hematological malignancies: translating basic techniques into diagnostic and therapeutic strategies.},
journal = {Journal of hematology &amp; oncology},
volume = {11},
number = {1},
pages = {131},
pmid = {30466456},
issn = {1756-8722},
support = {99QP//Hong Kong Polytechnic University/ ; 1-ZVJB//Hong Kong Polytechnic University/ ; G-YBX3//Hong Kong Polytechnic University/ ; 31701192//National Natural Science Foundation of China/ ; },
abstract = {Recent studies have revealed that non-coding regions comprise the vast majority of the human genome and long non-coding RNAs (lncRNAs) are a diverse class of non-coding RNAs that has been implicated in a variety of biological processes. Abnormal expression of lncRNAs has also been linked to different human diseases including cancers, yet the regulatory mechanisms and functional effects of lncRNAs are still ambiguous, and the molecular details also need to be confirmed. Unlike protein-coding gene, it is much more challenging to unravel the roles of lncRNAs owing to their unique and complex features such as functional diversity and low conservation among species, which greatly hamper their experimental characterization. In this review, we summarize and discuss both conventional and advanced approaches for the identification and functional characterization of lncRNAs related to hematological malignancies. In particular, the utility and advancement of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system as gene-editing tools are envisioned to facilitate the molecular dissection of lncRNAs via different knock-in/out strategies. Besides experimental considerations specific to lncRNAs, the roles of lncRNAs in the pathogenesis and progression of leukemia are also highlighted in the review. We expect that these insights may ultimately lead to clinical applications including development of biomarkers and novel therapeutic approaches targeting lncRNAs.},
}
@article {pmid30464460,
year = {2018},
author = {Cheng, WJ and Chen, LC and Ho, HO and Lin, HL and Sheu, MT},
title = {Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy.},
journal = {International journal of nanomedicine},
volume = {13},
number = {},
pages = {7079-7094},
pmid = {30464460},
issn = {1178-2013},
mesh = {Animals ; B7-H1 Antigen/*metabolism ; CRISPR-Associated Protein 9/metabolism ; CRISPR-Cas Systems/*genetics ; Cell Death ; Cell Line, Tumor ; Cell Survival ; Endocytosis ; Gene Silencing ; Humans ; *Immunotherapy ; Mice ; Nanoparticles/*chemistry/ultrastructure ; Particle Size ; Plasmids/metabolism ; Polyethyleneimine/*chemistry ; Proton Magnetic Resonance Spectroscopy ; RNA, Small Interfering/genetics/*metabolism ; Serum Albumin, Human/*chemistry ; Static Electricity ; Stearic Acids/*chemistry ; Transfection ; },
abstract = {Purpose: In this study, a double emulsion method for complexing plasmids with stearyl poly-ethylenimine (stPEI) as the core to form human serum albumin (HSA) (plasmid/stPEI/HSA) nanoparticles (NPs) was developed for gene delivery by non-covalently binding onto plasmid/stPEI/HSA nanoparticles with CRISPR/Cas9 or siRNA, which disrupts or silences the expression of programmed cell death ligand-1 (PD-L1) for immunotherapy.<br><br>Materials and methods: Chemically synthesized stearyl-polyethyenimine (stPEI)/plasmids/HSA nanoparticles were maded by double emulsion method. They were characterized by dynamic light scattering (DLS), transmission electron microscope and also evaluated by in vitro study on CT 26 cells.<br><br>Results: stPEI was synthesized by an N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC)-N-hydroxysuccinimide (NHS) reaction, and we found that the degree of substitution was ~1.0 when the ratio of PEI to stearic acid was 1:7 in the reaction. Then, two sgRNA sequences were selected and evaluated for their ability to knock out PD-L1 by decreasing its expression by about 20%. Based on the trend of particle size/zeta potential values as a function of ratio, F25P1 containing 25 μg of plasmid/stPEI/HSA NPs noncovalently bound to 1 μg plasmids via charge-charge interactions was found to be optimal. Its particle size was about 202.7±4.5 nm, and zeta potential was 12.60±0.15 mV. In an in vitro study, these NPs showed little cytotoxicity but high cellular uptake. Moreover, they revealed the potential for transfection and PD-L1 knockout in an in vitro cell model. Furthermore, F25P1S0.5 containing 25 μg of plasmid/stPEI/HSA NPs noncovalently bound to 1 μg of plasmids and 0.5 μg siRNA was prepared to simultaneously deliver plasmids and siRNA. An in vitro study demonstrated that the siRNA did not interfere with the transfection of plasmids and showed a high-transfection efficiency with a synergistic effect on inhibition of PD-L1 expression by 21.95%.<br><br>Conclusion: The plasmids/stPEI/HSA NPs could be a promising tool for gene delivery and improved immunotherapy.},
}
@article {pmid30463938,
year = {2019},
author = {Gas-Pascual, E and Ichikawa, HT and Sheikh, MO and Serji, MI and Deng, B and Mandalasi, M and Bandini, G and Samuelson, J and Wells, L and West, CM},
title = {CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology.},
journal = {The Journal of biological chemistry},
volume = {294},
number = {4},
pages = {1104-1125},
doi = {10.1074/jbc.RA118.006072},
pmid = {30463938},
issn = {1083-351X},
support = {R01 GM037539/GM/NIGMS NIH HHS/United States ; R21 AI123161/AI/NIAID NIH HHS/United States ; P41 GM103390/GM/NIGMS NIH HHS/United States ; P41 RR018502/RR/NCRR NIH HHS/United States ; P41 GM103490/GM/NIGMS NIH HHS/United States ; R01 GM084383/GM/NIGMS NIH HHS/United States ; R01 AI110638/AI/NIAID NIH HHS/United States ; },
abstract = {Infection with the protozoan parasite Toxoplasma gondii is a major health risk owing to birth defects, its chronic nature, ability to reactivate to cause blindness and encephalitis, and high prevalence in human populations. Unlike most eukaryotes, Toxoplasma propagates in intracellular parasitophorous vacuoles, but like nearly all other eukaryotes, Toxoplasma glycosylates many cellular proteins and lipids and assembles polysaccharides. Toxoplasma glycans resemble those of other eukaryotes, but species-specific variations have prohibited deeper investigations into their roles in parasite biology and virulence. The Toxoplasma genome encodes a suite of likely glycogenes expected to assemble N-glycans, O-glycans, a C-glycan, GPI-anchors, and polysaccharides, along with their precursors and membrane transporters. To investigate the roles of specific glycans in Toxoplasma, here we coupled genetic and glycomics approaches to map the connections between 67 glycogenes, their enzyme products, the glycans to which they contribute, and cellular functions. We applied a double-CRISPR/Cas9 strategy, in which two guide RNAs promote replacement of a candidate gene with a resistance gene; adapted MS-based glycomics workflows to test for effects on glycan formation; and infected fibroblast monolayers to assess cellular effects. By editing 17 glycogenes, we discovered novel Glc0-2-Man6-GlcNAc2-type N-glycans, a novel HexNAc-GalNAc-mucin-type O-glycan, and Tn-antigen; identified the glycosyltransferases for assembling novel nuclear O-Fuc-type and cell surface Glc-Fuc-type O-glycans; and showed that they are important for in vitro growth. The guide sequences, editing constructs, and mutant strains are freely available to researchers to investigate the roles of glycans in their favorite biological processes.},
}
@article {pmid30462638,
year = {2018},
author = {LaRoche-Johnston, F and Monat, C and Coulombe, S and Cousineau, B},
title = {Bacterial group II introns generate genetic diversity by circularization and trans-splicing from a population of intron-invaded mRNAs.},
journal = {PLoS genetics},
volume = {14},
number = {11},
pages = {e1007792},
pmid = {30462638},
issn = {1553-7404},
mesh = {Bacteria/*genetics/metabolism ; Bacterial Proteins/genetics/metabolism ; Base Sequence ; DNA Transposable Elements/genetics ; Evolution, Molecular ; Genetic Variation ; Humans ; *Introns ; Lactococcus lactis/genetics/metabolism ; Models, Genetic ; Nucleic Acid Conformation ; RNA/chemistry/genetics/metabolism ; RNA, Bacterial/chemistry/*genetics/metabolism ; RNA, Messenger/chemistry/genetics/metabolism ; Retroelements ; Spliceosomes/genetics ; Trans-Splicing ; },
abstract = {Group II introns are ancient retroelements that significantly shaped the origin and evolution of contemporary eukaryotic genomes. These self-splicing ribozymes share a common ancestor with the telomerase enzyme, the spliceosome machinery as well as the highly abundant spliceosomal introns and non-LTR retroelements. More than half of the human genome thus consists of various elements that evolved from ancient group II introns, which altogether significantly contribute to key functions and genetic diversity in eukaryotes. Similarly, group II intron-related elements in bacteria such as abortive phage infection (Abi) retroelements, diversity generating retroelements (DGRs) and some CRISPR-Cas systems have evolved to confer important functions to their hosts. In sharp contrast, since bacterial group II introns are scarce, irregularly distributed and frequently spread by lateral transfer, they have mainly been considered as selfish retromobile elements with no beneficial function to their host. Here we unveil a new group II intron function that generates genetic diversity at the RNA level in bacterial cells. We demonstrate that Ll.LtrB, the model group II intron from Lactococcus lactis, recognizes specific sequence motifs within cellular mRNAs by base pairing, and invades them by reverse splicing. Subsequent splicing of ectopically inserted Ll.LtrB, through circularization, induces a novel trans-splicing pathway that generates exon 1-mRNA and mRNA-mRNA intergenic chimeras. Our data also show that recognition of upstream alternative circularization sites on intron-interrupted mRNAs release Ll.LtrB circles harboring mRNA fragments of various lengths at their splice junction. Intergenic trans-splicing and alternative circularization both produce novel group II intron splicing products with potential new functions. Overall, this work describes new splicing pathways in bacteria that generate, similarly to the spliceosome in eukaryotes, genetic diversity at the RNA level while providing additional functional and evolutionary links between group II introns, spliceosomal introns and the spliceosome.},
}
@article {pmid30461029,
year = {2018},
author = {Jansson, S},
title = {Gene-edited plants: What is happening now?.},
journal = {Physiologia plantarum},
volume = {164},
number = {4},
pages = {370-371},
doi = {10.1111/ppl.12853},
pmid = {30461029},
issn = {1399-3054},
mesh = {Agriculture/legislation &amp; jurisprudence/methods/trends ; *CRISPR-Cas Systems ; Gene Editing/legislation &amp; jurisprudence/*methods/trends ; Plants/*genetics ; Plants, Genetically Modified ; },
}
@article {pmid30459943,
year = {2018},
author = {Tang, Y and Fu, Y},
title = {Class 2 CRISPR/Cas: an expanding biotechnology toolbox for and beyond genome editing.},
journal = {Cell &amp; bioscience},
volume = {8},
number = {},
pages = {59},
pmid = {30459943},
issn = {2045-3701},
abstract = {Artificial nuclease-dependent DNA cleavage systems (zinc-finger nuclease, ZFN; transcription activator like effectors, TALENs) and exogenous nucleic acid defense systems (CRISPR/Cas) have been used in the new era for genome modification. The most widely used toolbox for genome editing, modulation and detection contains Types II, V and VI of CRISPR/Cas Class 2 systems, categorized and characterized by Cas9, Cas12a and Cas13 respectively. In this review, we (1) elaborate on the definition, classification, structures of CRISPR/Cas Class 2 systems; (2) advance our understanding of new molecular mechanisms and recent progress in their applications, especially beyond genome-editing applications; (3) provide the insights on the specificity, efficiency and versatility of each tool; (4) elaborate the enhancement on specificity and efficiency of the CRISPR/Cas toolbox. The expanding and concerted usage of the CRISPR/Cas tools is making them more powerful in genome editing and other biotechnology applications.},
}
@article {pmid30451839,
year = {2018},
author = {Bolukbasi, MF and Liu, P and Luk, K and Kwok, SF and Gupta, A and Amrani, N and Sontheimer, EJ and Zhu, LJ and Wolfe, SA},
title = {Orthogonal Cas9-Cas9 chimeras provide a versatile platform for genome editing.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4856},
pmid = {30451839},
issn = {2041-1723},
support = {R01 AI117839/AI/NIAID NIH HHS/United States ; R01 GM115911/GM/NIGMS NIH HHS/United States ; R01 HL093766/HL/NHLBI NIH HHS/United States ; },
mesh = {Bacterial Proteins/*genetics/metabolism ; *Base Sequence ; *CRISPR-Cas Systems ; Carrier Proteins/genetics/metabolism ; Endonucleases/*genetics/metabolism ; Gene Editing/*methods ; Genetic Engineering ; Genome, Human ; HEK293 Cells ; Humans ; Jurkat Cells ; K562 Cells ; Mutant Chimeric Proteins/*genetics/metabolism ; Neisseria meningitidis/enzymology/genetics ; Nuclear Proteins/genetics/metabolism ; *Sequence Deletion ; Staphylococcus aureus/enzymology/genetics ; },
abstract = {The development of robust, versatile and accurate toolsets is critical to facilitate therapeutic genome editing applications. Here we establish RNA-programmable Cas9-Cas9 chimeras, in single- and dual-nuclease formats, as versatile genome engineering systems. In both of these formats, Cas9-Cas9 fusions display an expanded targeting repertoire and achieve highly specific genome editing. Dual-nuclease Cas9-Cas9 chimeras have distinct advantages over monomeric Cas9s including higher target site activity and the generation of predictable precise deletion products between their target sites. At a therapeutically relevant site within the BCL11A erythroid enhancer, Cas9-Cas9 nucleases produced precise deletions that comprised up to 97% of all sequence alterations. Thus Cas9-Cas9 chimeras represent an important tool that could be particularly valuable for therapeutic genome editing applications where a precise cleavage position and defined sequence end products are desirable.},
}
@article {pmid30451675,
year = {2018},
author = {Croteau, FR and Rousseau, GM and Moineau, S},
title = {[The CRISPR-Cas system: beyond genome editing].},
journal = {Medecine sciences : M/S},
volume = {34},
number = {10},
pages = {813-819},
doi = {10.1051/medsci/2018215},
pmid = {30451675},
issn = {1958-5381},
mesh = {Animals ; CRISPR-Cas Systems/*physiology ; Gene Editing/*methods/trends ; Genetic Engineering/methods/*trends ; Genetic Therapy/methods/trends ; *Genome ; Humans ; },
abstract = {CRISPR-Cas is an adaptive immune system used by many microbes to defend against nucleic acids invasion such as viral genomes. The microbial system uses its CRISPR locus to store genetic information that will generate short CRISPR RNAs. The latter with endonucleases (Cas) prevent future viral infections. Parts of this system were exploited to develop a powerful genome editing tool that was adapted for a variety of organisms. The ability of the CRISPR-Cas9 technology to effectively and precisely cut a targeted genomic DNA region has the potential to may be one day cure genetic diseases. The malleability of this editing tool also offers a wide range of possibilities from modulations of gene expression to epigenetic modifications. The natural CRISPR loci found in bacteria can be used to differentiate microbial strains or to study the interactions between bacteria and its habitat. Addressing CRISPR-Cas fundamentals in microbes and its popular use in eukaryotes, this review presents an update on a system that has revolutionized biological sciences.},
}
@article {pmid30446870,
year = {2019},
author = {Liu, Q and Wang, C and Jiao, X and Zhang, H and Song, L and Li, Y and Gao, C and Wang, K},
title = {Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems.},
journal = {Science China. Life sciences},
volume = {62},
number = {1},
pages = {1-7},
doi = {10.1007/s11427-018-9402-9},
pmid = {30446870},
issn = {1869-1889},
abstract = {The CRISPR/Cas system has been extensively applied to make precise genetic modifications in various organisms. Despite its importance and widespread use, large-scale mutation screening remains time-consuming, labour-intensive and costly. Here, we developed Hi-TOM (available at https://doi.org/www.hi-tom.net/hi-tom/), an online tool to track the mutations with precise percentage for multiple samples and multiple target sites. We also described a corresponding next-generation sequencing (NGS) library construction strategy by fixing the bridge sequences and barcoding primers. Analysis of the samples from rice, hexaploid wheat and human cells reveals that the Hi-TOM tool has high reliability and sensitivity in tracking various mutations, especially complex chimeric mutations frequently induced by genome editing. Hi-TOM does not require special design of barcode primers, cumbersome parameter configuration or additional data analysis. Thus, the streamlined NGS library construction and comprehensive result output make Hi-TOM particularly suitable for high-throughput identification of all types of mutations induced by CRISPR/Cas systems.},
}
@article {pmid30446639,
year = {2018},
author = {Wang, H and Shi, Y and Wang, L and Liu, S and Wu, S and Yang, Y and Feyereisen, R and Wu, Y},
title = {CYP6AE gene cluster knockout in Helicoverpa armigera reveals role in detoxification of phytochemicals and insecticides.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4820},
pmid = {30446639},
issn = {2041-1723},
mesh = {Animals ; Base Sequence ; CRISPR-Associated Protein 9/genetics/metabolism ; CRISPR-Cas Systems ; Cytochrome P-450 Enzyme System/deficiency/*genetics ; Embryo, Nonmammalian ; Female ; Gene Editing/methods ; Gene Expression ; *Genome, Insect ; Inactivation, Metabolic/*genetics ; Insect Proteins/deficiency/*genetics ; Insecticide Resistance/*genetics ; Insecticides/*metabolism/pharmacology ; Larva/drug effects/enzymology/genetics/growth &amp; development ; Lethal Dose 50 ; Male ; Moths/drug effects/enzymology/*genetics/growth &amp; development ; Multigene Family ; Mutation ; RNA, Guide/genetics/metabolism ; Reverse Genetics ; },
abstract = {The cotton bollworm Helicoverpa armigera, is one of the world's major pest of agriculture, feeding on over 300 hosts in 68 plant families. Resistance cases to most insecticide classes have been reported for this insect. Management of this pest in agroecosystems relies on a better understanding of how it copes with phytochemical or synthetic toxins. We have used genome editing to knock out a cluster of nine P450 genes and show that this significantly reduces the survival rate of the insect when exposed to two classes of host plant chemicals and two classes of insecticides. Functional expression of all members of this gene cluster identified the P450 enzymes capable of metabolism of these xenobiotics. The CRISPR-Cas9-based reverse genetics approach in conjunction with in vitro metabolism can rapidly identify the contributions of insect P450s in xenobiotic detoxification and serve to identify candidate genes for insecticide resistance.},
}
@article {pmid30444997,
year = {2018},
author = {Mo, CY and Marraffini, LA},
title = {If You'd Like to Stop a Type III CRISPR Ribonuclease, Then You Should Put a Ring (Nuclease) on It.},
journal = {Molecular cell},
volume = {72},
number = {4},
pages = {608-609},
doi = {10.1016/j.molcel.2018.10.048},
pmid = {30444997},
issn = {1097-4164},
abstract = {Athukoralage et al. (2018) identify a new class of nuclease that degrades cyclic oligoadenylate (cOA), a second messenger that activates non-specific RNA degradation by the type III CRISPR-Cas accessory RNase Csm6/Csx1. This discovery provides a mechanism for regulating the degradation of foreign transcripts during the type III CRISPR immune response.},
}
@article {pmid30443021,
year = {2018},
author = {Riad, A and Zeng, C and Weng, CC and Winters, H and Xu, K and Makvandi, M and Metz, T and Carlin, S and Mach, RH},
title = {Sigma-2 Receptor/TMEM97 and PGRMC-1 Increase the Rate of Internalization of LDL by LDL Receptor through the Formation of a Ternary Complex.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16845},
pmid = {30443021},
issn = {2045-2322},
abstract = {CRISPR/Cas gene studies were conducted in HeLa cells where either PGRMC1, TMEM97 or both proteins were removed via gene editing. A series of radioligand binding studies, confocal microscopy studies, and internalization of radiolabeled or fluorescently tagged LDL particles were then conducted in these cells. The results indicate that PGRMC1 knockout (KO) did not reduce the density of binding sites for the sigma-2 receptor (σ2R) radioligands, [125I]RHM-4 or [3H]DTG, but a reduction in the receptor affinity of both radioligands was observed. TMEM97 KO resulted in a complete loss of binding of [125I]RHM-4 and a significant reduction in binding of [3H]DTG. TMEM97 KO and PGRMC1 KO resulted in an equal reduction in the rate of uptake of fluorescently-tagged or 3H-labeled LDL, and knocking out both proteins did not result in a further rate of reduction of LDL uptake. Confocal microscopy and Proximity Ligation Assay studies indicated a clear co-localization of LDLR, PGRMC1 and TMEM97. These data indicate that the formation of a ternary complex of LDLR-PGRMC1-TMEM97 is necessary for the rapid internalization of LDL by LDLR.},
}
@article {pmid30442934,
year = {2018},
author = {Lee, HK and Willi, M and Miller, SM and Kim, S and Liu, C and Liu, DR and Hennighausen, L},
title = {Targeting fidelity of adenine and cytosine base editors in mouse embryos.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4804},
pmid = {30442934},
issn = {2041-1723},
support = {R01 EB022376/EB/NIBIB NIH HHS/United States ; R35 GM118062/GM/NIGMS NIH HHS/United States ; RM1 HG009490/HG/NHGRI NIH HHS/United States ; U01 AI142756/AI/NIAID NIH HHS/United States ; },
mesh = {Adenine/*metabolism ; Alleles ; Animals ; Animals, Genetically Modified ; CRISPR-Associated Protein 9/genetics/metabolism ; *CRISPR-Cas Systems ; Cytosine/*metabolism ; Embryo, Mammalian ; Gene Editing/*methods ; Genetic Loci ; Mice ; Microinjections ; *Point Mutation ; RNA, Guide/genetics/metabolism ; Reproducibility of Results ; Sensitivity and Specificity ; Zygote ; },
abstract = {Base editing directly converts a target base pair into a different base pair in the genome of living cells without introducing double-stranded DNA breaks. While cytosine base editors (CBE) and adenine base editors (ABE) are used to install and correct point mutations in a wide range of organisms, the extent and distribution of off-target edits in mammalian embryos have not been studied in detail. We analyze on-target and proximal off-target editing at 13 loci by a variety of CBEs and ABE in more than 430 alleles generated from mouse zygotic injections using newly generated and published sequencing data. ABE predominantly generates anticipated A•T-to-G•C edits. Among CBEs, SaBE3 and BE4, result in the highest frequencies of anticipated C•G-to-T•A products relative to editing byproducts. Together, these findings highlight the remarkable fidelity of ABE in mouse embryos and identify preferred CBE variants when fidelity in vivo is critical.},
}
@article {pmid30442929,
year = {2018},
author = {Koh, B and Abdul Qayum, A and Srivastava, R and Fu, Y and Ulrich, BJ and Janga, SC and Kaplan, MH},
title = {A conserved enhancer regulates Il9 expression in multiple lineages.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4803},
pmid = {30442929},
issn = {2041-1723},
support = {R01 AI129241/AI/NIAID NIH HHS/United States ; P30 CA082709/CA/NCI NIH HHS/United States ; R03 AI135356/AI/NIAID NIH HHS/United States ; U54 DK106846/DK/NIDDK NIH HHS/United States ; T32 DK007519/DK/NIDDK NIH HHS/United States ; R01 AI057459/AI/NIAID NIH HHS/United States ; },
mesh = {Animals ; Binding Sites ; CRISPR-Cas Systems ; Cell Differentiation ; Cell Lineage/genetics/*immunology ; Conserved Sequence ; *Enhancer Elements, Genetic ; Female ; Gene Editing ; Gene Expression Regulation ; Humans ; Interleukin-9/*genetics/immunology ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Primary Cell Culture ; Protein Binding ; T-Lymphocytes, Helper-Inducer/cytology/*immunology ; Transcription Factors/*genetics/immunology ; },
abstract = {Cytokine genes are regulated by multiple regulatory elements that confer tissue-specific and activation-dependent expression. The cis-regulatory elements of the gene encoding IL-9, a cytokine that promotes allergy, autoimmune inflammation and tumor immunity, have not been defined. Here we identify an enhancer (CNS-25) upstream of the Il9 gene that binds most transcription factors (TFs) that promote Il9 gene expression. Deletion of the enhancer in the mouse germline alters transcription factor binding to the remaining Il9 regulatory elements, and results in diminished IL-9 production in multiple cell types including Th9 cells, and attenuates IL-9-dependent immune responses. Moreover, deletion of the homologous enhancer (CNS-18) in primary human Th9 cultures results in significant decrease of IL-9 production. Thus, Il9 CNS-25/IL9 CNS-18 is a critical and conserved regulatory element for IL-9 production.},
}
@article {pmid30429256,
year = {2018},
author = {Strich, JR and Chertow, DS},
title = {CRISPR-Cas Biology and Infectious Diseases Applications.},
journal = {Journal of clinical microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1128/JCM.01307-18},
pmid = {30429256},
issn = {1098-660X},
abstract = {Infectious diseases remain a global threat contributing to excess morbidity and mortality annually with persistent potential for destabilizing pandemics. Improved understanding of the pathogenesis of bacteria, viruses, fungi, and parasites, along with rapid diagnosis and treatment of human infections are essential to improving infectious diseases outcomes worldwide. Genomic loci in bacteria and archea, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) proteins, function as an adaptive immune system for prokaryotes protecting against foreign invaders. CRISPR-Cas9 is now routinely applied for efficient gene editing contributing to advances in biomedical science. In the past decade improved understanding of other diverse CRISPR-Cas systems has expanded CRISPR applications, including in the field of infectious diseases. In this review, we summarize the biology of CRISPR-Cas systems and discuss existing and emerging applications to evaluate mechanisms of host-pathogen interactions, to develop accurate and portable diagnostics, and to advance prevention and treatment of infectious diseases.},
}
@article {pmid30426198,
year = {2018},
author = {Hahn, F and Nekrasov, V},
title = {CRISPR/Cas precision: do we need to worry about off-targeting in plants?.},
journal = {Plant cell reports},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00299-018-2355-9},
pmid = {30426198},
issn = {1432-203X},
support = {BB/P016855/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {The CRISPR/Cas technology has recently become the tool of choice for targeted genome modification in plants and beyond. Although CRSIPR/Cas offers a rapid and facile way of introducing changes at genomic loci of interest, its application is associated with off-targeting, i.e. introduction of unintended mutations at off-target sites within the genome, which has been reported frequently in the mammalian field. Here we summarise the current knowledge on the precision of CRISPR/Cas in plant systems and provide a summary of state-of the-art strategies for avoiding off-target mutations, as well as unintended on-target changes, in plants. These include using natural (e.g. Cas12a) or engineered (e.g. SpCas9-HF) CRISPR/Cas nucleases characterised by higher precision, as compared to the commonly used wild type SpCas9. In addition, we discuss the usage of CRISPR/Cas nucleases in the form of ribonucleoproteins (RNPs) as an option for reducing off-targeting in plants. Finally, we conclude that the most important factor for reducing CRISPR/Cas off-targeting remains careful selection of target sequences, for which we provide an overview of available online software tools and experimental guidance.},
}
@article {pmid30425154,
year = {2018},
author = {Høyland-Kroghsbo, NM and Muñoz, KA and Bassler, BL},
title = {Temperature, by Controlling Growth Rate, Regulates CRISPR-Cas Activity in Pseudomonas aeruginosa.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
pmid = {30425154},
issn = {2150-7511},
support = {R37 GM065859/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR)-associated (CRISPR-Cas) systems are adaptive defense systems that protect bacteria and archaea from invading genetic elements. In Pseudomonas aeruginosa, quorum sensing (QS) induces the CRISPR-Cas defense system at high cell density when the risk of bacteriophage infection is high. Here, we show that another cue, temperature, modulates P. aeruginosa CRISPR-Cas. Increased CRISPR adaptation occurs at environmental (i.e., low) temperatures compared to that at body (i.e., high) temperature. This increase is a consequence of the accumulation of CRISPR-Cas complexes, coupled with reduced P. aeruginosa growth rate at the lower temperature, the latter of which provides additional time prior to cell division for CRISPR-Cas to patrol the cell and successfully eliminate and/or acquire immunity to foreign DNA. Analyses of a QS mutant and synthetic QS compounds show that the QS and temperature cues act synergistically. The diversity and level of phage encountered by P. aeruginosa in the environment exceed that in the human body, presumably warranting increased reliance on CRISPR-Cas at environmental temperatures.IMPORTANCEP. aeruginosa is a soil dwelling bacterium and a plant pathogen, and it also causes life-threatening infections in humans. Thus, P. aeruginosa thrives in diverse environments and over a broad range of temperatures. Some P. aeruginosa strains rely on the CRISPR-Cas adaptive immune system as a phage defense mechanism. Our discovery that low temperatures increase CRISPR adaptation suggests that the rarely occurring but crucial naive adaptation events may take place predominantly under conditions of slow growth, e.g., during the bacterium's soil dwelling existence and during slow growth in biofilms.},
}
@article {pmid30418590,
year = {2019},
author = {Gordeeva, J and Morozova, N and Sierro, N and Isaev, A and Sinkunas, T and Tsvetkova, K and Matlashov, M and Truncaite, L and Morgan, RD and Ivanov, NV and Siksnys, V and Zeng, L and Severinov, K},
title = {BREX system of Escherichia coli distinguishes self from non-self by methylation of a specific DNA site.},
journal = {Nucleic acids research},
volume = {47},
number = {1},
pages = {253-265},
doi = {10.1093/nar/gky1125},
pmid = {30418590},
issn = {1362-4962},
support = {R01 GM107597/GM/NIGMS NIH HHS/United States ; },
abstract = {Prokaryotes evolved numerous systems that defend against predation by bacteriophages. In addition to well-known restriction-modification and CRISPR-Cas immunity systems, many poorly characterized systems exist. One class of such systems, named BREX, consists of a putative phosphatase, a methyltransferase and four other proteins. A Bacillus cereus BREX system provides resistance to several unrelated phages and leads to modification of specific motif in host DNA. Here, we study the action of BREX system from a natural Escherichia coli isolate. We show that while it makes cells resistant to phage λ infection, induction of λ prophage from cells carrying BREX leads to production of viruses that overcome the defense. The induced phage DNA contains a methylated adenine residue in a specific motif. The same modification is found in the genome of BREX-carrying cells. The results establish, for the first time, that immunity to BREX system defense is provided by an epigenetic modification.},
}
@article {pmid30418108,
year = {2019},
author = {Aung, MS and San, T and San, N and Oo, WM and Ko, PM and Thet, KT and Urushibara, N and Kawaguchiya, M and Sumi, A and Kobayashi, N},
title = {Molecular characterization of Staphylococcus argenteus in Myanmar: identification of novel genotypes/clusters in staphylocoagulase, protein A, alpha-haemolysin and other virulence factors.},
journal = {Journal of medical microbiology},
volume = {68},
number = {1},
pages = {95-104},
doi = {10.1099/jmm.0.000869},
pmid = {30418108},
issn = {1473-5644},
mesh = {Adult ; Aged ; Aged, 80 and over ; Bacterial Proteins/*genetics ; Bacterial Typing Techniques ; Coagulase/genetics ; Female ; Genotype ; Hemolysin Proteins/genetics ; Humans ; Male ; Multilocus Sequence Typing ; Myanmar ; Phylogeny ; Staphylococcal Infections/*microbiology ; Staphylococcal Protein A/genetics ; Staphylococcus/enzymology/*genetics/isolation &amp; purification ; Virulence Factors/*genetics ; Young Adult ; },
abstract = {PURPOSE: Staphylococcus argenteus is a novel emerging species of coagulase-positive staphylococcus that is genetically closely related to Staphylococcus aureus. To elucidate the molecular differences in the virulence factors (staphylocoagulase, protein A, alpha-haemolysin, enterotoxin-like toxin and staphylokinase) between these staphylococcal species, S. argenteus that had recently been isolated in Myanmar (five nasal isolates and four clinical isolates) were analysed.<br><br>METHODOLOGY: The nucleotide sequences of the virulence factors were determined by PCR and direct sequencing, followed by phylogenetic analysis by mega6 and multiple alignment by clustalw using the published sequence data for S. aureus and S. argenteus.<br><br>RESULTS: Six S. argenteus isolates belonged to MLST sequence type (ST) 2250, while others belonged to ST4625, ST2198 and ST2854. The novel staphylocoagulase (coa) genotype XIV and the novel coa-XI subtype (XId) were identified in an ST2198 isolate and all other isolates, respectively. Among the S. argenteus isolates, the protein A and alpha-haemolysin genes showed high sequence identity (96-98 % and >99 %, respectively), while lower identity was observed between S. argenteus and S. aureus (88-91 % and 86 %, respectively), with both species showing phylogenetically distinct clusters. Similar findings were found for the staphylococcal enterotoxin (SE)-like toxin genes selw, selx and sely. In contrast, the staphylokinase genes were almost identical between these two species. All of the coa-XId isolates had a CRISPR/Cas locus at the site of orfX without having SCCmec, whereas an ST2198 isolate lacked this locus.<br><br>CONCLUSION: The primary virulence factors (staphylocoagulase, protein A andalpha-haemolysin) as well as the SE-like toxins of S. argenteus were genetically discriminated from those of S. aureus, revealing the presence of the novel coa-type/subtype (coa-IXd, XIV) in S. argenteus.},
}
@article {pmid30417500,
year = {2019},
author = {Wahiduzzaman, M and Karnan, S and Ota, A and Hanamura, I and Murakami, H and Inoko, A and Rahman, ML and Hyodo, T and Konishi, H and Tsuzuki, S and Hosokawa, Y},
title = {Establishment and characterization of CRISPR/Cas9-mediated NF2-/- human mesothelial cell line: Molecular insight into fibroblast growth factor receptor 2 in malignant pleural mesothelioma.},
journal = {Cancer science},
volume = {110},
number = {1},
pages = {180-193},
doi = {10.1111/cas.13871},
pmid = {30417500},
issn = {1349-7006},
support = {//Hirose International Scholarship Foundation/ ; },
mesh = {Adolescent ; Adult ; Aged ; Aged, 80 and over ; Base Sequence ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Movement/genetics ; Cell Proliferation/genetics ; Child, Preschool ; Female ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic ; Humans ; Lung Neoplasms/*genetics/metabolism/pathology ; Male ; Mesothelioma/*genetics/metabolism/pathology ; Middle Aged ; Neurofibromin 2/*genetics/metabolism ; Pleural Neoplasms/*genetics/metabolism/pathology ; Receptor, Fibroblast Growth Factor, Type 2/*genetics ; Sequence Homology, Nucleic Acid ; Young Adult ; },
abstract = {Malignant pleural mesothelioma (MPM), a highly refractory tumor, is currently incurable due to the lack of an early diagnosis method and medication, both of which are urgently needed to improve the survival and/or quality of life of patients. NF2 is a tumor suppressor gene and is frequently mutated in MPM. Using a CRISPR/Cas9 system, we generated an NF2-knockout human mesothelial cell line, MeT-5A (NF2-KO). In NF2-KO cell clones, cell growth, clonogenic activity, migration activity, and invasion activity significantly increased compared with those in NF2-WT cell clones. Complementary DNA microarray analysis clearly revealed the differences in global gene expression profile between NF2-WT and NF2-KO cell clones. Quantitative PCR analysis and western blot analysis showed that the upregulation of fibroblast growth factor receptor 2 (FGFR2) was concomitant with the increases in phosphorylation levels of JNK, c-Jun, and retinoblastoma (Rb) in NF2-KO cell clones. These increases were all abrogated by the exogenous expression of NF2 in the NF2-KO clone. In addition, the disruption of FGFR2 in the NF2-KO cell clone suppressed cell proliferation as well as the phosphorylation levels of JNK, c-Jun, and Rb. Notably, FGFR2 was found to be highly expressed in NF2-negative human mesothelioma tissues (11/12 cases, 91.7%) but less expressed in NF2-positive tissues. Collectively, these findings suggest that NF2 deficiency might play a role in the tumorigenesis of human mesothelium through mediating FGFR2 expression; FGFR2 would be a candidate molecule to develop therapeutic and diagnostic strategies for targeting MPM with NF2 loss.},
}
@article {pmid30417194,
year = {2018},
author = {Liu, BY and He, XY and Zhuo, RX and Cheng, SX},
title = {Reversal of tumor malignization and modulation of cell behaviors through genome editing mediated by a multi-functional nanovector.},
journal = {Nanoscale},
volume = {10},
number = {45},
pages = {21209-21218},
doi = {10.1039/c8nr07321j},
pmid = {30417194},
issn = {2040-3372},
mesh = {Aptamers, Nucleotide/*chemistry/metabolism ; CRISPR-Cas Systems/genetics ; Cell Movement ; Cell Survival ; Drug Carriers/chemistry ; Focal Adhesion Protein-Tyrosine Kinases/deficiency/genetics ; Gene Editing/*methods ; HEK293 Cells ; HeLa Cells ; Humans ; Microscopy, Confocal ; Mucin-1/genetics/metabolism ; Nanoparticles/*chemistry ; Oligodeoxyribonucleotides/chemistry/metabolism ; Plasmids/chemistry/metabolism ; Tumor Suppressor Protein p53/genetics/metabolism ; },
abstract = {To effectively reverse tumor malignization by genome editing, a multi-functional self-assembled nanovector for the delivery of a genome editing plasmid specifically to tumor cells was developed. The nanovector core consisting of protamine and calcium carbonate entrapping the CRISPR-Cas9 plasmid is decorated by aptamer incorporated heparin. Owing to a high affinity between a MUC1 specific aptamer and mucin 1 (MUC1) overexpressed in tumor cells as well as the interaction between AS1411 and nucleolin on the tumor cell surface and cell nuclei, the nanovector can target the nuclei of tumorous cells for the knockout of focal adhesion kinase (FAK). Notably, the genome editing mediated by our delivery systems can effectively modulate cell behaviors and thus reverse tumor malignization. Up-regulated p53, p16, p21, E-cadherin, CD80, MICA, MICB and Fas, together with down-regulated MMP-9, vimentin, VEGF, TGF-β, CD47 and CD133 in genome edited cells indicate that the genome editing system can inhibit cancerous cell growth, prevent tumor invasion and metastasis, reverse tumor-induced immune suppression, and inhibit cancer stemness. More importantly, the edited cells can maintain the modulated cellular function after succeeding subcultures.},
}
@article {pmid30413649,
year = {2019},
author = {Li, CJ and Jiang, C and Liu, Y and Bell, T and Ma, W and Ye, Y and Huang, S and Guo, H and Zhang, H and Wang, L and Wang, J and Nomie, K and Zhang, L and Wang, M},
title = {Pleiotropic Action of Novel Bruton's Tyrosine Kinase Inhibitor BGB-3111 in Mantle Cell Lymphoma.},
journal = {Molecular cancer therapeutics},
volume = {18},
number = {2},
pages = {267-277},
doi = {10.1158/1535-7163.MCT-18-0478},
pmid = {30413649},
issn = {1538-8514},
support = {P30 CA016672/CA/NCI NIH HHS/United States ; R21 CA202104/CA/NCI NIH HHS/United States ; },
abstract = {Bruton's tyrosine kinase (BTK) is a key mediator of BCR-dependent cell growth signaling and a clinically effective therapeutic target in mantle cell lymphoma (MCL). The molecular impact of BTK inhibition remains unclear particularly in hematopoietic malignancies. We analyzed the molecular mechanisms of BTK inhibition with the novel inhibitor BGB-3111 (zanubrutinib) in MCL models. The efficacy of BGB-3111 was investigated using growth proliferation/cell viability and apoptosis assays in MCL cell lines and patient-derived xenograft (PDX) MCL cells. The activity and mechanisms of BGB-3111 were further confirmed using a cell line xenograft model, an MCL PDX mouse model, and a human phosphokinase profiler array and reverse phase protein array. Finally, the mechanisms related to resistance to BTK inhibition were analyzed by creating cell lines with low levels of BTK using CRISPR/Cas 9 genome editing. We found that inhibition of BTK leads to suppression of tumor growth, which was mediated via potent suppression of AKT/mTOR, apoptosis, and metabolic stress. Moreover, targeted disruption of the BTK gene in MCL cells resulted in resistance to BTK inhibition and the emergence of novel survival mechanisms. Our studies suggest a general efficacy of BTK inhibition in MCL and potential drug resistance mechanism via alternative signaling pathways.},
}
@article {pmid30409154,
year = {2018},
author = {Duan, J and Lu, G and Hong, Y and Hu, Q and Mai, X and Guo, J and Si, X and Wang, F and Zhang, Y},
title = {Live imaging and tracking of genome regions in CRISPR/dCas9 knock-in mice.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {192},
pmid = {30409154},
issn = {1474-760X},
mesh = {Animals ; *CRISPR-Cas Systems ; Cells, Cultured ; *Genome ; Green Fluorescent Proteins/genetics/*metabolism ; HEK293 Cells ; Hep G2 Cells ; Hepatocytes/cytology/*metabolism ; Humans ; Image Processing, Computer-Assisted ; Mice ; Mice, Inbred C57BL ; Molecular Imaging/*methods ; Telomere/genetics/*metabolism ; },
abstract = {CRISPR/dCas9 is a versatile tool that can be used to recruit various effectors and fluorescent molecules to defined genome regions where it can modulate genetic and epigenetic markers, or track the chromatin dynamics in live cells. In vivo applications of CRISPR/dCas9 in animals have been challenged by delivery issues. We generate and characterize a mouse strain with dCas9-EGFP ubiquitously expressed in various tissues. Studying telomere dynamics in these animals reveals surprising results different from those observed in cultured cell lines. The CRISPR/dCas9 knock-in mice provide an important and versatile tool to mechanistically study genome functions in live animals.},
