@article {pmid30648020,
year = {2019},
author = {García-Zea, JA and de la Herrán, R and Robles Rodríguez, F and Navajas-Pérez, R and Ruiz Rejón, C},
title = {Detection and variability analyses of CRISPR-like loci in the H. pylori genome.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6221},
doi = {10.7717/peerj.6221},
pmid = {30648020},
issn = {2167-8359},
abstract = {Helicobacter pylori is a human pathogenic bacterium with a high genomic plasticity. Although the functional CRISPR-Cas system has not been found in its genome, CRISPR-like loci have been recently identified. In this work, 53 genomes from different geographical areas are analyzed for the search and analysis of variability of this type of structure. We confirm the presence of a locus that was previously described in the VlpC gene in al lgenomes, and we characterize new CRISPR-like loci in other genomic locations. By studying the variability and gene location of these loci, the evolution and the possible roles of these sequences are discussed. Additionally, the usefulness of this type of sequences as a phylogenetic marker has been demonstrated, associating the different strains by geographical area.},
}
@article {pmid30647128,
year = {2019},
author = {Alimov, I and Menon, S and Cochran, N and Maher, R and Wang, Q and Alford, J and Concannon, JB and Yang, Z and Harrington, E and Llamas, L and Lindeman, A and Hoffman, G and Schuhmann, T and Russ, C and Reece-Hoyes, J and Canham, SM and Cai, X},
title = {Bile acid analogues are activators of Pyrin inflammasome.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.005103},
pmid = {30647128},
issn = {1083-351X},
abstract = {Bile acids are critical metabolites in the gastrointestinal tract which contribute to maintaining intestinal immune homeostasis through crosstalk with the gut microbiota. The conversion of bile acids by the gut microbiome is now recognized as a factor affecting both host metabolism and immune responses, but its physiological roles remain unclear. We conducted a screen for microbiome metabolites that would function as inflammasome activators and herein report the identification of 12-oxo-lithocholic acid, (BAA485), a potential microbiome-derived bile acid metabolite. We demonstrate the more potent analog 11-oxo-12S-hydroxy lithocholic acid methyl ester (BAA473) can induce secretion of interleukin-18 (IL18) through activation of the inflammasome in both myeloid and intestinal epithelial cells. Using a genome-wide clustered regularly interspaced short palindromic repeats (CRISPR) screen with compound induced pyroptosis in THP-1 cells, we identified inflammasome activation by BAA473 is Pyrin-dependent (MEFV). To our knowledge, the bile acid analogues BAA485 and BAA473 are the first small molecule activators of the Pyrin inflammasome. We surmise that Pyrin inflammasome activation through microbiota-modified bile acid metabolites such as BAA473 and BAA485 plays a role in gut microbiota regulated intestinal immune response. The discovery of these two bioactive compounds may help further unveil the importance of Pyrin in gut homeostasis and autoimmune diseases.},
}
@article {pmid30260951,
year = {2018},
author = {Hara, T and Maejima, I and Akuzawa, T and Hirai, R and Kobayashi, H and Tsukamoto, S and Tsunoda, M and Ono, A and Yamakoshi, S and Oikawa, S and Sato, K},
title = {Rer1-mediated quality control system is required for neural stem cell maintenance during cerebral cortex development.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007647},
pmid = {30260951},
issn = {1553-7404},
mesh = {Amyloid Precursor Protein Secretases/*metabolism ; Animals ; Behavior, Animal ; CRISPR-Cas Systems/genetics ; Cell Line, Tumor ; Cerebral Cortex/*growth & development/metabolism ; Chromosome Deletion ; Chromosome Disorders/genetics ; Chromosomes, Human, Pair 1/genetics ; Disease Models, Animal ; Female ; *Gene Expression Regulation, Developmental ; Humans ; Lysosomes/metabolism ; Male ; Membrane Glycoproteins/genetics/*metabolism ; Mice ; Mice, Knockout ; Neural Stem Cells ; Receptors, Cytoplasmic and Nuclear/genetics/*metabolism ; Receptors, Notch/metabolism ; },
abstract = {Rer1 is a retrieval receptor for endoplasmic reticulum (ER) retention of various ER membrane proteins and unassembled or immature components of membrane protein complexes. However, its physiological functions during mammalian development remain unclear. This study aimed to investigate the role of Rer1-mediated quality control system in mammalian development. We show that Rer1 is required for the sufficient cell surface expression and activity of γ-secretase complex, which modulates Notch signaling during mouse cerebral cortex development. When Rer1 was depleted in the mouse cerebral cortex, the number of neural stem cells decreased significantly, and malformation of the cerebral cortex was observed. Rer1 loss reduced γ-secretase activity and downregulated Notch signaling in the developing cerebral cortex. In Rer1-deficient cells, a subpopulation of γ-secretase complexes and components was transported to and degraded in lysosomes, thereby significantly reducing the amount of γ-secretase complex on the cell surface. These results suggest that Rer1 maintains Notch signaling by maintaining sufficient expression of the γ-secretase complex on the cell surface and regulating neural stem cell maintenance during cerebral cortex development.},
}
@article {pmid30248107,
year = {2018},
author = {Wu, S and Zhang, M and Yang, X and Peng, F and Zhang, J and Tan, J and Yang, Y and Wang, L and Hu, Y and Peng, Q and Li, J and Liu, Y and Guan, Y and Chen, C and Hamer, MA and Nijsten, T and Zeng, C and Adhikari, K and Gallo, C and Poletti, G and Schuler-Faccini, L and Bortolini, MC and Canizales-Quinteros, S and Rothhammer, F and Bedoya, G and González-José, R and Li, H and Krutmann, J and Liu, F and Kayser, M and Ruiz-Linares, A and Tang, K and Xu, S and Zhang, L and Jin, L and Wang, S},
title = {Genome-wide association studies and CRISPR/Cas9-mediated gene editing identify regulatory variants influencing eyebrow thickness in humans.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007640},
pmid = {30248107},
issn = {1553-7404},
support = {BB/I021213/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {CRISPR-Cas Systems/genetics ; Chromosomes, Human/genetics ; Eyebrows/*growth & development ; Forkhead Transcription Factors/genetics ; Gene Editing ; Genetic Loci/*genetics ; Genome-Wide Association Study ; Genotype ; Humans ; *Phenotype ; Polymorphism, Single Nucleotide ; SOXB1 Transcription Factors/genetics ; Selection, Genetic ; },
abstract = {Hair plays an important role in primates and is clearly subject to adaptive selection. While humans have lost most facial hair, eyebrows are a notable exception. Eyebrow thickness is heritable and widely believed to be subject to sexual selection. Nevertheless, few genomic studies have explored its genetic basis. Here, we performed a genome-wide scan for eyebrow thickness in 2961 Han Chinese. We identified two new loci of genome-wide significance, at 3q26.33 near SOX2 (rs1345417: P = 6.51×10(-10)) and at 5q13.2 near FOXD1 (rs12651896: P = 1.73×10(-8)). We further replicated our findings in the Uyghurs, a population from China characterized by East Asian-European admixture (N = 721), the CANDELA cohort from five Latin American countries (N = 2301), and the Rotterdam Study cohort of Dutch Europeans (N = 4411). A meta-analysis combining the full GWAS results from the three cohorts of full or partial Asian descent (Han Chinese, Uyghur and Latin Americans, N = 5983) highlighted a third signal of genome-wide significance at 2q12.3 (rs1866188: P = 5.81×10(-11)) near EDAR. We performed fine-mapping and prioritized four variants for further experimental verification. CRISPR/Cas9-mediated gene editing provided evidence that rs1345417 and rs12651896 affect the transcriptional activity of the nearby SOX2 and FOXD1 genes, which are both involved in hair development. Finally, suitable statistical analyses revealed that none of the associated variants showed clear signals of selection in any of the populations tested. Contrary to popular speculation, we found no evidence that eyebrow thickness is subject to strong selective pressure.},
}
@article {pmid30242271,
year = {2018},