}
@article {pmid30403660,
year = {2018},
author = {Rousset, F and Cui, L and Siouve, E and Becavin, C and Depardieu, F and Bikard, D},
title = {Genome-wide CRISPR-dCas9 screens in E. coli identify essential genes and phage host factors.},
journal = {PLoS genetics},
volume = {14},
number = {11},
pages = {e1007749},
pmid = {30403660},
issn = {1553-7404},
mesh = {*CRISPR-Cas Systems ; Escherichia coli/*genetics/virology ; *Genes, Essential ; *Genetic Association Studies ; *Genome, Bacterial ; *Genome-Wide Association Study ; Host-Pathogen Interactions ; },
abstract = {High-throughput genetic screens are powerful methods to identify genes linked to a given phenotype. The catalytic null mutant of the Cas9 RNA-guided nuclease (dCas9) can be conveniently used to silence genes of interest in a method also known as CRISPRi. Here, we report a genome-wide CRISPR-dCas9 screen using a starting pool of ~ 92,000 sgRNAs which target random positions in the chromosome of E. coli. To benchmark our method, we first investigate its utility to predict gene essentiality in the genome of E. coli during growth in rich medium. We could identify 79% of the genes previously reported as essential and demonstrate the non-essentiality of some genes annotated as essential. In addition, we took advantage of the intermediate repression levels obtained when targeting the template strand of genes to show that cells are very sensitive to the expression level of a limited set of essential genes. Our data can be visualized on CRISPRbrowser, a custom web interface available at crispr.pasteur.fr. We then apply the screen to discover E. coli genes required by phages λ, T4 and 186 to kill their host, highlighting the involvement of diverse host pathways in the infection process of the three tested phages. We also identify colanic acid capsule synthesis as a shared resistance mechanism to all three phages. Finally, using a plasmid packaging system and a transduction assay, we identify genes required for the formation of functional λ capsids, thus covering the entire phage cycle. This study demonstrates the usefulness and convenience of pooled genome-wide CRISPR-dCas9 screens in bacteria and paves the way for their broader use as a powerful tool in bacterial genomics.},
}
@article {pmid30400943,
year = {2018},
author = {Guo, X and Dean, A},
title = {CRISPR/Cas9 offers a new tool for studying the role of chromatin architecture in disease pathogenesis.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {185},
pmid = {30400943},
issn = {1474-760X},
support = {DK075033/DK/NIDDK NIH HHS/United States ; },
mesh = {CCCTC-Binding Factor/genetics/*metabolism ; *CRISPR-Cas Systems ; *Chromatin ; *Gene Expression Regulation, Neoplastic ; Humans ; Male ; Prostatic Neoplasms/genetics/*pathology ; Protein Binding ; *Regulatory Elements, Transcriptional ; },
abstract = {A recent study used CRISPR/Cas9 to reveal long-range looping between disease-related genes and their regulatory elements that is mediated by the CCCTC-binding factor (CTCF) in prostate cancer.},
}
@article {pmid30400928,
year = {2018},
author = {Yao, Y},
title = {Genome editing: from tools to biological insights.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {186},
pmid = {30400928},
issn = {1474-760X},
mesh = {*CRISPR-Cas Systems ; Gene Editing/*methods ; *Genetic Engineering ; *Genome ; },
}
@article {pmid30400804,
year = {2018},
author = {Smith, JL and Mou, H and Xue, W},
title = {Understanding and repurposing CRISPR-mediated alternative splicing.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {184},
pmid = {30400804},
issn = {1474-760X},
support = {DP2 HL137167/HL/NHLBI NIH HHS/United States ; P01 HL131471/HL/NHLBI NIH HHS/United States ; UG3 HL147367/HL/NHLBI NIH HHS/United States ; },
mesh = {*Alternative Splicing ; *CRISPR-Cas Systems ; *Exons ; Gene Editing/*methods ; Humans ; RNA, Guide/*genetics ; },
abstract = {Two new studies refine our understanding of CRISPR-associated exon skipping and redefine its utility in engineering alternative splicing.},
}
@article {pmid30400152,
year = {2018},
author = {Koslová, A and Kučerová, D and Reinišová, M and Geryk, J and Trefil, P and Hejnar, J},
title = {Genetic Resistance to Avian Leukosis Viruses Induced by CRISPR/Cas9 Editing of Specific Receptor Genes in Chicken Cells.},
journal = {Viruses},
volume = {10},
number = {11},
pages = {},
pmid = {30400152},
issn = {1999-4915},
mesh = {Animals ; Avian Leukosis/*genetics/*virology ; Avian Leukosis Virus/*physiology ; Base Sequence ; *CRISPR-Cas Systems ; Cell Line ; Chickens ; Disease Resistance/*genetics ; *Gene Editing ; Genes, Viral ; Genetic Techniques ; Genetic Vectors/genetics ; RNA, Guide ; Receptors, Virus/*genetics/metabolism ; },
abstract = {Avian leukosis viruses (ALVs), which are pathogens of concern in domestic poultry, utilize specific receptor proteins for cell entry that are both necessary and sufficient for host susceptibility to a given ALV subgroup. This unequivocal relationship offers receptors as suitable targets of selection and biotechnological manipulation with the aim of obtaining virus-resistant poultry. This approach is further supported by the existence of natural knock-outs of receptor genes that segregate in inbred lines of chickens. We used CRISPR/Cas9 genome editing tools to introduce frame-shifting indel mutations into tva, tvc, and tvj loci encoding receptors for the A, C, and J ALV subgroups, respectively. For all three loci, the homozygous frame-shifting indels generating premature stop codons induced phenotypes which were fully resistant to the virus of respective subgroup. In the tvj locus, we also obtained in-frame deletions corroborating the importance of W38 and the four amino-acids preceding it. We demonstrate that CRISPR/Cas9-mediated knock-out or the fine editing of ALV receptor genes might be the first step in the development of virus-resistant chickens.},
}
@article {pmid30397647,
year = {2018},
author = {Chatterjee, P and Jakimo, N and Jacobson, JM},
title = {Minimal PAM specificity of a highly similar SpCas9 ortholog.},
journal = {Science advances},
volume = {4},
number = {10},
pages = {eaau0766},
pmid = {30397647},
issn = {2375-2548},
abstract = {RNA-guided DNA endonucleases of the CRISPR-Cas system are widely used for genome engineering and thus have numerous applications in a wide variety of fields. CRISPR endonucleases, however, require a specific protospacer adjacent motif (PAM) flanking the target site, thus constraining their targetable sequence space. In this study, we demonstrate the natural PAM plasticity of a highly similar, yet previously uncharacterized, Cas9 from Streptococcus canis (ScCas9) through rational manipulation of distinguishing motif insertions. To this end, we report affinity to minimal 5'-NNG-3' PAM sequences and demonstrate the accurate editing capabilities of the ortholog in both bacterial and human cells. Last, we build an automated bioinformatics pipeline, the Search for PAMs by ALignment Of Targets (SPAMALOT), which further explores the microbial PAM diversity of otherwise overlooked Streptococcus Cas9 orthologs. Our results establish that ScCas9 can be used both as an alternative genome editing tool and as a functional platform to discover novel Streptococcus PAM specificities.},
}
@article {pmid30397343,
year = {2019},
author = {Özcan, A and Pausch, P and Linden, A and Wulf, A and Schühle, K and Heider, J and Urlaub, H and Heimerl, T and Bange, G and Randau, L},
title = {Type IV CRISPR RNA processing and effector complex formation in Aromatoleum aromaticum.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {89-96},
doi = {10.1038/s41564-018-0274-8},
pmid = {30397343},
issn = {2058-5276},
abstract = {Type IV CRISPR-Cas modules belong to class 1 prokaryotic adaptive immune systems, which are defined by the presence of multisubunit effector complexes. They usually lack the known Cas proteins involved in adaptation and target cleavage, and their function has not been experimentally addressed. To investigate RNA and protein components of this CRISPR-Cas type, we located a complete type IV cas gene locus and an adjacent CRISPR array on a megaplasmid of Aromatoleum aromaticum EbN1, which contains an additional type I-C system on its chromosome. RNA sequencing analyses verified CRISPR RNA (crRNA) production and maturation for both systems. Type IV crRNAs were shown to harbour unusually short 7 nucleotide 5'-repeat tags and stable 3' hairpin structures. A unique Cas6 variant (Csf5) was identified that generates crRNAs that are specifically incorporated into type IV CRISPR-ribonucleoprotein (crRNP) complexes. Structures of RNA-bound Csf5 were obtained. Recombinant production and purification of the type IV Cas proteins, together with electron microscopy, revealed that Csf2 acts as a helical backbone for type IV crRNPs that include Csf5, Csf3 and a large subunit (Csf1). Mass spectrometry analyses identified protein-protein and protein-RNA contact sites. These results highlight evolutionary connections between type IV and type I CRISPR-Cas systems and demonstrate that type IV CRISPR-Cas systems employ crRNA-guided effector complexes.},
}
@article {pmid30394685,
year = {2018},
author = {Li, P and Fu, X and Zhang, L and Li, S},
title = {CRISPR/Cas-based screening of a gene activation library in Saccharomyces cerevisiae identifies a crucial role of OLE1 in thermotolerance.},
journal = {Microbial biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1751-7915.13333},
pmid = {30394685},
issn = {1751-7915},
support = {21506113//National Natural Science Foundation of China/ ; 31470229//National Natural Science Foundation of China/ ; 31600067//National Natural Science Foundation of China/ ; 2016YFE0108500//National Key R&amp;D Program of China/ ; 2017T100064//China Postdoctoral Science Foundation/ ; 2015M581074//China Postdoctoral Science Foundation/ ; },
abstract = {CRISPR/Cas-based (clustered regularly interspaced short palindromic repeats/CRISPR-associated) screening has been proved to be an efficient method to study functional genomics from yeast to human. In this study, we report the development of a focused CRISPR/Cas-based gene activation library in Saccharomyces cerevisiae and its application in gene identification based on functional screening towards improved thermotolerance. The gene activation library was subjected to screening at 42°C, and the same library cultured at 30°C was set as a control group. After five successive subcultures, five clones were randomly picked from the libraries cultured at 30 and 42°C, respectively. The five clones selected at 30°C contain the specificity sequences of five different single guide RNAs, whereas all the five clones selected at 42°C contain the specificity sequence of one sgRNA that targets the promoter region of OLE1. A crucial role of OLE1 in thermotolerance was identified: the overexpression of OLE1 increased fatty acid unsaturation, and thereby helped counter lipid peroxidation caused by heat stress, rendering the yeast thermotolerant. This study described the application of CRISPR/Cas-based gene activation screening with an example of thermotolerant yeast screening, demonstrating that this method can be used to identify functional genes in yeast.},
}
@article {pmid30394652,
year = {2018},
author = {Borton, MA and Daly, RA and O'Banion, B and Hoyt, DW and Marcus, DN and Welch, S and Hastings, SS and Meulia, T and Wolfe, RA and Booker, AE and Sharma, S and Cole, DR and Wunch, K and Moore, JD and Darrah, TH and Wilkins, MJ and Wrighton, KC},
title = {Comparative genomics and physiology of the genus Methanohalophilus, a prevalent methanogen in hydraulically fractured shale.},
journal = {Environmental microbiology},
volume = {20},
number = {12},
pages = {4596-4611},
doi = {10.1111/1462-2920.14467},
pmid = {30394652},
issn = {1462-2920},
support = {1342701//National Science Foundation Dimensions of Biodiversity/ ; FE0024297//Department of Energy's National Energy Technology Laboratory/ ; //U.S. Department of Energy Joint Genome Institute/ ; DE-AC02-05CH11231//Office of Science of the U.S. Department of Energy/ ; },
abstract = {About 60% of natural gas production in the United States comes from hydraulic fracturing of unconventional reservoirs, such as shales or organic-rich micrites. This process inoculates and enriches for halotolerant microorganisms in these reservoirs over time, resulting in a saline ecosystem that includes methane producing archaea. Here, we survey the biogeography of methanogens across unconventional reservoirs, and report that members of genus Methanohalophilus are recovered from every hydraulically fractured unconventional reservoir sampled by metagenomics. We provide the first genomic sequencing of three isolate genomes, as well as two metagenome assembled genomes (MAGs). Utilizing six other previously sequenced isolate genomes and MAGs, we perform comparative analysis of the 11 genomes representing this genus. This genomic investigation revealed distinctions between surface and subsurface derived genomes that are consistent with constraints encountered in each environment. Genotypic differences were also uncovered between isolate genomes recovered from the same well, suggesting niche partitioning among closely related strains. These genomic substrate utilization predictions were then confirmed by physiological investigation. Fine-scale microdiversity was observed in CRISPR-Cas systems of Methanohalophilus, with genomes from geographically distinct unconventional reservoirs sharing spacers targeting the same viral population. These findings have implications for augmentation strategies resulting in enhanced biogenic methane production in hydraulically fractured unconventional reservoirs.},
}
@article {pmid30394044,
year = {2018},
author = {Ali, S and Park, SK and Kim, WC},
title = {The Pragmatic Introduction and Expression of Microbial Transgenes in Plants.},
journal = {Journal of microbiology and biotechnology},
volume = {28},
number = {12},
pages = {1955-1970},
doi = {10.4014/jmb.1808.08029},
pmid = {30394044},
issn = {1738-8872},
mesh = {Antibodies/metabolism ; Bioreactors ; CRISPR-Cas Systems/genetics ; Crops, Agricultural/genetics ; Disease Resistance/genetics ; Enzymes/biosynthesis ; Food Quality ; Gene Editing/methods ; *Gene Transfer Techniques ; Genes, Plant ; Genetic Engineering/*methods ; Plants/*genetics/metabolism/*microbiology ; Plants, Genetically Modified ; Secondary Metabolism ; Stress, Physiological ; *Transgenes ; Vaccines/biosynthesis ; },
abstract = {Several genetic strategies have been proposed for the successful transformation and expression of microbial transgenes in model and crop plants. Here, we bring into focus the prominent applications of microbial transgenes in plants for the development of disease resistance; mitigation of stress conditions; augmentation of food quality; and use of plants as &quot;bioreactors&quot; for the production of recombinant proteins, industrially important enzymes, vaccines, antimicrobial compounds, and other valuable secondary metabolites. We discuss the applicable and cost-effective approaches of transgenesis in different plants, as well as the limitations thereof. We subsequently present the contemporary developments in targeted genome editing systems that have facilitated the process of genetic modification and manifested stable and consumer-friendly genetically modified plants and their products. Finally, this article presents the different approaches and demonstrates the introduction and expression of microbial transgenes for the improvement of plant resistance to pathogens and abiotic stress conditions and the production of valuable compounds, together with the promising research progress in targeted genome editing technology. We include a special discussion on the highly efficient CRISPR-Cas system helpful in microbial transgene editing in plants.},
}
@article {pmid30394035,
year = {2018},
author = {Chen, F and Yang, P and Zhu, J},
title = {[Construction and application of PGRN and Rev-erbβ double genes knockout HEK293 cell lines].},
journal = {Sheng wu gong cheng xue bao = Chinese journal of biotechnology},
volume = {34},
number = {10},
pages = {1679-1692},
doi = {10.13345/j.cjb.180033},
pmid = {30394035},
issn = {1000-3061},
mesh = {Blotting, Western ; *CRISPR-Cas Systems ; ErbB Receptors/genetics ; Gene Expression ; Gene Expression Regulation ; *Gene Knockout Techniques ; Gene Products, rev/*genetics ; HEK293 Cells ; Humans ; Lentivirus ; Progranulins/*genetics ; Promoter Regions, Genetic ; RNA, Messenger ; },
abstract = {In order to study the molecular mechanism and physiological significance of the interaction between PGRN and Rev-erbβ, the PGRN gene in HEK293 (Rev-erbβ-/-) marked as C3-6 cell lines was knocked out by CRISPR/Cas9 system to generate the Rev-erbβ and PGRN double genes knockout HEK293 cell lines. First, four sgRNAs were designed for PGRN gene, and PGRN sgRNA2 and sgRNA3 with the higher activity were used to construct the Lentiviral vector, pLenti/CMV-Loxp-Cas9-sgRNA2-U6-sgRNA3-U6-Loxp-EF1α-Puro. Then, the lentivirus vector carrying Cas9 and double PGRN sgRNA were used to infect HEK293 C3-6 cells. Through drug screening, cloning and sequencing, we obtained the monoclonal HEK293 (Rev-erbβ-/-; PGRN-/-) marked as C3-6/23 cell lines. Using qRT-PCR and Western blotting, we detected PGRN mRNA and protein expression in C3-6/23 cell lines. Finally, genetic complementation was used to study the effect of PGRN-mediated Rev-erbβ on the regulation of the target gene promoter transcriptional activity in the C3-6/23 cell lines. In HEK293 C3-6/23 cell lines, the two DNA chains of PGRN gene were both deletion mutagenesis, and the expression mRNA and protein of PGRN did not reach the detection level. At the same time, the interaction between PGRN and Rev-erbβ enhanced the regulation of Rev-erbβ on the transcription of target gene promoter in the cell lines. Using CRISPR/Cas9 system, we successfully constructed the double knockout HEK293 (Rev-erbβ-/-; PGRN-/-) monoclonal cell lines. The study found that PGRN could affect Rev-erbβ on the regulation of target gene promoter transcription in the C3-6/23 cell lines; however, the mechanism of PGRN involvement in mediating Rev-erbβ in transcriptional regulation remains to be further studied.},
}
@article {pmid30393777,
year = {2018},
author = {Zhang, F and Zhao, S and Ren, C and Zhu, Y and Zhou, H and Lai, Y and Zhou, F and Jia, Y and Zheng, K and Huang, Z},
title = {CRISPRminer is a knowledge base for exploring CRISPR-Cas systems in microbe and phage interactions.},
journal = {Communications biology},
volume = {1},
number = {},
pages = {180},
pmid = {30393777},
issn = {2399-3642},
abstract = {CRISPR-Cas systems not only play key roles in prokaryotic acquired immunity, but can also be adapted as powerful genome editing tools. Understanding the native role of CRISPR-Cas systems in providing adaptive immunity can lead to new CRISPR-based technologies. Here, we develop CRISPRminer, a knowledge base and web server to comprehensively collect and investigate the knowledge of CRISPR-Cas systems and generate instructive annotations, including CRISPR arrays and Cas protein annotation, CRISPR-Cas system classification, self-targeting events detection, microbe-phage interaction inference, and anti-CRISPR annotation. CRISPRminer is user-friendly and freely available at http://www.microbiome-bigdata.com/CRISPRminer.},
}
@article {pmid30393194,
year = {2019},
author = {Hussain, W and Mahmood, T and Hussain, J and Ali, N and Shah, T and Qayyum, S and Khan, I},
title = {CRISPR/Cas system: A game changing genome editing technology, to treat human genetic diseases.},
journal = {Gene},
volume = {685},
number = {},
pages = {70-75},
doi = {10.1016/j.gene.2018.10.072},
pmid = {30393194},
issn = {1879-0038},
mesh = {Animals ; CRISPR-Associated Protein 9/metabolism ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; *Gene Editing ; Gene Expression Regulation ; Genetic Therapy ; *Genomics/methods ; Homologous Recombination ; Humans ; RNA, Guide ; },
abstract = {Genes, are the functional units of heredity that used as an instructors to make proteins either to become the functional or structural part of the cell. Hence, the proteins get more attention because most of the life functions depends on it. Any mutation or alteration in genome sequences results in complete loss of function or formation of abnormal protein which leads to hereditary disorder. Gene therapy on the other hand, used as a remedy, a process that make correction in the gene which is responsible for genomic disorders. The treatment of disease state depends on the understanding of their genetic basis. While, numerous molecular genome editing tools have been developed and are being utilized to translate the abstract of gene therapy into reality, but the problem is still a mystery. The genome editing molecular scissors can be applied to dictate the selected genetic products that can have the therapeutic power. Thus, editing the specific sequences depends on the type of strategies being used by a molecule such is HDR or NHEJ. CRISPR/Cas9 editing technology can use in disease model to study the genitival disorders. One side the CRISPR technology seemed to be extremely accurate but on the other side it has some harmful effects i.e. Cas9 proteins sometimes cuts the similar sequences other than the specific targeted and Off-targeting Sequences etc. Urgent attention and improvement are needed for various implication of CRISPR/Cas9 technology, including the delivery, precision and control over the mention system. This review presents the current scenario of genome editing in vivo and its implications for the future of human genetic disease treatment as well as genome throughput potency.},
}
@article {pmid30391232,
year = {2018},
author = {Chen, H and Li, Y and Du, C and Li, Y and Zhao, J and Zheng, X and Mao, Q and Xia, H},
title = {Aptazyme-mediated direct modulation of post-transcriptional sgRNA level for conditional genome editing and gene expression.},
journal = {Journal of biotechnology},
volume = {288},
number = {},
pages = {23-29},
doi = {10.1016/j.jbiotec.2018.10.011},
pmid = {30391232},
issn = {1873-4863},
mesh = {Aptamers, Nucleotide ; CRISPR-Cas Systems ; Gene Editing/*methods ; Gene Expression ; HEK293 Cells ; Humans ; RNA, Guide/genetics ; Theophylline ; },
abstract = {RNA-guided endonuclease Cas9 derived from microbial CRISPR-Cas adaptive immune systems is a powerful tool for genome editing, which has been widely used in eukaryotic systems, prokaryotic systems, and plants. However, the off-target effects caused by Cas9/sgRNA remain a major concern. Currently, the efforts to reduce the off-target effects mainly focus on improving the targeting specificity of sgRNA/Cas9, regulating the activity of the Cas9 protein or the sgRNA, and controlling the time window of their expression. In this study, a novel system was established to regulate the post-transcriptional sgRNA level by small molecule-controlled aptazyme. This system was shown to reduce the off-target effects caused by Cas9/sgRNA, while enabling precise temporal control over gene editing and regulatory activity. This new system could provide a potentially safer and more powerful tool for genome editing and therapeutic application.},
}
@article {pmid30390160,
year = {2019},
author = {Smirnikhina, SA and Anuchina, AA and Lavrov, AV},
title = {Ways of improving precise knock-in by genome-editing technologies.},
journal = {Human genetics},
volume = {138},
number = {1},
pages = {1-19},
doi = {10.1007/s00439-018-1953-5},
pmid = {30390160},
issn = {1432-1203},
support = {17-75-20095//Russian Science Foundation/ ; },
mesh = {*CRISPR-Cas Systems ; Gene Editing/*methods ; Gene Knock-In Techniques/*methods ; Genetic Engineering/*methods ; Humans ; },
abstract = {Despite the recent discover of genome-editing methods, today we can say these approaches have firmly entered our life. Two approaches-knocking out malfunctioning gene allele or correcting the mutation with precise knock-in-can be used in hereditary monogenic diseases treatment. The latter approach is relatively ineffective. Modern data about the ways of repair of double-strand DNA breaks formed by nucleases are presented in this review. The main part of the review is devoted to the ways of increasing precise and effective knock-in: inhibition of non-homologous end joining and stimulation of homology-directed repair key factors, use of small molecules with unknown mechanism of action, cell-cycle synchronization and cell-cycle-dependent activity of Cas9, donor molecule design, selection, alternative methods for insertion and other approaches.},
}
@article {pmid30389787,
year = {2018},
author = {Lynch, JM and Li, B and Katoli, P and Xiang, C and Leehy, B and Rangaswamy, N and Saenz-Vash, V and Wang, YK and Lei, H and Nicholson, TB and Meredith, E and Rice, DS and Prasanna, G and Chen, A},
title = {Binding of a glaucoma-associated myocilin variant to the αB-crystallin chaperone impedes protein clearance in trabecular meshwork cells.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {52},
pages = {20137-20156},
doi = {10.1074/jbc.RA118.004325},
pmid = {30389787},
issn = {1083-351X},
abstract = {Myocilin (MYOC) was discovered more than 20 years ago and is the gene whose mutations are most commonly observed in individuals with glaucoma. Despite extensive research efforts, the function of WT MYOC has remained elusive, and how mutant MYOC is linked to glaucoma is unclear. Mutant MYOC is believed to be misfolded within the endoplasmic reticulum, and under normal physiological conditions misfolded MYOC should be retro-translocated to the cytoplasm for degradation. To better understand mutant MYOC pathology, we CRISPR-engineered a rat to have a MYOC Y435H substitution that is the equivalent of the pathological human MYOC Y437H mutation. Using this engineered animal model, we discovered that the chaperone αB-crystallin (CRYAB) is a MYOC-binding partner and that co-expression of these two proteins increases protein aggregates. Our results suggest that the misfolded mutant MYOC aggregates with cytoplasmic CRYAB and thereby compromises protein clearance mechanisms in trabecular meshwork cells, and this process represents the primary mode of mutant MYOC pathology. We propose a model by which mutant MYOC causes glaucoma, and we propose that therapeutic treatment of patients having a MYOC mutation may focus on disrupting the MYOC-CRYAB complexes.},
}
@article {pmid30388811,
year = {2018},
author = {Dion, MB and Labrie, SJ and Shah, SA and Moineau, S},
title = {CRISPRStudio: A User-Friendly Software for Rapid CRISPR Array Visualization.},
journal = {Viruses},
volume = {10},
number = {11},
pages = {},
pmid = {30388811},
issn = {1999-4915},
support = {143924//CIHR/Canada ; },
mesh = {Base Sequence ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Computational Biology/*methods ; Data Mining ; Databases, Nucleic Acid ; Gene Editing ; Sequence Analysis, DNA ; *Software ; User-Computer Interface ; },
abstract = {The CRISPR-Cas system biologically serves as an adaptive defense mechanism against phages. However, there is growing interest in exploiting the hypervariable nature of the CRISPR locus, often of viral origin, for microbial typing and tracking. Moreover, the spacer content of any given strain provides a phage resistance profile. Large-scale CRISPR typing studies require an efficient method for showcasing CRISPR array similarities across multiple isolates. Historically, CRISPR arrays found in microbes have been represented by colored shapes based on nucleotide sequence identity and, while this approach is now routinely used, only scarce computational resources are available to automate the process, making it very time-consuming for large datasets. To alleviate this tedious task, we introduce CRISPRStudio, a command-line tool developed to accelerate CRISPR analysis and standardize the preparation of CRISPR array figures. It first compares nucleotide spacer sequences present in a dataset and then clusters them based on sequence similarity to assign a meaningful representative color. CRISPRStudio offers versatility to suit different biological contexts by including options such as automatic sorting of CRISPR loci and highlighting of shared spacers, while remaining fast and user-friendly.},
}
@article {pmid30388409,
year = {2018},
author = {Terns, MP},
title = {CRISPR-Based Technologies: Impact of RNA-Targeting Systems.},
journal = {Molecular cell},
volume = {72},
number = {3},
pages = {404-412},
pmid = {30388409},
issn = {1097-4164},
support = {R35 GM118160/GM/NIGMS NIH HHS/United States ; },
abstract = {DNA-targeting CRISPR-Cas systems, such as those employing the RNA-guided Cas9 or Cas12 endonucleases, have revolutionized our ability to predictably edit genomes and control gene expression. Here, I summarize information on RNA-targeting CRISPR-Cas systems and describe recent advances in converting them into powerful and programmable RNA-binding and cleavage tools with a wide range of novel and important biotechnological and biomedical applications.},
}
@article {pmid30387552,
year = {2018},
author = {Kumlehn, J and Pietralla, J and Hensel, G and Pacher, M and Puchta, H},
title = {The CRISPR/Cas revolution continues: From efficient gene editing for crop breeding to plant synthetic biology.},
journal = {Journal of integrative plant biology},
volume = {60},
number = {12},
pages = {1127-1153},
doi = {10.1111/jipb.12734},
pmid = {30387552},
issn = {1744-7909},
support = {FKZ 031B0192//German Federal Ministry of Education and Research/ ; },
abstract = {Since the discovery that nucleases of the bacterial CRISPR (clustered regularly interspaced palindromic repeat)-associated (Cas) system can be used as easily programmable tools for genome engineering, their application massively transformed different areas of plant biology. In this review, we assess the current state of their use for crop breeding to incorporate attractive new agronomical traits into specific cultivars of various crop plants. This can be achieved by the use of Cas9/12 nucleases for double-strand break induction, resulting in mutations by non-homologous recombination. Strategies for performing such experiments - from the design of guide RNA to the use of different transformation technologies - are evaluated. Furthermore, we sum up recent developments regarding the use of nuclease-deficient Cas9/12 proteins, as DNA-binding moieties for targeting different kinds of enzyme activities to specific sites within the genome. Progress in base deamination, transcriptional induction and transcriptional repression, as well as in imaging in plants, is also discussed. As different Cas9/12 enzymes are at hand, the simultaneous application of various enzyme activities, to multiple genomic sites, is now in reach to redirect plant metabolism in a multifunctional manner and pave the way for a new level of plant synthetic biology.},
}
@article {pmid30386377,
year = {2018},
author = {Guzina, J and Chen, WH and Stankovic, T and Djordjevic, M and Zdobnov, E and Djordjevic, M},
title = {In silico Analysis Suggests Common Appearance of scaRNAs in Type II Systems and Their Association With Bacterial Virulence.},
journal = {Frontiers in genetics},
volume = {9},
number = {},
pages = {474},
pmid = {30386377},
issn = {1664-8021},
abstract = {In addition to its well-established defense function, CRISPR/Cas can also exhibit crucial non-canonical activity through endogenous gene expression regulation, which was found to mainly affect bacterial virulence. These non-canonical functions depend on scaRNA, which is a small RNA encoded outside of CRISPR array, that is typically flanked by a transcription start site (TSS) and a terminator, and is in part complementary to another small CRISPR/Cas-associated RNA (tracrRNAs). Identification of scaRNAs is however largely complicated by the scarcity of RNA-Seq data across different bacteria, so that they were identified only in a relatively rare CRISPR/Cas subtype (IIB), and the possibility of finding them in other Type II systems is currently unclear. This study presents the first effort toward systematic detection of small CRISPR/Cas-associated regulatory RNAs, where obtained predictions can guide future experiments. The core of our approach is ab initio detection of small RNAs from bacterial genome, which is based on jointly predicting transcription signals - TSS and terminators - and homology to CRISPR array repeat. Particularly, we employ our improved approach for detecting bacterial TSS, since accurate TSS detection is the main limiting factor for accurate small RNA prediction. We also explore how our predictions match to available RNA-Seq data and analyze their conservation across related bacterial species. In Type IIB systems, our predictions are consistent with experimental data, and we systematically identify scaRNAs throughout this subtype. Furthermore, we identify scaRNA:tracrRNA pairs in a number of IIA/IIC systems, where the appearance of scaRNAs co-occurs with the strains being pathogenic. RNA-Seq and conservation analysis show that our method is well suited for predicting CRISPR/Cas-associated small RNAs. We also find possible existence of a modified mechanism of CRISPR-associated small RNA action, which, interestingly, closely resembles the setup employed in biotechnological applications. Overall, our findings indicate that scaRNA:tracrRNA pairs are present in all subtypes of Type II systems, and point to an underlying connection with bacterial virulence. In addition to formulating these hypotheses, careful manual curation that we performed, makes an important first step toward fully automated predictor of CRISPR/Cas-associated small RNAs, which will allow their large scale analysis across diverse bacterial genomes.},
}
@article {pmid30386178,
year = {2018},
author = {Shankar, S and Sreekumar, A and Prasad, D and Das, AV and Pillai, MR},
title = {Genome editing of oncogenes with ZFNs and TALENs: caveats in nuclease design.},
journal = {Cancer cell international},
volume = {18},
number = {},
pages = {169},
pmid = {30386178},
issn = {1475-2867},
abstract = {Background: Gene knockout technologies involving programmable nucleases have been used to create knockouts in several applications. Gene editing using Zinc-finger nucleases (ZFNs), Transcription activator like effectors (TALEs) and CRISPR/Cas systems has been used to create changes in the genome in order to make it non-functional. In the present study, we have looked into the possibility of using six fingered CompoZr ZFN pair to target the E6 gene of HPV 16 genome.<br><br>Methods: HPV 16+ve cell lines; SiHa and CaSki were used for experiments. CompoZr ZFNs targeting E6 gene were designed and constructed by Sigma-Aldrich. TALENs targeting E6 and E7 genes were made using TALEN assembly kit. Gene editing was monitored by T7E1 mismatch nuclease and Nuclease resistance assays. Levels of E6 and E7 were further analyzed by RT-PCR, western blot as well as immunoflourescence analyses. To check if there is any interference due to methylation, cell lines were treated with sodium butyrate, and Nocodazole.<br><br>Results: Although ZFN editing activity in yeast based MEL-I assay was high, it yielded very low activity in tumor cell lines; only 6% editing in CaSki and negligible activity in SiHa cell lines. Though editing efficiency was better in CaSki, no significant reduction in E6 protein levels was observed in immunocytochemical analysis. Further, in silico analysis of DNA binding prediction revealed that some of the ZFN modules bound to sequence that did not match the target sequence. Hence, alternate ZFN pairs for E6 and E7 were not synthesized since no further active sites could be identified by in silico analyses. Then we designed TALENs to target E6 and E7 gene. TALENs designed to target E7 gene led to reduction of E7 levels in CaSki and SiHa cervical cancer cell lines. However, TALEN designed to target E6 gene did not yield any editing activity.<br><br>Conclusions: Our study highlights that designed nucleases intended to obtain bulk effect should have a reasonable editing activity which reflects phenotypically as well. Nucleases with low editing efficiency, intended for generation of knockout cell lines nucleases could be obtained by single cell cloning. This could serve as a criterion for designing ZFNs and TALENs.},
}
@article {pmid30385564,
year = {2018},
author = {Kofler, N and Collins, JP and Kuzma, J and Marris, E and Esvelt, K and Nelson, MP and Newhouse, A and Rothschild, LJ and Vigliotti, VS and Semenov, M and Jacobsen, R and Dahlman, JE and Prince, S and Caccone, A and Brown, T and Schmitz, OJ},
title = {Editing nature: Local roots of global governance.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6414},
pages = {527-529},
doi = {10.1126/science.aat4612},
pmid = {30385564},
issn = {1095-9203},
mesh = {Animals ; Anthozoa/genetics ; *Bioethical Issues ; *CRISPR-Cas Systems ; Conservation of Natural Resources/*methods ; Coral Reefs ; Gene Editing/*ethics/*methods ; *Gene-Environment Interaction ; },
}
@article {pmid30383747,
year = {2018},
author = {Combs, PA and Fraser, HB},
title = {Spatially varying cis-regulatory divergence in Drosophila embryos elucidates cis-regulatory logic.},
journal = {PLoS genetics},
volume = {14},
number = {11},
pages = {e1007631},
pmid = {30383747},
issn = {1553-7404},
mesh = {Alleles ; Animals ; CRISPR-Cas Systems ; Drosophila/*genetics ; Drosophila Proteins/genetics ; *Embryo, Nonmammalian ; Gene Editing ; Gene Expression Profiling ; Gene Expression Regulation ; Gene Targeting ; Genome-Wide Association Study ; Polymorphism, Single Nucleotide ; *Regulatory Sequences, Nucleic Acid ; },
abstract = {Spatial patterning of gene expression is a key process in development, yet how it evolves is still poorly understood. Both cis- and trans-acting changes could participate in complex interactions, so to isolate the cis-regulatory component of patterning evolution, we measured allele-specific spatial gene expression patterns in D. melanogaster × simulans hybrid embryos. RNA-seq of cryo-sectioned slices revealed 66 genes with strong spatially varying allele-specific expression. We found that hunchback, a major regulator of developmental patterning, had reduced expression of the D. simulans allele specifically in the anterior tip of hybrid embryos. Mathematical modeling of hunchback cis-regulation suggested a candidate transcription factor binding site variant, which we verified as causal using CRISPR-Cas9 genome editing. In sum, even comparing morphologically near-identical species we identified surprisingly extensive spatial variation in gene expression, suggesting not only that development is robust to many such changes, but also that natural selection may have ample raw material for evolving new body plans via changes in spatial patterning.},
}
@article {pmid30382180,
year = {2018},
author = {Wang, HC and Wang, P and Chen, YW and Zhang, Y},
title = {Bevacizumab or fibronectin gene editing inhibits the osteoclastogenic effects of fibroblasts derived from human radicular cysts.},
journal = {Acta pharmacologica Sinica},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41401-018-0172-x},
pmid = {30382180},
issn = {1745-7254},
abstract = {Fibronectin (FN) is a main component of extracellular matrix (ECM) in most adult tissues. Under pathological conditions, particularly inflammation, wound healing and tumors, an alternatively spliced exon extra domain A (EDA) is included in the FN protein (EDA+FN), which facilitates cellular proliferation, motility, and aggressiveness in different lesions. In this study we investigated the effects of EDA+FN on bone destruction in human radicular cysts and explored the possibility of editing FN gene or blocking the related paracrine signaling pathway to inhibit the osteoclastogenesis. The specimens of radicular cysts were obtained from 20 patients. We showed that the vessel density was positively associated with both the lesion size (R = 0.49, P = 0.001) and EDA+FN staining (R = 0.26, P = 0.022) in the specimens. We isolated fibroblasts from surgical specimens, and used the CRISPR/Cas system to knockout the EDA exon, or used IST-9 antibody and bevacizumab to block EDA+FN and VEGF, respectively. Compared to control fibroblasts, the fibroblasts from radicular cysts exhibited significantly more Trap+MNCs, the relative expression level of VEGF was positively associated with both the ratio of EDA+FN/total FN (R = 0.271, P = 0.019) and with the number of Trap+MNCs (R = 0.331, P = 0.008). The knockout of the EDA exon significantly decreased VEGF expression in the fibroblasts derived from radicular cysts, leading to significantly decreased osteoclastogenesis; similar results were observed using bevacizumab to block VEGF, but block of EDA+FN with IST-9 antibody had no effect. Furthermore, the inhibitory effects of gene editing on Trap+MNC development were restored by exogenous VEGF. These results suggest that EDA+FN facilitates osteoclastogenesis in the fibrous capsule of radicular cysts, through a mechanism mediated by VEGF via an autocrine effect on the fibroblasts. Bevacizumab inhibits osteoclastogenesis in radicular cysts as effectively as the exclusion of the EDA exon by gene editing.},
}
@article {pmid30377319,
year = {2018},
author = {Wight, AJ},
title = {Strict EU ruling on gene-edited crops squeezes science.},
journal = {Nature},
volume = {563},
number = {7729},
pages = {15-16},
doi = {10.1038/d41586-018-07166-7},
pmid = {30377319},
issn = {1476-4687},
mesh = {Agriculture/economics/*legislation &amp; jurisprudence ; Animals ; Belgium ; Brazil ; Breeding/legislation &amp; jurisprudence ; CRISPR-Cas Systems/genetics ; Crops, Agricultural/economics/*genetics ; *European Union ; Evaluation Studies as Topic ; France ; Gene Editing/*legislation &amp; jurisprudence ; Humans ; Plants, Genetically Modified/*genetics ; },
}
@article {pmid30377126,
year = {2018},
author = {Zhang, H and Chen, M and Fang, T and Zhang, T and Ni, W},
title = {[Establishment and verification of a mouse model of Gata4 gene H435Y mutation].},
journal = {Nan fang yi ke da xue xue bao = Journal of Southern Medical University},
volume = {38},
number = {10},
pages = {1245-1249},
doi = {10.3969/j.issn.1673-4254.2018.10.15},
pmid = {30377126},
issn = {1673-4254},
mesh = {Animals ; *CRISPR-Cas Systems ; GATA4 Transcription Factor/*genetics ; Gene Targeting/*methods ; Mice ; Mice, Inbred C57BL ; Models, Animal ; Point Mutation/*genetics ; Polymerase Chain Reaction ; },
abstract = {OBJECTIVE: To establish a mouse model of H435Y mutation of Gata4 gene using CRISPR/Cas9- mediated gene targeting.<br><br>METHODS: The single-stranded guide RNA (sgRNA) specific to the H435Y loci of Gata4 gene was designed based on the sequence of Gata4 gene. After activity assessment, the active sgRNA and Cas9 were in vitro transcribed into RNA and microinjected along with the donor DNA fragment with point mutations into fertilized mouse eggs. The microinjected eggs were transferred into pseudopregnant mice to obtain the F0 generation mice with the target Gata4 gene mutation confirmed by PCR and gene sequencing. Gata4 gene mutations in the offsprings of the F0 generation mice were analyzed.<br><br>RESULTS: Gene sequencing confirmed the successful establishment of mouse models carrying H435Y mutation of Gata4 gene in 4 of the F0 generation mice. The positive F0 generation mice were crossed with wild-type C57BL/6J mice to obtain the F1 generation mice, and PCR confirmed the presence of H435Y mutations of Gata4 gene in 6 of the F1 mice. Then F2 generation mice were obtained by F1 generation matting with each other. PCR showed that H435Y mutation of Gata4 gene in F2 mice was found, indicating the mousemodel of Gata4 gene mutation in H435Y was established and propagated successfully.<br><br>CONCLUSIONS: We successfully established Gata4 gene H435Y mutant mouse models using CRISPR/Cas9 technique.},
}
@article {pmid30375719,
year = {2018},
author = {Pickett, CJ and Zeller, RW},
title = {Efficient genome editing using CRISPR-Cas-mediated homology directed repair in the ascidian Ciona robusta.},
journal = {Genesis (New York, N.Y. : 2000)},
volume = {56},
number = {11-12},
pages = {e23260},
doi = {10.1002/dvg.23260},
pmid = {30375719},
issn = {1526-968X},
support = {R21 DC013180/DC/NIDCD NIH HHS/United States ; 1R21DC01318001A1/NH/NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Ciona/*genetics ; Fetal Proteins/genetics/metabolism ; Gene Editing/*methods ; POU Domain Factors/genetics/metabolism ; T-Box Domain Proteins/genetics/metabolism ; },
abstract = {Eliminating or silencing a gene's level of activity is one of the classic approaches developmental biologists employ to determine a gene's function. A recently developed method of gene perturbation called CRISPR-Cas, which was derived from a prokaryotic adaptive immune system, has been adapted for use in eukaryotic cells. This technology has been established in several model organisms as a powerful and efficient tool for knocking out or knocking down the function of a gene of interest. It has been recently shown that CRISPR-Cas functions with fidelity and efficiency in Ciona robusta. Here, we show that in C. robusta CRISPR-Cas mediated genomic knock-ins can be efficiently generated. Electroporating a tissue-specific transgene driving Cas9 and a U6-driven gRNA transgene together with a fluorescent protein-containing homology directed repair (FP-HDR) template results in gene-specific patterns of fluorescence consistent with a targeted genomic insertion. Using the Tyrosinase locus to optimize reagents, we first characterize a new Pol III promoter for expressing gRNAs from the Ciona savignyi H1 gene, and then adapt technology that flanks gRNAs by ribozymes allowing cell-specific expression from Pol II promoters. Next, we examine homology arm-length efficiencies of FP-HDR templates. Reagents were then developed for targeting Brachyury and Pou4 that resulted in expected patterns of fluorescence, and sequenced PCR amplicons derived from single embryos validated predicted genomic insertions. Finally, using two differentially colored FP-HDR templates, we show that biallelic FP-HDR template insertion can be detected in live embryos of the F0 generation.},
}
@article {pmid30374457,
year = {2018},
author = {England, WE and Kim, T and Whitaker, RJ},
title = {Metapopulation Structure of CRISPR-Cas Immunity in Pseudomonas aeruginosa and Its Viruses.},
journal = {mSystems},
volume = {3},
number = {5},
pages = {},
pmid = {30374457},
issn = {2379-5077},
support = {T32 AI078876/AI/NIAID NIH HHS/United States ; },
abstract = {Viruses that infect the widespread opportunistic pathogen Pseudomonas aeruginosa have been shown to influence physiology and critical clinical outcomes in cystic fibrosis (CF) patients. To understand how CRISPR-Cas immune interactions may contribute to the distribution and coevolution of P. aeruginosa and its viruses, we reconstructed CRISPR arrays from a highly sampled longitudinal data set from CF patients attending the Copenhagen Cystic Fibrosis Clinic in Copenhagen, Denmark (R. L. Marvig, L. M. Sommer, S. Molin, and H. K. Johansen, Nat Genet 47:57-64, 2015, https://doi.org/10.1038/ng.3148). We show that new spacers are not added to or deleted from CRISPR arrays over time within a single patient but do vary among patients in this data set. We compared assembled CRISPR arrays from this data set to CRISPR arrays extracted from 726 additional publicly available P. aeruginosa sequences to show that local diversity in this population encompasses global diversity and that there is no evidence for population structure associated with location or environment sampled. We compare over 3,000 spacers from our global data set to 98 lytic and temperate viruses and proviruses and find a subset of related temperate virus clusters frequently targeted by CRISPR spacers. Highly targeted viruses are matched by different spacers in different arrays, resulting in a pattern of distributed immunity within the global population. Understanding the multiple immune contexts that P. aeruginosa viruses face can be applied to study of P. aeruginosa gene transfer, the spread of epidemic strains in cystic fibrosis patients, and viral control of P. aeruginosa infection. IMPORTANCE Pseudomonas aeruginosa is a widespread opportunistic pathogen and a major cause of morbidity and mortality in cystic fibrosis patients. Microbe-virus interactions play a critical role in shaping microbial populations, as viral infections can kill microbial populations or contribute to gene flow among microbes. Investigating how P. aeruginosa uses its CRISPR immune system to evade viral infection aids our understanding of how this organism spreads and evolves alongside its viruses in humans and the environment. Here, we identify patterns of CRISPR targeting and immunity that indicate P. aeruginosa and its viruses evolve in both a broad global population and in isolated human &quot;islands.&quot; These data set the stage for exploring metapopulation dynamics occurring within and between isolated &quot;island&quot; populations associated with CF patients, an essential step to inform future work predicting the specificity and efficacy of virus therapy and the spread of invasive viral elements and pathogenic epidemic bacterial strains.},
}
@article {pmid30368976,
year = {2019},
author = {Tanihara, F and Hirata, M and Nguyen, NT and Le, QA and Hirano, T and Takemoto, T and Nakai, M and Fuchimoto, DI and Otoi, T},
title = {Generation of PDX-1 mutant porcine blastocysts by introducing CRISPR/Cas9-system into porcine zygotes via electroporation.},
journal = {Animal science journal = Nihon chikusan Gakkaiho},
volume = {90},
number = {1},
pages = {55-61},
doi = {10.1111/asj.13129},
pmid = {30368976},
issn = {1740-0929},
support = {//Funds for the Development of Human Resources in Science and Technology/ ; //Home for Innovative Researchers and Academic Knowledge Users (HIRAKU)/ ; JP17H03938//JSPS KAKENHI/ ; JP17K19325//JSPS KAKENHI/ ; //SATREPS/ ; },
mesh = {Animals ; *Blastocyst ; CRISPR-Associated Protein 9/*genetics ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; *Electroporation ; Female ; Fertilization in Vitro ; Gene Editing/*methods ; Homeodomain Proteins/*genetics ; *Mutation ; RNA, Guide/genetics ; Swine/*genetics ; Trans-Activators/*genetics ; *Zygote ; },
abstract = {Recently, we established the GEEP (&quot;gene editing by electroporation of Cas9 protein&quot;) method, in which the CRISPR/Cas9 system, consisting of a Cas9 protein and single guide RNA (sgRNA), is introduced into pig zygotes by electroporation and thus induces highly efficient targeted gene disruption. In this study, we examined the effects of sgRNA on the blastocyst formation of porcine embryos and evaluated their genome-editing efficiency. To produce an animal model for diabetes, we targeted PDX-1 (pancreas duodenum homeobox 1), a gene that is crucial for pancreas development during the fetal period and whose monoallelic disruption impairs insulin secretion. First, Cas9 protein with different sgRNAs that targeted distinct sites in the PDX-1 exon 1 was introduced into in vitro-fertilized zygotes by the GEEP method. Of the six sgRNAs tested, three sgRNAs (sgRNA1, 2, and 3) successfully modified PDX-1 gene. The blastocyst formation rate of zygotes edited with sgRNA3 was significantly (p < 0.05) lower than that of control zygotes without the electroporation treatment. Our study indicates that the GEEP method can be successfully used to generate PDX-1 mutant blastocysts, but the development and the efficiency of editing the genome of zygotes may be affected by the sgRNA used for CRISPR/Cas9 system.},
}
@article {pmid30367669,
year = {2018},
author = {Alkan, F and Wenzel, A and Anthon, C and Havgaard, JH and Gorodkin, J},
title = {CRISPR-Cas9 off-targeting assessment with nucleic acid duplex energy parameters.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {177},
pmid = {30367669},
issn = {1474-760X},
mesh = {*CRISPR-Cas Systems ; Endonucleases/metabolism ; *Gene Editing ; Humans ; Nucleic Acids/*chemistry ; RNA, Guide/*genetics ; Substrate Specificity ; },
abstract = {BACKGROUND: Recent experimental efforts of CRISPR-Cas9 systems have shown that off-target binding and cleavage are a concern for the system and that this is highly dependent on the selected guide RNA (gRNA) design. Computational predictions of off-targets have been proposed as an attractive and more feasible alternative to tedious experimental efforts. However, accurate scoring of the high number of putative off-targets plays a key role for the success of computational off-targeting assessment.<br><br>RESULTS: We present an approximate binding energy model for the Cas9-gRNA-DNA complex, which systematically combines the energy parameters obtained for RNA-RNA, DNA-DNA, and RNA-DNA duplexes. Based on this model, two novel off-target assessment methods for gRNA selection in CRISPR-Cas9 applications are introduced: CRISPRoff to assign confidence scores to predicted off-targets and CRISPRspec to measure the specificity of the gRNA. We benchmark the methods against current state-of-the-art methods and show that both are in better agreement with experimental results. Furthermore, we show significant evidence supporting the inverse relationship between the on-target cleavage efficiency and specificity of the system, in which introduced binding energies are key components.<br><br>CONCLUSIONS: The impact of the binding energies provides a direction for further studies of off-targeting mechanisms. The performance of CRISPRoff and CRISPRspec enables more accurate off-target evaluation for gRNA selections, prior to any CRISPR-Cas9 genome-editing application. For given gRNA sequences or all potential gRNAs in a given target region, CRISPRoff-based off-target predictions and CRISPRspec-based specificity evaluations can be carried out through our webserver at https://rth.dk/resources/crispr/ .},
}
@article {pmid30367000,
year = {2019},
author = {Šulčius, S and Šimoliūnas, E and Alzbutas, G and Gasiūnas, G and Jauniškis, V and Kuznecova, J and Miettinen, S and Nilsson, E and Meškys, R and Roine, E and Paškauskas, R and Holmfeldt, K},
title = {Genomic Characterization of Cyanophage vB_AphaS-CL131 Infecting Filamentous Diazotrophic Cyanobacterium Aphanizomenon flos-aquae Reveals Novel Insights into Virus-Bacterium Interactions.},
journal = {Applied and environmental microbiology},
volume = {85},
number = {1},
pages = {},
doi = {10.1128/AEM.01311-18},
pmid = {30367000},
issn = {1098-5336},
abstract = {While filamentous cyanobacteria play a crucial role in food web dynamics and biogeochemical cycling of many aquatic ecosystems around the globe, the knowledge regarding the phages infecting them is limited. Here, we describe the complete genome of the virulent cyanophage vB_AphaS-CL131 (here, CL 131), a Siphoviridae phage that infects the filamentous diazotrophic bloom-forming cyanobacterium Aphanizomenon flos-aquae in the brackish Baltic Sea. CL 131 features a 112,793-bp double-stranded DNA (dsDNA) genome encompassing 149 putative open reading frames (ORFs), of which the majority (86%) lack sequence homology to genes with known functions in other bacteriophages or bacteria. Phylogenetic analysis revealed that CL 131 possibly represents a new evolutionary lineage within the group of cyanophages infecting filamentous cyanobacteria, which form a separate cluster from phages infecting unicellular cyanobacteria. CL 131 encodes a putative type V-U2 CRISPR-Cas system with one spacer (out of 10) targeting a DNA primase pseudogene in a cyanobacterium and a putative type II toxin-antitoxin system, consisting of a GNAT family N-acetyltransferase and a protein of unknown function containing the PRK09726 domain (characteristic of HipB antitoxins). Comparison of CL 131 proteins to reads from Baltic Sea and other available fresh- and brackish-water metagenomes and analysis of CRISPR-Cas arrays in publicly available A. flos-aquae genomes demonstrated that phages similar to CL 131 are present and dynamic in the Baltic Sea and share a common history with their hosts dating back at least several decades. In addition, different CRISPR-Cas systems within individual A. flos-aquae genomes targeted several sequences in the CL 131 genome, including genes related to virion structure and morphogenesis. Altogether, these findings revealed new genomic information for exploring viral diversity and provide a model system for investigation of virus-host interactions in filamentous cyanobacteria.IMPORTANCE The genomic characterization of novel cyanophage vB_AphaS-CL131 and the analysis of its genomic features in the context of other viruses, metagenomic data, and host CRISPR-Cas systems contribute toward a better understanding of aquatic viral diversity and distribution in general and of brackish-water cyanophages infecting filamentous diazotrophic cyanobacteria in the Baltic Sea in particular. The results of this study revealed previously undescribed features of cyanophage genomes (e.g., self-excising intein-containing putative dCTP deaminase and putative cyanophage-encoded CRISPR-Cas and toxin-antitoxin systems) and can therefore be used to predict potential interactions between bloom-forming cyanobacteria and their cyanophages.},
}
@article {pmid30365569,
year = {2018},
author = {Zhao, Q and Busch, B and Jiménez-Soto, LF and Ishikawa-Ankerhold, H and Massberg, S and Terradot, L and Fischer, W and Haas, R},
title = {Integrin but not CEACAM receptors are dispensable for Helicobacter pylori CagA translocation.},
journal = {PLoS pathogens},
volume = {14},
number = {10},
pages = {e1007359},
pmid = {30365569},
issn = {1553-7374},
mesh = {Antigens, Bacterial/genetics/*metabolism ; Antigens, CD/genetics/*metabolism ; Bacterial Proteins/genetics/*metabolism ; CRISPR-Cas Systems ; Cell Adhesion Molecules/antagonists &amp; inhibitors/genetics/*metabolism ; GPI-Linked Proteins/antagonists &amp; inhibitors/genetics/metabolism ; Humans ; Integrins/antagonists &amp; inhibitors/genetics/*metabolism ; Protein Transport ; Stomach Neoplasms/genetics/*metabolism/pathology ; Tumor Cells, Cultured ; },
abstract = {Translocation of the Helicobacter pylori (Hp) cytotoxin-associated gene A (CagA) effector protein via the cag-Type IV Secretion System (cag-T4SS) into host cells is a hallmark of infection with Hp and a major risk factor for severe gastric diseases, including gastric cancer. To mediate the injection of CagA, Hp uses a membrane-embedded syringe-like molecular apparatus extended by an external pilus-like rod structure that binds host cell surface integrin heterodimers. It is still largely unclear how the interaction of the cag-T4SS finally mediates translocation of the CagA protein into the cell cytoplasm. Recently certain carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), acting as receptor for the Hp outer membrane adhesin HopQ, have been identified to be involved in the process of CagA host cell injection. Here, we applied the CRISPR/Cas9-knockout technology to generate defined human gastric AGS and KatoIII integrin knockout cell lines. Although confocal laser scanning microscopy revealed a co-localization of Hp and β1 integrin heterodimers on gastric epithelial cells, Hp infection studies using the quantitative and highly sensitive Hp β-lactamase reporter system clearly show that neither β1 integrin heterodimers (α1β1, α2β1 or α5β1), nor any other αβ integrin heterodimers on the cell surface are essential for CagA translocation. In contrast, deletion of the HopQ adhesin in Hp, or the simultaneous knockout of the receptors CEACAM1, CEACAM5 and CEACAM6 in KatoIII cells abolished CagA injection nearly completely, although bacterial binding was only reduced to 50%. These data provide genetic evidence that the cag-T4SS-mediated interaction of Hp with cell surface integrins on human gastric epithelial cells is not essential for CagA translocation, but interaction of Hp with CEACAM receptors is facilitating CagA translocation by the cag-T4SS of this important microbe.},
}
@article {pmid30363939,
year = {2018},
author = {Donà, V and Perreten, V},
title = {Comparative Genomics of the First and Complete Genome of &quot;Actinobacillus porcitonsillarum&quot; Supports the Novel Species Hypothesis.},
journal = {International journal of genomics},
volume = {2018},
number = {},
pages = {5261719},
pmid = {30363939},
issn = {2314-436X},
abstract = {&quot;Actinobacillus porcitonsillarum&quot; is considered a nonpathogenic member of the Pasteurellaceae family, which phenotypically resembles the pathogen Actinobacillus pleuropneumoniae. Previous studies suggested that &quot;A. porcitonsillarum&quot; may represent a new species closely related to Actinobacillus minor, yet no full genome has been sequenced so far. We implemented the Oxford Nanopore and Illumina sequencing technologies to obtain the highly accurate and complete genome sequence of the &quot;A. porcitonsillarum&quot; strain 9953L55. After validating our de novo assembly strategy by comparing the A. pleuropneumoniae S4074T genome sequence obtained by Oxford Nanopore Technology combined with Illumina reads with a PacBio-sequenced S4074T genome from the NCBI database, we performed comparative analyses of the 9953L55 genome with the A. minor type strain NM305T, A. minor strain 202, and A. pleuropneumoniae S4074T. The 2,263,191 bp circular genome of 9953L55 consisted of 2168 and 2033 predicted genes and proteins, respectively. The lipopolysaccharide cluster resembled the genetic organization of A. pleuropneumoniae serotypes 1, 9, and 11, possibly explaining the positive reactions observed previously in serotyping tests. In contrast to NM305T, we confirmed the presence of a complete apxIICABD operon in 9953L55 and 202 accounting for their hemolytic phenotype and Christie-Atkins-Munch-Petersen (CAMP) reaction positivity. Orthologous gene cluster analysis provided insight into the differential ability of strains of the A. minor/&quot;porcitonsillarum&quot; complex and A. pleuropneumoniae to ferment lactose, raffinose, trehalose, and mannitol. The four strains showed distinct and shared transposable elements, CRISPR/Cas systems, and integrated prophages. Genome comparisons based on average nucleotide identity and in silico DNA-DNA hybridization confirmed the close relationship among strains belonging to the A. minor/&quot;porcitonsillarum&quot; complex compared to other Actinobacillus spp., but also suggested that 9953L55 and 202 belong to the same novel species closely related to A. minor, namely, &quot;A. porcitonsillarum.&quot; Recognition of the taxon as a separate species would improve diagnostics and control strategies of pig pleuropneumonia.},
}
@article {pmid30362590,
year = {2019},
author = {Khambhati, K and Bhattacharjee, G and Singh, V},
title = {Current progress in CRISPR-based diagnostic platforms.},
journal = {Journal of cellular biochemistry},
volume = {120},
number = {3},
pages = {2721-2725},
doi = {10.1002/jcb.27690},
pmid = {30362590},
issn = {1097-4644},
support = {//The Puri Foundation for Education in India/ ; },
abstract = {The CRISPR-Cas system is a key technology for genome editing and regulation in a wide range of organisms and cell types. Recently, CRISPR-Cas-based diagnostic platform has shown idealistic properties for pathogen detection. Integrating the CRISPR-Cas platform along with lateral flow system allows rapid, sensitive, specific, cheap, and reliable diagnostic. It has the potential to be in frontline for not only pathogen detection during the epidemic outbreak, but also cancer, and genetic diseases.},
}
@article {pmid30361373,
year = {2018},
author = {Kratochwil, CF and Liang, Y and Gerwin, J and Woltering, JM and Urban, S and Henning, F and Machado-Schiaffino, G and Hulsey, CD and Meyer, A},
title = {Agouti-related peptide 2 facilitates convergent evolution of stripe patterns across cichlid fish radiations.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6413},
pages = {457-460},
doi = {10.1126/science.aao6809},
pmid = {30361373},
issn = {1095-9203},
mesh = {Agouti-Related Protein/genetics/*physiology ; Animals ; *Biological Evolution ; CRISPR-Cas Systems ; Chromosome Mapping ; Cichlids/*anatomy &amp; histology/genetics/*physiology ; Gene Knockout Techniques ; Genetic Loci ; Mutation ; *Skin Pigmentation/genetics ; },
abstract = {The color patterns of African cichlid fishes provide notable examples of phenotypic convergence. Across the more than 1200 East African rift lake species, melanic horizontal stripes have evolved numerous times. We discovered that regulatory changes of the gene agouti-related peptide 2 (agrp2) act as molecular switches controlling this evolutionarily labile phenotype. Reduced agrp2 expression is convergently associated with the presence of stripe patterns across species flocks. However, cis-regulatory mutations are not predictive of stripes across radiations, suggesting independent regulatory mechanisms. Genetic mapping confirms the link between the agrp2 locus and stripe patterns. The crucial role of agrp2 is further supported by a CRISPR-Cas9 knockout that reconstitutes stripes in a nonstriped cichlid. Thus, we unveil how a single gene affects the convergent evolution of a complex color pattern.},
}
@article {pmid30357987,
year = {2019},
author = {Binder, WH},
title = {The Past 40 Years of Macromolecular Sciences: Reflections on Challenges in Synthetic Polymer and Material Science.},
journal = {Macromolecular rapid communications},
volume = {40},
number = {1},
pages = {e1800610},
doi = {10.1002/marc.201800610},
pmid = {30357987},
issn = {1521-3927},
support = {//DFG/ ; //EU/ ; //FWF/ ; //MLU-Halle-Wittenberg/ ; },
mesh = {Macromolecular Substances/chemical synthesis/chemistry ; Materials Science ; Polymers/chemical synthesis/*chemistry ; },
abstract = {Technology and science are often successful in discontinuities (&quot;disruptive innovations&quot; or &quot;leapfrogging&quot;), in turn allowing true, big societal development by entire changes in technology rather than by minuscule stepwise improvements. Examples are the emergence of modern computer science by inventing the field-effect transistor rather than further fine-tuning the &quot;Röhrentransistor&quot;; the development of (organic) light-emitting diodes in advance of the &quot;Gasglühstrumpf&quot;; CRISPR/Cas exceeding any previous genetic method or Ziegler-Natta polymerization enabling stereoregular polypropylene (PP) and high-density polyethylene (HDPE) in advance of free-radical polymerization. Where may the frogs in polymer science in the future &quot;jump&quot; to? Contemplating past achievements in (synthetic) polymer science, such as living polymerization, &quot;click&quot; chemistry, supramolecular chemistry, the potentially &quot;leaping&quot; areas of self-healing and (bio)degradable materials, amyloids, and biomaterials are reflected upon.},
}
@article {pmid30357478,
year = {2019},
author = {Baliga, P and Shekar, M and Venugopal, MN},
title = {Investigation of direct repeats, spacers and proteins associated with clustered regularly interspaced short palindromic repeat (CRISPR) system of Vibrio parahaemolyticus.},
journal = {Molecular genetics and genomics : MGG},
volume = {294},
number = {1},
pages = {253-262},
doi = {10.1007/s00438-018-1504-8},
pmid = {30357478},
issn = {1617-4623},
support = {BT/BI/04/049/99//Department of Biotechnology, Ministry of Science and Technology/ ; },
mesh = {Adaptive Immunity ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Computational Biology/*methods ; DNA, Intergenic ; Genome, Bacterial ; Vibrio parahaemolyticus/*genetics/immunology ; },
abstract = {Vibrio parahaemolyticus, a ubiquitous bacterium of the marine environment is an important food-borne pathogen responsible for gastroenteritis worldwide. In this study, we aimed to investigate the occurrence and diversity of the CRISPR-Cas system in V. parahaemolyticus genomes using a bioinformatics approach. The CRISPR-Cas system functions as an adaptive immune system in prokaryotes that provides immunity against foreign genetic elements. In total, 570 genomes V. parahaemolyticus genomes were analyzed of which 200 confirmed for the presence of CRISPR-Cas system. The CRISPR-Cas loci were further analyzed for their repeats, spacers and associated Cas proteins. Among the 200 V. parahaemolyticus strains analyzed, 16 (8%) strains possessed the CRISPR-Cas system of complete subtype I-F, while the remaining 184 (92%) harbored the minimalistic type, a subtype I-F variant. Orphan CRISPR repeats and Cas genes were found in one strain each. The CRISPR-associated direct repeat had an unit length of 28 bases. The number of repeat units in each array ranged from 3 to 5 or 5-41 depending on whether they belonged to the minimalistic or complete subtype-IF CRISPR-Cas system, respectively. Of the 768 spacers analyzed in this study, 295 were found to be unique to V. parahaemolyticus. Homology analysis of the conserved spacers revealed matches to plasmids, phages and gut viruses and self chromosomes. Among the CRISPR-associated proteins, Cas5 and Cas7 proteins were found to be conserved. However, variations were seen in the Cas6 protein, which could be grouped into four different types based on their protein length as well as amino acid composition. We present here the diversity and main features of the CRISPR-Cas system in V. parahaemolyticus, which could provide valuable insights in elucidating the role and mechanism of CRISPR/Cas elements in this pathogen.},
}
@article {pmid30357163,
year = {2018},
author = {Zheng, L and Shi, J and Mu, Y},
title = {Dynamics changes of CRISPR-Cas9 systems induced by high fidelity mutations.},
journal = {Physical chemistry chemical physics : PCCP},
volume = {20},
number = {43},
pages = {27439-27448},
doi = {10.1039/c8cp04226h},
pmid = {30357163},
issn = {1463-9084},
mesh = {Bacterial Proteins/genetics/*metabolism ; CRISPR-Associated Protein 9 ; CRISPR-Cas Systems ; Endonucleases/genetics/*metabolism ; *Mutation ; Protein Binding/genetics ; Protein Domains ; Static Electricity ; },
abstract = {CRISPR-Cas9, a powerful genome editing tool, has widely been applied in biological fields. Since the discovery of CRISPR-Cas9 as an adaptive immune system, it has been gradually modified to perform precise genome editing in eukaryotic cells by creating double-strand breaks. Although it is robust and efficient, the current CRISPR-Cas9 system faces a major flaw: off-target effects, which are not well understood. Several Cas9 mutants show significant improvement, with very low off-target effects; however, they also show relatively lower cleavage efficiency for on-target sequences. In this study, the dynamics of wild-type Cas9 from Streptococcus pyogenes and a high fidelity Cas9 mutant have been explored using molecular dynamics simulations. It was found that the mutations cause decreased electrostatic interactions between Cas9 and the R-loop. Consequently, the flexibility of the tDNA/sgRNA heteroduplex is decreased, which may explain the lower tolerance of mismatches in the heteroduplex region. The mutations also affect the protein dynamics and the correlation networks among Cas9 domains. In mutant Cas9, weakened communications between two catalytic domains as well as a slight opening of the conformation induced by the mutations account for the lower on-target cleavage efficiency and probably the lower off-target efficiency as well. These findings will facilitate more precise Cas9 engineering in future.},
}
@article {pmid30356064,
year = {2018},
author = {Wang, X and Li, X and Wang, T and Wu, SP and Jeong, JW and Kim, TH and Young, SL and Lessey, BA and Lanz, RB and Lydon, JP and DeMayo, FJ},
title = {SOX17 regulates uterine epithelial-stromal cross-talk acting via a distal enhancer upstream of Ihh.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4421},
pmid = {30356064},
issn = {2041-1723},
support = {HD-042311//U.S. Department of Health &amp; Human Services | NIH | Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD)/International ; Z1AES103311-01//U.S. Department of Health &amp; Human Services | NIH | National Institute of Environmental Health Sciences (NIEHS)/International ; },
mesh = {Animals ; CRISPR-Cas Systems/genetics/physiology ; Endometrium/metabolism ; Female ; GATA2 Transcription Factor/genetics/metabolism ; HMGB Proteins/genetics/*metabolism ; Hedgehog Proteins/genetics/metabolism ; Hepatocyte Nuclear Factor 3-beta/genetics/metabolism ; Leukemia Inhibitory Factor/genetics/metabolism ; Mice ; SOXF Transcription Factors/genetics/*metabolism ; Transcriptome/genetics ; Uterus/*metabolism ; },
abstract = {Mammalian pregnancy depends on the ability of the uterus to support embryo implantation. Previous studies reveal the Sox17 gene as a downstream target of the Pgr-Gata2-dependent transcription network that directs genomic actions in the uterine endometrium receptive for embryo implantation. Here, we report that ablating Sox17 in the uterine epithelium impairs leukemia inhibitory factor (LIF) and Indian hedgehog homolog (IHH) signaling, leading to failure of embryo implantation. In vivo deletion of the SOX17-binding region 19 kb upstream of the Ihh locus by CRISPR-Cas technology reduces Ihh expression specifically in the uterus and alters proper endometrial epithelial-stromal interactions, thereby impairing pregnancy. This SOX17-binding interval is also bound by GATA2, FOXA2, and PGR. This cluster of transcription factor binding is common in 737 uterine genes and may represent a key regulatory element essential for uterine epithelial gene expression.},
}
@article {pmid30355950,
year = {2018},
author = {Xu, J and Barone, S and Zahedi, K and Brooks, M and Soleimani, M},
title = {Slc4a8 in the Kidney: Expression, Subcellular Localization and Role in Salt Reabsorption.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {50},
number = {4},
pages = {1361-1375},
doi = {10.1159/000494596},
pmid = {30355950},
issn = {1421-9778},
mesh = {Animals ; Bicarbonates/metabolism ; CRISPR-Cas Systems/genetics ; Diuresis/drug effects ; Dogs ; Furosemide/pharmacology ; In Situ Hybridization ; Kidney/*metabolism ; Kidney Tubules, Collecting/metabolism ; Madin Darby Canine Kidney Cells ; Mice ; Mice, Knockout ; Oligoribonucleotides, Antisense/metabolism ; Plasmids/genetics/metabolism ; Sodium/urine ; Sodium Chloride/metabolism ; Sodium-Bicarbonate Symporters/deficiency/genetics/*metabolism ; },
abstract = {BACKGROUND/AIMS: The sodium-dependent bicarbonate transporter Slc4a8 (a.k.a NDCBE) mediates the co-transport of sodium and bicarbonate in exchange for chloride. It is abundantly detected in the brain, with low expression levels in the kidney. The cell distribution and subcellular localization of Slc4a8 in the kidney and its role in acid/base and electrolyte homeostasis has been the subject of conflicting reports. There are no conclusive localization or functional studies to pinpoint the location and demonstrate the function of Slc4a8 in the kidney.<br><br>METHODS: Molecular techniques, including RT-PCR and in situ hybridization, were performed on kidney sections and tagged epitopes were used to examine the membrane targeting of Slc4a8 in polarized kidney cells. Crispr/Cas9 was used to generate and examine Slc4a8 KO mice.<br><br>RESULTS: Zonal distribution and in situ hybridization studies showed very little expression for Slc4a8 (NDCBE) in the cortex or in cortical collecting ducts (CCD). Slc4a8 was predominantly detected in the outer and inner medullary collecting ducts (OMCD and IMCD), and was targeted to the basolateral membrane of osmotically tolerant MDCK cells. Slc4a8 KO mice did not show any abnormal salt or bicarbonate wasting under baseline conditions or in response to bicarbonate loading, salt restriction or furosemide-induced diuresis.<br><br>CONCLUSION: Slc4a8 (NDCBE) is absent in the CCD and is predominantly localized on the basolateral membrane of medullary collecting duct cells. Further, Slc4a8 deletion does not cause significant acid base or electrolyte abnormalities in pathophysiologic states. Additional studies are needed to examine the role of Slc4a8 (NDCBE) in intracellular pH and volume regulation in medullary collecting duct cells.},
}
@article {pmid30354961,
year = {2018},
author = {Pasricha, SR and Drakesmith, H},
title = {Hemoglobinopathies in the Fetal Position.},
journal = {The New England journal of medicine},
volume = {379},
number = {17},
pages = {1675-1677},
doi = {10.1056/NEJMcibr1809628},
pmid = {30354961},
issn = {1533-4406},
mesh = {Anemia, Sickle Cell/*drug therapy/genetics ; CRISPR-Cas Systems ; Carrier Proteins/genetics ; Erythroid Cells/metabolism ; Fetal Hemoglobin/*genetics ; *Gene Expression Regulation ; Humans ; Molecular Targeted Therapy ; eIF-2 Kinase/*antagonists &amp; inhibitors/genetics/metabolism ; },
}
@article {pmid30354846,
year = {2019},
author = {Yu, N and Yang, J and Mishina, Y and Giannobile, WV},
title = {Genome Editing: A New Horizon for Oral and Craniofacial Research.},
journal = {Journal of dental research},
volume = {98},
number = {1},
pages = {36-45},
doi = {10.1177/0022034518805978},
pmid = {30354846},
issn = {1544-0591},
abstract = {Precise and efficient genetic manipulations have enabled researchers to understand gene functions in disease and development, providing a platform to search for molecular cures. Over the past decade, the unprecedented advancement of genome editing techniques has revolutionized the biological research fields. Early genome editing strategies involved many naturally occurring nucleases, including meganucleases, zinc finger nucleases, and transcription activator-like effector-based nucleases. More recently, the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated nucleases (CRISPR/Cas) system has greatly enriched genetic manipulation methods in conducting research. Those nucleases generate double-strand breaks in the target gene sequences and then utilize DNA repair mechanisms to permit precise yet versatile genetic manipulations. The oral and craniofacial field harbors a plethora of diseases and developmental defects that require genetic models that can exploit these genome editing techniques. This review provides an overview of the genome editing techniques, particularly the CRISPR/Cas9 technique, for the oral and craniofacial research community. We also discuss the details about the emerging applications of genome editing in oral and craniofacial biology.},
}
@article {pmid30354811,
year = {2018},
author = {Waghulde, H and Cheng, X and Galla, S and Mell, B and Cai, J and Pruett-Miller, SM and Vazquez, G and Patterson, A and Vijay Kumar, M and Joe, B},
title = {Attenuation of Microbiotal Dysbiosis and Hypertension in a CRISPR/Cas9 Gene Ablation Rat Model of GPER1.},
journal = {Hypertension (Dallas, Tex. : 1979)},
volume = {72},
number = {5},
pages = {1125-1132},
pmid = {30354811},
issn = {1524-4563},
support = {R01 HL020176/HL/NHLBI NIH HHS/United States ; R01 HL112641/HL/NHLBI NIH HHS/United States ; R37 HL020176/HL/NHLBI NIH HHS/United States ; },
abstract = {G-protein-coupled estrogen receptor, Gper1, has been implicated in cardiovascular disease, but its mechanistic role in blood pressure control is poorly understood. Here, we demonstrate that genetically salt-sensitive hypertensive rats with complete genomic excision of Gper1 by a multiplexed guide RNA CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR associated proteins) approach present with lower blood pressure, which was accompanied by altered microbiota, different levels of circulating short chain fatty acids, and improved vascular relaxation. Microbiotal transplantation from hypertensive Gper1+/+ rats reversed the cardiovascular protective effect exerted by the genomic deletion of Gper1. Thus, this study reveals a role for Gper1 in promoting microbiotal alterations that contribute to cardiovascular pathology. However, the exact mechanism by which Gper1 regulates blood pressure is still unknown. Our results indicate that the function of Gper1 is contextually dependent on the microbiome, whereby, contemplation of using Gper1 as a target for therapy of cardiovascular disease requires caution.},
}
@article {pmid30352624,
year = {2018},
author = {Majeed, M and Soliman, H and Kumar, G and El-Matbouli, M and Saleh, M},
title = {Editing the genome of Aphanomyces invadans using CRISPR/Cas9.},
journal = {Parasites &amp; vectors},
volume = {11},
number = {1},
pages = {554},
pmid = {30352624},
issn = {1756-3305},
support = {P29294-B25//Austrian Science Fund/ ; },
mesh = {Animals ; Aphanomyces/enzymology/*genetics/pathogenicity ; CRISPR-Cas Systems ; Fish Diseases/parasitology ; Gene Targeting ; Genome ; Perciformes/parasitology ; Ribonucleoproteins/genetics ; Serine Proteases/genetics ; },
abstract = {BACKGROUND: The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is increasingly being used for genome editing experiments. It is a system to add, delete and/or replace parts of a gene in situ in a time- and cost-efficient manner. The genome of many organisms has been edited using this system. We tested the CRISPR/Cas9 system in Aphanomyces invadans, an oomycete, which is the causative agent of epizootic ulcerative syndrome (EUS) in many fish species. Extracellular proteases produced by this oomycete are believed to play a role in EUS virulence.<br><br>METHODS: We designed three single guide-RNAs (gRNA) to target A. invadans serine protease gene. These gRNAs were individually combined with the Cas9 to form ribo-nucleo-protein (RNP) complex. A. invadans protoplasts were then transfected with RNP complexes. After the transfection, the target gene was amplified and subjected to sequencing. Zoospores of A. invadans were also transfected with the RNP complex. Three groups of dwarf gourami (Trichogaster lalius) were then experimentally inoculated with (i) non-treated A. invadans zoospores; (ii) RNP-treated A. invadans zoospores; and (iii) autoclaved pond water as negative control, to investigate the effect of edited serine protease gene on the virulence of A. invadans in vivo.<br><br>RESULTS: Fluorescence microscopy showed sub-cellular localization of RNP complex in A. invadans protoplasts and zoospores. Sequencing results from the protoplast DNA revealed a point mutation in the target gene. A matching mutation was also detected in zoospores after similar treatment with the same RNP complex. In vivo results showed that the CRISPR/Cas9-treated A. invadans zoospores did not produce EUS clinical signs in the fish. These results were then confirmed by histopathological staining of the muscle sections using Gomori's methenamine silver nitrate and hematoxylin and eosin stains.<br><br>CONCLUSIONS: Results obtained in this study indicate that the RNP complex caused effective mutation in the target gene. This hindered the production of serine protease, which ultimately impeded the manifestation of EUS in the fish. Our methods thus establish a promising approach for functional genomics studies in A. invadans and provide novel avenues to develop effective strategies to control this pathogen.},
}
@article {pmid30352492,
year = {2018},
author = {Lee, HW},
title = {Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript.},
journal = {Molecules and cells},
volume = {41},
number = {10},
pages = {917-922},
pmid = {30352492},
issn = {0219-1032},
mesh = {4-1BB Ligand/*genetics ; *CRISPR-Cas Systems ; Gene Editing/*methods ; Genomics/*methods ; Humans ; },
abstract = {The CRISPR-Cas system is a well-established RNA-guided DNA editing technique widely used to modify genomic DNA sequences. I used the CRISPR-Cas9 system to change the second and third nucleotides of the triplet TCT of human TNSFSF9 in HepG2 cells to TAG to create an amber stop codon. The TCT triplet is the codon for Ser at the 172nd position of TNSFSF9. The two substituted nucleotides, AG, were confirmed by DNA sequencing of the PCR product followed by PCR amplification of the genomic TNFSF9 gene. Interestingly, sequencing of the cDNA of transcripts of the edited TNFSF9 gene revealed that the TAG had been re-edited to the wild type triplet TCT, and 1 or 2 bases just before the triplet had been deleted. These observations indicate that CRISPR-Cas9-mediated editing of bases in target genomic DNA can be followed by spontaneous re-editing (correcting) of the bases during transcription.},
}
@article {pmid30349006,
year = {2018},
author = {Daou, S and Barbour, H and Ahmed, O and Masclef, L and Baril, C and Sen Nkwe, N and Tchelougou, D and Uriarte, M and Bonneil, E and Ceccarelli, D and Mashtalir, N and Tanji, M and Masson, JY and Thibault, P and Sicheri, F and Yang, H and Carbone, M and Therrien, M and Affar, EB},
title = {Monoubiquitination of ASXLs controls the deubiquitinase activity of the tumor suppressor BAP1.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4385},
pmid = {30349006},
issn = {2041-1723},
support = {R01 CA198138/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cell Cycle/genetics/physiology ; Cell Line ; Cell Line, Tumor ; Cells, Cultured ; Drosophila ; Drosophila Proteins/genetics/*metabolism ; Fluorescent Antibody Technique ; Humans ; Immunoblotting ; Immunoprecipitation ; RNA, Small Interfering/genetics ; Repressor Proteins/genetics/metabolism ; Tumor Suppressor Proteins/genetics/*metabolism ; Ubiquitin Thiolesterase/genetics/*metabolism ; Ubiquitin-Conjugating Enzymes/genetics/metabolism ; Ubiquitination/genetics/physiology ; },