author = {Guo, Y and Jardin, BD and Zhou, P and Sethi, I and Akerberg, BN and Toepfer, CN and Ai, Y and Li, Y and Ma, Q and Guatimosim, S and Hu, Y and Varuzhanyan, G and VanDusen, NJ and Zhang, D and Chan, DC and Yuan, GC and Seidman, CE and Seidman, JG and Pu, WT},
title = {Hierarchical and stage-specific regulation of murine cardiomyocyte maturation by serum response factor.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3837},
pmid = {30242271},
issn = {2041-1723},
support = {U01 HL131003/HL/NHLBI NIH HHS/United States ; 2UM1 HL098166//U.S. Department of Health & Human Services | NIH | National Heart, Lung, and Blood Institute (NHLBI)/International ; 17IRG33410894//American Heart Association (American Heart Association, Inc.)/International ; },
mesh = {Animals ; Animals, Newborn ; CRISPR-Cas Systems ; Chromatin/metabolism ; Female ; Gene Expression Regulation ; Male ; Mice ; Mice, Knockout ; Mutagenesis ; Myocytes, Cardiac/*physiology ; Serum Response Factor/*metabolism ; Transcriptome ; },
abstract = {After birth, cardiomyocytes (CM) acquire numerous adaptations in order to efficiently pump blood throughout an animal's lifespan. How this maturation process is regulated and coordinated is poorly understood. Here, we perform a CRISPR/Cas9 screen in mice and identify serum response factor (SRF) as a key regulator of CM maturation. Mosaic SRF depletion in neonatal CMs disrupts many aspects of their maturation, including sarcomere expansion, mitochondrial biogenesis, transverse-tubule formation, and cellular hypertrophy. Maintenance of maturity in adult CMs is less dependent on SRF. This stage-specific activity is associated with developmentally regulated SRF chromatin occupancy and transcriptional regulation. SRF directly activates genes that regulate sarcomere assembly and mitochondrial dynamics. Perturbation of sarcomere assembly but not mitochondrial dynamics recapitulates SRF knockout phenotypes. SRF overexpression also perturbs CM maturation. Together, these data indicate that carefully balanced SRF activity is essential to promote CM maturation through a hierarchy of cellular processes orchestrated by sarcomere assembly.},
}
@article {pmid30222779,
year = {2018},
author = {Shi, CH and Rubel, C and Soss, SE and Sanchez-Hodge, R and Zhang, S and Madrigal, SC and Ravi, S and McDonough, H and Page, RC and Chazin, WJ and Patterson, C and Mao, CY and Willis, MS and Luo, HY and Li, YS and Stevens, DA and Tang, MB and Du, P and Wang, YH and Hu, ZW and Xu, YM and Schisler, JC},
title = {Disrupted structure and aberrant function of CHIP mediates the loss of motor and cognitive function in preclinical models of SCAR16.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007664},
pmid = {30222779},
issn = {1553-7404},
support = {R37 HL065619/HL/NHLBI NIH HHS/United States ; },
mesh = {Animals ; Behavior, Animal ; CRISPR-Cas Systems/genetics ; *Cognition ; Disease Models, Animal ; Female ; Humans ; Male ; Mice ; Mice, Inbred C57BL ; Models, Molecular ; Motor Activity/*genetics ; Mutagenesis, Site-Directed ; Phenotype ; Point Mutation ; Protein Domains/*genetics ; Protein Multimerization/genetics ; Rats ; Rats, Sprague-Dawley ; Spinocerebellar Ataxias/congenital/*genetics ; Ubiquitin-Protein Ligases/*genetics/metabolism ; },
abstract = {CHIP (carboxyl terminus of heat shock 70-interacting protein) has long been recognized as an active member of the cellular protein quality control system given the ability of CHIP to function as both a co-chaperone and ubiquitin ligase. We discovered a genetic disease, now known as spinocerebellar autosomal recessive 16 (SCAR16), resulting from a coding mutation that caused a loss of CHIP ubiquitin ligase function. The initial mutation describing SCAR16 was a missense mutation in the ubiquitin ligase domain of CHIP (p.T246M). Using multiple biophysical and cellular approaches, we demonstrated that T246M mutation results in structural disorganization and misfolding of the CHIP U-box domain, promoting oligomerization, and increased proteasome-dependent turnover. CHIP-T246M has no ligase activity, but maintains interactions with chaperones and chaperone-related functions. To establish preclinical models of SCAR16, we engineered T246M at the endogenous locus in both mice and rats. Animals homozygous for T246M had both cognitive and motor cerebellar dysfunction distinct from those observed in the CHIP null animal model, as well as deficits in learning and memory, reflective of the cognitive deficits reported in SCAR16 patients. We conclude that the T246M mutation is not equivalent to the total loss of CHIP, supporting the concept that disease-causing CHIP mutations have different biophysical and functional repercussions on CHIP function that may directly correlate to the spectrum of clinical phenotypes observed in SCAR16 patients. Our findings both further expand our basic understanding of CHIP biology and provide meaningful mechanistic insight underlying the molecular drivers of SCAR16 disease pathology, which may be used to inform the development of novel therapeutics for this devastating disease.},
}
@article {pmid29968715,
year = {2018},
author = {Matsuda, Y and Bai, T and Phippen, CBW and Nødvig, CS and Kjærbølling, I and Vesth, TC and Andersen, MR and Mortensen, UH and Gotfredsen, CH and Abe, I and Larsen, TO},
title = {Novofumigatonin biosynthesis involves a non-heme iron-dependent endoperoxide isomerase for orthoester formation.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2587},
pmid = {29968715},
issn = {2041-1723},
support = {VKR023427//Villum Fonden (Villum Foundation)/International ; JP15H01836//Japan Society for the Promotion of Science (JSPS)/International ; JP16H06443//Japan Society for the Promotion of Science (JSPS)/International ; },
mesh = {Aspergillus/genetics/*metabolism ; Biosynthetic Pathways ; CRISPR-Cas Systems ; Catalysis ; Fungal Proteins/genetics/*metabolism ; Gene Deletion ; Iron/metabolism ; Ketoglutaric Acids/metabolism ; Peroxides/metabolism ; Prostaglandin-E Synthases/genetics/*metabolism ; Terpenes/*metabolism ; },
abstract = {Novofumigatonin (1), isolated from the fungus Aspergillus novofumigatus, is a heavily oxygenated meroterpenoid containing a unique orthoester moiety. Despite the wide distribution of orthoesters in nature and their biological importance, little is known about the biogenesis of orthoesters. Here we show the elucidation of the biosynthetic pathway of 1 and the identification of key enzymes for the orthoester formation by a series of CRISPR-Cas9-based gene-deletion experiments and in vivo and in vitro reconstitutions of the biosynthesis. The novofumigatonin pathway involves endoperoxy compounds as key precursors for the orthoester synthesis, in which the Fe(II)/α-ketoglutarate-dependent enzyme NvfI performs the endoperoxidation. NvfE, the enzyme catalyzing the orthoester synthesis, is an Fe(II)-dependent, but cosubstrate-free, endoperoxide isomerase, despite the fact that NvfE shares sequence homology with the known Fe(II)/α-ketoglutarate-dependent dioxygenases. NvfE thus belongs to a class of enzymes that gained an isomerase activity by losing the α-ketoglutarate-binding ability.},
}
@article {pmid29779931,
year = {2018},
author = {Sedlyarov, V and Eichner, R and Girardi, E and Essletzbichler, P and Goldmann, U and Nunes-Hasler, P and Srndic, I and Moskovskich, A and Heinz, LX and Kartnig, F and Bigenzahn, JW and Rebsamen, M and Kovarik, P and Demaurex, N and Superti-Furga, G},
title = {The Bicarbonate Transporter SLC4A7 Plays a Key Role in Macrophage Phagosome Acidification.},
journal = {Cell host & microbe},
volume = {23},
number = {6},
pages = {766-774.e5},
pmid = {29779931},
issn = {1934-6069},
support = {//European Research Council/International ; },
mesh = {Bicarbonates/*metabolism ; CRISPR-Cas Systems ; Cation Transport Proteins/metabolism ; Cytoplasm/metabolism ; Gene Knockout Techniques ; Homeostasis ; Humans ; Hydrogen-Ion Concentration ; Macrophages/*metabolism ; Phagocytosis ; Phagosomes/*metabolism ; Sodium-Bicarbonate Symporters/genetics/*physiology ; THP-1 Cells ; Transcriptome ; U937 Cells ; },
abstract = {Macrophages represent the first line of immune defense against pathogens, and phagosome acidification is a necessary step in pathogen clearance. Here, we identified the bicarbonate transporter SLC4A7, which is strongly induced upon macrophage differentiation, as critical for phagosome acidification. Loss of SLC4A7 reduced acidification of phagocytosed beads or bacteria and impaired the intracellular microbicidal capacity in human macrophage cell lines. The phenotype was rescued by wild-type SLC4A7, but not by SLC4A7 mutants, affecting transport capacity or cell surface localization. Loss of SLC4A7 resulted in increased cytoplasmic acidification during phagocytosis, suggesting that SLC4A7-mediated, bicarbonate-driven maintenance of cytoplasmic pH is necessary for phagosome acidification. Altogether, we identify SLC4A7 and bicarbonate-driven cytoplasmic pH homeostasis as an important element of phagocytosis and the associated microbicidal functions in macrophages.},
}
@article {pmid29685891,
year = {2018},
author = {Wu, J and Wang, P and Li, L and You, C and Wang, Y},
title = {Cytotoxic and mutagenic properties of minor-groove O2-alkylthymidine lesions in human cells.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {22},
pages = {8638-8644},
pmid = {29685891},
issn = {1083-351X},
support = {R01 ES025121/ES/NIEHS NIH HHS/United States ; },
mesh = {Alkylation ; CRISPR-Cas Systems ; DNA/*chemistry ; *DNA Damage ; *DNA Replication ; DNA-Directed DNA Polymerase/chemistry/genetics/*metabolism ; Gene Editing ; HEK293 Cells ; Humans ; Mutagenesis ; Thymidine/*chemistry ; },
abstract = {Endogenous metabolism, environmental exposure, and cancer chemotherapy can lead to alkylation of DNA. It has been well documented that, among the different DNA alkylation products, minor-groove O2-alkylthymidine (O2-alkyldT) lesions are inefficiently repaired. In the present study, we examined how seven O2-alkyldT lesions, with the alkyl group being a Me, Et, nPr, iPr, nBu, iBu, or sBu, are recognized by the DNA replication machinery in human cells. We found that the replication bypass efficiencies of these lesions decrease with increasing length of the alkyl chain, and that these lesions induce substantial frequencies of T→A and T→G mutations. Replication experiments using isogenic cells deficient in specific translesion synthesis (TLS) DNA polymerases revealed that the absence of polymerase η or polymerase ζ, but not polymerase κ or polymerase ι, significantly decreased both the bypass efficiencies and the mutation frequencies for those O2-alkyldT lesions carrying a straight-chain alkyl group. Moreover, the mutagenic properties of the O2-alkyldT lesions were influenced by the length and topology of the alkyl chain and by TLS polymerases. Together, our results provide important new knowledge about the cytotoxic and mutagenic properties of O2-alkyldT lesions, and illustrate the roles of TLS polymerases in replicative bypass of these lesions in human cells.},
}
@article {pmid29674317,
year = {2018},
author = {Takahashi, C and Miyatake, K and Kusakabe, M and Nishida, E},
title = {The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {22},
pages = {8342-8361},
pmid = {29674317},
issn = {1083-351X},
mesh = {Animals ; Breast Neoplasms/enzymology/*pathology ; CRISPR-Cas Systems ; Cell Adhesion ; Cell Membrane ; Cells, Cultured ; Embryo, Nonmammalian/cytology/*enzymology ; Epithelial Cells/*chemistry/enzymology/pathology ; Female ; Hep G2 Cells ; Humans ; Mitogen-Activated Protein Kinase 6/antagonists & inhibitors/genetics/*metabolism ; Tight Junctions ; Transcription Factor AP-2/antagonists & inhibitors/genetics/*metabolism ; Xenopus laevis/embryology/*physiology ; },
abstract = {Epithelia contribute to physical barriers that protect internal tissues from the external environment and also support organ structure. Accordingly, establishment and maintenance of epithelial architecture are essential for both embryonic development and adult physiology. Here, using gene knockout and knockdown techniques along with gene profiling, we show that extracellular signal-regulated kinase 3 (ERK3), a poorly characterized atypical mitogen-activated protein kinase (MAPK), regulates the epithelial architecture in vertebrates. We found that in Xenopus embryonic epidermal epithelia, ERK3 knockdown impairs adherens and tight-junction protein distribution, as well as tight-junction barrier function, resulting in epidermal breakdown. Moreover, in human epithelial breast cancer cells, inhibition of ERK3 expression induced thickened epithelia with aberrant adherens and tight junctions. Results from microarray analyses suggested that transcription factor AP-2α (TFAP2A), a transcriptional regulator important for epithelial gene expression, is involved in ERK3-dependent changes in gene expression. Of note, TFAP2A knockdown phenocopied ERK3 knockdown in both Xenopus embryos and human cells, and ERK3 was required for full activation of TFAP2A-dependent transcription. Our findings reveal that ERK3 regulates epithelial architecture, possibly together with TFAP2A.},
}
@article {pmid28694465,
year = {2017},
author = {Zhang, W and Wang, G and Wang, Y and Jin, Y and Zhao, L and Xiong, Q and Zhang, L and Mou, L and Li, R and Yang, H and Dai, Y},
title = {Generation of complement protein C3 deficient pigs by CRISPR/Cas9-mediated gene targeting.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {5009},
pmid = {28694465},
issn = {2045-2322},
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Complement C3/*deficiency ; Fibroblasts/cytology/metabolism ; Gene Knockout Techniques/*methods ; Genetic Engineering ; Male ; Nuclear Transfer Techniques/*veterinary ; Swine ; },
abstract = {Complement protein C3 is the pivotal component of the complement system. Previous studies have demonstrated that C3 has implications in various human diseases and exerts profound functions under certain conditions. However, the delineation of pathological and physiological roles of C3 has been hampered by the insufficiency of suitable animal models. In the present study, we applied the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (Cas) system to target the C3 gene in porcine fetal fibroblasts. Our results indicated that CRISPR/Cas9 targeting efficiency was as high as 84.7%, and the biallelic mutation efficiency reached at 45.7%. The biallelic modified colonies were used as donor for somatic cell nuclear transfer (SCNT) technology to generate C3 targeted piglets. A total of 19 C3 knockout (KO) piglets were produced and their plasma C3 protein was undetectable by western blot analysis and ELISA. The hemolytic complement activity and complement-dependent cytotoxicity assay further confirmed that C3 was disrupted in these piglets. These C3 KO pigs could be utilized as a valuable large animal model for the elucidation of the roles of C3.},
}
@article {pmid30643127,
year = {2019},
author = {Nakamura, M and Srinivasan, P and Chavez, M and Carter, MA and Dominguez, AA and La Russa, M and Lau, MB and Abbott, TR and Xu, X and Zhao, D and Gao, Y and Kipniss, NH and Smolke, CD and Bondy-Denomy, J and Qi, LS},
title = {Anti-CRISPR-mediated control of gene editing and synthetic circuits in eukaryotic cells.},
journal = {Nature communications},
volume = {10},
number = {1},
pages = {194},
doi = {10.1038/s41467-018-08158-x},
pmid = {30643127},
issn = {2041-1723},
abstract = {Repurposed CRISPR-Cas molecules provide a useful tool set for broad applications of genomic editing and regulation of gene expression in prokaryotes and eukaryotes. Recent discovery of phage-derived proteins, anti-CRISPRs, which serve to abrogate natural CRISPR anti-phage activity, potentially expands the ability to build synthetic CRISPR-mediated circuits. Here, we characterize a panel of anti-CRISPR molecules for expanded applications to counteract CRISPR-mediated gene activation and repression of reporter and endogenous genes in various cell types. We demonstrate that cells pre-engineered with anti-CRISPR molecules become resistant to gene editing, thus providing a means to generate "write-protected" cells that prevent future gene editing. We further show that anti-CRISPRs can be used to control CRISPR-based gene regulation circuits, including implementation of a pulse generator circuit in mammalian cells. Our work suggests that anti-CRISPR proteins should serve as widely applicable tools for synthetic systems regulating the behavior of eukaryotic cells.},
}
@article {pmid30199527,
year = {2018},
author = {Gay, S and Bugeon, J and Bouchareb, A and Henry, L and Delahaye, C and Legeai, F and Montfort, J and Le Cam, A and Siegel, A and Bobe, J and Thermes, V},