abstract = {The tumor suppressor and deubiquitinase (DUB) BAP1 and its Drosophila ortholog Calypso assemble DUB complexes with the transcription regulators Additional sex combs-like (ASXL1, ASXL2, ASXL3) and Asx respectively. ASXLs and Asx use their DEUBiquitinase ADaptor (DEUBAD) domain to stimulate BAP1/Calypso DUB activity. Here we report that monoubiquitination of the DEUBAD is a general feature of ASXLs and Asx. BAP1 promotes DEUBAD monoubiquitination resulting in an increased stability of ASXL2, which in turn stimulates BAP1 DUB activity. ASXL2 monoubiquitination is directly catalyzed by UBE2E family of Ubiquitin-conjugating enzymes and regulates mammalian cell proliferation. Remarkably, Calypso also regulates Asx monoubiquitination and transgenic flies expressing monoubiquitination-defective Asx mutant exhibit developmental defects. Finally, the protein levels of ASXL2, BAP1 and UBE2E enzymes are highly correlated in mesothelioma tumors suggesting the importance of this signaling axis for tumor suppression. We propose that monoubiquitination orchestrates a molecular symbiosis relationship between ASXLs and BAP1.},
}
@article {pmid30346516,
year = {2018},
author = {Markusková, B and Lichvariková, A and Szemes, T and Korenová, J and Kuchta, T and Drahovská, H},
title = {Genome analysis of lactic acid bacterial strains selected as potential starters for traditional Slovakian bryndza cheese.},
journal = {FEMS microbiology letters},
volume = {365},
number = {23},
pages = {},
doi = {10.1093/femsle/fny257},
pmid = {30346516},
issn = {1574-6968},
abstract = {Genomes of 21 strains of lactic acid bacteria isolated from Slovakian traditional cheeses were sequenced on an Illumina MiSeq platform. Subsequently, they were analysed regarding taxonomic classification, presence of genes encoding defence systems, antibiotic resistance and production of biogenic amines. Thirteen strains were found to carry genes encoding at least one bacteriocin, 18 carried genes encoding at least one restriction-modification system, all strains carried 1-6 prophages and 9 strains had CRISPR-Cas systems. CRISPR-Cas type II-A was the most common, containing 0-24 spacers. Only 10% spacers were found to be homological to known bacteriophage or plasmid sequences in databases. Two Enterococcus faecium strains and a Lactococcus lactis strain carried antibiotic resistance genes. Genes encoding for ornithine decarboxylase were detected in four strains and genes encoding for agmatine deiminase were detected in four strains. Lactobacillus paraplantarum 251 L appeared to be the most interesting strain, as it contained genes encoding for two bacteriocins, a restriction-modification system, two CRISPR-Cas systems, four prophages and no genes connected with antibiotic resistance or production of biogenic amines.},
}
@article {pmid30345399,
year = {2018},
author = {Yao, R and Liu, D and Jia, X and Zheng, Y and Liu, W and Xiao, Y},
title = {CRISPR-Cas9/Cas12a biotechnology and application in bacteria.},
journal = {Synthetic and systems biotechnology},
volume = {3},
number = {3},
pages = {135-149},
pmid = {30345399},
issn = {2405-805X},
abstract = {CRISPR-Cas technologies have greatly reshaped the biology field. In this review, we discuss the CRISPR-Cas with a particular focus on the associated technologies and applications of CRISPR-Cas9 and CRISPR-Cas12a, which have been most widely studied and used. We discuss the biological mechanisms of CRISPR-Cas as immune defense systems, recently-discovered anti-CRISPR-Cas systems, and the emerging Cas variants (such as xCas9 and Cas13) with unique characteristics. Then, we highlight various CRISPR-Cas biotechnologies, including nuclease-dependent genome editing, CRISPR gene regulation (including CRISPR interference/activation), DNA/RNA base editing, and nucleic acid detection. Last, we summarize up-to-date applications of the biotechnologies for synthetic biology and metabolic engineering in various bacterial species.},
}
@article {pmid30344094,
year = {2018},
author = {Mohr, G and Silas, S and Stamos, JL and Makarova, KS and Markham, LM and Yao, J and Lucas-Elío, P and Sanchez-Amat, A and Fire, AZ and Koonin, EV and Lambowitz, AM},
title = {A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition.},
journal = {Molecular cell},
volume = {72},
number = {4},
pages = {700-714.e8},
pmid = {30344094},
issn = {1097-4164},
support = {R01 GM037706/GM/NIGMS NIH HHS/United States ; R01 GM037949/GM/NIGMS NIH HHS/United States ; ZIA LM000073-22/NULL/Intramural NIH HHS/United States ; },
abstract = {Prokaryotic CRISPR-Cas systems provide adaptive immunity by integrating portions of foreign nucleic acids (spacers) into genomic CRISPR arrays. Cas6 proteins then process CRISPR array transcripts into spacer-derived RNAs (CRISPR RNAs; crRNAs) that target Cas nucleases to matching invaders. We find that a Marinomonas mediterranea fusion protein combines three enzymatic domains (Cas6, reverse transcriptase [RT], and Cas1), which function in both crRNA biogenesis and spacer acquisition from RNA and DNA. We report a crystal structure of this divergent Cas6, identify amino acids required for Cas6 activity, show that the Cas6 domain is required for RT activity and RNA spacer acquisition, and demonstrate that CRISPR-repeat binding to Cas6 regulates RT activity. Co-evolution of putative interacting surfaces suggests a specific structural interaction between the Cas6 and RT domains, and phylogenetic analysis reveals repeated, stable association of free-standing Cas6s with CRISPR RTs in multiple microbial lineages, indicating that a functional interaction between these proteins preceded evolution of the fusion.},
}
@article {pmid30343903,
year = {2018},
author = {Dillard, KE and Brown, MW and Johnson, NV and Xiao, Y and Dolan, A and Hernandez, E and Dahlhauser, SD and Kim, Y and Myler, LR and Anslyn, EV and Ke, A and Finkelstein, IJ},
title = {Assembly and Translocation of a CRISPR-Cas Primed Acquisition Complex.},
journal = {Cell},
volume = {175},
number = {4},
pages = {934-946.e15},
doi = {10.1016/j.cell.2018.09.039},
pmid = {30343903},
issn = {1097-4172},
support = {F31 GM125201/GM/NIGMS NIH HHS/United States ; R01 GM124141/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas systems confer an adaptive immunity against viruses. Following viral injection, Cas1-Cas2 integrates segments of the viral genome (spacers) into the CRISPR locus. In type I CRISPR-Cas systems, efficient &quot;primed&quot; spacer acquisition and viral degradation (interference) require both the Cascade complex and the Cas3 helicase/nuclease. Here, we present single-molecule characterization of the Thermobifida fusca (Tfu) primed acquisition complex (PAC). We show that TfuCascade rapidly samples non-specific DNA via facilitated one-dimensional diffusion. Cas3 loads at target-bound Cascade and the Cascade/Cas3 complex translocates via a looped DNA intermediate. Cascade/Cas3 complexes stall at diverse protein roadblocks, resulting in a double strand break at the stall site. In contrast, Cas1-Cas2 samples DNA transiently via 3D collisions. Moreover, Cas1-Cas2 associates with Cascade and translocates with Cascade/Cas3, forming the PAC. PACs can displace different protein roadblocks, suggesting a mechanism for long-range spacer acquisition. This work provides a molecular basis for the coordinated steps in CRISPR-based adaptive immunity.},
}
@article {pmid30340517,
year = {2018},
author = {Guo, T and Feng, YL and Xiao, JJ and Liu, Q and Sun, XN and Xiang, JF and Kong, N and Liu, SC and Chen, GQ and Wang, Y and Dong, MM and Cai, Z and Lin, H and Cai, XJ and Xie, AY},
title = {Harnessing accurate non-homologous end joining for efficient precise deletion in CRISPR/Cas9-mediated genome editing.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {170},
pmid = {30340517},
issn = {1474-760X},
mesh = {Animals ; Base Sequence ; CRISPR-Cas Systems/*genetics ; DNA Breaks, Double-Stranded ; DNA End-Joining Repair/*genetics ; DNA-Binding Proteins/metabolism ; *Gene Editing ; Gene Knockout Techniques ; *Genome ; HEK293 Cells ; Humans ; Liver/metabolism ; Mice ; Mutagenesis, Insertional/genetics ; Reproducibility of Results ; *Sequence Deletion ; },
abstract = {BACKGROUND: Many applications of CRISPR/Cas9-mediated genome editing require Cas9-induced non-homologous end joining (NHEJ), which was thought to be error prone. However, with directly ligatable ends, Cas9-induced DNA double strand breaks may be repaired preferentially by accurate NHEJ.<br><br>RESULTS: In the repair of two adjacent double strand breaks induced by paired Cas9-gRNAs at 71 genome sites, accurate NHEJ accounts for about 50% of NHEJ events. This paired Cas9-gRNA approach underestimates the level of accurate NHEJ due to frequent + 1 templated insertions, which can be avoided by the predefined Watson/Crick orientation of protospacer adjacent motifs (PAMs). The paired Cas9-gRNA strategy also provides a flexible, reporter-less approach for analyzing both accurate and mutagenic NHEJ in cells and in vivo, and it has been validated in cells deficient for XRCC4 and in mouse liver. Due to high frequencies of precise deletions of defined &quot;3n&quot;-, &quot;3n + 1&quot;-, or &quot;3n + 2&quot;-bp length, accurate NHEJ is used to improve the efficiency and homogeneity of gene knockouts and targeted in-frame deletions. Compared to &quot;3n + 1&quot;-bp, &quot;3n + 2&quot;-bp can overcome + 1 templated insertions to increase the frequency of out-of-frame mutations. By applying paired Cas9-gRNAs to edit MDC1 and key 53BP1 domains, we are able to generate predicted, precise deletions for functional analysis. Lastly, a Plk3 inhibitor promotes NHEJ with bias towards accurate NHEJ, providing a chemical approach to improve genome editing requiring precise deletions.<br><br>CONCLUSIONS: NHEJ is inherently accurate in repair of Cas9-induced DNA double strand breaks and can be harnessed to improve CRISPR/Cas9 genome editing requiring precise deletion of a defined length.},
}
@article {pmid30340514,
year = {2018},
author = {Schoonenberg, VAC and Cole, MA and Yao, Q and Macias-Treviño, C and Sher, F and Schupp, PG and Canver, MC and Maeda, T and Pinello, L and Bauer, DE},
title = {CRISPRO: identification of functional protein coding sequences based on genome editing dense mutagenesis.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {169},
pmid = {30340514},
issn = {1474-760X},
support = {R03DK109232/DK/NIDDK NIH HHS/United States ; K08 DK093705/DK/NIDDK NIH HHS/United States ; DP2OD022716/HL/NHLBI NIH HHS/United States ; R03 DK109232/DK/NIDDK NIH HHS/United States ; DP2 HL137300/HL/NHLBI NIH HHS/United States ; P01 HL032262/HL/NHLBI NIH HHS/United States ; P01HL032262/HL/NHLBI NIH HHS/United States ; R00 HG008399/HG/NHGRI NIH HHS/United States ; K08DK093705/DK/NIDDK NIH HHS/United States ; R00HG008399/HG/NHGRI NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems/*genetics ; Cell Line ; *Gene Editing ; *Genome ; Humans ; Molecular Sequence Annotation ; Mutagenesis/*genetics ; Open Reading Frames/*genetics ; Protein Structure, Secondary ; RNA, Guide/genetics ; RNA, Messenger/genetics/metabolism ; },
abstract = {CRISPR/Cas9 pooled screening permits parallel evaluation of comprehensive guide RNA libraries to systematically perturb protein coding sequences in situ and correlate with functional readouts. For the analysis and visualization of the resulting datasets, we develop CRISPRO, a computational pipeline that maps functional scores associated with guide RNAs to genomes, transcripts, and protein coordinates and structures. No currently available tool has similar functionality. The ensuing genotype-phenotype linear and three-dimensional maps raise hypotheses about structure-function relationships at discrete protein regions. Machine learning based on CRISPRO features improves prediction of guide RNA efficacy. The CRISPRO tool is freely available at gitlab.com/bauerlab/crispro .},
}
@article {pmid30340417,
year = {2018},
author = {Van Houdt, R and Provoost, A and Van Assche, A and Leys, N and Lievens, B and Mijnendonckx, K and Monsieurs, P},
title = {Cupriavidus metallidurans Strains with Different Mobilomes and from Distinct Environments Have Comparable Phenomes.},
journal = {Genes},
volume = {9},
number = {10},
pages = {},
pmid = {30340417},
issn = {2073-4425},
support = {C90356//Federaal Wetenschapsbeleid/ ; },
abstract = {Cupriavidus metallidurans has been mostly studied because of its resistance to numerous heavy metals and is increasingly being recovered from other environments not typified by metal contamination. They host a large and diverse mobile gene pool, next to their native megaplasmids. Here, we used comparative genomics and global metabolic comparison to assess the impact of the mobilome on growth capabilities, nutrient utilization, and sensitivity to chemicals of type strain CH34 and three isolates (NA1, NA4 and H1130). The latter were isolated from water sources aboard the International Space Station (NA1 and NA4) and from an invasive human infection (H1130). The mobilome was expanded as prophages were predicted in NA4 and H1130, and a genomic island putatively involved in abietane diterpenoids metabolism was identified in H1130. An active CRISPR-Cas system was identified in strain NA4, providing immunity to a plasmid that integrated in CH34 and NA1. No correlation between the mobilome and isolation environment was found. In addition, our comparison indicated that the metal resistance determinants and properties are conserved among these strains and thus maintained in these environments. Furthermore, all strains were highly resistant to a wide variety of chemicals, much broader than metals. Only minor differences were observed in the phenomes (measured by phenotype microarrays), despite the large difference in mobilomes and the variable (shared by two or three strains) and strain-specific genomes.},
}
@article {pmid30338908,
year = {2018},
author = {Zhou, L and Peng, R and Zhang, R and Li, J},
title = {The applications of CRISPR/Cas system in molecular detection.},
journal = {Journal of cellular and molecular medicine},
volume = {22},
number = {12},
pages = {5807-5815},
pmid = {30338908},
issn = {1582-4934},
support = {81871721//National Natural Science Foundation of China/ ; 81772273//National Natural Science Foundation of China/ ; 7174345//Natural Science Foundation of Beijing Municipality/ ; BJ-2018-136//Beijing Hospital Nova Project/ ; },
abstract = {The Streptococcus pyogenes CRISPR/Cas system has found widespread applications as a gene-editing and regulatory tool for the simultaneous delivery of the Cas9 protein and guide RNAs into the cell, thus making the recognition of specific DNA sequences possible. The recent study that shows that Cas9 can also bind to and cleave RNA in an RNA-programmable manner is suggestive of potential utility of this system as a universal nucleic-acid recognition tool. To increase the signal intensity of the CRISPR/Cas system, a signal amplification technique has to be exploited appropriately; this requirement is also a challenge for the detection of DNA or RNA. Furthermore, the CRISPR/Cas system may be used to detect point mutations or single-nucleotide variants because of the specificity of the recognition between the target sequence and the CRISPR/Cas system. These lines of evidence make this technique capable of detecting pathogens during infection via analysis of their DNA or RNA. Thus, here we summarize applications of the CRISPR/Cas system to the recognition and detection of DNA and RNA molecules as well as the signal amplification. We also describe its potential ability to detect mutations and single-nucleotide variants. Finally, we sum up its applications to testing for pathogens and potential barriers for its implementation.},
}
@article {pmid30338024,
year = {2018},
author = {Parise, D and Parise, MTD and Viana, MVC and Muñoz-Bucio, AV and Cortés-Pérez, YA and Arellano-Reynoso, B and Díaz-Aparicio, E and Dorella, FA and Pereira, FL and Carvalho, AF and Figueiredo, HCP and Ghosh, P and Barh, D and Gomide, ACP and Azevedo, VAC},
title = {First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico.},
journal = {Standards in genomic sciences},
volume = {13},
number = {},
pages = {21},
pmid = {30338024},
issn = {1944-3277},
abstract = {Corynebacterium pseudotuberculosis is a pathogenic bacterium which has been rapidly spreading all over the world, causing economic losses in the agricultural sector and sporadically infecting humans. Six C. pseudotuberculosis strains were isolated from goats, sheep, and horses with distinct abscess locations. For the first time, Mexican genomes of this bacterium were sequenced and studied in silico. All strains were sequenced using Ion Personal Genome Machine sequencer, assembled using Newbler and SPAdes software. The automatic genome annotation was done using the software RAST and in-house scripts for transference, followed by manual curation using Artemis software and BLAST against NCBI and UniProt databases. The six genomes are publicly available in NCBI database. The analysis of nucleotide sequence similarity and the generated phylogenetic tree led to the observation that the Mexican strains are more similar between strains from the same host, but the genetic structure is probably more influenced by transportation of animals between farms than host preference. Also, a putative drug target was predicted and in silico analysis of 46 strains showed two gene clusters capable of differentiating the biovars equi and ovis: Restriction Modification system and CRISPR-Cas cluster.},
}
@article {pmid30337455,
year = {2018},
author = {Harrington, LB and Burstein, D and Chen, JS and Paez-Espino, D and Ma, E and Witte, IP and Cofsky, JC and Kyrpides, NC and Banfield, JF and Doudna, JA},
title = {Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6416},
pages = {839-842},
doi = {10.1126/science.aav4294},
pmid = {30337455},
issn = {1095-9203},
support = {/HHMI/Howard Hughes Medical Institute/United States ; },
abstract = {CRISPR-Cas systems provide microbes with adaptive immunity to infectious nucleic acids and are widely employed as genome editing tools. These tools use RNA-guided Cas proteins whose large size (950 to 1400 amino acids) has been considered essential to their specific DNA- or RNA-targeting activities. Here we present a set of CRISPR-Cas systems from uncultivated archaea that contain Cas14, a family of exceptionally compact RNA-guided nucleases (400 to 700 amino acids). Despite their small size, Cas14 proteins are capable of targeted single-stranded DNA (ssDNA) cleavage without restrictive sequence requirements. Moreover, target recognition by Cas14 triggers nonspecific cutting of ssDNA molecules, an activity that enables high-fidelity single-nucleotide polymorphism genotyping (Cas14-DETECTR). Metagenomic data show that multiple CRISPR-Cas14 systems evolved independently and suggest a potential evolutionary origin of single-effector CRISPR-based adaptive immunity.},
}
@article {pmid30333047,
year = {2018},
author = {Balabaskaran-Nina, P and Desai, SA},
title = {Diverse target gene modifications in Plasmodium falciparum using Bxb1 integrase and an intronic attB.},
journal = {Parasites &amp; vectors},
volume = {11},
number = {1},
pages = {548},
pmid = {30333047},
issn = {1756-3305},
mesh = {Animals ; CRISPR-Cas Systems ; Genetic Engineering/*methods ; Genetic Vectors ; Humans ; Integrases/*genetics ; *Introns ; Malaria, Falciparum/parasitology ; Plasmodium falciparum/enzymology/*genetics ; Transfection ; },
abstract = {Genetic manipulation of the human malaria parasite Plasmodium falciparum is needed to explore pathogen biology and evaluate antimalarial targets. It is, however, aggravated by a low transfection efficiency, a paucity of selectable markers and a biased A/T-rich genome. While various enabling technologies have been introduced over the past two decades, facile and broad-range modification of essential genes remains challenging. We recently devised a new application of the Bxb1 integrase strategy to meet this need through an intronic attB sequence within the gene of interest. Although this attB is silent and without effect on intron splicing or protein translation and function, it allows efficient gene modification with minimal risk of unwanted changes at other genomic sites. We describe the range of applications for this new method as well as specific cases where it is preferred over CRISPR-Cas9 and other technologies. The advantages and limitations of various strategies for endogenous gene editing are also discussed.},
}
@article {pmid30329221,
year = {2018},
author = {Gong, T and Tang, B and Zhou, X and Zeng, J and Lu, M and Guo, X and Peng, X and Lei, L and Gong, B and Li, Y},
title = {Genome editing in Streptococcus mutans through self-targeting CRISPR arrays.},
journal = {Molecular oral microbiology},
volume = {33},
number = {6},
pages = {440-449},
doi = {10.1111/omi.12247},
pmid = {30329221},
issn = {2041-1014},
mesh = {Biofilms/growth &amp; development ; *CRISPR-Cas Systems ; Dental Caries/microbiology ; Dental Plaque/microbiology ; Gene Editing/*methods ; Glucosyltransferases/genetics ; Humans ; Microscopy, Electron, Scanning ; Streptococcus mutans/*genetics/pathogenicity ; Virulence Factors/genetics ; },
abstract = {Streptococcus mutans is the primary etiological agent of human dental caries. Its major virulence factors, glucosyltransferases (Gtfs), utilize sucrose to synthesize extracellular polysaccharides (EPS), leading to the formation of dental plaque biofilm. The current study was designed to develop a novel self-targeting gene editing technology that targeted gtfs to inhibit biofilms formation. The CRISPR-Cas system (ie, clustered regularly interspaced short palindromic repeat, with CRISPR-associated proteins) provides sequence-specific protection against foreign genetic materials in archaea and bacteria, and has been widely developed for genomic engineering. The first aim of this study was to test whether components of the CRISPR-Cas9 system from S mutans UA159 is necessary to defend against foreign DNA. The data showed that a suitable PAM site, tracrRNA, Cas9, and RNase III are indispensable elements to perform normal function of S mutans CRISPR-Cas9 system. Based on these results, we designed self-targeting CRISPR arrays (containing spacer sequences identifying with gtfB) and cloned them onto plasmids. Afterward, we transformed the plasmids and editing templates into UA159 (self-targeting) to acquire desired mutants. Our data showed that this technology performed well and was able to successfully edit gtfB or gtfBgtfC genes. This resulted in high reduction in EPS synthesis and was able to breakdown biofilm formation, which is also a promising tool for dental clinics in order to prevent the formation of S mutans biofilms in the future.},
}
@article {pmid30328670,
year = {2018},
author = {Yang, Y and Wang, YH and Chen, XE and Tian, D and Xu, X and Li, K and Huang, YP and He, L},
title = {CRISPR/Cas9-mediated Tyrosine hydroxylase knockout resulting in larval lethality in Agrotis ipsilon.},
journal = {Insect science},
volume = {25},
number = {6},
pages = {1017-1024},
doi = {10.1111/1744-7917.12647},
pmid = {30328670},
issn = {1744-7917},
support = {2015CB755703//National Basic Research Program of China/ ; 31772517//National Natural Science Foundation of China/ ; 18140902200//Science and Technology Commission of Shanghai Municipality/ ; //Shanghai Key Lab for Urban Ecological Processes and Eco-Restoration, East China Normal University/ ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Expression Regulation, Developmental ; Larva/*growth &amp; development ; Lepidoptera/enzymology/*genetics/*growth &amp; development ; Mutation ; Pest Control, Biological ; Phenotype ; Tyrosine 3-Monooxygenase/*deficiency/*genetics ; },
abstract = {Tyrosine hydroxylase (TH) is involved in insect melanin and the catecholamine biosynthesis pathway. TH as an enzyme catalyzing the conversion of tyrosine to 3,4-dihydroxyphenylalanine is the first step reaction in the pathway. Although TH has been proven to affect the pigmentation of the epidermis and development in many insects, there is no report about physiological function of the TH gene in Agrotis ipsilon. Here we cloned the TH gene from A. ipsilon. Semi-quantitative real-time polymerase chain reaction (PCR) analysis showed that AiTH was expressed at all development stages. Moreover, its high expression levels in the head and epidermis suggest that it is mainly related to pigment deposition and insect development. Then, we used the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 system to target the AiTH gene: deletion events were detected at the target sites. Compared with the control group, a few mutants with the phenomenon of narrowing in the egg shell and embryos can develop but cannot hatch; the other hatched embryos were seriously dehydrated after hatching and died within the first day. Quantitative real-time PCR analysis revealed that TH was down-regulated in AiTH mutants. Here, our work demonstrated that AiTH plays an important role in growth and development of newly hatched larvae; meanwhile, it would be a promising target to explore a control strategy for A. ipsilon.},
}
@article {pmid30326628,
year = {2018},
author = {Chen, G and Xiong, L and Wang, Y and He, L and Huang, R and Liao, L and Zhu, Z and Wang, Y},
title = {ITGB1b-Deficient Rare Minnows Delay Grass Carp Reovirus (GCRV) Entry and Attenuate GCRV-Triggered Apoptosis.},
journal = {International journal of molecular sciences},
volume = {19},
number = {10},
pages = {},
pmid = {30326628},
issn = {1422-0067},
support = {31721005 and 31702332//National Natural Science Foundation of China/ ; },
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems ; Carps/*genetics/*virology ; Clathrin/metabolism ; Endocytosis ; Fish Diseases/*genetics/*virology ; Gene Knockout Techniques ; Integrin beta1/*genetics ; Phenotype ; Phylogeny ; Reoviridae/classification/*physiology ; *Virus Internalization ; },
abstract = {Integrin β-1 (ITGB1) is a transmembrane protein belonging to the integrin family and it plays an important role in viral entry. In this study, the itgb1b gene of the rare minnow, Gobiocypris rarus, was cloned and analyzed. To investigate the possible role of itgb1b on grass carp reovirus (GCRV) infection, we generated an ITGB1b-deficient rare minnow (ITGB1b-/-) using the CRISPR/Cas9 system. Following stimulation with GCRV, the survival time of the -ITGB1b-/- rare minnows was extended in comparison to the wild-type minnows. Moreover, the relative copy number of GCRV and the level of clathrin-mediated endocytosis-associated and apoptosis-related gene expression in the ITGB1b-/- rare minnows was significantly lower than that of the wild-type minnows. These results suggested that the absence of itgb1b reduced viral entry efficiency and the expression of apoptosis-related genes. Moreover, the data suggested that itgb1b played an important role in mediating the entry of viruses into the cells via clathrin. Therefore, these findings provide novel insight into the function of itgb1b in the process of GCRV infection.},
}
@article {pmid30323337,
year = {2018},
author = {Ding, Y and Gong, C and Huang, and Chen, R and Sui, P and Lin, KH and Liang, G and Yuan, L and Xiang, H and Chen, J and Yin, T and Alexander, PB and Wang, QF and Song, EW and Li, QJ and Wood, KC and Wang, XF},
title = {Synthetic lethality between HER2 and transaldolase in intrinsically resistant HER2-positive breast cancers.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4274},
pmid = {30323337},
issn = {2041-1723},
support = {F30 CA206348/CA/NCI NIH HHS/United States ; P50 CA190991/CA/NCI NIH HHS/United States ; W81XWH-16-1-0703//U.S. Department of Defense (DOD)/International ; W81XWH-16-1-0618//U.S. Department of Defense (DOD)/International ; },
mesh = {Breast Neoplasms/*genetics/metabolism ; CRISPR-Cas Systems ; Cell Death/drug effects ; Cell Line, Tumor ; Drug Resistance, Neoplasm/*genetics ; Female ; Genetic Testing ; HEK293 Cells ; Humans ; Lapatinib/pharmacology ; Metabolic Flux Analysis ; NADP/metabolism ; Pentose Phosphate Pathway ; Receptor, ErbB-2/*genetics ; Synthetic Lethal Mutations/*genetics ; Transaldolase/*genetics ; },
abstract = {Intrinsic resistance to anti-HER2 therapy in breast cancer remains an obstacle in the clinic, limiting its efficacy. However, the biological basis for intrinsic resistance is poorly understood. Here we performed a CRISPR/Cas9-mediated loss-of-function genetic profiling and identified TALDO1, which encodes the rate-limiting transaldolase (TA) enzyme in the non-oxidative pentose phosphate pathway, as essential for cellular survival following pharmacological HER2 blockade. Suppression of TA increases cell susceptibility to HER2 inhibition in two intrinsically resistant breast cancer cell lines with HER2 amplification. Mechanistically, TA depletion combined with HER2 inhibition significantly reduces cellular NADPH levels, resulting in excessive ROS production and deficient lipid and nucleotide synthesis. Importantly, higher TA expression correlates with poor response to HER2 inhibition in a breast cancer patient cohort. Together, these results pinpoint TA as a novel metabolic enzyme possessing synthetic lethality with HER2 inhibition that can potentially be exploited as a biomarker or target for combination therapy.},
}
@article {pmid30323295,
year = {2018},
author = {Dong, C and Fontana, J and Patel, A and Carothers, JM and Zalatan, JG},
title = {Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4318},
doi = {10.1038/s41467-018-06909-4},
pmid = {30323295},
issn = {2041-1723},
abstract = {In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.},
}
@article {pmid30320547,
year = {2018},
author = {Vuolo, L and Stevenson, NL and Heesom, KJ and Stephens, DJ},
title = {Dynein-2 intermediate chains play crucial but distinct roles in primary cilia formation and function.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30320547},
issn = {2050-084X},
support = {MR/P000177/1//Medical Research Council/United Kingdom ; BB/N000420/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; MR/K018019/1//Medical Research Council/United Kingdom ; BB/L014181/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Adaptor Proteins, Signal Transducing/chemistry/*metabolism ; Amino Acid Sequence ; Animals ; CRISPR-Cas Systems/genetics ; Carrier Proteins/chemistry/*metabolism ; Cell Line ; Cell Membrane/metabolism ; Cilia/*metabolism/ultrastructure ; Dyneins/*metabolism ; Gene Knockout Techniques ; Humans ; Mice ; Mutation/genetics ; Phenotype ; Tumor Suppressor Proteins/metabolism ; },
abstract = {The dynein-2 microtubule motor is the retrograde motor for intraflagellar transport. Mutations in dynein-2 components cause skeletal ciliopathies, notably Jeune syndrome. Dynein-2 contains a heterodimer of two non-identical intermediate chains, WDR34 and WDR60. Here, we use knockout cell lines to demonstrate that each intermediate chain has a distinct role in cilium function. Using quantitative proteomics, we show that WDR34 KO cells can assemble a dynein-2 motor complex that binds IFT proteins yet fails to extend an axoneme, indicating complex function is stalled. In contrast, WDR60 KO cells do extend axonemes but show reduced assembly of dynein-2 and binding to IFT proteins. Both proteins are required to maintain a functional transition zone and for efficient bidirectional intraflagellar transport. Our results indicate that the subunit asymmetry within the dynein-2 complex is matched with a functional asymmetry between the dynein-2 intermediate chains. Furthermore, this work reveals that loss of function of dynein-2 leads to defects in transition zone architecture, as well as intraflagellar transport.},
}
@article {pmid30319822,
year = {2018},
author = {Lone, BA and Karna, SKL and Ahmad, F and Shahi, N and Pokharel, YR},
title = {CRISPR/Cas9 System: A Bacterial Tailor for Genomic Engineering.},
journal = {Genetics research international},
volume = {2018},
number = {},
pages = {3797214},
pmid = {30319822},
issn = {2090-3154},
abstract = {Microbes use diverse defence strategies that allow them to withstand exposure to a variety of genome invaders such as bacteriophages and plasmids. One such defence strategy is the use of RNA guided endonuclease called CRISPR-associated (Cas) 9 protein. The Cas9 protein, derived from type II CRISPR/Cas system, has been adapted as a versatile tool for genome targeting and engineering due to its simplicity and high efficiency over the earlier tools such as ZFNs and TALENs. With recent advancements, CRISPR/Cas9 technology has emerged as a revolutionary tool for modulating the genome in living cells and inspires innovative translational applications in different fields. In this paper we review the developments and its potential uses in the CRISPR/Cas9 technology as well as recent advancements in genome engineering using CRISPR/Cas9.},
}
@article {pmid30317145,
year = {2018},
author = {Bron, PA and Marcelli, B and Mulder, J and van der Els, S and Morawska, LP and Kuipers, OP and Kok, J and Kleerebezem, M},
title = {Renaissance of traditional DNA transfer strategies for improvement of industrial lactic acid bacteria.},
journal = {Current opinion in biotechnology},
volume = {56},
number = {},
pages = {61-68},
doi = {10.1016/j.copbio.2018.09.004},
pmid = {30317145},
issn = {1879-0429},
abstract = {The ever-expanding genomic insight in natural diversity of lactic acid bacteria (LAB) has revived the industrial interest in traditional and natural genetic mobilization methodologies. Here, we review recent advances in horizontal gene transfer processes in LAB, including natural competence, conjugation, and phage transduction. In addition, we envision the possibilities for industrial strain improvement arising from the recent discoveries of molecular exchanges between bacteria through nanotubes and extracellular vesicles, as well as the constantly expanding genome editing possibilities using the CRISPR-Cas technology.},
}
@article {pmid30309916,
year = {2018},
author = {Eldred, KC and Hadyniak, SE and Hussey, KA and Brenerman, B and Zhang, PW and Chamling, X and Sluch, VM and Welsbie, DS and Hattar, S and Taylor, J and Wahlin, K and Zack, DJ and Johnston, RJ},
title = {Thyroid hormone signaling specifies cone subtypes in human retinal organoids.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6411},
pages = {},
pmid = {30309916},
issn = {1095-9203},
support = {R01 EY025598/EY/NEI NIH HHS/United States ; T32 GM007231/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {CRISPR-Cas Systems ; Cell Line ; Embryonic Stem Cells/metabolism ; *Gene Expression Regulation, Developmental ; Humans ; Mutation ; Organoids/*growth &amp; development/metabolism ; Proteolysis ; Retina/cytology/*growth &amp; development ; Retinal Cone Photoreceptor Cells/*classification ; Thyroid Hormones/*metabolism ; },
abstract = {The mechanisms underlying specification of neuronal subtypes within the human nervous system are largely unknown. The blue (S), green (M), and red (L) cones of the retina enable high-acuity daytime and color vision. To determine the mechanism that controls S versus L/M fates, we studied the differentiation of human retinal organoids. Organoids and retinas have similar distributions, expression profiles, and morphologies of cone subtypes. S cones are specified first, followed by L/M cones, and thyroid hormone signaling controls this temporal switch. Dynamic expression of thyroid hormone-degrading and -activating proteins within the retina ensures low signaling early to specify S cones and high signaling late to produce L/M cones. This work establishes organoids as a model for determining mechanisms of human development with promising utility for therapeutics and vision repair.},
}
@article {pmid30298816,
year = {2018},
author = {Libby, AR and Joy, DA and So, PL and Mandegar, MA and Muncie, JM and Mendoza-Camacho, FN and Weaver, VM and Conklin, BR and McDevitt, TC},
title = {Spatiotemporal mosaic self-patterning of pluripotent stem cells using CRISPR interference.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30298816},
issn = {2050-084X},
support = {P01 HL089707/HL/NHLBI NIH HHS/United States ; Center Core Grant, NIH P30 AI027763/NH/NIH HHS/United States ; LAI-C1408015//California Institute for Regenerative Medicine/International ; P01HL089707/NH/NIH HHS/United States ; U01 HL100406/HL/NHLBI NIH HHS/United States ; NSF-CBET 0939511//Emergent Behaviors of Integrated Cellular Systems/International ; S10 RR028962/RR/NCRR NIH HHS/United States ; R01 HL130533/HL/NHLBI NIH HHS/United States ; Instrumentation Grant, NIH S10 RR028962/NH/NIH HHS/United States ; F31HL140907/HL/NHLBI NIH HHS/United States ; P30 AI027763/AI/NIAID NIH HHS/United States ; U01HL100406/NH/NIH HHS/United States ; T32 HD007470/HD/NICHD NIH HHS/United States ; R01HL130533/NH/NIH HHS/United States ; F31 HL140907/HL/NHLBI NIH HHS/United States ; },
mesh = {Antigens, CD/*genetics ; CRISPR-Cas Systems/genetics ; Cadherins/*genetics ; Cell Communication/genetics ; Cell Differentiation/*genetics ; Cell Lineage/genetics ; Gene Knockdown Techniques ; Humans ; Induced Pluripotent Stem Cells/*cytology/metabolism ; Morphogenesis/genetics ; rho-Associated Kinases/*genetics ; },
abstract = {Morphogenesis involves interactions of asymmetric cell populations to form complex multicellular patterns and structures comprised of distinct cell types. However, current methods to model morphogenic events lack control over cell-type co-emergence and offer little capability to selectively perturb specific cell subpopulations. Our in vitro system interrogates cell-cell interactions and multicellular organization within human induced pluripotent stem cell (hiPSC) colonies. We examined effects of induced mosaic knockdown of molecular regulators of cortical tension (ROCK1) and cell-cell adhesion (CDH1) with CRISPR interference. Mosaic knockdown of ROCK1 or CDH1 resulted in differential patterning within hiPSC colonies due to cellular self-organization, while retaining an epithelial pluripotent phenotype. Knockdown induction stimulates a transient wave of differential gene expression within the mixed populations that stabilized in coordination with observed self-organization. Mosaic patterning enables genetic interrogation of emergent multicellular properties, which can facilitate better understanding of the molecular pathways that regulate symmetry-breaking during morphogenesis.},
}
@article {pmid30297904,
year = {2018},
author = {Villiger, L and Grisch-Chan, HM and Lindsay, H and Ringnalda, F and Pogliano, CB and Allegri, G and Fingerhut, R and Häberle, J and Matos, J and Robinson, MD and Thöny, B and Schwank, G},
title = {Treatment of a metabolic liver disease by in vivo genome base editing in adult mice.},
journal = {Nature medicine},
volume = {24},
number = {10},
pages = {1519-1525},
doi = {10.1038/s41591-018-0209-1},
pmid = {30297904},
issn = {1546-170X},
abstract = {CRISPR-Cas-based genome editing holds great promise for targeting genetic disorders, including inborn errors of hepatocyte metabolism. Precise correction of disease-causing mutations in adult tissues in vivo, however, is challenging. It requires repair of Cas9-induced double-stranded DNA (dsDNA) breaks by homology-directed mechanisms, which are highly inefficient in nondividing cells. Here we corrected the disease phenotype of adult phenylalanine hydroxylase (Pah)enu2 mice, a model for the human autosomal recessive liver disease phenylketonuria (PKU)1, using recently developed CRISPR-Cas-associated base editors2-4. These systems enable conversion of C∙G to T∙A base pairs and vice versa, independent of dsDNA break formation and homology-directed repair (HDR). We engineered and validated an intein-split base editor, which allows splitting of the fusion protein into two parts, thereby circumventing the limited cargo capacity of adeno-associated virus (AAV) vectors. Intravenous injection of AAV-base editor systems resulted in Pahenu2 gene correction rates that restored physiological blood phenylalanine (L-Phe) levels below 120 µmol/l [5]. We observed mRNA correction rates up to 63%, restoration of phenylalanine hydroxylase (PAH) enzyme activity, and reversion of the light fur phenotype in Pahenu2 mice. Our findings suggest that targeting genetic diseases in vivo using AAV-mediated delivery of base-editing agents is feasible, demonstrating potential for therapeutic application.},
}
@article {pmid30296255,
year = {2018},
author = {Baskoylu, SN and Yersak, J and O'Hern, P and Grosser, S and Simon, J and Kim, S and Schuch, K and Dimitriadi, M and Yanagi, KS and Lins, J and Hart, AC},
title = {Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration.},
journal = {PLoS genetics},
volume = {14},
number = {10},
pages = {e1007682},
pmid = {30296255},
issn = {1553-7404},
mesh = {Amino Acid Sequence ; Amyotrophic Lateral Sclerosis/*genetics/pathology ; Animals ; Animals, Genetically Modified ; Base Sequence ; CRISPR-Cas Systems ; Caenorhabditis elegans/*genetics ; Caenorhabditis elegans Proteins/*genetics ; Cholinergic Neurons/metabolism/*pathology ; Disease Models, Animal ; Gain of Function Mutation ; Gene Frequency ; Gene Knock-In Techniques ; Glutamic Acid/metabolism ; Humans ; Loss of Function Mutation ; Motor Neurons/metabolism/*pathology ; Superoxide Dismutase/*genetics ; Superoxide Dismutase-1/*genetics ; },
abstract = {Mutations in Cu/Zn superoxide dismutase 1 (SOD1) lead to Amyotrophic Lateral Sclerosis (ALS), a neurodegenerative disease that disproportionately affects glutamatergic and cholinergic motor neurons. Previous work with SOD1 overexpression models supports a role for SOD1 toxic gain of function in ALS pathogenesis. However, the impact of SOD1 loss of function in ALS cannot be directly examined in overexpression models. In addition, overexpression may obscure the contribution of SOD1 loss of function in the degeneration of different neuronal populations. Here, we report the first single-copy, ALS knock-in models in C. elegans generated by transposon- or CRISPR/Cas9- mediated genome editing of the endogenous sod-1 gene. Introduction of ALS patient amino acid changes A4V, H71Y, L84V, G85R or G93A into the C. elegans sod-1 gene yielded single-copy/knock-in ALS SOD1 models. These differ from previously reported overexpression models in multiple assays. In single-copy/knock-in models, we observed differential impact of sod-1 ALS alleles on glutamatergic and cholinergic neurodegeneration. A4V, H71Y, G85R, and G93A animals showed increased SOD1 protein accumulation and oxidative stress induced degeneration, consistent with a toxic gain of function in cholinergic motor neurons. By contrast, H71Y, L84V, and G85R lead to glutamatergic neuron degeneration due to sod-1 loss of function after oxidative stress. However, dopaminergic and serotonergic neuronal populations were spared in single-copy ALS models, suggesting a neuronal-subtype specificity previously not reported in invertebrate ALS SOD1 models. Combined, these results suggest that knock-in models may reproduce the neurotransmitter-type specificity of ALS and that both SOD1 loss and gain of toxic function differentially contribute to ALS pathogenesis in different neuronal populations.},