title = {MiR-202 controls female fecundity by regulating medaka oogenesis.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007593},
pmid = {30199527},
issn = {1553-7404},
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Female ; Fertility/*genetics ; Gene Editing ; Gene Expression Profiling ; *Gene Expression Regulation, Developmental ; Gene Knockout Techniques ; Granulosa Cells ; Male ; MicroRNAs/*physiology ; Oocytes/growth & development/metabolism ; Oogenesis/*genetics ; Oryzias/*physiology ; Ovary/cytology/growth & development/metabolism ; },
abstract = {Female gamete production relies on coordinated molecular and cellular processes that occur in the ovary throughout oogenesis. In fish, as in other vertebrates, these processes have been extensively studied both in terms of endocrine/paracrine regulation and protein expression and activity. The role of small non-coding RNAs in the regulation of animal reproduction remains however largely unknown and poorly investigated, despite a growing interest for the importance of miRNAs in a wide variety of biological processes. Here, we analyzed the role of miR-202, a miRNA predominantly expressed in male and female gonads in several vertebrate species. We studied its expression in the medaka ovary and generated a mutant line (using CRISPR/Cas9 genome editing) to determine its importance for reproductive success with special interest for egg production. Our results show that miR-202-5p is the most abundant mature form of the miRNA and that it is expressed in granulosa cells and in the unfertilized egg. The knock out (KO) of mir-202 gene resulted in a strong phenotype both in terms of number and quality of eggs produced. Mutant females exhibited either no egg production or produced a dramatically reduced number of eggs that could not be fertilized, ultimately leading to no reproductive success. We quantified the size distribution of the oocytes in the ovary of KO females and performed a large-scale transcriptomic analysis approach to identified dysregulated molecular pathways. Together, cellular and molecular analyses indicate that the lack of miR-202 impairs the early steps of oogenesis/folliculogenesis and decreases the number of large (i.e. vitellogenic) follicles, ultimately leading to dramatically reduced female fecundity. This study sheds new light on the regulatory mechanisms that control the early steps of follicular development, including possible targets of miR-202-5p, and provides the first in vivo functional evidence that a gonad-predominant microRNA may have a major role in female reproduction.},
}
@article {pmid30110323,
year = {2018},
author = {Ravi, P and Trivedi, D and Hasan, G},
title = {FMRFa receptor stimulated Ca2+ signals alter the activity of flight modulating central dopaminergic neurons in Drosophila melanogaster.},
journal = {PLoS genetics},
volume = {14},
number = {8},
pages = {e1007459},
pmid = {30110323},
issn = {1553-7404},
support = {P40 OD018537/OD/NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems ; *Calcium Signaling ; Dopaminergic Neurons/*physiology ; Drosophila Proteins/genetics/*physiology ; Drosophila melanogaster/genetics/*physiology ; Flight, Animal/*physiology ; Gene Expression Regulation ; Male ; Receptors, Invertebrate Peptide/genetics/*physiology ; },
abstract = {Neuropeptide signaling influences animal behavior by modulating neuronal activity and thus altering circuit dynamics. Insect flight is a key innate behavior that very likely requires robust neuromodulation. Cellular and molecular components that help modulate flight behavior are therefore of interest and require investigation. In a genetic RNAi screen for G-protein coupled receptors that regulate flight bout durations, we earlier identified several receptors, including the receptor for the neuropeptide FMRFa (FMRFaR). To further investigate modulation of insect flight by FMRFa we generated CRISPR-Cas9 mutants in the gene encoding the Drosophila FMRFaR. The mutants exhibit significant flight deficits with a focus in dopaminergic cells. Expression of a receptor specific RNAi in adult central dopaminergic neurons resulted in progressive loss of sustained flight. Further, genetic and cellular assays demonstrated that FMRFaR stimulates intracellular calcium signaling through the IP3R and helps maintain neuronal excitability in a subset of dopaminergic neurons for positive modulation of flight bout durations.},
}
@article {pmid30076291,
year = {2018},
author = {Yang, D and Zheng, X and Chen, S and Wang, Z and Xu, W and Tan, J and Hu, T and Hou, M and Wang, W and Gu, Z and Wang, Q and Zhang, R and Zhang, Y and Liu, Q},
title = {Sensing of cytosolic LPS through caspy2 pyrin domain mediates noncanonical inflammasome activation in zebrafish.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3052},
pmid = {30076291},
issn = {2041-1723},
mesh = {Animals ; Bacterial Infections/*immunology ; CRISPR-Cas Systems ; Caspases/*drug effects/genetics/immunology/*metabolism ; Cytosol/*metabolism ; Disease Models, Animal ; Fibroblasts/immunology ; Gastrointestinal Tract/pathology ; Gene Knockdown Techniques ; HEK293 Cells ; HeLa Cells ; Humans ; Immunity, Innate ; Inflammasomes/*metabolism ; Inflammation ; Lipopolysaccharides/*toxicity ; NLR Family, Pyrin Domain-Containing 3 Protein ; Pyrin Domain/*physiology ; Pyroptosis/immunology ; Sepsis/microbiology ; Zebrafish/*immunology/microbiology ; Zebrafish Proteins/*drug effects/genetics/*metabolism ; },
abstract = {The noncanonical inflammasome is critical for cytosolic sensing of Gram-negative pathogens. Here, we show that bacterial infection induces caspy2 activation in zebrafish fibroblasts, which mediates pyroptosis via a caspase-5-like activity. Zebrafish caspy2 binds directly to lipopolysaccharide via the N-terminal pyrin death domain, resulting in caspy2 oligomerization, which is critical for pyroptosis. Furthermore, we show that caspy2 is highly expressed in the zebrafish gut and is activated during infection. Knockdown of caspy2 expression impairs the ability of zebrafish to restrict bacterial invasion in vivo, and protects larvae from lethal sepsis. Collectively, our results identify a crucial event in the evolution of pattern recognition into the death domain superfamily-mediated intracellular lipopolysaccharide-sensing pathway in innate immunity.},
}
@article {pmid29751067,
year = {2018},
author = {Shi, X and Kitano, A and Jiang, Y and Luu, V and Hoegenauer, KA and Nakada, D},
title = {Clonal expansion and myeloid leukemia progression modeled by multiplex gene editing of murine hematopoietic progenitor cells.},
journal = {Experimental hematology},
volume = {64},
number = {},
pages = {33-44.e5},
pmid = {29751067},
issn = {1873-2399},
support = {R01 DK107413/DK/NIDDK NIH HHS/United States ; R01 CA193235/CA/NCI NIH HHS/United States ; P30 CA125123/CA/NCI NIH HHS/United States ; P30 AI036211/AI/NIAID NIH HHS/United States ; S10 RR024574/RR/NCRR NIH HHS/United States ; },
mesh = {Animals ; Bone Marrow Transplantation ; CRISPR-Associated Protein 9 ; *CRISPR-Cas Systems ; Clone Cells/*pathology ; Disease Models, Animal ; Disease Progression ; Female ; Gene Editing/*methods ; Genes, Neoplasm ; Hematopoietic Stem Cells/*pathology ; Humans ; INDEL Mutation ; Leukemia, Myeloid, Acute/genetics/*pathology ; Male ; Mice ; Mice, Inbred C57BL ; Mutation ; Neoplastic Stem Cells/*pathology ; Preleukemia/genetics/pathology ; Ribonucleoproteins/genetics ; Specific Pathogen-Free Organisms ; },
abstract = {Recent advances in next-generation sequencing have identified novel mutations and revealed complex genetic architectures in human hematological malignancies. Moving forward, new methods to quickly generate animal models that recapitulate the complex genetics of human hematological disorders are needed to transform the genetic information to new therapies. Here, we used a ribonucleoprotein-based CRISPR/Cas9 system to model human clonal hematopoiesis of indeterminate potential and acute myeloid leukemia (AML). We edited multiple genes recurrently mutated in hematological disorders, including those encoding epigenetic regulators, transcriptional regulators, and signaling components in murine hematopoietic stem/progenitor cells. Tracking the clonal dynamics by sequencing the indels induced by CRISPR/Cas9 revealed clonal expansion in some recipient mice that progressed to AML initiated by leukemia-initiating cells. Our results establish that the CRISPR/Cas9-mediated multiplex mutagenesis can be used to engineer a variety of murine models of hematological malignancies with complex genetic architectures seen in human disease.},
}
@article {pmid29468553,
year = {2018},
author = {Naert, T and Vleminckx, K},
title = {CRISPR/Cas9-Mediated Knockout of Rb1 in Xenopus tropicalis.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1726},
number = {},
pages = {177-193},
doi = {10.1007/978-1-4939-7565-5_16},
pmid = {29468553},
issn = {1940-6029},
mesh = {Animals ; *CRISPR-Cas Systems ; Gene Knockout Techniques/*methods ; *Genome ; Retinoblastoma Protein/*antagonists & inhibitors/genetics ; Xenopus/classification/*genetics ; },
abstract = {At this time, no molecular targeted therapies exist for treatment of retinoblastoma. This can be, in part, attributed to the lack of animal models that allow for both rapid identification of novel therapeutic targets and hypothesis driven drug testing. Within this scope, we have recently reported the first genuine genetic nonmammalian retinoblastoma cancer model within the aquatic model organism Xenopus tropicalis (Naert et al., Sci Rep 6: 35263, 2016). Here we describe the methods to generate rb1 mosaic mutant Xenopus tropicalis by employing the CRISPR/Cas9 technology. In depth, we discuss short guide RNA (sgRNA) design parameters, generation, quality control, quantification, and delivery followed by several methods for assessing genome editing efficiencies. As such the reader should be capable, by minor changes to the methods described here, to (co-) target rb1 or any one or multiple gene(s) within the Xenopus tropicalis genome by multiplex CRISPR/Cas9 methodology.},
}
@article {pmid29177429,
year = {2017},
author = {Rahim, K and Huo, L and Li, C and Zhang, P and Basit, A and Xiang, B and Ting, B and Hao, X and Zhu, X},
title = {Identification of a basidiomycete-specific Vilse-like GTPase activating proteins (GAPs) and its roles in the production of virulence factors in Cryptococcus neoformans.},
journal = {FEMS yeast research},
volume = {17},
number = {8},
pages = {},
doi = {10.1093/femsyr/fox089},
pmid = {29177429},
issn = {1567-1364},
mesh = {Biomarkers ; CRISPR-Cas Systems ; Cell Wall/metabolism ; Cryptococcus neoformans/classification/*physiology ; GTPase-Activating Proteins/*genetics/*metabolism ; Gene Editing ; Gene Expression Regulation, Fungal ; Humans ; Melanins/metabolism ; Mutation ; Osmotic Pressure ; Phylogeny ; Signal Transduction ; Virulence Factors ; },
abstract = {Cryptococcus neoformans is a basidiomycetous pathogenic yeast that causes fatal infections in both immunocompetent and immunocompromised patients. Regulation on the production of its virulence factors is not fully understood. Here we reported the characterization of a gene, named CVH1(CNA06260), encoding a Drosophila Vilse-like RhoGAP homolog, which is hallmarked by three conserved functional domains: WW, MyTH4 and RhoGAP. Phylogenetic analysis suggests that CVH1 is highly conserved from protists to mammals and interestingly in basidiomycetes, but absent in plants or Ascomycota and other lower fungi. This phylogenetic distribution indicates an evolutionary link among these groups of organisms. Functional analyses demonstrated that CVH1 was involved in stress tolerance and virulence factor production. By disrupting CVH1, we created a second mutant cvh1Δ with the CRISPR-Cas9 editing tool. The mutant strain exhibited hypersensitivity to osmotic stress by 2 M sorbitol and NaCl, suggesting defects in the HOG signaling pathway and an interaction of Cvh1 with the HOG pathway. Hypersensitivity of cvh1Δ to 1% Congo red and 0.01% SDS suggests that the cell wall integrity was impaired in the mutant. And cvh1Δ hardly produced the pigment melanin and capsule. Our study for the first time demonstrates that the fungal Vilse-like RhoGAP CVH1 is an important regulator of multiple biological processes in C. neoformans, and provides novel insights into the regulatory circuit of stress resistance/cell wall integrity, and laccase and capsule synthesis in C. neoformans.},
}
@article {pmid29145596,
year = {2017},
author = {Mans, R and Hassing, EJ and Wijsman, M and Giezekamp, A and Pronk, JT and Daran, JM and van Maris, AJA},
title = {A CRISPR/Cas9-based exploration into the elusive mechanism for lactate export in Saccharomyces cerevisiae.},
journal = {FEMS yeast research},
volume = {17},
number = {8},
pages = {},
doi = {10.1093/femsyr/fox085},
pmid = {29145596},
issn = {1567-1364},
mesh = {Bioreactors ; *CRISPR-Cas Systems ; Fermentation ; Gene Deletion ; Gene Editing ; Gene Knockout Techniques ; Glucose/metabolism ; Lactic Acid/*metabolism ; *Metabolic Engineering ; Metabolic Networks and Pathways ; Saccharomyces cerevisiae/*genetics/*metabolism ; Saccharomyces cerevisiae Proteins/genetics/metabolism ; },
abstract = {CRISPR/Cas9-based genome editing allows rapid, simultaneous modification of multiple genetic loci in Saccharomyces cerevisiae. Here, this technique was used in a functional analysis study aimed at identifying the hitherto unknown mechanism of lactate export in this yeast. First, an S. cerevisiae strain was constructed with deletions in 25 genes encoding transport proteins, including the complete aqua(glycero)porin family and all known carboxylic acid transporters. The 25-deletion strain was then transformed with an expression cassette for Lactobacillus casei lactate dehydrogenase (LcLDH). In anaerobic, glucose-grown batch cultures this strain exhibited a lower specific growth rate (0.15 vs. 0.25 h-1) and biomass-specific lactate production rate (0.7 vs. 2.4 mmol g biomass-1 h-1) than an LcLDH-expressing reference strain. However, a comparison of the two strains in anaerobic glucose-limited chemostat cultures (dilution rate 0.10 h-1) showed identical lactate production rates. These results indicate that, although deletion of the 25 transporter genes affected the maximum specific growth rate, it did not impact lactate export rates when analysed at a fixed specific growth rate. The 25-deletion strain provides a first step towards a 'minimal transportome' yeast platform, which can be applied for functional analysis of specific (heterologous) transport proteins as well as for evaluation of metabolic engineering strategies.},
}
@article {pmid29099923,
year = {2017},
author = {Borodina, I and Zhao, ZK},
title = {Editorial: Yeast cell factories for production of fuels and chemicals.},
journal = {FEMS yeast research},
volume = {17},
number = {8},
pages = {},
doi = {10.1093/femsyr/fox082},
pmid = {29099923},
issn = {1567-1364},
mesh = {*Biofuels ; CRISPR-Cas Systems ; Gene Editing ; Genome, Fungal ; Genomics/methods ; *Metabolic Engineering ; Saccharomyces cerevisiae/*physiology ; },
}
@article {pmid30639735,
year = {2019},
author = {Gürtler, S and Wolke, C and Otto, O and Heise, N and Scholz, F and Laporte, A and Elsner, M and Jörns, A and Weinert, S and Döring, M and Jansing, S and Gardemann, A and Lendeckel, U and Schild, L},
title = {Tafazzin-dependent cardiolipin composition in C6 glioma cells correlates with changes in mitochondrial and cellular functions, and cellular proliferation.},
journal = {Biochimica et biophysica acta. Molecular and cell biology of lipids},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.bbalip.2019.01.006},
pmid = {30639735},
issn = {1879-2618},
abstract = {The mitochondrial phospholipid cardiolipin (CL) has been implicated with mitochondrial morphology, function and, more recently, with cellular proliferation. Tafazzin, an acyltransferase with key functions in CL remodeling determining actual CL composition, affects mitochondrial oxidative phosphorylation. Here, we show that the CRISPR-Cas9 mediated knock-out of tafazzin (Taz) is associated with substantial alterations of various mitochondrial and cellular characteristics in C6 glioma cells. The knock-out of tafazzin substantially changed the profile of fatty acids incorporated in CL and the distribution of molecular CL species. Taz knock-out was further associated with decreased capacity of oxidative phosphorylation that mainly originates from impaired complex I associated energy metabolism in C6 glioma cells. The lack of tafazzin switched energy metabolism from oxidative phosphorylation to glycolysis indicated by lower respiration rates, membrane potential and higher levels of mitochondria-derived reactive oxygen species but keeping the cellular ATP content unchanged. The impact of tafazzin on mitochondria was also indicated by altered morphology and arrangement in tafazzin deficient C6 glioma cells. In the cells we observed tafazzin-dependent changes in the distribution of cellular fatty acids as an indication of altered lipid metabolism as well as in stability/morphology. Most impressive is the dramatic reduction in cell proliferation in tafazzin deficient C6 glioma cells that is not mediated by reactive oxygen species. Our data clearly indicate that defects in CL phospholipid remodeling trigger a cascade of events including modifications in CL linked to subsequent alterations in mitochondrial and cellular functions.},