}
@article {pmid30296034,
year = {2018},
author = {Tomlinson, T},
title = {A Crispr Future for Gene-Editing Regulation: a Proposal for an Updated Biotechnology Regulatory System in an Era of Human Genomic Editing.},
journal = {Fordham law review},
volume = {87},
number = {1},
pages = {437-483},
pmid = {30296034},
issn = {0015-704X},
mesh = {Biotechnology/*ethics/legislation &amp; jurisprudence/*standards ; *CRISPR-Cas Systems ; Embryo Research/*ethics/history/legislation &amp; jurisprudence ; Gene Editing/*ethics/legislation &amp; jurisprudence/*standards ; *Government Regulation/history ; History, 20th Century ; Humans ; Stem Cell Research/ethics/history/legislation &amp; jurisprudence ; United States ; },
abstract = {Recent developments in gene-editing technology have enabled scientists to manipulate the human genome in unprecedented ways. One technology in particular, Clustered Regularly Interspaced Short Pallindromic Repeat (CRISPR), has made gene editing more precise and cost-effective than ever before. Indeed, scientists have already shown that CRISPR can eliminate genes linked to life-threatening diseases from an individual's genetic makeup and, when used on human embryos, CRISPR has the potential to permanently eliminate hereditary diseases from the human genome in its entirety. These developments have brought great hope to individuals and their families, who suffer from genetically linked diseases. But there is a dark side: in the wrong hands, CRISPR could negatively impact the course of human evolution or be used to create biological weaponry. Despite these possible consequences, CRISPR remains largely unregulated due to the United States's outdated regulatory scheme for biotechnology. Moreover, human embryo research, which is likely critical to maximizing the therapeutic applications of CRISPR, is not easily undertaken by scientists due to a number of federal and state restrictions aimed at preventing such research. This Note examines the possible benefits and consequences of CRISPR and discusses the current regulations in both the fields of biotechnology and human embryo research that hamper the government's ability to effectively regulate this technology. Ultimately, this Note proposes a new regulatory scheme for biotechnology that focuses on the processes used to create products using CRISPR, rather than the products themselves, with a focus on enabling ethical research using human embryos to maximize the potential benefits of CRISPR.},
}
@article {pmid30295654,
year = {2018},
author = {Du, L and Zhou, A and Sohr, A and Roy, S},
title = {An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {139},
pages = {},
pmid = {30295654},
issn = {1940-087X},
support = {R00 HL114867/HL/NHLBI NIH HHS/United States ; R35 GM124878/GM/NIGMS NIH HHS/United States ; },
abstract = {Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a &quot;Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated&quot; (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.},
}
@article {pmid30295162,
year = {2018},
author = {Ali, Q},
title = {Non-conventional therapeutic technique to replace CRISPR bacteria from biofilm by inducible lysogen.},
journal = {Journal of biological dynamics},
volume = {},
number = {},
pages = {1-28},
doi = {10.1080/17513758.2018.1527958},
pmid = {30295162},
issn = {1751-3766},
abstract = {Bacteriophage can be an effective means of regulating bacterial populations when conditions allow phage invasion of bacterial colonies. Phage can either infect and lyse a host cell, or insert their DNA into the host cell genome; the latter process is called lysogeny. The clustered regularly interspaced short palindromic repeat (CRISPR) system, linked with CRISPR-associated (Cas) genes, is a regulatory system present in a variety of bacteria which confers immunity against bacteriophage. Studies of the group behaviour of bacteria with CRISPR/Cas systems have provided evidence that CRISPR in lysogenized bacteria can cause an inability to form biofilm. This allows CRISPR-immune bacteria in biofilms to effectively resist phage therapy. Our recent work has described a potential therapeutic technique to eradicate CRISPR-immune bacteria from a biofilm by a continuous influx of lysogens carrying an identical phage sequence. However, this model predicted that the CRISPR-immune population could persist for long times before eradication. Our current focus is on the use of diverse lysogens against CRISPR-capable bacterial populations. The goal of this work is to find a suitable strategy which can eradicate bacteria with a CRISPR system through the influx of finite amounts of distinct lysogens over fixed intervals.},
}
@article {pmid30293118,
year = {2018},
author = {Yang, X and Huang, B and Deng, L and Hu, Z},
title = {Progress in gene therapy using oncolytic vaccinia virus as vectors.},
journal = {Journal of cancer research and clinical oncology},
volume = {144},
number = {12},
pages = {2433-2440},
pmid = {30293118},
issn = {1432-1335},
mesh = {Animals ; CRISPR-Cas Systems ; Cancer Vaccines/genetics/immunology ; Gene Targeting ; *Genetic Therapy/methods ; Genetic Vectors/*genetics ; Humans ; Immunotherapy ; Neoplasms/genetics/immunology/therapy ; *Oncolytic Virotherapy/methods ; Oncolytic Viruses/*genetics ; Vaccinia virus/*genetics ; },
abstract = {BACKGROUND: Vaccinia virus was widely used in the World Health Organization's smallpox eradication campaign and is currently a promising vector for gene therapy owing to its unique characteristics. Vaccinia virus can selectively replicate and propagate productively in tumor cells, resulting in oncolysis. In addition, rapid viral particle production, wide host range, large genome size (approximately 200 kb), and safe handling render vaccinia virus a suitable vector for gene therapy.<br><br>MATERIALS AND METHODS: Cancer vaccines and gene therapy are being studied in clinical trials and experiment researches. However, we put forward unique challenges of optimal selection of foreign genes, administration and modification of VACV, personalized medicine, and other existing problems, based on current researches and our own experiments.<br><br>CONCLUSION: This review presents an overview of the vaccinia virus from its mechanisms to medical researches and clinical trials. We believe that the solution to these problems will contribute to understanding mechanisms of VACV and provide a theoretical basis for clinical treatment.},
}
@article {pmid30291237,
year = {2018},
author = {Xu, C and Lu, Z and Luo, Y and Liu, Y and Cao, Z and Shen, S and Li, H and Liu, J and Chen, K and Chen, Z and Yang, X and Gu, Z and Wang, J},
title = {Targeting of NLRP3 inflammasome with gene editing for the amelioration of inflammatory diseases.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4092},
pmid = {30291237},
issn = {2041-1723},
mesh = {Amino Acid Sequence ; Animals ; Apoptosis Regulatory Proteins/metabolism ; CRISPR-Cas Systems ; Calcium-Binding Proteins/metabolism ; Caspase Activation and Recruitment Domain ; Female ; *Gene Editing ; *Genetic Therapy ; Inflammasomes/*genetics ; Inflammation/*therapy ; Male ; Mice, Inbred C57BL ; NLR Family, Pyrin Domain-Containing 3 Protein/*genetics/metabolism ; Peritonitis/immunology ; Protein Conformation ; },
abstract = {The NLRP3 inflammasome is a well-studied target for the treatment of multiple inflammatory diseases, but how to promote the current therapeutics remains a large challenge. CRISPR/Cas9, as a gene editing tool, allows for direct ablation of NLRP3 at the genomic level. In this study, we screen an optimized cationic lipid-assisted nanoparticle (CLAN) to deliver Cas9 mRNA (mCas9) and guide RNA (gRNA) into macrophages. By using CLAN encapsulating mCas9 and gRNA-targeting NLRP3 (gNLRP3) (CLANmCas9/gNLRP3), we disrupt NLRP3 of macrophages, inhibiting the activation of the NLRP3 inflammasome in response to diverse stimuli. After intravenous injection, CLANmCas9/gNLRP3 mitigates acute inflammation of LPS-induced septic shock and monosodium urate crystal (MSU)-induced peritonitis. In addition, CLANmCas9/gNLRP3 treatment improves insulin sensitivity and reduces adipose inflammation of high-fat-diet (HFD)-induced type 2 diabetes (T2D). Thus, our study provides a promising strategy for treating NLRP3-dependent inflammatory diseases and provides a carrier for delivering CRISPR/Cas9 into macrophages.},
}
@article {pmid30290202,
year = {2019},
author = {Chen, S and Liu, H and Liang, W and Hong, L and Zhang, B and Huang, L and Guo, X and Duan, G},
title = {Insertion sequences in the CRISPR-Cas system regulate horizontal antimicrobial resistance gene transfer in Shigella strains.},
journal = {International journal of antimicrobial agents},
volume = {53},
number = {2},
pages = {109-115},
doi = {10.1016/j.ijantimicag.2018.09.020},
pmid = {30290202},
issn = {1872-7913},
abstract = {Multidrug-resistant (MDR) Shigella strains are an enormous threat to public health. Antimicrobial resistance genes are frequently located on plasmids, phages and integrons, which enter bacterial cells by horizontal gene transfer (HGT). CRISPR-Cas systems are adaptive prokaryotic immune systems in bacteria that confer resistance to foreign genetic material such as phages and other mobile genetic elements. However, this may come at a cost of inhibiting the acquisition of other beneficial genes through HGT. This study investigated how Shigella strains regulate the activity of the CRISPR-Cas system spontaneously when they require an exogenous gene necessary for survival. Insertion sequence (IS) elements were identified in cas genes, such as IS600 in cse2, ISSfl2 in cas6e and IS629 in cse1-cas3. The number of spacers in CRISPR-Cas arrays in strains containing an IS was less than that for strains with no IS. Interestingly, fewer spacers were also found in MDR Shigella isolates. Furthermore, an antimicrobial-resistant strain was constructed by electrotransformation of a resistance plasmid in order to detect changes in the CRISPR-Cas system. It was found that the cse2 gene had a new IS (IS600) in the antimicrobial-resistant strain. Bioinformatics analyses showed that the IS600 insertion hotspot was TGC-GGC in the cse2 gene, and the tertiary structure of the Cse2 protein was different with IS600. IS600 caused a five-order of magnitude decrease in relative expression of the cse2 gene. This study sheds mechanistic light on CRISPR-Cas-mediated HGT of antimicrobial resistance genes in Shigella spp. isolates.},
}
@article {pmid30289378,
year = {2018},
author = {Tashkandi, M and Ali, Z and Aljedaani, F and Shami, A and Mahfouz, MM},
title = {Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato.},
journal = {Plant signaling &amp; behavior},
volume = {13},
number = {10},
pages = {e1525996},
pmid = {30289378},
issn = {1559-2324},
abstract = {CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.},
}
@article {pmid30286211,
year = {2018},
author = {Ye, W and Chew, M and Hou, J and Lai, F and Leopold, SJ and Loo, HL and Ghose, A and Dutta, AK and Chen, Q and Ooi, EE and White, NJ and Dondorp, AM and Preiser, P and Chen, J},
title = {Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway.},
journal = {PLoS pathogens},
volume = {14},
number = {10},
pages = {e1007298},
pmid = {30286211},
issn = {1553-7374},
support = {R01 NS099064/NS/NINDS NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems ; Cell-Derived Microparticles/*immunology ; Cells, Cultured ; Cytoplasm/metabolism ; Erythrocytes/*immunology/metabolism/parasitology ; Humans ; Interferon-Induced Helicase, IFIH1/antagonists &amp; inhibitors/genetics/*metabolism ; Killer Cells, Natural/*immunology/metabolism/parasitology ; Lymphocyte Activation ; Malaria, Falciparum/*immunology/metabolism/parasitology ; Plasmodium falciparum/*immunology/isolation &amp; purification ; },
abstract = {Natural killer (NK) cells provide the first line of defense against malaria parasite infection. However, the molecular mechanisms through which NK cells are activated by parasites are largely unknown, so is the molecular basis underlying the variation in NK cell responses to malaria infection in the human population. Here, we compared transcriptional profiles of responding and non-responding NK cells following exposure to Plasmodium-infected red blood cells (iRBCs) and identified MDA5, a RIG-I-like receptor involved in sensing cytosolic RNAs, to be differentially expressed. Knockout of MDA5 in responding human NK cells by CRISPR/cas9 abolished NK cell activation, IFN-γ secretion, lysis of iRBCs. Similarly, inhibition of TBK1/IKKε, an effector molecule downstream of MDA5, also inhibited activation of responding NK cells. Conversely, activation of MDA5 by liposome-packaged poly I:C restored non-responding NK cells to lyse iRBCs. We further show that microvesicles containing large parasite RNAs from iRBCs activated NK cells by fusing with NK cells. These findings suggest that NK cells are activated through the MDA5 pathway by parasite RNAs that are delivered to the cytoplasm of NK cells by microvesicles from iRBCs. The difference in MDA5 expression between responding and non-responding NK cells following exposure to iRBCs likely contributes to the variation in NK cell responses to malaria infection in the human population.},
}
@article {pmid30285624,
year = {2018},
author = {Howells, RM and Craze, M and Bowden, S and Wallington, EJ},
title = {Efficient generation of stable, heritable gene edits in wheat using CRISPR/Cas9.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {215},
pmid = {30285624},
issn = {1471-2229},
support = {BB/J019356/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Agrobacterium/genetics ; *CRISPR-Cas Systems ; DNA, Bacterial ; Gene Editing/*methods ; Genome, Plant ; Hordeum/genetics ; Plant Breeding/methods ; Plants, Genetically Modified/genetics ; Transformation, Genetic ; Triticum/*genetics ; },
abstract = {BACKGROUND: The use of CRISPR/Cas9 systems could prove to be a valuable tool in crop research, providing the ability to fully knockout gene function in complex genomes or to precisely adjust gene function by knockout of individual alleles.<br><br>RESULTS: We compare gene editing in hexaploid wheat (Triticum aestivum) with diploid barley (Hordeum vulgare), using a combination of single genome and tri-genome targeting. High efficiency gene editing, 11-17% for single genome targeted guides and 5% for tri-genome targeted guides, was achieved in wheat using stable Agrobacterium-mediated transformation. Gene editing in wheat was shown to be predominantly heterozygous, edits were inherited in a Mendelian fashion over multiple generations and no off-target effects were observed. Comparison of editing between the two species demonstrated that more stable, heritable edits were produced in wheat, whilst barley exhibited continued and somatic editing.<br><br>CONCLUSION: Our work shows the potential to obtain stable edited transgene-free wheat lines in 36 weeks through only two generations and that targeted mutagenesis of individual homeologues within the wheat genome is achievable with a modest amount of effort, and without off-target mutations or the need for lengthy crossing strategies.},
}
@article {pmid30285540,
year = {2019},
author = {Smith, CIE and Zain, R},
title = {Therapeutic Oligonucleotides: State of the Art.},
journal = {Annual review of pharmacology and toxicology},
volume = {59},
number = {},
pages = {605-630},
doi = {10.1146/annurev-pharmtox-010818-021050},
pmid = {30285540},
issn = {1545-4304},
abstract = {Oligonucleotides (ONs) can interfere with biomolecules representing the entire extended central dogma. Antisense gapmer, steric block, splice-switching ONs, and short interfering RNA drugs have been successfully developed. Moreover, antagomirs (antimicroRNAs), microRNA mimics, aptamers, DNA decoys, DNAzymes, synthetic guide strands for CRISPR/Cas, and innate immunity-stimulating ONs are all in clinical trials. DNA-targeting, triplex-forming ONs and strand-invading ONs have made their mark on drug development research, but not yet as medicines. Both design and synthetic nucleic acid chemistry are crucial for achieving biologically active ONs. The dominating modifications are phosphorothioate linkages, base methylation, and numerous 2'-substitutions in the furanose ring, such as 2'-fluoro, O-methyl, or methoxyethyl. Locked nucleic acid and constrained ethyl, a related variant, are bridged forms where the 2'-oxygen connects to the 4'-carbon in the sugar. Phosphorodiamidate morpholino oligomers, carrying a modified heterocyclic backbone ring, have also been commercialized. Delivery remains a major obstacle, but systemic administration and intrathecal infusion are used for treatment of the liver and brain, respectively.},
}
@article {pmid30284145,
year = {2018},
author = {Lau, CH and Suh, Y},
title = {In vivo epigenome editing and transcriptional modulation using CRISPR technology.},
journal = {Transgenic research},
volume = {27},
number = {6},
pages = {489-509},
pmid = {30284145},
issn = {1573-9368},
support = {R01 CA180126/CA/NCI NIH HHS/United States ; R01 GM104459/GM/NIGMS NIH HHS/United States ; U19 AG056278/AG/NIA NIH HHS/United States ; P01 AG017242/AG/NIA NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; DNA Methylation ; *Epigenesis, Genetic ; *Epigenomics ; *Gene Editing ; Humans ; Promoter Regions, Genetic ; *Transcription, Genetic ; },
abstract = {The rapid advancement of CRISPR technology has enabled targeted epigenome editing and transcriptional modulation in the native chromatin context. However, only a few studies have reported the successful editing of the epigenome in adult animals in contrast to the rapidly growing number of in vivo genome editing over the past few years. In this review, we discuss the challenges facing in vivo epigenome editing and new strategies to overcome the huddles. The biggest challenge has been the difficulty in packaging dCas9 fusion proteins required for manipulation of epigenome into the adeno-associated virus (AAV) delivery vehicle. We review the strategies to address the AAV packaging issue, including small dCas9 orthologues, truncated dCas9 mutants, a split-dCas9 system, and potent truncated effector domains. We discuss the dCas9 conjugation strategies to recruit endogenous chromatin modifiers and remodelers to specific genomic loci, and recently developed methods to recruit multiple copies of the dCas9 fusion protein, or to simultaneous express multiple gRNAs for robust epigenome editing or synergistic transcriptional modulation. The use of Cre-inducible dCas9-expressing mice or a genetic cross between dCas9- and sgRNA-expressing flies has also helped overcome the transgene delivery issue. We provide perspective on how a combination use of these strategies can facilitate in vivo epigenome editing and transcriptional modulation.},
}
@article {pmid30284144,
year = {2018},
author = {Vilarino, M and Suchy, FP and Rashid, ST and Lindsay, H and Reyes, J and McNabb, BR and van der Meulen, T and Huising, MO and Nakauchi, H and Ross, PJ},
title = {Mosaicism diminishes the value of pre-implantation embryo biopsies for detecting CRISPR/Cas9 induced mutations in sheep.},
journal = {Transgenic research},
volume = {27},
number = {6},
pages = {525-537},
pmid = {30284144},
issn = {1573-9368},
mesh = {Animals ; *Animals, Genetically Modified ; Biopsy ; *Blastocyst ; *CRISPR-Cas Systems ; Embryo Transfer ; *Embryo, Mammalian ; Embryonic Development ; Female ; Gene Editing/methods/*veterinary ; Homeodomain Proteins/*genetics ; Male ; Mosaicism ; *Mutation ; Sheep ; Trans-Activators/*genetics ; },
abstract = {The production of knock-out (KO) livestock models is both expensive and time consuming due to their long gestational interval and low number of offspring. One alternative to increase efficiency is performing a genetic screening to select pre-implantation embryos that have incorporated the desired mutation. Here we report the use of sheep embryo biopsies for detecting CRISPR/Cas9-induced mutations targeting the gene PDX1 prior to embryo transfer. PDX1 is a critical gene for pancreas development and the target gene required for the creation of pancreatogenesis-disabled sheep. We evaluated the viability of biopsied embryos in vitro and in vivo, and we determined the mutation efficiency using PCR combined with gel electrophoresis and digital droplet PCR (ddPCR). Next, we determined the presence of mosaicism in ~ 50% of the recovered fetuses employing a clonal sequencing methodology. While the use of biopsies did not compromise embryo viability, the presence of mosaicism diminished the diagnostic value of the technique. If mosaicism could be overcome, pre-implantation embryo biopsies for mutation screening represents a powerful approach that will streamline the creation of KO animals.},
}
@article {pmid30284045,
year = {2019},
author = {Majumdar, S and Terns, MP},
title = {CRISPR RNA-guided DNA cleavage by reconstituted Type I-A immune effector complexes.},
journal = {Extremophiles : life under extreme conditions},
volume = {23},
number = {1},
pages = {19-33},
doi = {10.1007/s00792-018-1057-0},
pmid = {30284045},
issn = {1433-4909},
support = {R35 GM118160/GM/NIGMS NIH HHS/United States ; R35GM118160//National Institutes of Health/ ; },
abstract = {Diverse CRISPR-Cas immune systems protect archaea and bacteria from viruses and other mobile genetic elements. All CRISPR-Cas systems ultimately function by sequence-specific destruction of invading complementary nucleic acids. However, each CRISPR system uses compositionally distinct crRNP [CRISPR (cr) RNA/Cas protein] immune effector complexes to recognize and destroy invasive nucleic acids by unique molecular mechanisms. Previously, we found that Type I-A (Csa) effector crRNPs from Pyrococcus furiosus function in vivo to eliminate invader DNA. Here, we reconstituted functional Type I-A effector crRNPs in vitro with recombinant Csa proteins and synthetic crRNA and characterized properties of crRNP assembly, target DNA recognition and cleavage. Six proteins (Csa 4-1, Cas3″, Cas3', Cas5a, Csa2, Csa5) are essential for selective target DNA binding and cleavage. Native gel shift analysis and UV-induced RNA-protein crosslinking demonstrate that Cas5a and Csa2 directly interact with crRNA 5' tag and guide sequences, respectively. Mutational analysis revealed that Cas3″ is the effector nuclease of the complex. Together, our results indicate that DNA cleavage by Type I-A crRNPs requires crRNA-guided and protospacer adjacent motif-dependent target DNA binding to unwind double-stranded DNA and expose single strands for progressive ATP-dependent 3'-5' cleavage catalyzed by integral Cas3' helicase and Cas3″ nuclease crRNP components.},
}
@article {pmid30283411,
year = {2018},
author = {Terceti, MS and Vences, A and Matanza, XM and Dalsgaard, I and Pedersen, K and Osorio, CR},
title = {Molecular Epidemiology of Photobacterium damselae subsp. damselae Outbreaks in Marine Rainbow Trout Farms Reveals Extensive Horizontal Gene Transfer and High Genetic Diversity.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {2155},
pmid = {30283411},
issn = {1664-302X},
abstract = {The marine bacterium Photobacterium damselae subsp. damselae is a pathogen for a variety of marine animals, as well as for humans, and is nowadays considered an emerging pathogen for fish of importance in marine aquaculture. Recent studies have suggested that outbreaks in fish farms are caused by multiclonal populations of this subspecies that exist in the environment. Here, we report the study of a collection of 31 strains isolated during the course of disease outbreaks in marine rainbow trout farms in Denmark in 1994, 1995, and 2006, respectively. A phylogenetic analysis based on the toxR gene sequence, and the screening of virulence-related genes uncovered a high genetic heterogeneity, even among strains isolated from the same fish farm at the same time. Moreover, comparative analysis of the whole genome sequences of four selected strains revealed a large number of differentially occurring genes, which included virulence genes, pPHDD1 plasmid, polysaccharide synthesis gene clusters, CRISPR-Cas systems and putative new mobile genetic elements. This study provides sound evidence that P. damselae subsp. damselae outbreaks in Danish rainbow trout farms were caused by multiclonal populations and that horizontal gene transfer constitutes a strong driving force in the generation of intraspecific diversity in this pathogen.},
}
@article {pmid30282704,
year = {2018},
author = {Hasan, MH and Davis, LE and Bollavarapu, RK and Mitra, D and Parmar, R and Tandon, R},
title = {Dynamin Is Required for Efficient Cytomegalovirus Maturation and Envelopment.},
journal = {Journal of virology},
volume = {92},
number = {24},
pages = {},
pmid = {30282704},
issn = {1098-5514},
abstract = {Cytomegalovirus secondary envelopment occurs in a virus-induced cytoplasmic assembly compartment (vAC) generated via a drastic reorganization of the membranes of the secretory and endocytic systems. Dynamin is a eukaryotic GTPase that is implicated in membrane remodeling and endocytic membrane fission events; however, the role of dynamin in cellular trafficking of viruses beyond virus entry is only partially understood. Mouse embryonic fibroblasts (MEF) engineered to excise all three isoforms of dynamin were infected with mouse cytomegalovirus (MCMV-K181). Immediate-early (IE1; m123) viral protein was detected in these triple dynamin knockout (TKO) cells, as well as in mock-induced parental MEF, at early times postinfection, although levels were reduced in TKO cells, indicating that virus entry was affected but not eliminated. Levels of IE1 protein and another viral early protein (m04) were normalized by 48 h postinfection; however, late protein (m55; gB) expression was reduced in infected TKO cells compared to parental MEF. Ultrastructural analysis revealed intact stages of nuclear virus maturation in both cases with equivalent numbers of nucleocapsids containing packaged viral DNA (C-capsids), indicating successful viral DNA replication, capsid assembly, and genome packaging. Most importantly, severe defects in virus envelopment were visualized in TKO cells but not in parental cells. Dynamin inhibitor (dynasore)-treated MEF showed a phenotype similar to TKO cells upon mouse cytomegalovirus infection, confirming the role of dynamin in late maturation processes. In summary, dynamin-mediated endocytic pathways are critical for the completion of cytoplasmic stages of cytomegalovirus maturation.IMPORTANCE Viruses are known to exploit specific cellular functions at different stages of their life cycle in order to replicate, avoid immune recognition by the host and to establish a successful infection. Cytomegalovirus (CMV)-infected cells are characterized by a prominent cytoplasmic inclusion (virus assembly compartment [vAC]) that is the site of virus maturation and envelopment. While endocytic membranes are known to be the functional components of vAC, knowledge of specific endocytic pathways implicated in CMV maturation and envelopment is lacking. We show here that dynamin, which is an integral part of host endocytic machinery, is largely dispensable for early stages of CMV infection but is required at a late stage of CMV maturation. Studies on dynamin function in CMV infection will help us understand the host-virus interaction pathways amenable to targeting by conventional small molecules, as well as by newer generation nucleotide-based therapeutics (e.g., small interfering RNA, CRISPR/CAS gRNA, etc.).},
}
@article {pmid30279181,
year = {2018},
author = {Jin, JJ and Lv, W and Xia, P and Xu, ZY and Zheng, AD and Wang, XJ and Wang, SS and Zeng, R and Luo, HM and Li, GL and Zuo, B},
title = {Long noncoding RNA SYISL regulates myogenesis by interacting with polycomb repressive complex 2.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {E9802-E9811},
pmid = {30279181},
issn = {1091-6490},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Differentiation ; *Epigenesis, Genetic ; Gene Silencing ; Mice ; Mice, Knockout ; Muscle Development/*physiology ; Polycomb Repressive Complex 2/genetics/*metabolism ; Promoter Regions, Genetic ; RNA, Long Noncoding/genetics/*metabolism ; },
abstract = {Although many long noncoding RNAs (lncRNAs) have been identified in muscle, their physiological function and regulatory mechanisms remain largely unexplored. In this study, we systematically characterized the expression profiles of lncRNAs during C2C12 myoblast differentiation and identified an intronic lncRNA, SYISL (SYNPO2 intron sense-overlapping lncRNA), that is highly expressed in muscle. Functionally, SYISL promotes myoblast proliferation and fusion but inhibits myogenic differentiation. SYISL knockout in mice results in significantly increased muscle fiber density and muscle mass. Mechanistically, SYISL recruits the enhancer of zeste homolog 2 (EZH2) protein, the core component of polycomb repressive complex 2 (PRC2), to the promoters of the cell-cycle inhibitor gene p21 and muscle-specific genes such as myogenin (MyoG), muscle creatine kinase (MCK), and myosin heavy chain 4 (Myh4), leading to H3K27 trimethylation and epigenetic silencing of target genes. Taken together, our results reveal that SYISL is a repressor of muscle development and plays a vital role in PRC2-mediated myogenesis.},
}
@article {pmid30278987,
year = {2019},
author = {Rui, Y and Wilson, DR and Green, JJ},
title = {Non-Viral Delivery To Enable Genome Editing.},
journal = {Trends in biotechnology},
volume = {37},
number = {3},
pages = {281-293},
doi = {10.1016/j.tibtech.2018.08.010},
pmid = {30278987},
issn = {1879-3096},
support = {R01 EB022148/EB/NIBIB NIH HHS/United States ; },
abstract = {Genome-editing technologies such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENS), and the clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein system have revolutionized biological research. Each biotechnology consists of a DNA-binding protein that can be programmed to recognize and initiate double-strand breaks (DSBs) for site-specific gene modification. These technologies have the potential to be harnessed to cure diseases caused by aberrant gene expression. To be successful therapeutically, their functionality depends on their safe and efficient delivery into the cell nucleus. This review discusses the challenges in the delivery of genome-editing tools, and highlights recent innovations in non-viral delivery that have potential to overcome these limitations and advance the translation of genome editing towards patient care.},
}
@article {pmid30276556,
year = {2018},
author = {Xue, T and Liu, K and Chen, D and Yuan, X and Fang, J and Yan, H and Huang, L and Chen, Y and He, W},
title = {Improved bioethanol production using CRISPR/Cas9 to disrupt the ADH2 gene in Saccharomyces cerevisiae.},
journal = {World journal of microbiology &amp; biotechnology},
volume = {34},
number = {10},
pages = {154},
pmid = {30276556},
issn = {1573-0972},
support = {2017J01622//Natural Science Foundation of Fujian Province/ ; CARS-170501//National Sugar Crop Reserach System/ ; JAT160114//Education Department Project of Fujian Province/ ; },
mesh = {Alcohol Dehydrogenase/*genetics/*metabolism ; Analysis of Variance ; Base Sequence ; *CRISPR-Cas Systems/genetics ; Cloning, Molecular ; DNA, Fungal/analysis ; Escherichia coli/genetics ; Ethanol/*metabolism ; Fermentation ; Gene Deletion ; Gene Editing ; Gene Expression Regulation, Fungal ; Gene Knockout Techniques/methods ; Genetic Engineering/*methods ; Genome, Fungal/genetics ; Metabolic Engineering/*methods ; Metabolic Networks and Pathways/genetics ; Saccharomyces cerevisiae/*genetics/*metabolism ; Saccharomyces cerevisiae Proteins/*genetics/*metabolism ; Sequence Alignment ; Transformation, Genetic ; },
abstract = {Bioethanol, as a form of renewable and clean energy, has become increasingly important to the energy supply. One major obstacle in ethanol production is developing a high-capacity system. Existing approaches for regulating the ethanol production pathway are relatively insufficient, with nonspecific genetic manipulation. Here, we used CRISPR/Cas9 technology to disrupt the alcohol dehydrogenase (ADH) 2 gene via complete deletion of the gene and introduction of a frameshift mutation in the ADH2 locus. Sequencing demonstrated the accurate knockout of the target gene with 91.4% and near 100% targeting efficiency. We also utilized genome resequencing to validate the mutations in the ADH2 mutants targeted by various single-guide RNAs. This extensive analysis indicated the mutations in the CRISPR/Cas9-engineered strains were homozygous. We applied the engineered Saccharomyces cerevisiae strains for bioethanol production. Results showed that the ethanol yield improved by up to 74.7% compared with the yield obtained using the native strain. This work illustrates the applicability of this highly efficient and specific genome engineering approach to promote the improvement of bioethanol production in S. cerevisiae via metabolic engineering. Importantly, this study is the first report of the disruption of a target gene, ADH2, in S. cerevisiae using CRISPR/Cas9 technology to improve bioethanol yield.},
}
@article {pmid30275376,
year = {2018},
author = {Zhu, S and Yu, X and Li, Y and Sun, Y and Zhu, Q and Sun, J},
title = {Highly Efficient Targeted Gene Editing in Upland Cotton Using the CRISPR/Cas9 System.},
journal = {International journal of molecular sciences},
volume = {19},
number = {10},
pages = {},
pmid = {30275376},
issn = {1422-0067},
support = {2017YFD0101604; 2016YFD0100200//the National Key Research and Development Program of China/ ; 31760401//the National Natural Science Foundation of China/ ; gxjs-yz03//Specific Project for Crops Breeding of Shihezi University/ ; },
mesh = {Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; *Gene Editing ; Genes, Plant ; Genetic Vectors/metabolism ; Gossypium/*genetics ; Mutagenesis/genetics ; Mutation/genetics ; Plants, Genetically Modified ; RNA, Guide/metabolism ; },
abstract = {The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) gene editing system has been shown to be able to induce highly efficient mutagenesis in the targeted DNA of many plants, including cotton, and has become an important tool for investigation of gene function and crop improvement. Here, we developed a simple and easy to operate CRISPR/Cas9 system and demonstrated its high editing efficiency in cotton by targeting-ALARP, a gene encoding alanine-rich protein that is preferentially expressed in cotton fibers. Based on sequence analysis of the target site in the 10 transgenic cottons containing CRISPR/Cas9, we found that the mutation frequencies of GhALARP-A and GhALARP-D target sites were 71.4⁻100% and 92.9⁻100%, respectively. The most common editing event was deletion, but deletion together with large insertion was also observed. Mosaic mutation editing events were detected in most transgenic plants. No off-target mutation event was detected in any the 15 predicted sites analyzed. This study provided mutants for further study of the function of GhALARP in cotton fiber development. Our results further demonstrated the feasibility of use of CRISPR/Cas9 as a targeted mutagenesis tool in cotton, and provided an efficient tool for targeted mutagenesis and functional genomics in cotton.},
}
@article {pmid30275337,
year = {2018},
author = {Ling, L and Raikhel, AS},
title = {Serotonin signaling regulates insulin-like peptides for growth, reproduction, and metabolism in the disease vector Aedes aegypti.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {E9822-E9831},
pmid = {30275337},
issn = {1091-6490},
support = {R01 AI036959/AI/NIAID NIH HHS/United States ; },
mesh = {Aedes/*physiology ; Animals ; CRISPR-Cas Systems ; Female ; Insect Proteins/*metabolism ; Insulin/*metabolism ; Mosquito Vectors/*physiology ; Peptide Fragments/*metabolism ; Receptors, Serotonin/chemistry/genetics/*metabolism ; *Reproduction ; Serotonin/*metabolism ; Signal Transduction ; },
abstract = {Disease-transmitting female mosquitoes require a vertebrate blood meal to produce their eggs. An obligatory hematophagous lifestyle, rapid reproduction, and existence of a large number of transmittable diseases make mosquitoes the world's deadliest animals. Attaining optimal body size and nutritional status is critical for mosquitoes to become reproductively competent and effective disease vectors. We report that blood feeding boosts serotonin concentration and elevates the serotonin receptor Aa5HT2B (Aedes aegypti 5-hydroxytryptamine receptor, type 2B) transcript level in the fat-body, an insect analog of the vertebrate liver and adipose tissue. Aa5HT2B gene disruption using the CRISPR-Cas9 gene-editing approach led to a decreased body size, postponed development, shortened lifespan, retarded ovarian growth, and dramatically diminished lipid accumulation. Expression of the insulin-like peptide (ILP) genes ilp2 and ilp6 was down-regulated while that of ilp5 and ilp4 was up-regulated in response to Aa5HT2B disruption. CRISPR-Cas9 disruption of ilp2 or ilp6 resulted in adverse phenotypes similar to those of Aa5HT2B disruption, while ilp5 CRISPR-Cas9 disruption had exactly the opposite effect on growth and metabolism, with significantly increased body size and elevated lipid stores. Simultaneous CRISPR-Cas9 disruption of Aa5HT2B and ilp5 rescued these phenotypic manifestations. Aa5HT2B RNAi silencing rendered ilp6 insensitive to serotonin treatment in the cultured fat-body, suggesting a regulatory link between Aa5HT2B and ILP6. Moreover, CRISPR-Cas9 ilp6 disruption affects expression of ilp-2, -5, and -4, pointing out on a possible role of ILP6 as a mediator of the Aa5HT2B action.},
}
@article {pmid30275336,
year = {2018},
author = {Sago, CD and Lokugamage, MP and Paunovska, K and Vanover, DA and Monaco, CM and Shah, NN and Gamboa Castro, M and Anderson, SE and Rudoltz, TG and Lando, GN and Munnilal Tiwari, P and Kirschman, JL and Willett, N and Jang, YC and Santangelo, PJ and Bryksin, AV and Dahlman, JE},
title = {High-throughput in vivo screen of functional mRNA delivery identifies nanoparticles for endothelial cell gene editing.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {E9944-E9952},
pmid = {30275336},
issn = {1091-6490},
support = {T32 EB006343/EB/NIBIB NIH HHS/United States ; T32 EB021962/EB/NIBIB NIH HHS/United States ; T32 GM008433/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Cells, Cultured ; Endothelial Cells/cytology/*metabolism ; *Gene Editing ; *Gene Transfer Techniques ; HEK293 Cells ; Hepatocytes/cytology/metabolism ; High-Throughput Screening Assays ; Humans ; Lipids/*chemistry ; Mice ; Mice, Inbred C57BL ; Nanoparticles/*administration &amp; dosage/chemistry ; RNA, Guide/chemistry/*genetics ; RNA, Messenger/chemistry/*genetics ; },
abstract = {Dysfunctional endothelium causes more disease than any other cell type. Systemically administered RNA delivery to nonliver tissues remains challenging, in large part because there is no high-throughput method to identify nanoparticles that deliver functional mRNA to cells in vivo. Here we report a system capable of simultaneously quantifying how >100 lipid nanoparticles (LNPs) deliver mRNA that is translated into functional protein. Using this system (named FIND), we measured how >250 LNPs delivered mRNA to multiple cell types in vivo and identified 7C2 and 7C3, two LNPs that efficiently deliver siRNA, single-guide RNA (sgRNA), and mRNA to endothelial cells. The 7C3 delivered Cas9 mRNA and sgRNA to splenic endothelial cells as efficiently as hepatocytes, distinguishing it from LNPs that deliver Cas9 mRNA and sgRNA to hepatocytes more than other cell types. These data demonstrate that FIND can identify nanoparticles with novel tropisms in vivo.},
}
@article {pmid30275281,
year = {2018},
author = {Zhang, H and Pan, H and Zhou, C and Wei, Y and Ying, W and Li, S and Wang, G and Li, C and Ren, Y and Li, G and Ding, X and Sun, Y and Li, GL and Song, L and Li, Y and Yang, H and Liu, Z},
title = {Simultaneous zygotic inactivation of multiple genes in mouse through CRISPR/Cas9-mediated base editing.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {20},
pages = {},
doi = {10.1242/dev.168906},
pmid = {30275281},
issn = {1477-9129},
mesh = {Amino Acid Transport Systems, Acidic/metabolism ; Animals ; Base Sequence ; CRISPR-Cas Systems/*genetics ; Cochlea/metabolism ; Deafness/genetics/physiopathology ; Disease Models, Animal ; Electrophysiological Phenomena ; Gene Editing/*methods ; Membrane Proteins/metabolism ; Mice ; Molecular Motor Proteins/metabolism ; Mutation/genetics ; Zygote/*metabolism ; },
abstract = {In vivo genetic mutation has become a powerful tool for dissecting gene function; however, multi-gene interaction and the compensatory mechanisms involved can make findings from single mutations, at best difficult to interpret, and, at worst, misleading. Hence, it is necessary to establish an efficient way to disrupt multiple genes simultaneously. CRISPR/Cas9-mediated base editing disrupts gene function by converting a protein-coding sequence into a stop codon; this is referred to as CRISPR-stop. Its application in generating zygotic mutations has not been well explored yet. Here, we first performed a proof-of-principle test by disrupting Atoh1, a gene crucial for auditory hair cell generation. Next, we individually mutated vGlut3 (Slc17a8), otoferlin (Otof) and prestin (Slc26a5), three genes needed for normal hearing function. Finally, we successfully disrupted vGlut3, Otof and prestin simultaneously. Our results show that CRISPR-stop can efficiently generate single or triple homozygous F0 mouse mutants, bypassing laborious mouse breeding. We believe that CRISPR-stop is a powerful method that will pave the way for high-throughput screening of mouse developmental and functional genes, matching the efficiency of methods available for model organisms such as Drosophila.},
}
@article {pmid30274819,
year = {2018},
author = {Song, Y and Zhang, Y and Chen, M and Deng, J and Sui, T and Lai, L and Li, Z},
title = {Functional validation of the albinism-associated tyrosinase T373K SNP by CRISPR/Cas9-mediated homology-directed repair (HDR) in rabbits.},
journal = {EBioMedicine},
volume = {36},
number = {},
pages = {517-525},
pmid = {30274819},
issn = {2352-3964},