}
@article {pmid30639408,
year = {2019},
author = {Takeshita, D and Sato, M and Inanaga, H and Numata, T},
title = {Crystal Structures of Csm2 and Csm3 in the Type III-A CRISPR-Cas Effector Complex.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2019.01.009},
pmid = {30639408},
issn = {1089-8638},
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR) loci and CRISPR-associated (Cas) genes encode CRISPR RNAs (crRNA) and Cas proteins, respectively, which play important roles in the adaptive immunity system (CRISPR-Cas system) in prokaryotes. The crRNA and Cas proteins form ribonucleoprotein effector complexes to capture and degrade invading genetic materials with base complementarity to the crRNA guide sequences. The Csm complex, a type III-A effector complex, comprises five Cas proteins (Csm1-Csm5) and a crRNA, which co-transcriptionally degrades invading DNA and RNA. Here we report the crystal structures of the Staphylococcus epidermidis Csm2 (SeCsm2) and Thermoplasma volcanium Csm3 (TvCsm3) at 2.4 and 2.7 Å resolutions, respectively. SeCsm2 adopts a monomeric globular fold by itself, in striking contrast to the previously reported Thermotoga maritima Csm2, which adopted an extended conformation and formed a dimeric structure. We propose that the globular monomeric form is the bona fide structure of Csm2. TvCsm3 forms a filamentous structure in the crystals. The molecular arrangement of TvCsm3 is similar to that of the stacked Cmr4 proteins in the Cmr complex, suggesting the functionally relevant architecture of the present Csm3 structure. We constructed model structures of the Csm complex, which revealed that Csm3 binds the crRNA and periodically deforms the crRNA-target duplex by a similar mechanism to that of Cmr4 in the Cmr complex. The model and mutational analysis suggest that the conserved lysine residue of Csm2 is important for target RNA binding, and Csm2 stabilizes the active structure of the Csm complex to facilitate the reaction.},
}
@article {pmid30639240,
year = {2018},
author = {Swarts, DC and Jinek, M},
title = {Mechanistic Insights into the cis- and trans-Acting DNase Activities of Cas12a.},
journal = {Molecular cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.molcel.2018.11.021},
pmid = {30639240},
issn = {1097-4164},
abstract = {CRISPR-Cas12a (Cpf1) is an RNA-guided DNA-cutting nuclease that has been repurposed for genome editing. Upon target DNA binding, Cas12a cleaves both the target DNA in cis and non-target single-stranded DNAs (ssDNAs) in trans. To elucidate the molecular basis for both DNase cleavage modes, we performed structural and biochemical studies on Francisella novicida Cas12a. We show that guide RNA-target strand DNA hybridization conformationally activates Cas12a, triggering its trans-acting, non-specific, single-stranded DNase activity. In turn, cis cleavage of double-stranded DNA targets is a result of protospacer adjacent motif (PAM)-dependent DNA duplex unwinding, electrostatic stabilization of the displaced non-target DNA strand, and ordered sequential cleavage of the non-target and target DNA strands. Cas12a releases the PAM-distal DNA cleavage product and remains bound to the PAM-proximal DNA cleavage product in a catalytically competent, trans-active state. Together, these results provide a revised model for the molecular mechanisms of both the cis- and the trans-acting DNase activities of Cas12a enzymes, enabling their further exploitation as genome editing tools.},
}
@article {pmid30637337,
year = {2018},
author = {Bayer, K and Jahn, MT and Slaby, BM and Moitinho-Silva, L and Hentschel, U},
title = {Marine Sponges as Chloroflexi Hot Spots: Genomic Insights and High-Resolution Visualization of an Abundant and Diverse Symbiotic Clade.},
journal = {mSystems},
volume = {3},
number = {6},
pages = {},
doi = {10.1128/mSystems.00150-18},
pmid = {30637337},
issn = {2379-5077},
abstract = {Members of the widespread bacterial phylum Chloroflexi can dominate high-microbial-abundance (HMA) sponge microbiomes. In the Sponge Microbiome Project, Chloroflexi sequences amounted to 20 to 30% of the total microbiome of certain HMA sponge genera with the classes/clades SAR202, Caldilineae, and Anaerolineae being the most prominent. We performed metagenomic and single-cell genomic analyses to elucidate the functional gene repertoire of Chloroflexi symbionts of Aplysina aerophoba. Eighteen draft genomes were reconstructed and placed into phylogenetic context of which six were investigated in detail. Common genomic features of Chloroflexi sponge symbionts were related to central energy and carbon converting pathways, amino acid and fatty acid metabolism, and respiration. Clade-specific metabolic features included a massively expanded genomic repertoire for carbohydrate degradation in Anaerolineae and Caldilineae genomes, but only amino acid utilization by SAR202. While Anaerolineae and Caldilineae import cofactors and vitamins, SAR202 genomes harbor genes encoding components involved in cofactor biosynthesis. A number of features relevant to symbiosis were further identified, including CRISPR-Cas systems, eukaryote-like repeat proteins, and secondary metabolite gene clusters. Chloroflexi symbionts were visualized in the sponge extracellular matrix at ultrastructural resolution by the fluorescence in situ hybridization-correlative light and electron microscopy (FISH-CLEM) method. Carbohydrate degradation potential was reported previously for "Candidatus Poribacteria" and SAUL, typical symbionts of HMA sponges, and we propose here that HMA sponge symbionts collectively engage in degradation of dissolved organic matter, both labile and recalcitrant. Thus, sponge microbes may not only provide nutrients to the sponge host, but they may also contribute to dissolved organic matter (DOM) recycling and primary productivity in reef ecosystems via a pathway termed the sponge loop. IMPORTANCEChloroflexi represent a widespread, yet enigmatic bacterial phylum with few cultivated members. We used metagenomic and single-cell genomic approaches to characterize the functional gene repertoire of Chloroflexi symbionts in marine sponges. The results of this study suggest clade-specific metabolic specialization and that Chloroflexi symbionts have the genomic potential for dissolved organic matter (DOM) degradation from seawater. Considering the abundance and dominance of sponges in many benthic environments, we predict that the role of sponge symbionts in biogeochemical cycles is larger than previously thought.},
}
@article {pmid30545858,
year = {2018},
author = {Dzau, VJ and McNutt, M and Bai, C},
title = {Wake-up call from Hong Kong.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6420},
pages = {1215},
doi = {10.1126/science.aaw3127},
pmid = {30545858},
issn = {1095-9203},
mesh = {*CRISPR-Cas Systems ; Gene Editing/*ethics/*standards ; *Genome, Human ; Hong Kong ; Humans ; Stakeholder Participation ; },
}
@article {pmid30511631,
year = {2018},
author = {Farooq, R and Hussain, K and Nazir, S and Javed, MR and Masood, N},
title = {CRISPR/Cas9; A robust technology for producing genetically engineered plants.},
journal = {Cellular and molecular biology (Noisy-le-Grand, France)},
volume = {64},
number = {14},
pages = {31-38},
pmid = {30511631},
issn = {1165-158X},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing ; Genetic Engineering/*methods ; Mutation/genetics ; Plants, Genetically Modified/*genetics ; Transgenes ; },