mesh = {Albinism, Oculocutaneous/*genetics/metabolism ; *Amino Acid Substitution ; Animals ; *CRISPR-Cas Systems ; Cells, Cultured ; Disease Models, Animal ; Enzyme Activation ; Female ; Gene Editing ; Genetic Association Studies ; Genetic Loci ; Genetic Predisposition to Disease ; Melanins ; Monophenol Monooxygenase/*genetics/metabolism ; Mutation ; *Polymorphism, Single Nucleotide ; Rabbits ; *Recombinational DNA Repair ; },
abstract = {BACKGROUND: Oculocutaneous albinism (OCA) is a group of autosomal recessive disorders characterized by reduced melanin that are caused by mutations in the gene encoding tyrosinase (TYR), which is the rate-limiting enzyme in the production of the pigment melanin. Many studies or meta-analyses have suggested an association between the TYR T373K SNP and OCA1, but there is limited biochemical and genetic evidence to support this association.<br><br>METHODS: We overexpressed TYR-WT and TYR-T373K mutants on HK293T cells and tested the changes of melanin production and tyrosinase activity. Then we generated TYR-K373T knock-in (KI) rabbits by microinjection of ssDNA and synthesized RNAs targeting C1118A using CRISPR/Cas9-HDR to observe the formation of melanin.<br><br>FINDINGS: We demonstrated that the T373K mutation in TYR can reduce tyrosinase activity, leading to an absence of melanin synthesis at the cell-level. The gene-edited TYR-K373T rabbits exhibited rescued melanin production in hair follicles and irises, as inferred from the evident decrease in pigmentation in TYR-T373K rabbits, thus providing functional validation of the albinism-associated T373K SNP at the animal level.<br><br>INTERPRETATION: Our study provides the first animal-level functional validation of the albinism-associated TYR K373T SNP in rabbits, and these results will facilitate gene therapy of OCA1 in pre-clinical settings in the future. FUND: The National Key Research and Development Program of China Stem Cell and Translational Research, the Strategic Priority Research Program of the Chinese Academy of Sciences, the Guangdong Province Science and Technology Plan Project, and the Program for JLU Science and Technology Innovative Research Team.},
}
@article {pmid30269229,
year = {2018},
author = {Hong, KQ and Liu, DY and Chen, T and Wang, ZW},
title = {Recent advances in CRISPR/Cas9 mediated genome editing in Bacillus subtilis.},
journal = {World journal of microbiology &amp; biotechnology},
volume = {34},
number = {10},
pages = {153},
pmid = {30269229},
issn = {1573-0972},
support = {21576200//National Natural Science Foundation of China/ ; 21776209//National Natural Science Foundation of China/ ; 21621004//National Natural Science Foundation of China/ ; },
mesh = {Bacillus subtilis/*genetics ; Bacterial Proteins/genetics ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Endonucleases ; Gene Editing/*methods ; Genes, Bacterial/genetics ; Molecular Biology/methods ; },
abstract = {Genome editing using engineered nucleases has rapidly transformed from a niche technology to a mainstream method used in various host cells. Its widespread adoption has been largely developed by the emergence of the clustered regularly interspaced short palindromic repeats (CRISPR) system, which uses an easily customizable specificity RNA-guided DNA endonuclease, such as Cas9. Recently, CRISPR/Cas9 mediated genome engineering has been widely applied to model organisms, including Bacillus subtilis, enabling facile, rapid high-fidelity modification of endogenous native genes. Here, we reviewed the recent progress in B. subtilis gene editing using CRISPR/Cas9 based tools, and highlighted state-of-the-art strategies for design of CRISPR/Cas9 system. Finally, future perspectives on the use of CRISPR/Cas9 genome engineering for sequence-specific genome editing in B. subtilis are provided.},
}
@article {pmid30266827,
year = {2018},
author = {Vaid, S and Camp, JG and Hersemann, L and Eugster Oegema, C and Heninger, AK and Winkler, S and Brandl, H and Sarov, M and Treutlein, B and Huttner, WB and Namba, T},
title = {A novel population of Hopx-dependent basal radial glial cells in the developing mouse neocortex.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {20},
pages = {},
doi = {10.1242/dev.169276},
pmid = {30266827},
issn = {1477-9129},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cell Proliferation ; Embryo, Mammalian/metabolism ; Ependymoglial Cells/*metabolism ; Gene Expression Profiling ; Gene Expression Regulation, Developmental ; Homeodomain Proteins/*metabolism ; Humans ; Lateral Ventricles/embryology ; Mice, Inbred C57BL ; Neocortex/*cytology/*embryology/metabolism ; PAX6 Transcription Factor/metabolism ; Stem Cells/cytology ; },
abstract = {A specific subpopulation of neural progenitor cells, the basal radial glial cells (bRGCs) of the outer subventricular zone (OSVZ), are thought to have a key role in the evolutionary expansion of the mammalian neocortex. In the developing lissencephalic mouse neocortex, bRGCs exist at low abundance and show significant molecular differences from bRGCs in developing gyrencephalic species. Here, we demonstrate that the developing mouse medial neocortex (medNcx), in contrast to the canonically studied lateral neocortex (latNcx), exhibits an OSVZ and an abundance of bRGCs similar to that in developing gyrencephalic neocortex. Unlike bRGCs in developing mouse latNcx, the bRGCs in medNcx exhibit human bRGC-like gene expression, including expression of Hopx, a human bRGC marker. Disruption of Hopx expression in mouse embryonic medNcx and forced Hopx expression in mouse embryonic latNcx demonstrate that Hopx is required and sufficient, respectively, for bRGC abundance as found in the developing gyrencephalic neocortex. Taken together, our data identify a novel bRGC subpopulation in developing mouse medNcx that is highly related to bRGCs of developing gyrencephalic neocortex.},
}
@article {pmid30266728,
year = {2018},
author = {Morovic, W and Roos, P and Zabel, B and Hidalgo-Cantabrana, C and Kiefer, A and Barrangou, R},
title = {Transcriptional and Functional Analysis of Bifidobacterium animalis subsp. lactis Exposure to Tetracycline.},
journal = {Applied and environmental microbiology},
volume = {84},
number = {23},
pages = {},
pmid = {30266728},
issn = {1098-5336},
abstract = {Commercial probiotic bacteria must be tested for acquired antibiotic resistance elements to avoid potential transfer to pathogens. The European Food Safety Authority recommends testing resistance using microdilution culture techniques previously used to establish inhibitory thresholds for the Bifidobacterium genus. Many Bifidobacterium animalis subsp. lactis strains exhibit increased resistance to tetracycline, historically attributed to the ribosomal protection gene tet(W). However, some strains that harbor genetically identical tet(W) genes show various inhibition levels, suggesting that other genetic elements also contribute to observed differences. Here, we adapted several molecular assays to confirm the inhibition of B. animalis subsp. lactis strains Bl-04 and HN019 and employed RNA sequencing to assess the transcriptional differences related to genomic polymorphisms. We detected specific stress responses to the antibiotic by correlating ATP concentration to number of viable genome copies from droplet digital PCR and found that the bacteria were still metabolically active in high drug concentrations. Transcriptional analyses revealed that several polymorphic regions, particularly a novel multidrug efflux transporter, were differentially expressed between the strains in each experimental condition, likely having phenotypic effects. We also found that the tet(W) gene was upregulated only during subinhibitory tetracycline concentrations, while two novel tetracycline resistance genes were upregulated at high concentrations. Furthermore, many genes involved in amino acid metabolism and transporter function were upregulated, while genes for complex carbohydrate utilization, protein metabolism, and clustered regularly interspaced short palindromic repeat(s) (CRISPR)-Cas systems were downregulated. These results provide high-throughput means for assessing antibiotic resistances of two highly related probiotic strains and determine the genetic network that contributes to the global tetracycline response.IMPORTANCEBifidobacterium animalis subsp. lactis is widely used in human food and dietary supplements. Although well documented to be safe, B. animalis subsp. lactis strains must not contain transferable antibiotic resistance elements. Many B. animalis subsp. lactis strains have different resistance measurements despite being genetically similar, and the reasons for this are not well understood. In the current study, we sought to examine how genomic differences between two closely related industrial B. animalis subsp. lactis strains contribute to different resistance levels. This will lead to a better understanding of resistance, identify future targets for analysis of transferability, and expand our understanding of tetracycline resistance in bacteria.},
}
@article {pmid30266091,
year = {2018},
author = {Mao, Y and Yang, X and Zhou, Y and Zhang, Z and Botella, JR and Zhu, JK},
title = {Manipulating plant RNA-silencing pathways to improve the gene editing efficiency of CRISPR/Cas9 systems.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {149},
pmid = {30266091},
issn = {1474-760X},
support = {NA//Chinese Academy of Sciences/International ; NA//Youth Innovation Promotion Association, CAS/International ; },
mesh = {Arabidopsis/*genetics ; CRISPR-Associated Protein 9/*metabolism ; *CRISPR-Cas Systems ; *Gene Editing ; Mutation ; *RNA Interference ; RNA, Plant/*metabolism ; Viral Proteins/metabolism ; },
abstract = {BACKGROUND: The CRISPR/Cas9 system, composed of a single-guide RNA for target recognition and a Cas9 protein for DNA cleavage, has the potential to revolutionize agriculture as well as medicine. Even though extensive work has been done to improve the gene editing activity of CRISPR/Cas9, little is known about the regulation of this bacterial system in eukaryotic host cells, especially at the post-transcriptional level.<br><br>RESULTS: Here, we evaluate the expression levels of the two CRISPR/Cas9 components and the gene editing efficiency in a set of Arabidopsis mutants involved in RNA silencing. We find that mutants defective in the post-transcriptional gene-silencing pathway display significantly higher Cas9 and sgRNA transcript levels, resulting in higher mutagenesis frequencies than wild-type controls. Accordingly, silencing of AGO1 by introduction of an AGO1-RNAi cassette into the CRISPR/Cas9 vector provides an increase in gene editing efficiency. Co-expression of the viral suppressor p19 from the tomato bushy stunt virus to suppress the plant RNA-silencing pathway shows a strong correlation between the severity of the phenotypic effects caused by p19 and the gene editing efficiency of the CRISPR/Cas9 system for two different target genes, AP1 and TT4.<br><br>CONCLUSIONS: This system has useful practical applications in facilitating the detection of CRISPR/Cas9-induced mutations in T1 plants as well as the identification of transgene-free T2 plants by simple visual observation of the symptom severity caused by p19. Our study shows that CRISPR/Cas9 gene editing efficiency can be improved by reducing RNA silencing in plants.},
}
@article {pmid30265349,
year = {2018},
author = {Muhr, M and Paulat, M and Awwanah, M and Brinkkötter, M and Teichmann, T},
title = {CRISPR/Cas9-mediated knockout of Populus BRANCHED1 and BRANCHED2 orthologs reveals a major function in bud outgrowth control.},
journal = {Tree physiology},
volume = {38},
number = {10},
pages = {1588-1597},
doi = {10.1093/treephys/tpy088},
pmid = {30265349},
issn = {1758-4469},
mesh = {*CRISPR-Cas Systems ; Gene Knockout Techniques ; Phenotype ; Plant Leaves/genetics/growth &amp; development ; Plant Proteins/*genetics/metabolism ; Plant Stems/genetics/*growth &amp; development ; Populus/*genetics/*growth &amp; development/metabolism ; Transcription Factors/*genetics/metabolism ; },
abstract = {The TCP-type transcription factors BRANCHED1 and BRANCHED2 shape plant architecture by suppressing bud outgrowth, with BRANCHED2 only playing a minor role in Arabidopsis. Here, we investigated the function of orthologs of these genes in the model tree Populus. We used CRISPR/Cas9 to generate loss-of-function mutants of previously identified Populus BRANCHED1-1 and BRANCHED2-1 candidate genes. BRANCHED1-1 mutants exhibited strongly enhanced bud outgrowth. BRANCHED2-1 mutants had an extreme bud outgrowth phenotype and possessed two ectopic leaves at each node. While BRANCHED1 function is conserved in poplar, BRANCHED2, in contrast to its Arabidopsis counterpart, plays an even more critical role in bud outgrowth regulation. In addition, we identified a new, not yet reported association of this gene to leaf development.},
}
@article {pmid30262503,
year = {2018},
author = {He, S and Del Viso, F and Chen, CY and Ikmi, A and Kroesen, AE and Gibson, MC},
title = {An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6409},
pages = {1377-1380},
doi = {10.1126/science.aar8384},
pmid = {30262503},
issn = {1095-9203},
mesh = {Animals ; Bacterial Proteins ; Body Patterning/*genetics ; CRISPR-Associated Protein 9 ; CRISPR-Cas Systems ; Endoderm/cytology/growth &amp; development ; Endonucleases ; *Gene Expression Regulation, Developmental ; Gene Knockdown Techniques/methods ; Genes, Homeobox/genetics/*physiology ; Larva/cytology/genetics/growth &amp; development ; Mutagenesis ; RNA, Small Interfering/genetics ; Sea Anemones/cytology/genetics/*growth &amp; development ; Transcription Factors/genetics/*physiology ; },
abstract = {Hox genes encode conserved developmental transcription factors that govern anterior-posterior (A-P) pattering in diverse bilaterian animals, which display bilateral symmetry. Although Hox genes are also present within Cnidaria, these simple animals lack a definitive A-P axis, leaving it unclear how and when a functionally integrated Hox code arose during evolution. We used short hairpin RNA (shRNA)-mediated knockdown and CRISPR-Cas9 mutagenesis to demonstrate that a Hox-Gbx network controls radial segmentation of the larval endoderm during development of the sea anemone Nematostella vectensis. Loss of Hox-Gbx activity also elicits marked defects in tentacle patterning along the directive (orthogonal) axis of primary polyps. On the basis of our results, we propose that an axial Hox code may have controlled body patterning and tissue segmentation before the evolution of the bilaterian A-P axis.},
}
@article {pmid30261908,
year = {2018},
author = {Dank, A and Smid, EJ and Notebaart, RA},
title = {CRISPR-Cas genome engineering of esterase activity in Saccharomyces cerevisiae steers aroma formation.},
journal = {BMC research notes},
volume = {11},
number = {1},
pages = {682},
pmid = {30261908},
issn = {1756-0500},
mesh = {*CRISPR-Cas Systems ; Carboxylic Ester Hydrolases ; Clustered Regularly Interspaced Short Palindromic Repeats ; Esterases/*genetics/metabolism ; Fermentation ; *Gene Editing ; Mutation ; *Odorants ; Saccharomyces cerevisiae/*enzymology ; Saccharomyces cerevisiae Proteins ; },
abstract = {OBJECTIVE: Saccharomyces cerevisiae is used worldwide for the production of ale-type beers. This yeast is responsible for the production of the characteristic fruity aroma compounds. Esters constitute an important group of aroma active secondary metabolites produced by S. cerevisiae. Previous work suggests that esterase activity, which results in ester degradation, may be the key factor determining the abundance of fruity aroma compounds. Here, we test this hypothesis by deletion of two S. cerevisiae esterases, IAH1 and TIP1, using CRISPR-Cas9 genome editing and by studying the effect of these deletions on esterase activity and extracellular ester pools.<br><br>RESULTS: Saccharomyces cerevisiae mutants were constructed lacking esterase IAH1 and/or TIP1 using CRISPR-Cas9 genome editing. Esterase activity using 5-(6)-carboxyfluorescein diacetate (cFDA) as substrate was found to be significantly lower for ΔIAH1 and ΔIAH1ΔTIP1 mutants compared to wild type (WT) activity (P < 0.05 and P < 0.001, respectively). As expected, we observed an increase in relative abundance of acetate and ethyl esters and an increase in ethyl esters in ΔIAH1 and ΔTIP1, respectively. Interestingly, the double gene disruption mutant ΔIAH1ΔTIP1 showed an aroma profile comparable to WT levels, suggesting the existence and activation of a complex regulatory mechanism to compensate multiple genomic alterations in aroma metabolism.},
}
@article {pmid30261168,
year = {2019},
author = {Hidalgo-Cantabrana, C and Goh, YJ and Barrangou, R},
title = {Characterization and Repurposing of Type I and Type II CRISPR-Cas Systems in Bacteria.},
journal = {Journal of molecular biology},
volume = {431},
number = {1},
pages = {21-33},
doi = {10.1016/j.jmb.2018.09.013},
pmid = {30261168},
issn = {1089-8638},
abstract = {CRISPR-Cas systems constitute the adaptive immune system of bacteria and archaea, as a sequence-specific nucleic acid targeting defense mechanism. The sequence-specific recognition and cleavage of Cas effector complexes has been harnessed to developed CRISPR-based technologies and drive the genome editing revolution underway, due to their efficacy, efficiency, and ease of implementation in a broad range of organisms. CRISPR-based technologies offer a wide variety of opportunities in genome remodeling and transcriptional regulation, opening new avenues for therapeutic and biotechnological applications. To repurpose CRISPR-Cas systems for these applications, the various elements of the system need to be first identified and functionally characterized in their native host. Bioinformatic tools are first used to identify putative CRISPR arrays and their associated genes, followed by a comprehensive characterization of the CRISPR-Cas system, encompassing predictions for guide and target sequences. Subsequently, interference assays and transcriptomic analyses should be performed to probe the functionality of the CRISPR-Cas system. Once an endogenous CRISPR-Cas system is characterized as functional, they can be readily repurposed by delivering an engineered synthetic CRISPR array or a small RNA guide for targeted gene manipulation. Alternatively, developing a plasmid-based system for heterologous expression of the necessary CRISPR components can enable exploitation in other organisms. Altogether, there is a wide diversity of native CRISPR-Cas systems in many bacteria and most archaea that await functional characterization and repurposing for genome editing applications in prokaryotes.},
}
@article {pmid30260951,
year = {2018},
author = {Hara, T and Maejima, I and Akuzawa, T and Hirai, R and Kobayashi, H and Tsukamoto, S and Tsunoda, M and Ono, A and Yamakoshi, S and Oikawa, S and Sato, K},
title = {Rer1-mediated quality control system is required for neural stem cell maintenance during cerebral cortex development.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007647},
pmid = {30260951},
issn = {1553-7404},
mesh = {Amyloid Precursor Protein Secretases/*metabolism ; Animals ; Behavior, Animal ; CRISPR-Cas Systems/genetics ; Cell Line, Tumor ; Cerebral Cortex/*growth &amp; development/metabolism ; Chromosome Deletion ; Chromosome Disorders/genetics ; Chromosomes, Human, Pair 1/genetics ; Disease Models, Animal ; Female ; *Gene Expression Regulation, Developmental ; Humans ; Lysosomes/metabolism ; Male ; Membrane Glycoproteins/genetics/*metabolism ; Mice ; Mice, Knockout ; Neural Stem Cells ; Receptors, Cytoplasmic and Nuclear/genetics/*metabolism ; Receptors, Notch/metabolism ; },
abstract = {Rer1 is a retrieval receptor for endoplasmic reticulum (ER) retention of various ER membrane proteins and unassembled or immature components of membrane protein complexes. However, its physiological functions during mammalian development remain unclear. This study aimed to investigate the role of Rer1-mediated quality control system in mammalian development. We show that Rer1 is required for the sufficient cell surface expression and activity of γ-secretase complex, which modulates Notch signaling during mouse cerebral cortex development. When Rer1 was depleted in the mouse cerebral cortex, the number of neural stem cells decreased significantly, and malformation of the cerebral cortex was observed. Rer1 loss reduced γ-secretase activity and downregulated Notch signaling in the developing cerebral cortex. In Rer1-deficient cells, a subpopulation of γ-secretase complexes and components was transported to and degraded in lysosomes, thereby significantly reducing the amount of γ-secretase complex on the cell surface. These results suggest that Rer1 maintains Notch signaling by maintaining sufficient expression of the γ-secretase complex on the cell surface and regulating neural stem cell maintenance during cerebral cortex development.},
}
@article {pmid30260068,
year = {2019},
author = {Ebrahimi, S and Teimoori, A and Khanbabaei, H and Tabasi, M},
title = {Harnessing CRISPR/Cas 9 System for manipulation of DNA virus genome.},
journal = {Reviews in medical virology},
volume = {29},
number = {1},
pages = {e2009},
doi = {10.1002/rmv.2009},
pmid = {30260068},
issn = {1099-1654},
abstract = {The recent development of the Clustered Regularly Interspaced Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system, a genome editing system, has many potential applications in virology. The possibility of introducing site specific breaks has provided new possibilities to precisely manipulate viral genomics. Here, we provide diagrams to summarize the steps involved in the process. We also systematically review recent applications of the CRISPR/Cas9 system for manipulation of DNA virus genomics and discuss the therapeutic potential of the system to treat viral diseases.},
}
@article {pmid30259067,
year = {2018},
author = {Xiang, G and Ren, J and Hai, T and Fu, R and Yu, D and Wang, J and Li, W and Wang, H and Zhou, Q},
title = {Editing porcine IGF2 regulatory element improved meat production in Chinese Bama pigs.},
journal = {Cellular and molecular life sciences : CMLS},
volume = {75},
number = {24},
pages = {4619-4628},
pmid = {30259067},
issn = {1420-9071},
support = {31471215//National Natural Science Foundation of China/ ; 31422038//National Natural Science Foundation of China/ ; 31471395//National Natural Science Foundation of China/ ; 31501188//National Natural Science Foundation of China/ ; XDA16010205//Strategic Priority Research Program of Chinese Academy of Sciences/ ; 2015AA020307//National High-Tech Research and Development Program/ ; 2016ZX08010001//National Special Key Project for Transgenic Breeding/ ; },
mesh = {Alleles ; Animal Husbandry/methods ; Animals ; Breeding/methods ; *CRISPR-Cas Systems ; Female ; Gene Editing/*methods ; Genotype ; Insulin-Like Growth Factor II/*genetics ; *Introns ; Male ; Meat/analysis ; Mutation ; Phenotype ; *Regulatory Sequences, Nucleic Acid ; Swine/*genetics ; },
abstract = {Insulin-like growth factor 2 (IGF2) is an important growth factor, which promotes growth and development in mammals during fetal and postnatal stages. Using CRISPR-Cas9 system, we generated multiple founder pigs containing 12 different mutant alleles around a regulatory element within the intron 3 of IGF2 gene. Crossing two male founders passed four mutant alleles onto F1 generation, and these mutations abolished repressor ZBED6 binding and rendered this regulatory element nonfunctional. Both founders and F1 animals showed significantly faster growth, without affecting meat quality. These results indicated that editing IGF2 intron 3-3072 site using CRISPR-Cas9 technology improved meat production in Bama pigs. This is the first demonstration that editing non-coding region can improve economic traits in livestock.},
}
@article {pmid30258941,
year = {2018},
author = {Karlapudi, AP and T C, V and Tammineedi, J and Srirama, K and Kanumuri, L and Prabhakar Kodali, V},
title = {In silico sgRNA tool design for CRISPR control of quorum sensing in Acinetobacter species.},
journal = {Genes &amp; diseases},
volume = {5},
number = {2},
pages = {123-129},
pmid = {30258941},
issn = {2352-3042},
abstract = {CRISPR genome editing utilizes Cas9 nuclease and single guide RNA (sgRNA), which directs the nuclease to a specific site in the genome and makes a double-stranded break (DSB). Design of sgRNA for CRISPR-Cas targeting, and to promote CRISPR adaptation, uses a regulatory mechanism that ensures maximum CRISPR-Cas9 system functions when a bacterial population is at highest risk of phage infection. Acinetobacter baumannii is the most regularly identified gram-negative bacterium infecting patients. Recent reports have demonstrated that the extent of diseases caused by A. baumannii is expanding and, in a few cases, now surpasses the quantity of infections caused by P. aeruginosa. Most Acinetobacter strains possess biofilm-forming ability, which plays a major role in virulence and drug resistance. Biofilm bacteria use quorum sensing, a cell-to-cell communication process, to activate gene expression. Many genes are involved in biofilm formation and the mechanism to disrupt the biofilm network is still not clearly understood. In this study, we performed in silico gene editing to exploit the AbaI gene, responsible for biofilm formation. The study explored different tools available for genome editing to create gene knockouts, selecting the A. baumannii AbaI gene as a target.},
}
@article {pmid30255296,
year = {2018},
author = {Adames, NR and Gallegos, JE and Peccoud, J},
title = {Yeast genetic interaction screens in the age of CRISPR/Cas.},
journal = {Current genetics},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00294-018-0887-8},
pmid = {30255296},
issn = {1432-0983},
support = {R01GM078989//National Institute of General Medical Sciences/ ; 1759900//Directorate for Biological Sciences/ ; 1832320//Directorate for Engineering/ ; },
abstract = {The ease of performing both forward and reverse genetics in Saccharomyces cerevisiae, along with its stable haploid state and short generation times, has made this budding yeast the consummate model eukaryote for genetics. The major advantage of using budding yeast for reverse genetics is this organism's highly efficient homology-directed repair, allowing for precise genome editing simply by introducing DNA with homology to the chromosomal target. Although plasmid- and PCR-based genome editing tools are quite efficient, they depend on rare spontaneous DNA breaks near the target sequence. Consequently, they can generate only one genomic edit at a time, and the edit must be associated with a selectable marker. However, CRISPR/Cas technology is efficient enough to permit markerless and multiplexed edits in a single step. These features have made CRISPR/Cas popular for yeast strain engineering in synthetic biology and metabolic engineering applications, but it has not been widely employed for genetic screens. In this review, we critically examine different methods to generate multi-mutant strains in systematic genetic interaction screens and discuss the potential of CRISPR/Cas to supplement or improve on these methods.},
}
@article {pmid30254261,
year = {2018},
author = {Serif, M and Dubois, G and Finoux, AL and Teste, MA and Jallet, D and Daboussi, F},
title = {One-step generation of multiple gene knock-outs in the diatom Phaeodactylum tricornutum by DNA-free genome editing.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3924},
pmid = {30254261},
issn = {2041-1723},
mesh = {Adenine Phosphoribosyltransferase/genetics/metabolism ; Algal Proteins/genetics/metabolism ; Amino Acid Sequence ; Base Sequence ; CRISPR-Cas Systems ; Diatoms/*genetics/metabolism ; Gene Editing/*methods ; Gene Knockout Techniques/*methods ; Microalgae/genetics/metabolism ; Multienzyme Complexes/genetics/metabolism ; Orotate Phosphoribosyltransferase/genetics/metabolism ; Orotidine-5'-Phosphate Decarboxylase/genetics/metabolism ; Reproducibility of Results ; Ribonucleoproteins/genetics/metabolism ; Sequence Homology, Amino Acid ; Transfection/*methods ; },
abstract = {Recently developed transgenic techniques to explore and exploit the metabolic potential of microalgae present several drawbacks associated with the delivery of exogenous DNA into the cells and its subsequent integration at random sites within the genome. Here, we report a highly efficient multiplex genome-editing method in the diatom Phaeodactylum tricornutum, relying on the biolistic delivery of CRISPR-Cas9 ribonucleoproteins coupled with the identification of two endogenous counter-selectable markers, PtUMPS and PtAPT. First, we demonstrate the functionality of RNP delivery by positively selecting the disruption of each of these genes. Then, we illustrate the potential of the approach for multiplexing by generating double-gene knock-out strains, with 65% to 100% efficiency, using RNPs targeting one of these markers and PtAureo1a, a photoreceptor-encoding gene. Finally, we created triple knock-out strains in one step by delivering six RNP complexes into Phaeodactylum cells. This approach could readily be applied to other hard-to-transfect organisms of biotechnological interest.},
}
@article {pmid30254120,
year = {2018},
author = {Cernak, P and Estrela, R and Poddar, S and Skerker, JM and Cheng, YF and Carlson, AK and Chen, B and Glynn, VM and Furlan, M and Ryan, OW and Donnelly, MK and Arkin, AP and Taylor, JW and Cate, JHD},
title = {Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host.},
journal = {mBio},
volume = {9},
number = {5},
pages = {},
pmid = {30254120},
issn = {2150-7511},
mesh = {Biotechnology ; CRISPR-Associated Protein 9/genetics ; *CRISPR-Cas Systems ; *Gene Editing ; Genes, Mating Type, Fungal/genetics ; *Genetic Engineering ; Kluyveromyces/*genetics/metabolism ; Lipid Metabolism ; Saccharomyces cerevisiae/genetics ; Synthetic Biology/*methods ; Temperature ; Thermotolerance ; },
abstract = {Throughout history, the yeast Saccharomyces cerevisiae has played a central role in human society due to its use in food production and more recently as a major industrial and model microorganism, because of the many genetic and genomic tools available to probe its biology. However, S. cerevisiae has proven difficult to engineer to expand the carbon sources it can utilize, the products it can make, and the harsh conditions it can tolerate in industrial applications. Other yeasts that could solve many of these problems remain difficult to manipulate genetically. Here, we engineered the thermotolerant yeast Kluyveromyces marxianus to create a new synthetic biology platform. Using CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats with Cas9)-mediated genome editing, we show that wild isolates of K. marxianus can be made heterothallic for sexual crossing. By breeding two of these mating-type engineered K. marxianus strains, we combined three complex traits-thermotolerance, lipid production, and facile transformation with exogenous DNA-into a single host. The ability to cross K. marxianus strains with relative ease, together with CRISPR-Cas9 genome editing, should enable engineering of K. marxianus isolates with promising lipid production at temperatures far exceeding those of other fungi under development for industrial applications. These results establish K. marxianus as a synthetic biology platform comparable to S. cerevisiae, with naturally more robust traits that hold potential for the industrial production of renewable chemicals.IMPORTANCE The yeast Kluyveromyces marxianus grows at high temperatures and on a wide range of carbon sources, making it a promising host for industrial biotechnology to produce renewable chemicals from plant biomass feedstocks. However, major genetic engineering limitations have kept this yeast from replacing the commonly used yeast Saccharomyces cerevisiae in industrial applications. Here, we describe genetic tools for genome editing and breeding K. marxianus strains, which we use to create a new thermotolerant strain with promising fatty acid production. These results open the door to using K. marxianus as a versatile synthetic biology platform organism for industrial applications.},
}
@article {pmid30253789,
year = {2018},
author = {Gaj, T and Perez-Pinera, P},
title = {The continuously evolving CRISPR barcoding toolbox.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {143},
pmid = {30253789},
issn = {1474-760X},
mesh = {Animals ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; },
abstract = {Two articles recently described the development of CRISPR technologies that have the potential to fundamentally transform the barcoding and tracing of mammalian cells.},
}
@article {pmid30251692,
year = {2018},
author = {Luanpitpong, S and Poohadsuan, J and Samart, P and Kiratipaiboon, C and Rojanasakul, Y and Issaragrisil, S},
title = {Reactive oxygen species mediate cancer stem-like cells and determine bortezomib sensitivity via Mcl-1 and Zeb-1 in mantle cell lymphoma.},
journal = {Biochimica et biophysica acta. Molecular basis of disease},
volume = {1864},
number = {11},
pages = {3739-3753},
doi = {10.1016/j.bbadis.2018.09.010},
pmid = {30251692},
issn = {1879-260X},
mesh = {Antineoplastic Agents/*pharmacology/therapeutic use ; Apoptosis/drug effects ; Biopsy ; Bortezomib/*pharmacology/therapeutic use ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Proliferation ; Drug Resistance, Neoplasm ; Female ; Free Radical Scavengers/pharmacology ; Gene Knockdown Techniques ; HEK293 Cells ; Humans ; Lymph Nodes/pathology ; Lymphoma, Mantle-Cell/*drug therapy/pathology ; Middle Aged ; Myeloid Cell Leukemia Sequence 1 Protein/antagonists &amp; inhibitors/genetics/*metabolism ; Neoplasm Recurrence, Local/pathology/prevention &amp; control ; Neoplastic Stem Cells/drug effects/metabolism ; Primary Cell Culture ; Reactive Oxygen Species/*metabolism ; Zinc Finger E-box-Binding Homeobox 1/*metabolism ; },
abstract = {Mantle cell lymphoma (MCL) is an aggressive, incurable non-Hodgkin B-cell lymphoma with good initial response to therapy then subsequently relapse. Cancer stem cells (CSCs) are considered to be an underlying cause of these inevitable drug resistance and tumor regrowth, but how CSCs are regulated is largely unknown. We demonstrate here for the first time the existence of CSC-like subpopulations that are modulated by reactive oxygen species (ROS) in MCL cell lines and patient-derived primary cells in an inverse correlation with bortezomib (BTZ) sensitivity. Using various known donors and inhibitors of cellular superoxide (O2-), hydrogen peroxide (H2O2) and hydroxyl radical (OH), we unveil their distinct roles in the regulation of CSC-like subpopulations and thus MCL response to BTZ. O2- inhibits CSC-like cells and sensitizes BTZ-induced apoptosis, whereas H2O2 conversely enriches CSC-like cells and protects against apoptosis and OH has minimal effects. We further observed that an anti-apoptotic Mcl-1 and a transcription factor Zeb-1 are favorable targets of O2- and H2O2, respectively. Using small molecule inhibition, ectopic expression and CRISPR/Cas9-mediated gene manipulation, we verified the roles of Mcl-1 and Zeb-1 in CSC and apoptosis regulation by O2- and H2O2. Our findings provide a novel mechanistic insight into the significance of redox status of MCL cells in determining their drug response via CSC-like subpopulations, which are imperative to a better understanding of therapeutic resistance and relapse.},
}
@article {pmid30251682,
year = {2018},
author = {Montioli, R and Desbats, MA and Grottelli, S and Doimo, M and Bellezza, I and Borri Voltattorni, C and Salviati, L and Cellini, B},
title = {Molecular and cellular basis of ornithine δ-aminotransferase deficiency caused by the V332M mutation associated with gyrate atrophy of the choroid and retina.},
journal = {Biochimica et biophysica acta. Molecular basis of disease},
volume = {1864},
number = {11},
pages = {3629-3638},
doi = {10.1016/j.bbadis.2018.08.032},
pmid = {30251682},
issn = {1879-260X},
mesh = {CRISPR-Cas Systems/genetics ; Coenzymes/metabolism ; Enzyme Assays ; Gene Knockout Techniques ; Gyrate Atrophy/drug therapy/*genetics/pathology ; HEK293 Cells ; Holoenzymes/genetics/metabolism ; Humans ; Mutagenesis, Site-Directed ; Ornithine-Oxo-Acid Transaminase/*genetics/metabolism ; Point Mutation ; Protein Aggregation, Pathological/drug therapy/*genetics/pathology ; Pyridoxal Phosphate/*metabolism ; Pyridoxine/pharmacology/therapeutic use ; Recombinant Proteins/genetics/metabolism ; Treatment Outcome ; Vitamin B Complex/*pharmacology/therapeutic use ; },
abstract = {Gyrate atrophy (GA) is a rare recessive disorder characterized by progressive blindness, chorioretinal degeneration and systemic hyperornithinemia. GA is caused by point mutations in the gene encoding ornithine δ-aminotransferase (OAT), a tetrameric pyridoxal 5'-phosphate-dependent enzyme catalysing the transamination of l-ornithine and α-ketoglutarate to glutamic-γ-semialdehyde and l-glutamate in mitochondria. More than 50 OAT variants have been identified, but their molecular and cellular properties are mostly unknown. A subset of patients is responsive to pyridoxine administration, although the mechanisms underlying responsiveness have not been clarified. Herein, we studied the effects of the V332M mutation identified in pyridoxine-responsive patients. The Val332-to-Met substitution does not significantly affect the spectroscopic and kinetic properties of OAT, but during catalysis it makes the protein prone to convert into the apo-form, which undergoes unfolding and aggregation under physiological conditions. By using the CRISPR/Cas9 technology we generated a new cellular model of GA based on HEK293 cells knock-out for the OAT gene (HEK-OAT_KO). When overexpressed in HEK-OAT_KO cells, the V332M variant is present in an inactive apodimeric form, but partly shifts to the catalytically-competent holotetrameric form in the presence of exogenous PLP, thus explaining the responsiveness of these patients to pyridoxine administration. Overall, our data represent the first integrated molecular and cellular analysis of the effects of a pathogenic mutation in OAT. In addition, we validated a novel cellular model for the disease that could prove instrumental to define the molecular defect of other GA-causing variants, as well as their responsiveness to pyridoxine and other putative drugs.},
}
@article {pmid30251625,
year = {2018},
author = {Emmer, BT and Hesketh, GG and Kotnik, E and Tang, VT and Lascuna, PJ and Xiang, J and Gingras, AC and Chen, XW and Ginsburg, D},
title = {The cargo receptor SURF4 promotes the efficient cellular secretion of PCSK9.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30251625},
issn = {2050-084X},
support = {R35 HL135793/HL/NHLBI NIH HHS/United States ; T32 HL007853/HL/NHLBI NIH HHS/United States ; R35-HL135793T/HL/NHLBI NIH HHS/United States ; T32-HL007853/HL/NHLBI NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Biotinylation ; CRISPR-Cas Systems/genetics ; Endoplasmic Reticulum/metabolism ; Gene Deletion ; HEK293 Cells ; Humans ; Membrane Proteins/*metabolism ; Mutagenesis/genetics ; Proprotein Convertase 9/*metabolism ; Protein Binding ; Recombinant Fusion Proteins/metabolism ; Secretory Pathway ; },
abstract = {PCSK9 is a secreted protein that regulates plasma cholesterol levels and cardiovascular disease risk. Prior studies suggested the presence of an ER cargo receptor that recruits PCSK9 into the secretory pathway, but its identity has remained elusive. Here, we apply a novel approach that combines proximity-dependent biotinylation and proteomics together with genome-scale CRISPR screening to identify SURF4, a homologue of the yeast cargo receptor Erv29p, as a primary mediator of PCSK9 secretion in HEK293T cells. The functional contribution of SURF4 to PCSK9 secretion was confirmed with multiple independent SURF4-targeting sgRNAs, clonal SURF4-deficient cell lines, and functional rescue with SURF4 cDNA. SURF4 was found to localize to the early secretory pathway where it physically interacts with PCSK9. Deletion of SURF4 resulted in ER accumulation and decreased extracellular secretion of PCSK9. These findings support a model in which SURF4 functions as an ER cargo receptor mediating the efficient cellular secretion of PCSK9.},
}
@article {pmid30251378,
year = {2019},
author = {da Silva Xavier, A and de Almeida, JCF and de Melo, AG and Rousseau, GM and Tremblay, DM and de Rezende, RR and Moineau, S and Alfenas-Zerbini, P},
title = {Characterization of CRISPR-Cas systems in the Ralstonia solanacearum species complex.},
journal = {Molecular plant pathology},
volume = {20},
number = {2},
pages = {223-239},
doi = {10.1111/mpp.12750},
pmid = {30251378},
issn = {1364-3703},
support = {APQ-01926-14//Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG)/ ; //Natural Sciences and Engineering Research Council of Canada/ ; APQ-01926-14//Fundação de Amparo à Pesquisa do Estado de Minas Gerais/ ; },
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPRs) are composed of an array of short DNA repeat sequences separated by unique spacer sequences that are flanked by associated (Cas) genes. CRISPR-Cas systems are found in the genomes of several microbes and can act as an adaptive immune mechanism against invading foreign nucleic acids, such as phage genomes. Here, we studied the CRISPR-Cas systems in plant-pathogenic bacteria of the Ralstonia solanacearum species complex (RSSC). A CRISPR-Cas system was found in 31% of RSSC genomes present in public databases. Specifically, CRISPR-Cas types I-E and II-C were found, with I-E being the most common. The presence of the same CRISPR-Cas types in distinct Ralstonia phylotypes and species suggests the acquisition of the system by a common ancestor before Ralstonia species segregation. In addition, a Cas1 phylogeny (I-E type) showed a perfect geographical segregation of phylotypes, supporting an ancient acquisition. Ralstoniasolanacearum strains CFBP2957 and K60T were challenged with a virulent phage, and the CRISPR arrays of bacteriophage-insensitive mutants (BIMs) were analysed. No new spacer acquisition was detected in the analysed BIMs. The functionality of the CRISPR-Cas interference step was also tested in R. solanacearum CFBP2957 using a spacer-protospacer adjacent motif (PAM) delivery system, and no resistance was observed against phage phiAP1. Our results show that the CRISPR-Cas system in R. solanacearum CFBP2957 is not its primary antiviral strategy.},
}
@article {pmid30251319,
year = {2018},
author = {Martin, RM and Moniruzzaman, M and Mucci, NC and Willis, A and Woodhouse, JN and Xian, Y and Xiao, C and Brussaard, CPD and Wilhelm, SW},
title = {Cylindrospermopsis raciborskii Virus and host: genomic characterization and ecological relevance.},