abstract = {CRISPR/Cas9 is a technology evolved from modified type II immune system of bacteria and archaea. Exploitation of this bacterial immune system in all eukaryotes including plants may lead to site-specific targeted genome engineering. Genome engineering is objectively utilized to express/silence a trait harbouring gene in the plant genome. In this review, different genetic engineering techniques including classical breeding, RNAi and genetic transformation and synthetic sequence-specific nucleases (zinc finger nucleases; ZFNs and transcription activator-like effector nuclease; TALENs) techniques have been described and compared with advanced genome editing technique CRISPR/Cas9, on the basis of their merits and drawbacks. This revolutionary genome engineering technology has edge over all other approaches because of its simplicity, stability, specificity of the target and multiple genes can be engineered at a time. CRISPR/Cas9 requires only Cas9 endonuclease and single guide RNA, which are directly delivered into plant cells via either vector-mediated stable transformation or transient delivery of ribonucleoproteins (RNPs) and generate double-strand breaks (DSBs) at target site. These DSBs are further repaired by cell endogenous repairing pathways via HDR or NHEJ. The major advantage of CRISPR/Cas9 system is that engineered plants are considered Non-GM; can be achieved using in vitro expressed RNPs transient delivery. Different variants of Cas9 genes cloned in different plasmid vectors can be used to achieve different objectives of genome editing including double-stranded DNA break, single-stranded break, activate/repress the gene expression. Fusion of Cas9 with fluorescent protein can lead to visualize the expression of the CRISPR/Cas9 system. The applications of this technology in plant genome editing to improve different plant traits are comprehensively described.},
}
@article {pmid30417500,
year = {2019},
author = {Wahiduzzaman, M and Karnan, S and Ota, A and Hanamura, I and Murakami, H and Inoko, A and Rahman, ML and Hyodo, T and Konishi, H and Tsuzuki, S and Hosokawa, Y},
title = {Establishment and characterization of CRISPR/Cas9-mediated NF2-/- human mesothelial cell line: Molecular insight into fibroblast growth factor receptor 2 in malignant pleural mesothelioma.},
journal = {Cancer science},
volume = {110},
number = {1},
pages = {180-193},
doi = {10.1111/cas.13871},
pmid = {30417500},
issn = {1349-7006},
support = {//Hirose International Scholarship Foundation/ ; },
mesh = {Adolescent ; Adult ; Aged ; Aged, 80 and over ; Base Sequence ; *CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Movement/genetics ; Cell Proliferation/genetics ; Child, Preschool ; Female ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic ; Humans ; Lung Neoplasms/*genetics/metabolism/pathology ; Male ; Mesothelioma/*genetics/metabolism/pathology ; Middle Aged ; Neurofibromin 2/*genetics/metabolism ; Pleural Neoplasms/*genetics/metabolism/pathology ; Receptor, Fibroblast Growth Factor, Type 2/*genetics ; Sequence Homology, Nucleic Acid ; Young Adult ; },
abstract = {Malignant pleural mesothelioma (MPM), a highly refractory tumor, is currently incurable due to the lack of an early diagnosis method and medication, both of which are urgently needed to improve the survival and/or quality of life of patients. NF2 is a tumor suppressor gene and is frequently mutated in MPM. Using a CRISPR/Cas9 system, we generated an NF2-knockout human mesothelial cell line, MeT-5A (NF2-KO). In NF2-KO cell clones, cell growth, clonogenic activity, migration activity, and invasion activity significantly increased compared with those in NF2-WT cell clones. Complementary DNA microarray analysis clearly revealed the differences in global gene expression profile between NF2-WT and NF2-KO cell clones. Quantitative PCR analysis and western blot analysis showed that the upregulation of fibroblast growth factor receptor 2 (FGFR2) was concomitant with the increases in phosphorylation levels of JNK, c-Jun, and retinoblastoma (Rb) in NF2-KO cell clones. These increases were all abrogated by the exogenous expression of NF2 in the NF2-KO clone. In addition, the disruption of FGFR2 in the NF2-KO cell clone suppressed cell proliferation as well as the phosphorylation levels of JNK, c-Jun, and Rb. Notably, FGFR2 was found to be highly expressed in NF2-negative human mesothelioma tissues (11/12 cases, 91.7%) but less expressed in NF2-positive tissues. Collectively, these findings suggest that NF2 deficiency might play a role in the tumorigenesis of human mesothelium through mediating FGFR2 expression; FGFR2 would be a candidate molecule to develop therapeutic and diagnostic strategies for targeting MPM with NF2 loss.},
}
@article {pmid30326628,
year = {2018},
author = {Chen, G and Xiong, L and Wang, Y and He, L and Huang, R and Liao, L and Zhu, Z and Wang, Y},
title = {ITGB1b-Deficient Rare Minnows Delay Grass Carp Reovirus (GCRV) Entry and Attenuate GCRV-Triggered Apoptosis.},
journal = {International journal of molecular sciences},
volume = {19},
number = {10},
pages = {},
pmid = {30326628},
issn = {1422-0067},
support = {31721005 and 31702332//National Natural Science Foundation of China/ ; },
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems ; Carps/*genetics/*virology ; Clathrin/metabolism ; Endocytosis ; Fish Diseases/*genetics/*virology ; Gene Knockout Techniques ; Integrin beta1/*genetics ; Phenotype ; Phylogeny ; Reoviridae/classification/*physiology ; *Virus Internalization ; },
abstract = {Integrin β-1 (ITGB1) is a transmembrane protein belonging to the integrin family and it plays an important role in viral entry. In this study, the itgb1b gene of the rare minnow, Gobiocypris rarus, was cloned and analyzed. To investigate the possible role of itgb1b on grass carp reovirus (GCRV) infection, we generated an ITGB1b-deficient rare minnow (ITGB1b-/-) using the CRISPR/Cas9 system. Following stimulation with GCRV, the survival time of the -ITGB1b-/- rare minnows was extended in comparison to the wild-type minnows. Moreover, the relative copy number of GCRV and the level of clathrin-mediated endocytosis-associated and apoptosis-related gene expression in the ITGB1b-/- rare minnows was significantly lower than that of the wild-type minnows. These results suggested that the absence of itgb1b reduced viral entry efficiency and the expression of apoptosis-related genes. Moreover, the data suggested that itgb1b played an important role in mediating the entry of viruses into the cells via clathrin. Therefore, these findings provide novel insight into the function of itgb1b in the process of GCRV infection.},
}
@article {pmid30254261,
year = {2018},
author = {Serif, M and Dubois, G and Finoux, AL and Teste, MA and Jallet, D and Daboussi, F},
title = {One-step generation of multiple gene knock-outs in the diatom Phaeodactylum tricornutum by DNA-free genome editing.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3924},
pmid = {30254261},
issn = {2041-1723},
mesh = {Adenine Phosphoribosyltransferase/genetics/metabolism ; Algal Proteins/genetics/metabolism ; Amino Acid Sequence ; Base Sequence ; CRISPR-Cas Systems ; Diatoms/*genetics/metabolism ; Gene Editing/*methods ; Gene Knockout Techniques/*methods ; Microalgae/genetics/metabolism ; Multienzyme Complexes/genetics/metabolism ; Orotate Phosphoribosyltransferase/genetics/metabolism ; Orotidine-5'-Phosphate Decarboxylase/genetics/metabolism ; Reproducibility of Results ; Ribonucleoproteins/genetics/metabolism ; Sequence Homology, Amino Acid ; Transfection/*methods ; },
abstract = {Recently developed transgenic techniques to explore and exploit the metabolic potential of microalgae present several drawbacks associated with the delivery of exogenous DNA into the cells and its subsequent integration at random sites within the genome. Here, we report a highly efficient multiplex genome-editing method in the diatom Phaeodactylum tricornutum, relying on the biolistic delivery of CRISPR-Cas9 ribonucleoproteins coupled with the identification of two endogenous counter-selectable markers, PtUMPS and PtAPT. First, we demonstrate the functionality of RNP delivery by positively selecting the disruption of each of these genes. Then, we illustrate the potential of the approach for multiplexing by generating double-gene knock-out strains, with 65% to 100% efficiency, using RNPs targeting one of these markers and PtAureo1a, a photoreceptor-encoding gene. Finally, we created triple knock-out strains in one step by delivering six RNP complexes into Phaeodactylum cells. This approach could readily be applied to other hard-to-transfect organisms of biotechnological interest.},