journal = {Environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1462-2920.14425},
pmid = {30251319},
issn = {1462-2920},
support = {//Kenneth &amp; Blaire Mossman Endowment/ ; //NIOZ/ ; LP130100311//ARC-Linkage/ ; //University of Tennessee/ ; DEB 1240870//National Science Foundation/ ; IOS 141528//National Science Foundation/ ; },
abstract = {Cylindrospermopsis (Raphidiopsis) raciborskii is an invasive, filamentous, nitrogen-fixing cyanobacterium that forms frequent blooms in freshwater habitats. While viruses play key roles in regulating the abundance, production and diversity of their hosts in aquatic ecosystems, the role(s) of viruses in the ecology of C. raciborskii is almost unexplored. Progress in this field has been hindered by the absence of a characterized virus-host system in C. raciborskii. To bridge this gap, we sequenced the genome of CrV-01T, a previously isolated cyanosiphovirus, and its host, C. raciborskii strain Cr2010. Analyses suggest that CrV-01T represents a distinct clade of siphoviruses infecting, and perhaps lysogenizing, filamentous cyanobacteria. Its genome contains unique features that include an intact CRISPR array and a 12 kb inverted duplication. Evidence suggests CrV-01T recently gained the ability to infect Cr2010 and recently lost the ability to form lysogens. The cyanobacterial host contains a CRISPR-Cas system with CRISPR spacers matching protospacers within the inverted duplication of the CrV-01T genome. Examination of metagenomes demonstrates that viruses with high genetic identity to CrV-01T, but lacking the inverted duplication, are present in C. raciborskii blooms in Australia. The unique genomic features of the CrV/Cr2010 system offers opportunities to investigate in more detail virus-host interactions in an ecologically important bloom-forming cyanobacterium.},
}
@article {pmid30248107,
year = {2018},
author = {Wu, S and Zhang, M and Yang, X and Peng, F and Zhang, J and Tan, J and Yang, Y and Wang, L and Hu, Y and Peng, Q and Li, J and Liu, Y and Guan, Y and Chen, C and Hamer, MA and Nijsten, T and Zeng, C and Adhikari, K and Gallo, C and Poletti, G and Schuler-Faccini, L and Bortolini, MC and Canizales-Quinteros, S and Rothhammer, F and Bedoya, G and González-José, R and Li, H and Krutmann, J and Liu, F and Kayser, M and Ruiz-Linares, A and Tang, K and Xu, S and Zhang, L and Jin, L and Wang, S},
title = {Genome-wide association studies and CRISPR/Cas9-mediated gene editing identify regulatory variants influencing eyebrow thickness in humans.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007640},
pmid = {30248107},
issn = {1553-7404},
support = {BB/I021213/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {CRISPR-Cas Systems/genetics ; Chromosomes, Human/genetics ; Eyebrows/*growth &amp; development ; Forkhead Transcription Factors/genetics ; Gene Editing ; Genetic Loci/*genetics ; Genome-Wide Association Study ; Genotype ; Humans ; *Phenotype ; Polymorphism, Single Nucleotide ; SOXB1 Transcription Factors/genetics ; Selection, Genetic ; },
abstract = {Hair plays an important role in primates and is clearly subject to adaptive selection. While humans have lost most facial hair, eyebrows are a notable exception. Eyebrow thickness is heritable and widely believed to be subject to sexual selection. Nevertheless, few genomic studies have explored its genetic basis. Here, we performed a genome-wide scan for eyebrow thickness in 2961 Han Chinese. We identified two new loci of genome-wide significance, at 3q26.33 near SOX2 (rs1345417: P = 6.51×10(-10)) and at 5q13.2 near FOXD1 (rs12651896: P = 1.73×10(-8)). We further replicated our findings in the Uyghurs, a population from China characterized by East Asian-European admixture (N = 721), the CANDELA cohort from five Latin American countries (N = 2301), and the Rotterdam Study cohort of Dutch Europeans (N = 4411). A meta-analysis combining the full GWAS results from the three cohorts of full or partial Asian descent (Han Chinese, Uyghur and Latin Americans, N = 5983) highlighted a third signal of genome-wide significance at 2q12.3 (rs1866188: P = 5.81×10(-11)) near EDAR. We performed fine-mapping and prioritized four variants for further experimental verification. CRISPR/Cas9-mediated gene editing provided evidence that rs1345417 and rs12651896 affect the transcriptional activity of the nearby SOX2 and FOXD1 genes, which are both involved in hair development. Finally, suitable statistical analyses revealed that none of the associated variants showed clear signals of selection in any of the populations tested. Contrary to popular speculation, we found no evidence that eyebrow thickness is subject to strong selective pressure.},
}
@article {pmid30248089,
year = {2018},
author = {Chabas, H and Lion, S and Nicot, A and Meaden, S and van Houte, S and Moineau, S and Wahl, LM and Westra, ER and Gandon, S},
title = {Evolutionary emergence of infectious diseases in heterogeneous host populations.},
journal = {PLoS biology},
volume = {16},
number = {9},
pages = {e2006738},
pmid = {30248089},
issn = {1545-7885},
abstract = {The emergence and re-emergence of pathogens remains a major public health concern. Unfortunately, when and where pathogens will (re-)emerge is notoriously difficult to predict, as the erratic nature of those events is reinforced by the stochastic nature of pathogen evolution during the early phase of an epidemic. For instance, mutations allowing pathogens to escape host resistance may boost pathogen spread and promote emergence. Yet, the ecological factors that govern such evolutionary emergence remain elusive because of the lack of ecological realism of current theoretical frameworks and the difficulty of experimentally testing their predictions. Here, we develop a theoretical model to explore the effects of the heterogeneity of the host population on the probability of pathogen emergence, with or without pathogen evolution. We show that evolutionary emergence and the spread of escape mutations in the pathogen population is more likely to occur when the host population contains an intermediate proportion of resistant hosts. We also show that the probability of pathogen emergence rapidly declines with the diversity of resistance in the host population. Experimental tests using lytic bacteriophages infecting their bacterial hosts containing Clustered Regularly Interspaced Short Palindromic Repeat and CRISPR-associated (CRISPR-Cas) immune defenses confirm these theoretical predictions. These results suggest effective strategies for cross-species spillover and for the management of emerging infectious diseases.},
}
@article {pmid30245733,
year = {2018},
author = {Hsu, DS and Kornepati, AV and Glover, W and Kennedy, EM and Cullen, BR},
title = {Targeting HPV16 DNA using CRISPR/Cas inhibits anal cancer growth in vivo.},
journal = {Future virology},
volume = {13},
number = {7},
pages = {475-482},
pmid = {30245733},
issn = {1746-0794},
support = {R21 CA198050/CA/NCI NIH HHS/United States ; },
abstract = {Aim: The goal of this study was to determine if a single AAV vector, encoding Cas9 and guide RNAs specific for the HPV16 E6 and E7 genes, could inhibit the growth of an HPV16-induced tumor in vivo.<br><br>Materials &amp; methods: We grew HPV16+, patient-derived anal cancer explants in immunodeficient mice and then challenged these by injection of AAV-based vectors encoding Cas9 and control or HPV16-specific guide RNAs.<br><br>Results &amp; conclusion: We observed a significant and selective reduction in tumor growth when the HPV16 E6 and E7 genes were targeted using Cas9. These studies provide proof of principle for the hypothesis that CRISPR/Cas has the potential to be used to selectively treat HPV-induced tumors in humans.},
}
@article {pmid30244670,
year = {2018},
author = {Koonin, EV},
title = {Open questions: CRISPR biology.},
journal = {BMC biology},
volume = {16},
number = {1},
pages = {95},
pmid = {30244670},
issn = {1741-7007},
abstract = {CRISPR-Cas systems, the purveyors of adaptive immunity in archaea and bacteria and sources of the new generation of genome engineering tools, have been studied in exquisite molecular detail. However, when it comes to biological functions, ecology, and evolution of CRISPR-Cas, many more intriguing questions remain than there are answers.},
}
@article {pmid30244429,
year = {2018},
author = {Yang, Z and Chen, S and Xue, S and Li, X and Sun, Z and Yang, Y and Hu, X and Geng, T and Cui, H},
title = {Generation of Cas9 transgenic zebrafish and their application in establishing an ERV-deficient animal model.},
journal = {Biotechnology letters},
volume = {40},
number = {11-12},
pages = {1507-1518},
pmid = {30244429},
issn = {1573-6776},
support = {91540117//the National Natural Science Foundation of China/ ; 81773013//the National Natural Science Foundation of China/ ; 2016YFC1303604//the National Key Research and Development Program in China/ ; },
mesh = {Animals ; Animals, Genetically Modified/*genetics ; CRISPR-Cas Systems/*genetics ; Endogenous Retroviruses/*genetics ; Female ; Gene Editing/*methods ; Gene Knockout Techniques ; Male ; Promoter Regions, Genetic/genetics ; Zebrafish/*genetics ; },
abstract = {OBJECTIVES: To investigate the effect of endogenous Cas9 on genome editing efficiency in transgenic zebrafish.<br><br>RESULTS: Here we have constructed a transgenic zebrafish strain that can be screened by pigment deficiency. Compared with the traditional CRISPR injection method, the transgenic zebrafish can improve the efficiency of genome editing significantly. At the same time, we first observed that the phenotype of vertebral malformation in early embryonic development of zebrafish after ZFERV knockout.<br><br>CONCLUSIONS: The transgenic zebrafish with expressed Cas9, is more efficient in genome editing. And the results of ZFERV knockout indicated that ERV may affect the vertebral development by Notch1/Delta D signal pathway.},
}
@article {pmid30244086,
year = {2018},
author = {Kim, MS and Shin, MJ and Kim, KH},
title = {Increase of viral hemorrhagic septicemia virus growth by knockout of IRF9 gene in Epithelioma papulosum cyprini cells.},
journal = {Fish &amp; shellfish immunology},
volume = {83},
number = {},
pages = {443-448},
doi = {10.1016/j.fsi.2018.09.025},
pmid = {30244086},
issn = {1095-9947},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Line ; Fishes ; Gene Editing ; Gene Knockout Techniques ; Interferon Type I/immunology ; Interferon-Stimulated Gene Factor 3, gamma Subunit/*genetics ; Novirhabdovirus/*physiology ; Poly I-C/pharmacology ; Virus Replication ; },
abstract = {Viral hemorrhagic septicemia virus (VHSV) has been a notorious pathogen in freshwater and marine fish. Due to the lack of effective treatment measures against VHSV disease, the development of prophylactic vaccines has been required, and methods that can produce high-titered viruses would be advantageous in producing cost-effective vaccines. Type I interferon (IFN) responses are the key elements of vertebrates' antiviral activities, and IFN-stimulated gene factor 3 (ISGF3) complex formed through type I IFNs up-regulates the expression of IFN-stimulated genes (ISGs). IFN regulatory factor 9 (IRF9) is a key component of ISGF3, so the inhibition of IRF9 would compromise host's type I IFN responses, which would weaken host antiviral activity. In this study, to increase the replication of VHSV, we generated IRF9 knockout Epithelioma papulosum cyprini (EPC) cells using a CRISPR/Cas9 vector that contains an EPC cell's U6 promoter-driven guide RNA cassette (targeting IRF9 gene) and a Cas9 expressing cassette. In the clones of IRF9 knockout EPC cells, there were no increase in ISG15 gene by poly I:C, and in Mx1 gene by both poly I:C and VHSV. Interestingly, although the increased folds were conspicuously lower than control EPC cells, the expression of ISG 15 gene in all the IRF9 knockout clones was significantly increased by VHSV infection. Control EPC cells pre-treated with poly I:C did not show any CPE when infected with VHSV, however, IRF9 knockout EPC cells showed CPE by VHSV infection in spite of being pretreated with poly I:C. The replication of VHSV in IRF9 knockout EPC cells was significantly faster and higher than that in control EPC cells indicating that the IRF9 knockout-mediated decrease of type I IFN responses allowed VHSV to replicate efficiently. Considering an economical aspect for the production of fish vaccines, the present IRF9 knockout EPC cells can be used to get higher-titered VHSV.},
}
@article {pmid30243490,
year = {2018},
author = {Lu, R and Yuan, T and Wang, Y and Zhang, T and Yuan, Y and Wu, D and Zhou, M and He, Z and Lu, Y and Chen, Y and Fan, J and Liang, J and Cheng, Y},
title = {Spontaneous severe hypercholesterolemia and atherosclerosis lesions in rabbits with deficiency of low-density lipoprotein receptor (LDLR) on exon 7.},
journal = {EBioMedicine},
volume = {36},
number = {},
pages = {29-38},
pmid = {30243490},
issn = {2352-3964},
mesh = {Animals ; Animals, Genetically Modified ; Atherosclerosis/*genetics/metabolism/*pathology ; Biomarkers ; CRISPR-Cas Systems ; Coronary Artery Disease/genetics/metabolism/pathology ; Disease Models, Animal ; *Exons ; Female ; Gene Targeting ; Genotype ; Hypercholesterolemia/diagnosis/*genetics/metabolism ; Inflammation Mediators/blood ; Leukocyte Count ; Lipids/blood ; Male ; Plaque, Atherosclerotic/pathology ; Rabbits ; Receptors, LDL/*deficiency ; Sequence Deletion ; },
abstract = {Rabbits (Oryctolagus cuniculus) have been the very frequently used as animal models in the study of human lipid metabolism and atherosclerosis, because they have similar lipoprotein metabolism to humans. Most of hyperlipidemia and atherosclerosis rabbit models are produced by feeding rabbits a high-cholesterol diet. Gene editing or knockout (KO) offered another means of producing rabbit models for study of the metabolism of lipids and lipoproteins. Even so, apolipoprotein (Apo)E KO rabbits must be fed a high-cholesterol diet to induce hyperlipidemia. In this study, we used the CRISPR/Cas9 system anchored exon 7 of low-density lipoprotein receptor (LDLR) in an attempt to generate KO rabbits. We designed two sgRNA sequences located in E7:g.7055-7074 and E7:g.7102-7124 of rabbit LDLR gene, respectively. Seven LDLR-KO founder rabbits were generated, and all of them contained biallelic modifications. Various mutational LDLR amino acid sequences of the 7 founder rabbits were subjected to tertiary structure modeling with SWISS-MODEL, and results showed that the structure of EGF-A domain of each protein differs from the wild-type. All the founder rabbits spontaneously developed hypercholesterolemia and atherosclerosis on a normal chow (NC) diet. Analysis of their plasma lipids and lipoproteins at the age of 12 weeks revealed that all these KO rabbits exhibited markedly increased levels of plasma TC (the highest of which was 1013.15 mg/dl, 20-fold higher than wild-type rabbits), LDL-C (the highest of which was 730.00 mg/dl, 35-fold higher than wild-type rabbits) and TG accompanied by reduced HDL-C levels. Pathological examinations of a founder rabbit showed prominent aortic atherosclerosis lesions and coronary artery atherosclerosis.In conclusion, we have reported the generation LDLR-KO rabbit model for the study of spontaneous hypercholesterolemia and atherosclerosis on a NC diet. The LDLR-KO rabbits should be a useful rabbit model of human familial hypercholesterolemia (FH) for the simulations of human primary hypercholesterolemia and such models would allow more exact research into cardio-cerebrovascular disease.},
}
@article {pmid30242271,
year = {2018},
author = {Guo, Y and Jardin, BD and Zhou, P and Sethi, I and Akerberg, BN and Toepfer, CN and Ai, Y and Li, Y and Ma, Q and Guatimosim, S and Hu, Y and Varuzhanyan, G and VanDusen, NJ and Zhang, D and Chan, DC and Yuan, GC and Seidman, CE and Seidman, JG and Pu, WT},
title = {Hierarchical and stage-specific regulation of murine cardiomyocyte maturation by serum response factor.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3837},
pmid = {30242271},
issn = {2041-1723},
support = {U01 HL131003/HL/NHLBI NIH HHS/United States ; 2UM1 HL098166//U.S. Department of Health &amp; Human Services | NIH | National Heart, Lung, and Blood Institute (NHLBI)/International ; 17IRG33410894//American Heart Association (American Heart Association, Inc.)/International ; },
mesh = {Animals ; Animals, Newborn ; CRISPR-Cas Systems ; Chromatin/metabolism ; Female ; Gene Expression Regulation ; Male ; Mice ; Mice, Knockout ; Mutagenesis ; Myocytes, Cardiac/*physiology ; Serum Response Factor/*metabolism ; Transcriptome ; },
abstract = {After birth, cardiomyocytes (CM) acquire numerous adaptations in order to efficiently pump blood throughout an animal's lifespan. How this maturation process is regulated and coordinated is poorly understood. Here, we perform a CRISPR/Cas9 screen in mice and identify serum response factor (SRF) as a key regulator of CM maturation. Mosaic SRF depletion in neonatal CMs disrupts many aspects of their maturation, including sarcomere expansion, mitochondrial biogenesis, transverse-tubule formation, and cellular hypertrophy. Maintenance of maturity in adult CMs is less dependent on SRF. This stage-specific activity is associated with developmentally regulated SRF chromatin occupancy and transcriptional regulation. SRF directly activates genes that regulate sarcomere assembly and mitochondrial dynamics. Perturbation of sarcomere assembly but not mitochondrial dynamics recapitulates SRF knockout phenotypes. SRF overexpression also perturbs CM maturation. Together, these data indicate that carefully balanced SRF activity is essential to promote CM maturation through a hierarchy of cellular processes orchestrated by sarcomere assembly.},
}
@article {pmid30241607,
year = {2018},
author = {Zhang, C and Konermann, S and Brideau, NJ and Lotfy, P and Wu, X and Novick, SJ and Strutzenberg, T and Griffin, PR and Hsu, PD and Lyumkis, D},
title = {Structural Basis for the RNA-Guided Ribonuclease Activity of CRISPR-Cas13d.},
journal = {Cell},
volume = {175},
number = {1},
pages = {212-223.e17},
pmid = {30241607},
issn = {1097-4172},
support = {DP5 OD021369/OD/NIH HHS/United States ; DP5 OD021396/OD/NIH HHS/United States ; U54 GM103368/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas endonucleases directed against foreign nucleic acids mediate prokaryotic adaptive immunity and have been tailored for broad genetic engineering applications. Type VI-D CRISPR systems contain the smallest known family of single effector Cas enzymes, and their signature Cas13d ribonuclease employs guide RNAs to cleave matching target RNAs. To understand the molecular basis for Cas13d function and explain its compact molecular architecture, we resolved cryoelectron microscopy structures of Cas13d-guide RNA binary complex and Cas13d-guide-target RNA ternary complex to 3.4 and 3.3 Å resolution, respectively. Furthermore, a 6.5 Å reconstruction of apo Cas13d combined with hydrogen-deuterium exchange revealed conformational dynamics that have implications for RNA scanning. These structures, together with biochemical and cellular characterization, provide insights into its RNA-guided, RNA-targeting mechanism and delineate a blueprint for the rational design of improved transcriptome engineering technologies.},
}
@article {pmid30241032,
year = {2018},
author = {Han, YQ and Ming, SL and Wu, HT and Zeng, L and Ba, G and Li, J and Lu, WF and Han, J and Du, QJ and Sun, MM and Yang, GY and Wang, J and Chu, BB},
title = {Myostatin knockout induces apoptosis in human cervical cancer cells via elevated reactive oxygen species generation.},
journal = {Redox biology},
volume = {19},
number = {},
pages = {412-428},
pmid = {30241032},
issn = {2213-2317},
mesh = {A549 Cells ; Animals ; Antioxidants/pharmacology ; Apoptosis/*genetics ; CRISPR-Cas Systems/genetics ; Cachexia/*pathology ; Caspases/metabolism ; Cell Line, Tumor ; Cell Proliferation/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Cytochromes c/metabolism ; Epoxy Compounds/pharmacology ; Fatty Acids/metabolism ; Female ; Gene Knockout Techniques ; HEK293 Cells ; HeLa Cells ; Humans ; Lipid Metabolism/physiology ; Membrane Potential, Mitochondrial/genetics ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Mitochondria/genetics/metabolism ; Myostatin/*genetics ; Oxidation-Reduction ; Reactive Oxygen Species/*metabolism ; Uterine Cervical Neoplasms/genetics/*pathology ; Xenograft Model Antitumor Assays ; },
abstract = {Myostatin (Mstn) is postulated to be a key determinant of muscle loss and cachexia in cancer. However, no experimental evidence supports a role for Mstn in cancer, particularly in regulating the survival and growth of cancer cells. In this study, we showed that the expression of Mstn was significantly increased in different tumor tissues and human cancer cells. Mstn knockdown inhibited the proliferation of cancer cells. A knockout (KO) of Mstn created by clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) 9 (CRISPR/Cas9) induced mitochondria-dependent apoptosis in HeLa cells. Furthermore, KO of Mstn reduced the lipid content. Molecular analyses demonstrated that the expression levels of fatty acid oxidation-related genes were upregulated and then increased rate of fatty acid oxidation. Mstn deficiency-induced apoptosis took place along with generation of reactive oxygen species (ROS) and elevated fatty acid oxidation, which may play a role in triggering mitochondrial membrane depolarization, the release of cytochrome c (Cyt-c), and caspase activation. Importantly, apoptosis induced by Mstn KO was partially rescued by antioxidants and etomoxir, thereby suggesting that the increased level of ROS was functionally involved in mediating apoptosis. Overall, our findings demonstrate a novel function of Mstn in regulating mitochondrial metabolism and apoptosis within cancer cells. Hence, inhibiting the production and function of Mstn may be an effective therapeutic intervention during cancer progression and muscle loss in cachexia.},
}
@article {pmid30239876,
year = {2018},
author = {Han, W and Stella, S and Zhang, Y and Guo, T and Sulek, K and Peng-Lundgren, L and Montoya, G and She, Q},
title = {A Type III-B Cmr effector complex catalyzes the synthesis of cyclic oligoadenylate second messengers by cooperative substrate binding.},
journal = {Nucleic acids research},
volume = {46},
number = {19},
pages = {10319-10330},
pmid = {30239876},
issn = {1362-4962},
abstract = {Recently, Type III-A CRISPR-Cas systems were found to catalyze the synthesis of cyclic oligoadenylates (cOAs), a second messenger that specifically activates Csm6, a Cas accessory RNase and confers antiviral defense in bacteria. To test if III-B CRISPR-Cas systems could mediate a similar CRISPR signaling pathway, the Sulfolobus islandicus Cmr-α ribonucleoprotein complex (Cmr-α-RNP) was purified from the native host and tested for cOA synthesis. We found that the system showed a robust production of cyclic tetra-adenylate (c-A4), and that c-A4 functions as a second messenger to activate the III-B-associated RNase Csx1 by binding to its CRISPR-associated Rossmann Fold domain. Investigation of the kinetics of cOA synthesis revealed that Cmr-α-RNP displayed positively cooperative binding to the adenosine triphosphate (ATP) substrate. Furthermore, mutagenesis of conserved domains in Cmr2α confirmed that, while Palm 2 hosts the active site of cOA synthesis, Palm 1 domain serves as the primary site in the enzyme-substrate interaction. Together, our data suggest that the two Palm domains cooperatively interact with ATP molecules to achieve a robust cOA synthesis by the III-B CRISPR-Cas system.},
}
@article {pmid30239713,
year = {2018},
author = {Haverkamp, THA and Geslin, C and Lossouarn, J and Podosokorskaya, OA and Kublanov, I and Nesbø, CL},
title = {Thermosipho spp. Immune System Differences Affect Variation in Genome Size and Geographical Distributions.},
journal = {Genome biology and evolution},
volume = {10},
number = {11},
pages = {2853-2866},
pmid = {30239713},
issn = {1759-6653},
mesh = {Bacteria/*genetics/immunology ; Gene Transfer, Horizontal ; *Genome, Bacterial ; Hydrothermal Vents/*microbiology ; Oil and Gas Fields/*microbiology ; *Phylogeny ; RNA, Ribosomal, 16S/genetics ; },
abstract = {Thermosipho species inhabit thermal environments such as marine hydrothermal vents, petroleum reservoirs, and terrestrial hot springs. A 16S rRNA phylogeny of available Thermosipho spp. sequences suggested habitat specialists adapted to living in hydrothermal vents only, and habitat generalists inhabiting oil reservoirs, hydrothermal vents, and hotsprings. Comparative genomics of 15 Thermosipho genomes separated them into three distinct species with different habitat distributions: The widely distributed T. africanus and the more specialized, T. melanesiensis and T. affectus. Moreover, the species can be differentiated on the basis of genome size (GS), genome content, and immune system composition. For instance, the T. africanus genomes are largest and contained the most carbohydrate metabolism genes, which could explain why these isolates were obtained from ecologically more divergent habitats. Nonetheless, all the Thermosipho genomes, like other Thermotogae genomes, show evidence of genome streamlining. GS differences between the species could further be correlated to differences in defense capacities against foreign DNA, which influence recombination via HGT. The smallest genomes are found in T. affectus that contain both CRISPR-cas Type I and III systems, but no RM system genes. We suggest that this has caused these genomes to be almost devoid of mobile elements, contrasting the two other species genomes that contain a higher abundance of mobile elements combined with different immune system configurations. Taken together, the comparative genomic analyses of Thermosipho spp. revealed genetic variation allowing habitat differentiation within the genus as well as differentiation with respect to invading mobile DNA.},
}
@article {pmid30238143,
year = {2018},
author = {Shi, TQ and Huang, H and Kerkhoven, EJ and Ji, XJ},
title = {Advancing metabolic engineering of Yarrowia lipolytica using the CRISPR/Cas system.},
journal = {Applied microbiology and biotechnology},
volume = {102},
number = {22},
pages = {9541-9548},
pmid = {30238143},
issn = {1432-0614},
support = {21776131//National Natural Science Foundation of China/ ; 21476111//National Natural Science Foundation of China/ ; XTD1814//the Jiangsu Synergetic Innovation Center for Advanced Bio-Manufacture/ ; },
mesh = {Bacterial Proteins/genetics/metabolism ; CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Metabolic Engineering/*methods/trends ; Yarrowia/*genetics/*metabolism ; },
abstract = {The oleaginous yeast Yarrowia lipolytica is widely used for the production of both bulk and fine chemicals, including organic acids, fatty acid-derived biofuels and chemicals, polyunsaturated fatty acids, single-cell proteins, terpenoids, and other valuable products. Consequently, it is becoming increasingly popular for metabolic engineering applications. Multiple gene manipulation tools including URA blast, Cre/LoxP, and transcription activator-like effector nucleases (TALENs) have been developed for metabolic engineering in Y. lipolytica. However, the low efficiency and time-consuming procedures involved in these methods hamper further research. The emergence of the CRISPR/Cas system offers a potential solution for these problems due to its high efficiency, ease of operation, and time savings, which can significantly accelerate the genomic engineering of Y. lipolytica. In this review, we summarize the research progress on the development of CRISPR/Cas systems for Y. lipolytica, including Cas9 proteins and sgRNA expression strategies, as well as gene knock-out/knock-in and repression/activation applications. Finally, the most promising and tantalizing future prospects in this area are highlighted.},
}
@article {pmid30232659,
year = {2018},
author = {Li, Z and Zhao, J and Muhammad, N and Wang, D and Mao, Q and Xia, H},
title = {Establishment of a HEK293 cell line by CRISPR/Cas9-mediated luciferase knock-in to study transcriptional regulation of the human SREBP1 gene.},
journal = {Biotechnology letters},
volume = {40},
number = {11-12},
pages = {1495-1506},
doi = {10.1007/s10529-018-2608-2},
pmid = {30232659},
issn = {1573-6776},
support = {No. 81471772//National Natural Science Foundation of China/ ; No. 81773265//National Natural Science Foundation of China/ ; No. 2016CSY015//the Fundamental Research Funds for the Central Universities, Shaanxi Normal University/ ; No.2018SF-106//Key Research and Development Plan of Shaanxi Province/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing ; Gene Expression Regulation/*genetics ; Gene Knock-In Techniques/*methods ; HEK293 Cells ; Humans ; Luciferases/*genetics ; Sterol Regulatory Element Binding Protein 1/*genetics/metabolism ; },
abstract = {OBJECTIVES: To establish a HEK293 cell line with a luciferase knock-in reporter controlled by the endogenous SREBP1 promoter for investigating transcriptional regulation of the SREBP1 gene.<br><br>RESULTS: PCR confirmed the site-specific integration of a single copy of the exogenous luciferase gene into one allele of the genome and a 14 bp deletion of the targeted sequence in the other. Luciferase activity was directly correlated with the promoter activity of the endogenous SREBP1 gene in the HEK293-SREBP1-T2A-luciferase-KI cell line cell line.<br><br>CONCLUSIONS: We successfully generated a novel luciferase knock-in reporter system, which will be very useful for studying transcriptional regulation of the SREBP1 gene and for screening drugs or chemical molecules that regulate SREBP1 gene expression.},
}
@article {pmid30232196,
year = {2018},
author = {Nachmanson, D and Lian, S and Schmidt, EK and Hipp, MJ and Baker, KT and Zhang, Y and Tretiakova, M and Loubet-Senear, K and Kohrn, BF and Salk, JJ and Kennedy, SR and Risques, RA},
title = {Targeted genome fragmentation with CRISPR/Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS).},
journal = {Genome research},
volume = {28},
number = {10},
pages = {1589-1599},
pmid = {30232196},
issn = {1549-5469},
support = {R01 CA160674/CA/NCI NIH HHS/United States ; R01 CA181308/CA/NCI NIH HHS/United States ; R44 CA221426/CA/NCI NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; DNA/genetics ; DNA Fragmentation ; Female ; High-Throughput Nucleotide Sequencing ; Humans ; Ovarian Neoplasms/*genetics ; Sequence Analysis, DNA/*methods ; Tumor Suppressor Protein p53/*genetics ; },
abstract = {Next-generation sequencing methods suffer from low recovery, uneven coverage, and false mutations. DNA fragmentation by sonication is a major contributor to these problems because it produces randomly sized fragments, PCR amplification bias, and end artifacts. In addition, oligonucleotide-based hybridization capture, a common target enrichment method, has limited efficiency for small genomic regions, contributing to low recovery. This becomes a critical problem in clinical applications, which value cost-effective approaches focused on the sequencing of small gene panels. To address these issues, we developed a targeted genome fragmentation approach based on CRISPR/Cas9 digestion that produces DNA fragments of similar length. These fragments can be enriched by a simple size selection, resulting in targeted enrichment of up to approximately 49,000-fold. Additionally, homogenous length fragments significantly reduce PCR amplification bias and maximize read usability. We combined this novel target enrichment approach with Duplex Sequencing, which uses double-strand molecular tagging to correct for sequencing errors. The approach, termed CRISPR-DS, enables efficient target enrichment of small genomic regions, even coverage, ultra-accurate sequencing, and reduced DNA input. As proof of principle, we applied CRISPR-DS to the sequencing of the exonic regions of TP53 and performed side-by-side comparisons with standard Duplex Sequencing. CRISPR-DS detected previously reported pathogenic TP53 mutations present as low as 0.1% in peritoneal fluid of women with ovarian cancer, while using 10- to 100-fold less DNA than standard Duplex Sequencing. Whether used as standalone enrichment or coupled with high-accuracy sequencing methods, CRISPR-based fragmentation offers a simple solution for fast and efficient small target enrichment.},
}
@article {pmid30231914,
year = {2018},
author = {Ibraheim, R and Song, CQ and Mir, A and Amrani, N and Xue, W and Sontheimer, EJ},
title = {All-in-one adeno-associated virus delivery and genome editing by Neisseria meningitidis Cas9 in vivo.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {137},
pmid = {30231914},
issn = {1474-760X},
support = {129056-RSG-16-093//American Cancer Society/International ; HL137167/HL/NHLBI NIH HHS/United States ; DP2 HL137167/HL/NHLBI NIH HHS/United States ; P01 HL131471/HL/NHLBI NIH HHS/United States ; GM1115911/GM/NIGMS NIH HHS/United States ; R01 GM115911/GM/NIGMS NIH HHS/United States ; HL131471/HL/NHLBI NIH HHS/United States ; },
mesh = {4-Hydroxyphenylpyruvate Dioxygenase/genetics ; Animals ; CRISPR-Associated Protein 9/*genetics/metabolism ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Dependovirus/*genetics ; *Gene Editing ; Genetic Vectors/administration &amp; dosage ; Mice ; Mice, Inbred C57BL ; Neisseria meningitidis/enzymology ; Oxidoreductases/genetics ; Plasmids/administration &amp; dosage ; Proprotein Convertase 9/genetics ; Tyrosinemias/therapy ; },
abstract = {BACKGROUND: Clustered, regularly interspaced, short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas) have recently opened a new avenue for gene therapy. Cas9 nuclease guided by a single-guide RNA (sgRNA) has been extensively used for genome editing. Currently, three Cas9 orthologs have been adapted for in vivo genome engineering applications: Streptococcus pyogenes Cas9 (SpyCas9), Staphylococcus aureus Cas9 (SauCas9), and Campylobacter jejuni (CjeCas9). However, additional in vivo editing platforms are needed, in part to enable a greater range of sequences to be accessed via viral vectors, especially those in which Cas9 and sgRNA are combined into a single vector genome.<br><br>RESULTS: Here, we present in vivo editing using Neisseria meningitidis Cas9 (NmeCas9). NmeCas9 is compact, edits with high accuracy, and possesses a distinct protospacer adjacent motif (PAM), making it an excellent candidate for safe gene therapy applications. We find that NmeCas9 can be used to target the Pcsk9 and Hpd genes in mice. Using tail-vein hydrodynamic-based delivery of NmeCas9 plasmid to target the Hpd gene, we successfully reprogram the tyrosine degradation pathway in Hereditary Tyrosinemia Type I mice. More importantly, we deliver NmeCas9 with its sgRNA in a single recombinant adeno-associated vector (rAAV) to target Pcsk9, resulting in lower cholesterol levels in mice. This all-in-one vector yielded > 35% gene modification after two weeks of vector administration, with minimal off-target cleavage in vivo.<br><br>CONCLUSIONS: Our findings indicate that NmeCas9 can enable the editing of disease-causing loci in vivo, expanding the targeting scope of RNA-guided nucleases.},
}
@article {pmid30231020,
year = {2018},
author = {Magee, CL and Kleyn, PW and Monks, BM and Betz, U and Basnet, S},
title = {Pre-existing technological core and roots for the CRISPR breakthrough.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0198541},
pmid = {30231020},
issn = {1932-6203},
mesh = {Animals ; Bacteria/enzymology/genetics/metabolism ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Endonucleases/genetics/metabolism ; Gene Editing/*methods ; Genome ; Humans ; *Patents as Topic ; },
abstract = {This paper applies objective methods to explore the technological origins of the widely acclaimed CRISPR breakthrough in the technological domain of genome engineering. Previously developed patent search techniques are first used to recover a set of patents that well-represent the genome editing domain before CRISPR. Main paths are then determined from the citation network associated with this patent set allowing identification of the three major knowledge trajectories. The most significant of these trajectories for CRISPR involves the core of genome editing with less significant trajectories involving cloning and endonuclease specific developments. The major patents on the core trajectory are consistent with qualitative expert knowledge of the topical area. A second set of patents that we call the CRISPR roots are obtained by finding the patents directly cited by the recent CRISPR patents along with patents cited by that set of patents. We find that the CRISPR roots contain 8 key patents from the genome engineering main path associated with restriction endonucleases and the expected strong connection of CRISPR to prior genome editing technology such as Zn finger nucleases. Nonetheless, analysis of the full CRISPR roots shows that a very wide array of technological knowledge beyond genome engineering has contributed to achieving the CRISPR breakthrough. Such breadth in origins is not surprising since &quot;spillover&quot; is generally perceived as important and previous qualitative studies of CRISPR have shown not only technological breadth in origins but scientific breadth as well. In addition, we find that the estimated rate of functional performance improvement of the CRISPR roots set is about 9% per year compared to the genome engineering set (~4% per year). These estimates indicate below average rates of improvement and may indicate that CRISPR (and perhaps yet undiscovered) genome engineering developments could evolve in effectiveness over an upcoming long rather than short time period.},
}
@article {pmid30228869,
year = {2018},
author = {Reimer, KA and Neugebauer, KM},
title = {Blood Relatives: Splicing Mechanisms underlying Erythropoiesis in Health and Disease.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
pmid = {30228869},
issn = {2046-1402},
abstract = {During erythropoiesis, hematopoietic stem and progenitor cells transition to erythroblasts en route to terminal differentiation into enucleated red blood cells. Transcriptome-wide changes underlie distinct morphological and functional characteristics at each cell division during this process. Many studies of gene expression have historically been carried out in erythroblasts, and the biogenesis of β-globin mRNA-the most highly expressed transcript in erythroblasts-was the focus of many seminal studies on the mechanisms of pre-mRNA splicing. We now understand that pre-mRNA splicing plays an important role in shaping the transcriptome of developing erythroblasts. Recent advances have provided insight into the role of alternative splicing and intron retention as important regulatory mechanisms of erythropoiesis. However, dysregulation of splicing during erythropoiesis is also a cause of several hematological diseases, including β-thalassemia and myelodysplastic syndromes. With a growing understanding of the role that splicing plays in these diseases, we are well poised to develop gene-editing treatments. In this review, we focus on changes in the developing erythroblast transcriptome caused by alternative splicing, the molecular basis of splicing-related blood diseases, and therapeutic advances in disease treatment using CRISPR/Cas9 gene editing.},
}
@article {pmid30226608,
year = {2018},
author = {Takao, A and Yoshikawa, K and Karnan, S and Ota, A and Uemura, H and De Velasco, MA and Kura, Y and Suzuki, S and Ueda, R and Nishino, T and Hosokawa, Y},
title = {Generation of PTEN‑knockout (‑/‑) murine prostate cancer cells using the CRISPR/Cas9 system and comprehensive gene expression profiling.},
journal = {Oncology reports},
volume = {40},
number = {5},
pages = {2455-2466},
doi = {10.3892/or.2018.6683},
pmid = {30226608},
issn = {1791-2431},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; *Genetic Therapy ; Humans ; Immunity, Cellular/immunology ; Male ; Mice ; MicroRNAs/genetics ; Microarray Analysis ; PTEN Phosphohydrolase/*genetics ; Prostate/immunology/pathology ; Prostatic Neoplasms/*genetics/immunology/pathology ; Proto-Oncogene Proteins c-akt/genetics ; },
abstract = {Phosphatase and tensin homolog (PTEN) deficiency is associated with development, progression, and metastasis of various cancers. However, changes in gene expression associated with PTEN deficiency have not been fully characterized. To explore genes with altered expression in PTEN‑deficient cells, the present study generated a PTEN‑knockout cell line (ΔPTEN) from a mouse prostate cancer‑derived cell line using the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR‑associated protein 9 (CRISPR/Cas9) gene editing system. Following transfection of the CRISPR/Cas9 construct, DNA sequencing was performed to identify deletion of the Pten locus and PTEN inactivation was verified by western blotting. The ΔPTEN cell line exhibited enhanced RAC‑alpha serine/threonine‑protein kinase phosphorylation and cyclin D1 expression. In addition, an increase in cell proliferation and colony formation was observed in the ΔPTEN cell line. Gene expression profiling experiments were analyzed with microarray and microRNA (miRNA) arrays. In the microarray analysis, 111 genes exhibited ≥10‑fold increased expression compared with the parent strain and mock cell line and 23 genes were downregulated. The only miRNA with increased expression of 10‑fold or more was mmu‑miR‑210‑3p. Genes with enhanced expression included genes involved in the development, progression, and metastasis of cancer such as Tet methylcytosine dioxygenase 1, twist family BHLH transcription factor 2, C‑fos‑induced growth factor and Wingless‑Type MMTV Integration Site Family, Member 3, and genes involved in immunosuppression such as Arginase 1. The results of the present study suggest that PTEN deficiency mobilizes a variety of genes critical for cancer cell survival and host immune evasion.},
}
@article {pmid30226584,
year = {2018},
author = {Liu, Q and Fan, D and Adah, D and Wu, Z and Liu, R and Yan, QT and Zhang, Y and Du, ZY and Wang, D and Li, Y and Bao, SY and Liu, LP},
title = {CRISPR/Cas9‑mediated hypoxia inducible factor‑1α knockout enhances the antitumor effect of transarterial embolization in hepatocellular carcinoma.},
journal = {Oncology reports},
volume = {40},
number = {5},
pages = {2547-2557},
pmid = {30226584},
issn = {1791-2431},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Carcinoma, Hepatocellular/*genetics/pathology/surgery ; Cell Line, Tumor ; *Chemoembolization, Therapeutic ; Gene Knockout Techniques ; Hepatic Artery/surgery ; Humans ; Hypoxia-Inducible Factor 1, alpha Subunit/*genetics ; Liver/pathology/surgery ; Liver Neoplasms/*genetics/pathology/surgery ; Mice ; Tumor Hypoxia/genetics ; Xenograft Model Antitumor Assays ; },
abstract = {Transarterial embolization (TAE) is a palliative option commonly used for the treatment of advanced, unresectable hepatocellular carcinoma (HCC). However, patient prognosis in regards to overall survival has not improved with this method, mainly due to hypoxia‑inducible factor‑1α (HIF‑1α)‑induced angiogenesis and invasiveness. Thus, it is hypothesized that HIF‑1α may be an ideal knockout target for the treatment of HCC in combination with TAE. Thus, in the present study, HIF‑1α knockout was conducted in human liver cancer SMMC‑7721 cells and a xenograft HCC model was established using a lentivirus‑mediated CRISPR/Cas system (LV‑Cas) with small guide RNA‑721 (LV‑H721). Furthermore, hepatic artery ligation (HAL) was used to mimic human transarterial chemoembolization in mice. The results revealed that HIF‑1α was highly expressed in both HCC patient tissues and SMMC‑7721‑induced tumor tissues. The HIF‑1α knockout in SMMC‑7721 cells significantly suppressed cell invasiveness and migration, and induced cell apoptosis under CoCl2‑mimicking hypoxic conditions. Compared with the control groups, HAL + LV‑H721 inhibited SMMC‑7721 tumor growth in orthotopic HCC and markedly prolonged the survival of HCC‑bearing mice, which was accompanied by a lower CD31 expression (tumor angiogenesis) and increased apoptosis in the tumor cells. These findings demonstrated a valuable antitumor synergism in combining CRISPR/Cas9‑mediated HIF‑1α knockout with TAE in mice and highlighted the possibility that HIF‑1α may be an effective therapeutic knockout target in combination with TAE for HCC treatment.},
}
@article {pmid30224454,
year = {2018},
author = {Oberhofer, G and Ivy, T and Hay, BA},
title = {Behavior of homing endonuclease gene drives targeting genes required for viability or female fertility with multiplexed guide RNAs.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {40},
pages = {E9343-E9352},
pmid = {30224454},
issn = {1091-6490},
support = {T32 GM007616/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Drosophila melanogaster ; Female ; Fertility/genetics ; *Gene Targeting ; },
abstract = {A gene drive method of particular interest for population suppression utilizes homing endonuclease genes (HEGs), wherein a site-specific, nuclease-encoding cassette is copied, in the germline, into a target gene whose loss of function results in loss of viability or fertility in homozygous, but not heterozygous, progeny. Earlier work in Drosophila and mosquitoes utilized HEGs consisting of Cas9 and a single guide RNA (gRNA) that together target a specific gene for cleavage. Homing was observed, but resistant alleles immune to cleavage, while retaining wild-type gene function, were also created through nonhomologous end joining. Such alleles prevent drive and population suppression. Targeting a gene for cleavage at multiple positions has been suggested as a strategy to prevent the appearance of resistant alleles. To test this hypothesis, we generated two suppression HEGs in Drosophila melanogaster targeting genes required for embryonic viability or fertility, using a HEG consisting of CRISPR/Cas9 and gRNAs designed to cleave each gene at four positions. Rates of target locus cleavage were very high, and multiplexing of gRNAs prevented resistant allele formation. However, germline homing rates were modest, and the HEG cassette was unstable during homing events, resulting in frequent partial copying of HEGs that lacked gRNAs, a dominant marker gene, or Cas9. Finally, in drive experiments, the HEGs failed to spread due to the high fitness load induced in offspring as a result of maternal carryover of Cas9/gRNA complex activity. Alternative design principles are proposed that may mitigate these problems in future gene drive engineering.},
}
@article {pmid30224156,
year = {2018},
author = {Marzec, M and Hensel, G},
title = {Targeted Base Editing Systems Are Available for Plants.},
journal = {Trends in plant science},
volume = {23},
number = {11},
pages = {955-957},
doi = {10.1016/j.tplants.2018.08.011},
pmid = {30224156},
issn = {1878-4372},
abstract = {Use of RNA-guided endonucleases for targeted genome editing is one of the most important breakthrough discoveries of the 21st century. Recent studies have described modifications of this precise base editing technique that open up a new dimension to plant genome editing.},
}
@article {pmid30222779,
year = {2018},
author = {Shi, CH and Rubel, C and Soss, SE and Sanchez-Hodge, R and Zhang, S and Madrigal, SC and Ravi, S and McDonough, H and Page, RC and Chazin, WJ and Patterson, C and Mao, CY and Willis, MS and Luo, HY and Li, YS and Stevens, DA and Tang, MB and Du, P and Wang, YH and Hu, ZW and Xu, YM and Schisler, JC},
title = {Disrupted structure and aberrant function of CHIP mediates the loss of motor and cognitive function in preclinical models of SCAR16.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007664},
pmid = {30222779},
issn = {1553-7404},
support = {R25 GM089569/GM/NIGMS NIH HHS/United States ; R37 HL065619/HL/NHLBI NIH HHS/United States ; },
mesh = {Animals ; Behavior, Animal ; CRISPR-Cas Systems/genetics ; *Cognition ; Disease Models, Animal ; Female ; Humans ; Male ; Mice ; Mice, Inbred C57BL ; Models, Molecular ; Motor Activity/*genetics ; Mutagenesis, Site-Directed ; Phenotype ; Point Mutation ; Protein Domains/*genetics ; Protein Multimerization/genetics ; Rats ; Rats, Sprague-Dawley ; Spinocerebellar Ataxias/congenital/*genetics ; Ubiquitin-Protein Ligases/*genetics/metabolism ; },
abstract = {CHIP (carboxyl terminus of heat shock 70-interacting protein) has long been recognized as an active member of the cellular protein quality control system given the ability of CHIP to function as both a co-chaperone and ubiquitin ligase. We discovered a genetic disease, now known as spinocerebellar autosomal recessive 16 (SCAR16), resulting from a coding mutation that caused a loss of CHIP ubiquitin ligase function. The initial mutation describing SCAR16 was a missense mutation in the ubiquitin ligase domain of CHIP (p.T246M). Using multiple biophysical and cellular approaches, we demonstrated that T246M mutation results in structural disorganization and misfolding of the CHIP U-box domain, promoting oligomerization, and increased proteasome-dependent turnover. CHIP-T246M has no ligase activity, but maintains interactions with chaperones and chaperone-related functions. To establish preclinical models of SCAR16, we engineered T246M at the endogenous locus in both mice and rats. Animals homozygous for T246M had both cognitive and motor cerebellar dysfunction distinct from those observed in the CHIP null animal model, as well as deficits in learning and memory, reflective of the cognitive deficits reported in SCAR16 patients. We conclude that the T246M mutation is not equivalent to the total loss of CHIP, supporting the concept that disease-causing CHIP mutations have different biophysical and functional repercussions on CHIP function that may directly correlate to the spectrum of clinical phenotypes observed in SCAR16 patients. Our findings both further expand our basic understanding of CHIP biology and provide meaningful mechanistic insight underlying the molecular drivers of SCAR16 disease pathology, which may be used to inform the development of novel therapeutics for this devastating disease.},
}
@article {pmid30222773,
year = {2018},
author = {Kurata, M and Wolf, NK and Lahr, WS and Weg, MT and Kluesner, MG and Lee, S and Hui, K and Shiraiwa, M and Webber, BR and Moriarity, BS},
title = {Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0198714},
pmid = {30222773},
issn = {1932-6203},
mesh = {CRISPR-Associated Protein 9/genetics ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Editing/*methods ; HEK293 Cells ; Humans ; Microarray Analysis ; Plasmids/genetics ; Promoter Regions, Genetic ; RNA, Guide/*genetics ; },
abstract = {The CRISPR/Cas9 system is an RNA guided nuclease system that evolved as a mechanism of adaptive immunity in bacteria. This system has been adopted for numerous genome engineering applications in research and recently, therapeutics. The CRISPR/Cas9 system has been largely implemented by delivery of Cas9 as protein, RNA, or plasmid along with a chimeric crRNA-tracrRNA guide RNA (gRNA) under the expression of a pol III promoter, such as U6. Using this approach, multiplex genome engineering has been achieved by delivering several U6-gRNA plasmids targeting multiple loci. However, this approach is limited due to the efficiently of delivering multiple plasmids to a single cell at one time. To augment the capability and accessibility of multiplexed genome engineering, we developed an efficient golden gate based method to assemble gRNAs linked by optimal Csy4 ribonuclease sequences to deliver up to 10 gRNAs as a single gRNA array transcript. Here we report the optimal expression of our guide RNA array under a strong pol II promoter. This system can be implemented alongside the myriad of CRISPR applications, allowing users to model complex biological processes requiring numerous gRNAs.},
}
@article {pmid30222730,
year = {2018},
author = {Dorn, A and Röhrig, S and Papp, K and Schröpfer, S and Hartung, F and Knoll, A and Puchta, H},
title = {The topoisomerase 3α zinc-finger domain T1 of Arabidopsis thaliana is required for targeting the enzyme activity to Holliday junction-like DNA repair intermediates.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007674},
pmid = {30222730},
issn = {1553-7404},
mesh = {Arabidopsis/*physiology ; Arabidopsis Proteins/genetics/*metabolism ; CRISPR-Cas Systems/genetics ; Catalytic Domain/genetics ; DNA Repair/*physiology ; DNA Topoisomerases, Type I/genetics/*metabolism ; DNA, Cruciform/genetics ; Endonucleases/genetics/*metabolism ; Escherichia coli Proteins/genetics/metabolism ; Gene Knockout Techniques ; Holliday Junction Resolvases/genetics/metabolism ; Mutagenesis ; Phenotype ; Plant Roots/growth &amp; development ; Plants, Genetically Modified ; Zinc Fingers/*genetics ; },
abstract = {Topoisomerase 3α, a class I topoisomerase, consists of a TOPRIM domain, an active centre and a variable number of zinc-finger domains (ZFDs) at the C-terminus, in multicellular organisms. Whereas the functions of the TOPRIM domain and the active centre are known, the specific role of the ZFDs is still obscure. In contrast to mammals where a knockout of TOP3α leads to lethality, we found that CRISPR/Cas induced mutants in Arabidopsis are viable but show growth retardation and meiotic defects, which can be reversed by the expression of the complete protein. However, complementation with AtTOP3α missing either the TOPRIM-domain or carrying a mutation of the catalytic tyrosine of the active centre leads to embryo lethality. Surprisingly, this phenotype can be overcome by the simultaneous removal of the ZFDs from the protein. In combination with a mutation of the nuclease AtMUS81, the TOP3α knockout proved to be also embryo lethal. Here, expression of TOP3α without ZFDs, and in particular without the conserved ZFD T1, leads to only a partly complementation in root growth-in contrast to the complete protein, that restores root length to mus81-1 mutant level. Expressing the E. coli resolvase RusA in this background, which is able to process Holliday junction (HJ)-like recombination intermediates, we could rescue this root growth defect. Considering all these results, we conclude that the ZFD T1 is specifically required for targeting the topoisomerase activity to HJ like recombination intermediates to enable their processing. In the case of an inactivated enzyme, this leads to cell death due to the masking of these intermediates, hindering their resolution by MUS81.},
}
@article {pmid30222157,
year = {2018},
author = {Sorlien, EL and Witucki, MA and Ogas, J},
title = {Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {138},
pages = {},
pmid = {30222157},
issn = {1940-087X},
support = {P30 CA023168/CA/NCI NIH HHS/United States ; R21 CA182197/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Knockout Techniques/*methods ; Zebrafish/*genetics ; },
abstract = {Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.},
}
@article {pmid30220031,
year = {2018},
author = {Kim, MS and Kim, KH},
title = {CRISPR/Cas9-mediated knockout of HIF-1α gene in epithelioma papulosum cyprini (EPC) cells inhibited apoptosis and viral hemorrhagic septicemia virus (VHSV) growth.},
journal = {Archives of virology},
volume = {163},
number = {12},
pages = {3395-3402},
doi = {10.1007/s00705-018-4018-0},
pmid = {30220031},
issn = {1432-8798},
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems ; Cell Line ; Cyprinidae/virology ; Fish Diseases/*genetics/metabolism/physiopathology/virology ; Gene Knockout Techniques ; Hemorrhagic Septicemia, Viral/*genetics/metabolism/physiopathology/virology ; Hypoxia-Inducible Factor 1, alpha Subunit/*genetics/metabolism ; Novirhabdovirus/genetics/*growth &amp; development/physiology ; },
abstract = {Hypoxia-inducible factor-1 (HIF-1) is a heterodimer of HIF-1α and HIF-1β, and its key role in the regulation of cellular responses to hypoxia has been well-demonstrated. The participation of HIF-1α in apoptosis has been reported in mammals, however, a little information is available on the role of HIF-1α in the progression of apoptosis in fish. In this study, to know the role of HIF-1α in the apoptosis of fish cells, we produced HIF-1α knockout Epithelioma papulosum cyprini (EPC) cells using a CRISPR/Cas9 vector, and a single cell clone showing a heterozygous insertion/deletion (indel) mutation (one nucleotide insertion and one nucleotide deletion in HIF-1α gene) was chosen for further experiments. To confirm the knockout of HIF-1α, cells were transfected with a hypoxia reporting vector containing hypoxic response elements (HREs). EPC cells transfected with the reporting plasmids showed significantly increased luminescence by exposure to cobalt chloride, a prolyl hydroxylases inhibitor. On the other hand, HIF-1α knockout EPC cells showed a non-responsiveness to a cobalt chloride exposure, suggesting that functional HIF-1α protein was not produced in the HIF-1α knockout EPC cells. Apoptosis progression induced by camptothecin and viral hemorrhagic septicemia virus (VHSV) infection was severely inhibited by HIF-1α knockout, and the replication of VHSV was significantly retarded in HIF-1α knockout EPC cells. These results suggest that HIF-1α in EPC cells acts as a pro-apoptotic factor in the progression of apoptosis triggered by a DNA damaging agent and rhabdoviral infection.},
}
@article {pmid30219987,
year = {2018},
author = {Hu, L and Zhang, H and Yang, Q and Meng, Q and Han, S and Nwafor, CC and Khan, MHU and Fan, C and Zhou, Y},
title = {Promoter variations in a homeobox gene, BnA10.LMI1, determine lobed leaves in rapeseed (Brassica napus L.).},
journal = {TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik},
volume = {131},
number = {12},
pages = {2699-2708},
pmid = {30219987},
issn = {1432-2242},
support = {2015CB150202//National Key Basic Research Program of China/ ; 2662015PY172//Fundamental Research Funds for the Central Universities/ ; },
mesh = {Alleles ; Amino Acid Sequence ; Brassica napus/anatomy &amp; histology/*genetics ; CRISPR-Cas Systems ; Chromosome Mapping ; *Genes, Homeobox ; *Genes, Plant ; Genetic Linkage ; Plant Leaves/*anatomy &amp; histology ; Plant Proteins/genetics ; Plants, Genetically Modified/genetics ; *Promoter Regions, Genetic ; Transcription Factors/genetics ; },
abstract = {KEY MESSAGE: BnA10.LMI1 positively regulates the development of leaf lobes in Brassica napus, and cis-regulatory divergences cause the different allele effects. Leaf shape is an important agronomic trait, and large variations in this trait exist within the Brassica germplasm. The lobed leaf is a unique morphological characteristic for Brassica improvement. Nevertheless, the molecular basis of leaf lobing in Brassica is poorly understood. Here, we show that an incompletely dominant locus, BnLLA10, is responsible for the lobed-leaf shape in rapeseed. A LATE MERISTEM IDENTITY1 (LMI1)-like gene (BnA10.LMI1) encoding an HD-Zip I transcription factor is the causal gene underlying the BnLLA10 locus. Sequence analysis of parental alleles revealed no sequence variations in the coding sequences, whereas abundant variations were identified in the regulatory region. Consistent with this finding, the expression levels of BnLMI1 were substantially elevated in the lobed-leaf parent compared with its near-isogenic line. The knockout mutations of BnA10.LMI1 gene were induced using the CRISPR/Cas9 system in both HY (the lobed-leaf parent) and J9707 (serrated leaf) genetic backgrounds. BnA10.LMI1 null mutations in the HY background were sufficient to produce unlobed leaves, whereas null mutations in the J9707 background showed no obvious changes in leaf shape compared with the control. Collectively, our results indicate that BnA10.LMI1 positively regulates the development of leaf lobes in B. napus, with cis-regulatory divergences causing the different allelic effects, providing new insights into the molecular mechanism of leaf lobe formation in Brassica crops.},
}
@article {pmid30217040,
year = {2018},
author = {Pan, Q and Wang, J and Gao, Y and Cui, H and Liu, C and Qi, X and Zhang, Y and Wang, Y and Wang, X},
title = {The Natural Large Genomic Deletion Is Unrelated to the Increased Virulence of the Novel Genotype Fowl Adenovirus 4 Recently Emerged in China.},
journal = {Viruses},
volume = {10},
number = {9},
pages = {},
pmid = {30217040},
issn = {1999-4915},
mesh = {Adenoviridae/classification/*genetics ; Adenoviridae Infections/*veterinary ; Animals ; CRISPR-Cas Systems ; Chickens ; China/epidemiology ; Ducks ; Gene Editing ; *Genome, Viral ; Genotype ; Phylogeny ; Poultry Diseases/diagnosis/epidemiology/*virology ; *Sequence Deletion ; Virulence/genetics ; },
abstract = {Since 2015, severe hydropericardium-hepatitis syndrome (HHS), caused by a highly pathogenic fowl adenovirus 4 (FAdV-4), emerged in China. In our previous study, the FAdV-4 has been identified as a novel genotype with a unique 1966-bp nucleotide deletion (1966Del) between open reading frame 42 and 43. In this study, the natural 1966Del was frequently identified among 17 clinical isolates and other reported Chinese clinical strains. To investigate the relationship between 1966Del and the increased virulence of the novel FAdV-4, a CRISPR/Cas9 operating platform for FAdV-4 was developed for the first time in this study. Based on this platform, a Re1966 strain was rescued, inserted the relative 1966Del sequence of a nonpathogenic strain KR5. In the pathogenicity study, the Re1966 strain retained high virulence for specific-pathogen-free chickens, similar to the parental wild-type HLJFAd15, although the survival time of chickens infected with Re1966 was much longer. Therefore, the natural 1966Del was identified as a non-essential site for the increased virulence of the emerged novel FAdV-4. Although further research on the virulence-determining region or point within the genome of the novel FAdV-4 is needed, the CRISPR/Cas9 operating platform for the novel FAdV-4 was developed and successfully applied to edit the genomic DNA for the first time, and it provides a novel powerful tool for both basic virology studies and vaccine vector development of FAdVs.},
}
@article {pmid30213958,
year = {2018},
author = {Lager, AM and Corradin, OG and Cregg, JM and Elitt, MS and Shick, HE and Clayton, BLL and Allan, KC and Olsen, HE and Madhavan, M and Tesar, PJ},
title = {Rapid functional genetics of the oligodendrocyte lineage using pluripotent stem cells.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3708},
pmid = {30213958},
issn = {2041-1723},
support = {F31 NS083354/NS/NINDS NIH HHS/United States ; S10 OD016164/OD/NIH HHS/United States ; P30 CA043703/CA/NCI NIH HHS/United States ; R01 NS093357/NS/NINDS NIH HHS/United States ; R01 NS095280/NS/NINDS NIH HHS/United States ; },
mesh = {Alleles ; Animals ; CRISPR-Cas Systems ; Cell Differentiation/genetics ; *Cell Lineage ; DNA Mutational Analysis ; Genetic Association Studies ; Genetic Engineering ; Genotype ; Induced Pluripotent Stem Cells ; Lentivirus ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Neurons/metabolism ; Oligodendroglia/*cytology ; Pluripotent Stem Cells/*cytology ; },
abstract = {Oligodendrocyte dysfunction underlies many neurological disorders, but rapid assessment of mutation-specific effects in these cells has been impractical. To enable functional genetics in oligodendrocytes, here we report a highly efficient method for generating oligodendrocytes and their progenitors from mouse embryonic and induced pluripotent stem cells, independent of mouse strain or mutational status. We demonstrate that this approach, when combined with genome engineering, provides a powerful platform for the expeditious study of genotype-phenotype relationships in oligodendrocytes.},
}
@article {pmid30213538,
year = {2018},
author = {Suzuki, M and Hayashi, T and Inoue, T and Agata, K and Hirayama, M and Suzuki, M and Shigenobu, S and Takeuchi, T and Yamamoto, T and Suzuki, KT},
title = {Cas9 ribonucleoprotein complex allows direct and rapid analysis of coding and noncoding regions of target genes in Pleurodeles waltl development and regeneration.},
journal = {Developmental biology},
volume = {443},
number = {2},
pages = {127-136},
doi = {10.1016/j.ydbio.2018.09.008},
pmid = {30213538},
issn = {1095-564X},
mesh = {Animals ; Animals, Genetically Modified ; Breeding/methods ; CRISPR-Associated Protein 9/*genetics/metabolism ; CRISPR-Cas Systems ; Developmental Biology/methods ; Gene Knockout Techniques ; Phenotype ; Pleurodeles/*genetics/metabolism ; Regeneration/*genetics ; Ribonucleoproteins/genetics/metabolism ; Sequence Analysis, DNA/methods ; },
abstract = {Newts have remarkable ability to regenerate their organs and have been used in research for centuries. However, the laborious work of breeding has hampered reverse genetics strategies in newt. Here, we present simple and efficient gene knockout using Cas9 ribonucleoprotein complex (RNP) in Pleurodeles waltl, a species suitable for regenerative biology studies using reverse genetics. Most of the founders exhibited severe phenotypes against each target gene (tyrosinase, pax6, tbx5); notably, all tyrosinase Cas9 RNP-injected embryos showed complete albinism. Moreover, amplicon sequencing analysis of Cas9 RNP-injected embryos revealed virtually complete biallelic disruption at target loci in founders, allowing direct phenotype analysis in the F0 generation. In addition, we demonstrated the generation of tyrosinase null F1 offspring within a year. Finally, we expanded this approach to the analysis of noncoding regulatory elements by targeting limb-specific enhancer of sonic hedgehog, known as the zone of polarizing activity regulatory sequence (ZRS; also called MFCS1). Disruption of ZRS led to digit deformation in limb regeneration. From these results, we are confident that this highly efficient gene knockout method will accelerate gene functional analysis in the post-genome era of salamanders.},
}
@article {pmid30213032,
year = {2018},
author = {Ho, BX and Loh, SJH and Chan, WK and Soh, BS},
title = {In Vivo Genome Editing as a Therapeutic Approach.},
journal = {International journal of molecular sciences},
volume = {19},
number = {9},
pages = {},
pmid = {30213032},
issn = {1422-0067},
mesh = {CRISPR-Cas Systems/genetics/physiology ; Gene Editing/*methods ; Hemophilia A/genetics/metabolism ; Humans ; Mucopolysaccharidosis II/genetics/metabolism ; Mutation/genetics ; Transcription Activator-Like Effector Nucleases/*genetics ; Zinc Finger Nucleases/genetics/metabolism ; },
abstract = {Genome editing has been well established as a genome engineering tool that enables researchers to establish causal linkages between genetic mutation and biological phenotypes, providing further understanding of the genetic manifestation of many debilitating diseases. More recently, the paradigm of genome editing technologies has evolved to include the correction of mutations that cause diseases via the use of nucleases such as zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and more recently, Cas9 nuclease. With the aim of reversing disease phenotypes, which arise from somatic gene mutations, current research focuses on the clinical translatability of correcting human genetic diseases in vivo, to provide long-term therapeutic benefits and potentially circumvent the limitations of in vivo cell replacement therapy. In this review, in addition to providing an overview of the various genome editing techniques available, we have also summarized several in vivo genome engineering strategies that have successfully demonstrated disease correction via in vivo genome editing. The various benefits and challenges faced in applying in vivo genome editing in humans will also be discussed.},
}
@article {pmid30212742,
year = {2018},
author = {Du, J and Yin, N and Xie, T and Zheng, Y and Xia, N and Shang, J and Chen, F and Zhang, H and Yu, J and Liu, F},
title = {Quantitative assessment of HR and NHEJ activities via CRISPR/Cas9-induced oligodeoxynucleotide-mediated DSB repair.},
journal = {DNA repair},
volume = {70},
number = {},
pages = {67-71},
doi = {10.1016/j.dnarep.2018.09.002},
pmid = {30212742},
issn = {1568-7856},
mesh = {Base Sequence ; CRISPR-Cas Systems/*genetics ; Cell Line ; DNA Breaks, Double-Stranded ; DNA End-Joining Repair/*genetics ; Homologous Recombination/*genetics ; Humans ; Oligodeoxyribonucleotides/*metabolism ; },
abstract = {Homologous recombination (HR) and non-homologous end joining (NHEJ) are the two major mechanisms for the repair of DNA double-strand breaks (DSBs) in eukaryotic cells. Previously, we designed an assay for detecting NHEJ activity by using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system, however, this approach cannot be used to predict the activity of HR repair. Hence, we developed a novel method that is capable of quantitatively measuring both HR and NHEJ activities via CRISPR/Cas9-induced oligodeoxynucleotide (ODN)-mediated DSB repair. In the present experimental procedures, the CRISPR/Cas9 plasmid was cotransfected with single-stranded ODN (ssODN) or blunt-ended double-stranded ODN (dsODN), both of which harbored a unique marker sequence. After the induction of site-specific DSBs by CRISPR/Cas9 system, the ssODN, functioned as the donor template for HR repair, could insert the marker sequence into the DSB sites, while the dsODN was embedded in the DSB sites through NHEJ pathway. Next, by means of PCR analysis using a specific primer for the marker sequence and the primers that flank the DSB sites, the relative amount of integrated marker sequence in the genomic DNA could be quantitatively determined. The correlation between the marker sequence abundance and the HR and NHEJ activities was confirmed by using the selective HR and NHEJ inhibitors. This accessible and rapid quantitative assay for HR and NHEJ activities might be useful for the future research of the DSB repair mechanisms.},
}
@article {pmid30210230,
year = {2018},
author = {Zelinka, CP and Sotolongo-Lopez, M and Fadool, JM},
title = {Targeted disruption of the endogenous zebrafish rhodopsin locus as models of rapid rod photoreceptor degeneration.},
journal = {Molecular vision},
volume = {24},
number = {},
pages = {587-602},
pmid = {30210230},
issn = {1090-0535},
support = {R21 EY025410/EY/NEI NIH HHS/United States ; },
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Codon, Terminator/genetics ; *Disease Models, Animal ; Frameshift Mutation/genetics ; Gene Targeting ; Immunoblotting ; Polymorphism, Restriction Fragment Length ; RNA, Messenger/genetics ; Retinal Degeneration/*genetics/pathology ; Retinal Rod Photoreceptor Cells/*pathology ; Rhodopsin/*genetics ; Zebrafish/*genetics ; Zebrafish Proteins/*genetics ; },
abstract = {Purpose: Retinitis pigmentosa (RP) is a collection of genetic disorders that results in the degeneration of light-sensitive photoreceptor cells, leading to blindness. RP is associated with more than 70 loci that may display dominant or recessive modes of inheritance, but mutations in the gene encoding the visual pigment rhodopsin (RHO) are the most frequent cause. In an effort to develop precise mutations in zebrafish as novel models of photoreceptor degeneration, we describe the generation and germline transmission of a series of novel clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-induced insertion and deletion (indel) mutations in the major zebrafish rho locus, rh1-1.<br><br>Methods: One- or two-cell staged zebrafish embryos were microinjected with in vitro transcribed mRNA encoding Cas9 and a single guide RNA (gRNA). Mutations were detected by restriction fragment length polymorphism (RFLP) and DNA sequence analyses in injected embryos and offspring. Immunolabeling with rod- and cone-specific antibodies was used to test for histological and cellular changes.<br><br>Results: Using gRNAs that targeted highly conserved regions of rh1-1, a series of dominant and recessive alleles were recovered that resulted in the rapid degeneration of rod photoreceptors. No effect on cones was observed. Targeting the 5'-coding sequence of rh1-1 led to the recovery of several indels similar to disease-associated alleles. A frame shift mutation leading to a premature stop codon (T17*) resulted in rod degeneration when brought to homozygosity. Immunoblot and fluorescence labeling with a Rho-specific antibody suggest that this is indeed a null allele, illustrating that the Rho expression is essential for rod survival. Two in-frame mutations were recovered that disrupted the highly conserved N-linked glycosylation consensus sequence at N15. Larvae heterozygous for either of the alleles demonstrated rapid rod degeneration. Targeting of the 3'-coding region of rh1-1 resulted in the recovery of an allele encoding a premature stop codon (S347*) upstream of the conserved VSPA sorting sequence and a second in-frame allele that disrupted the putative phosphorylation site at S339. Both alleles resulted in rod death in a dominant inheritance pattern. Following the loss of the targeting sequence, immunolabeling for Rho was no longer restricted to the rod outer segment, but it was also localized to the plasma membrane.<br><br>Conclusions: The efficiency of CRISPR/Cas9 for gene targeting, coupled with the large number of mutations associated with RP, provided a backdrop for the rapid isolation of novel alleles in zebrafish that phenocopy disease. These novel lines will provide much needed in-vivo models for high throughput screens of compounds or genes that protect from photoreceptor degeneration.},
}
@article {pmid30209390,
year = {2018},
author = {Akcakaya, P and Bobbin, ML and Guo, JA and Malagon-Lopez, J and Clement, K and Garcia, SP and Fellows, MD and Porritt, MJ and Firth, MA and Carreras, A and Baccega, T and Seeliger, F and Bjursell, M and Tsai, SQ and Nguyen, NT and Nitsch, R and Mayr, LM and Pinello, L and Bohlooly-Y, M and Aryee, MJ and Maresca, M and Joung, JK},
title = {In vivo CRISPR editing with no detectable genome-wide off-target mutations.},
journal = {Nature},
volume = {561},
number = {7723},
pages = {416-419},
pmid = {30209390},
issn = {1476-4687},
support = {P30 DK043351/DK/NIDDK NIH HHS/United States ; R00 HG008399/HG/NHGRI NIH HHS/United States ; R35 GM118158/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Associated Proteins/genetics/*metabolism ; CRISPR-Cas Systems/*genetics ; Female ; Gene Editing/*methods/*standards ; Genome/*genetics ; Humans ; INDEL Mutation ; Male ; Mice ; Mice, Inbred C57BL ; *Mutation ; Proprotein Convertase 9/genetics ; Substrate Specificity/*genetics ; Transgenes/genetics ; },
abstract = {CRISPR-Cas genome-editing nucleases hold substantial promise for developing human therapeutic applications1-6 but identifying unwanted off-target mutations is important for clinical translation7. A well-validated method that can reliably identify off-targets in vivo has not been described to date, which means it is currently unclear whether and how frequently these mutations occur. Here we describe 'verification of in vivo off-targets' (VIVO), a highly sensitive strategy that can robustly identify the genome-wide off-target effects of CRISPR-Cas nucleases in vivo. We use VIVO and a guide RNA deliberately designed to be promiscuous to show that CRISPR-Cas nucleases can induce substantial off-target mutations in mouse livers in vivo. More importantly, we also use VIVO to show that appropriately designed guide RNAs can direct efficient in vivo editing in mouse livers with no detectable off-target mutations. VIVO provides a general strategy for defining and quantifying the off-target effects of gene-editing nucleases in whole organisms, thereby providing a blueprint to foster the development of therapeutic strategies that use in vivo gene editing.},
}
@article {pmid30209206,
year = {2018},
author = {Cubbon, A and Ivancic-Bace, I and Bolt, EL},
title = {CRISPR-Cas immunity, DNA repair and genome stability.},
journal = {Bioscience reports},
volume = {38},
number = {5},
pages = {},
pmid = {30209206},
issn = {1573-4935},
support = {BB/M020541-1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {Co-opting of CRISPR-Cas 'Interference' reactions for editing the genomes of eukaryotic and prokaryotic cells has highlighted crucial support roles for DNA repair systems that strive to maintain genome stability. As front-runners in genome editing that targets DNA, the class 2 CRISPR-Cas enzymes Cas9 and Cas12a rely on repair of DNA double-strand breaks (DDSBs) by host DNA repair enzymes, using mechanisms that vary in how well they are understood. Data are emerging about the identities of DNA repair enzymes that support genome editing in human cells. At the same time, it is becoming apparent that CRISPR-Cas systems functioning in their native environment, bacteria or archaea, also need DNA repair enzymes. In this short review, we survey how DNA repair and CRISPR-Cas systems are intertwined. We consider how understanding DNA repair and CRISPR-Cas interference reactions in nature might help improve the efficacy of genome editing procedures that utilise homologous or analogous systems in human and other cells.},
}
@article {pmid30208656,
year = {2018},
author = {Sun, Q and Lin, L and Liu, D and Wu, D and Fang, Y and Wu, J and Wang, Y},
title = {CRISPR/Cas9-Mediated Multiplex Genome Editing of the BnWRKY11 and BnWRKY70 Genes in Brassica napus L.},
journal = {International journal of molecular sciences},
volume = {19},
number = {9},
pages = {},
pmid = {30208656},
issn = {1422-0067},
support = {2016YFD0102000//National Key Research and Development Program of China/ ; 2015CB150201//National Key Basic Research Program of China/ ; 31330057//National Natural Science Foundation of China/ ; 31601330//National Natural Science Foundation of China/ ; 2015M581867//China Postdoctoral Science Foundation/ ; 2016T90514//China Postdoctoral Science Foundation/ ; },
mesh = {Ascomycota/physiology ; Brassica napus/*genetics ; *CRISPR-Cas Systems ; Disease Resistance ; *Gene Editing ; Gene Expression Regulation, Plant ; Genome, Plant ; Mutagenesis ; Mutation ; Plant Diseases/*genetics/microbiology ; Plant Proteins/*genetics ; Plants, Genetically Modified/*genetics ; Transcription Factors/*genetics ; },
abstract = {Targeted genome editing is a desirable means of basic science and crop improvement. The clustered, regularly interspaced, palindromic repeat (CRISPR)/Cas9 (CRISPR-associated 9) system is currently the simplest and most commonly used system in targeted genomic editing in plants. Single and multiplex genome editing in plants can be achieved under this system. In Arabidopsis, AtWRKY11 and AtWRKY70 genes were involved in JA- and SA-induced resistance to pathogens, in rapeseed (Brassica napus L.), BnWRKY11 and BnWRKY70 genes were found to be differently expressed after inoculated with the pathogenic fungus, Sclerotinia sclerotiorum (Lib.) de Bary. In this study, two Cas9/sgRNA constructs targeting two copies of BnWRKY11 and four copies of BnWRKY70 were designed to generate BnWRKY11 and BnWRKY70 mutants respectively. As a result, twenty-two BnWRKY11 and eight BnWRKY70 independent transformants (T₀) were obtained, with the mutation ratios of 54.5% (12/22) and 50% (4/8) in BnWRKY11 and BnWRKY70 transformants respectively. Eight and two plants with two copies of mutated BnWRKY11 and BnWRKY70 were obtained respectively. In T₁ generation of each plant examined, new mutations on target genes were detected with high efficiency. The vast majority of BnWRKY70 mutants showed editing in three copies of BnWRKY70 in examined T₁ plants. BnWRKY70 mutants exhibited enhanced resistance to Sclerotinia, while BnWRKY11 mutants showed no significant difference in Sclerotinia resistance when compared to non-transgenic plants. In addition, plants that overexpressed BnWRKY70 showed increased sensitivity when compared to non-transgenic plants. Altogether, our results demonstrated that BnWRKY70 may function as a regulating factor to negatively control the Sclerotinia resistance and CRISPR/Cas9 system could be used to generate germplasm in B. napus with high resistance against Sclerotinia.},
}
@article {pmid30208287,
year = {2018},
author = {Stanley, SY and Maxwell, KL},
title = {Phage-Encoded Anti-CRISPR Defenses.},
journal = {Annual review of genetics},
volume = {52},
number = {},
pages = {445-464},
doi = {10.1146/annurev-genet-120417-031321},
pmid = {30208287},
issn = {1545-2948},
abstract = {The battle for survival between bacteria and bacteriophages (phages) is an arms race where bacteria develop defenses to protect themselves from phages and phages evolve counterstrategies to bypass these defenses. CRISPR-Cas adaptive immune systems represent a widespread mechanism by which bacteria protect themselves from phage infection. In response to CRISPR-Cas, phages have evolved protein inhibitors known as anti-CRISPRs. Here, we describe the discovery and mechanisms of action of anti-CRISPR proteins. We discuss the potential impact of anti-CRISPRs on bacterial evolution, speculate on their evolutionary origins, and contemplate the possible next steps in the CRISPR-Cas evolutionary arms race. We also touch on the impact of anti-CRISPRs on the development of CRISPR-Cas-based biotechnological tools.},
}
@article {pmid30206235,
year = {2018},
author = {Wang, H and Guo, W and Mitra, J and Hegde, PM and Vandoorne, T and Eckelmann, BJ and Mitra, S and Tomkinson, AE and Van Den Bosch, L and Hegde, ML},
title = {Mutant FUS causes DNA ligation defects to inhibit oxidative damage repair in Amyotrophic Lateral Sclerosis.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3683},
pmid = {30206235},
issn = {2041-1723},
mesh = {Amyotrophic Lateral Sclerosis/*genetics/pathology ; CRISPR-Cas Systems/genetics ; Cell Line ; DNA/*metabolism ; DNA Damage/*genetics ; DNA Ligases/metabolism ; DNA Repair/*genetics ; Gene Knockout Techniques ; Genes, Dominant ; Humans ; Induced Pluripotent Stem Cells/metabolism ; Models, Biological ; Mutation/*genetics ; *Oxidative Stress ; Poly(ADP-ribose) Polymerases/metabolism ; RNA-Binding Protein FUS/*genetics ; Reactive Oxygen Species/metabolism ; X-ray Repair Cross Complementing Protein 1/metabolism ; },
abstract = {Genome damage and defective repair are etiologically linked to neurodegeneration. However, the specific mechanisms involved remain enigmatic. Here, we identify defects in DNA nick ligation and oxidative damage repair in a subset of amyotrophic lateral sclerosis (ALS) patients. These defects are caused by mutations in the RNA/DNA-binding protein FUS. In healthy neurons, FUS protects the genome by facilitating PARP1-dependent recruitment of XRCC1/DNA Ligase IIIα (LigIII) to oxidized genome sites and activating LigIII via direct interaction. We discover that loss of nuclear FUS caused DNA nick ligation defects in motor neurons due to reduced recruitment of XRCC1/LigIII to DNA strand breaks. Moreover, DNA ligation defects in ALS patient-derived iPSC lines carrying FUS mutations and in motor neurons generated therefrom are rescued by CRISPR/Cas9-mediated correction of mutation. Our findings uncovered a pathway of defective DNA ligation in FUS-linked ALS and suggest that LigIII-targeted therapies may prevent or slow down disease progression.},
}
@article {pmid30205462,
year = {2018},
author = {Hidalgo-Cantabrana, C and Sanozky-Dawes, R and Barrangou, R},
title = {Insights into the Human Virome Using CRISPR Spacers from Microbiomes.},
journal = {Viruses},
volume = {10},
number = {9},
pages = {},
pmid = {30205462},
issn = {1999-4915},
support = {support//North Carolina Agricultural Foundation/International ; internal support//North Carolina State University/International ; },
mesh = {*Biodiversity ; Clustered Regularly Interspaced Short Palindromic Repeats ; Humans ; Metagenomics ; *Microbiota ; Viruses/*classification/genetics/*isolation &amp; purification ; },
abstract = {Due to recent advances in next-generation sequencing over the past decade, our understanding of the human microbiome and its relationship to health and disease has increased dramatically. Yet, our insights into the human virome, and its interplay with important microbes that impact human health, is relatively limited. Prokaryotic and eukaryotic viruses are present throughout the human body, comprising a large and diverse population which influences several niches and impacts our health at various body sites. The presence of prokaryotic viruses like phages, has been documented at many different body sites, with the human gut being the richest ecological niche. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and associated proteins constitute the adaptive immune system of bacteria, which prevents attack by invasive nucleic acid. CRISPR-Cas systems function by uptake and integration of foreign genetic element sequences into the CRISPR array, which constitutes a genomic archive of iterative vaccination events. Consequently, CRISPR spacers can be investigated to reconstruct interplay between viruses and bacteria, and metagenomic sequencing data can be exploited to provide insights into host-phage interactions within a niche. Here, we show how the CRISPR spacer content of commensal and pathogenic bacteria can be used to determine the evidence of their phage exposure. This framework opens new opportunities for investigating host-virus dynamics in metagenomic data, and highlights the need to dedicate more efforts for virome sampling and sequencing.},
}
An unhandled exception occurred at $0000000000402653 :
EAccessViolation : Access violation
  $0000000000402653
  $0000000000404849