}
@article {pmid30110327,
year = {2018},
author = {Xiao, D and Wang, H and Hao, L and Guo, X and Ma, X and Qian, Y and Chen, H and Ma, J and Zhang, J and Sheng, W and Shou, W and Huang, G and Ma, D},
title = {The roles of SMYD4 in epigenetic regulation of cardiac development in zebrafish.},
journal = {PLoS genetics},
volume = {14},
number = {8},
pages = {e1007578},
pmid = {30110327},
issn = {1553-7404},
support = {P01 HL134599/HL/NHLBI NIH HHS/United States ; },
mesh = {Adolescent ; Animals ; CRISPR-Cas Systems ; Child ; Child, Preschool ; Cohort Studies ; Disease Models, Animal ; Embryonic Development/drug effects ; *Epigenesis, Genetic ; Female ; Gene Expression Profiling ; Gene Expression Regulation, Developmental ; Heart/drug effects/embryology ; Heart Defects, Congenital/genetics ; Histone Deacetylase 1/genetics/physiology ; Histone-Lysine N-Methyltransferase/genetics/*physiology ; Humans ; Infant ; Male ; Mutation, Missense ; Protein Conformation ; Sequence Analysis, RNA ; Transcriptome ; Whole Exome Sequencing ; Zebrafish/embryology/*genetics ; Zebrafish Proteins/genetics/*physiology ; },
abstract = {SMYD4 belongs to a family of lysine methyltransferases. We analyzed the role of smyd4 in zebrafish development by generating a smyd4 mutant zebrafish line (smyd4L544Efs*1) using the CRISPR/Cas9 technology. The maternal and zygotic smyd4L544Efs*1 mutants demonstrated severe cardiac malformations, including defects in left-right patterning and looping and hypoplastic ventricles, suggesting that smyd4 was critical for heart development. Importantly, we identified two rare SMYD4 genetic variants in a 208-patient cohort with congenital heart defects. Both biochemical and functional analyses indicated that SMYD4(G345D) was pathogenic. Our data suggested that smyd4 functions as a histone methyltransferase and, by interacting with HDAC1, also serves as a potential modulator for histone acetylation. Transcriptome and bioinformatics analyses of smyd4L544Efs*1 and wild-type developing hearts suggested that smyd4 is a key epigenetic regulator involved in regulating endoplasmic reticulum-mediated protein processing and several important metabolic pathways in developing zebrafish hearts.},
}
@article {pmid30080860,
year = {2018},
author = {Torbey, P and Thierion, E and Collombet, S and de Cian, A and Desmarquet-Trin-Dinh, C and Dura, M and Concordet, JP and Charnay, P and Gilardi-Hebenstreit, P},
title = {Cooperation, cis-interactions, versatility and evolutionary plasticity of multiple cis-acting elements underlie krox20 hindbrain regulation.},
journal = {PLoS genetics},
volume = {14},
number = {8},
pages = {e1007581},
pmid = {30080860},
issn = {1553-7404},
mesh = {Amino Acid Sequence ; Animals ; CRISPR-Cas Systems ; Chromatin/metabolism ; Early Growth Response Protein 2/*genetics/physiology ; Enhancer Elements, Genetic ; Evolution, Molecular ; *Gene Expression Regulation, Developmental ; Genetic Loci ; Morphogenesis/genetics ; Rhombencephalon/*metabolism ; Transcriptional Activation ; Zebrafish/embryology/*genetics ; },
abstract = {Cis-regulation plays an essential role in the control of gene expression, and is particularly complex and poorly understood for developmental genes, which are subject to multiple levels of modulation. In this study, we performed a global analysis of the cis-acting elements involved in the control of the zebrafish developmental gene krox20. krox20 encodes a transcription factor required for hindbrain segmentation and patterning, a morphogenetic process highly conserved during vertebrate evolution. Chromatin accessibility analysis reveals a cis-regulatory landscape that includes 6 elements participating in the control of initiation and autoregulatory aspects of krox20 hindbrain expression. Combining transgenic reporter analyses and CRISPR/Cas9-mediated mutagenesis, we assign precise functions to each of these 6 elements and provide a comprehensive view of krox20 cis-regulation. Three important features emerged. First, cooperation between multiple cis-elements plays a major role in the regulation. Cooperation can surprisingly combine synergy and redundancy, and is not restricted to transcriptional enhancer activity (for example, 4 distinct elements cooperate through different modes to maintain autoregulation). Second, several elements are unexpectedly versatile, which allows them to be involved in different aspects of control of gene expression. Third, comparative analysis of the elements and their activities in several vertebrate species reveals that this versatility is underlain by major plasticity across evolution, despite the high conservation of the gene expression pattern. These characteristics are likely to be of broad significance for developmental genes.},
}
@article {pmid29991786,
year = {2018},
author = {Callaway, E},
title = {Controversial CRISPR 'gene drives' tested in mammals for the first time.},
journal = {Nature},
volume = {559},
number = {7713},
pages = {164},
doi = {10.1038/d41586-018-05665-1},
pmid = {29991786},
issn = {1476-4687},
mesh = {Animals ; Animals, Wild/genetics ; *CRISPR-Cas Systems ; Culicidae/genetics ; Female ; Gene Drive Technology/*methods ; *Gene Editing ; Introduced Species ; Malaria/prevention & control/transmission ; Male ; Mice ; Pest Control, Biological/*methods ; Sex Characteristics ; Uncertainty ; },
}
@article {pmid29985941,
year = {2018},
author = {Iyer, V and Boroviak, K and Thomas, M and Doe, B and Riva, L and Ryder, E and Adams, DJ},
title = {No unexpected CRISPR-Cas9 off-target activity revealed by trio sequencing of gene-edited mice.},
journal = {PLoS genetics},
volume = {14},
number = {7},
pages = {e1007503},
pmid = {29985941},
issn = {1553-7404},
support = {//Wellcome Trust/United Kingdom ; },
mesh = {Animals ; Biological Variation, Population/genetics ; CRISPR-Cas Systems/*genetics ; DNA Mutational Analysis/methods ; Female ; Gene Editing/*methods ; Genome/genetics ; Hair Color/genetics ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Transgenic ; Monophenol Monooxygenase/*genetics ; Mutagenesis/*genetics ; Pedigree ; RNA, Guide/genetics ; Research Design ; Whole Genome Sequencing/*methods ; },
abstract = {CRISPR-Cas9 technologies have transformed genome-editing of experimental organisms and have immense therapeutic potential. Despite significant advances in our understanding of the CRISPR-Cas9 system, concerns remain over the potential for off-target effects. Recent studies have addressed these concerns using whole-genome sequencing (WGS) of gene-edited embryos or animals to search for de novo mutations (DNMs), which may represent candidate changes introduced by poor editing fidelity. Critically, these studies used strain-matched, but not pedigree-matched controls and thus were unable to reliably distinguish generational or colony-related differences from true DNMs. Here we used a trio design and whole genome sequenced 8 parents and 19 embryos, where 10 of the embryos were mutagenised with well-characterised gRNAs targeting the coat colour Tyrosinase (Tyr) locus. Detailed analyses of these whole genome data allowed us to conclude that if CRISPR mutagenesis were causing SNV or indel off-target mutations in treated embryos, then the number of these mutations is not statistically distinguishable from the background rate of DNMs occurring due to other processes.},
}
@article {pmid29973717,
year = {2018},
author = {Zimmermann, M and Murina, O and Reijns, MAM and Agathanggelou, A and Challis, R and Tarnauskaitė, Ž and Muir, M and Fluteau, A and Aregger, M and McEwan, A and Yuan, W and Clarke, M and Lambros, MB and Paneesha, S and Moss, P and Chandrashekhar, M and Angers, S and Moffat, J and Brunton, VG and Hart, T and de Bono, J and Stankovic, T and Jackson, AP and Durocher, D},
title = {CRISPR screens identify genomic ribonucleotides as a source of PARP-trapping lesions.},
journal = {Nature},
volume = {559},
number = {7713},
pages = {285-289},
pmid = {29973717},
issn = {1476-4687},
support = {MC_PC_U127580972//Medical Research Council/United Kingdom ; },
mesh = {Animals ; BRCA1 Protein/deficiency/genetics ; *CRISPR-Cas Systems ; Cell Line ; *DNA Damage/drug effects ; DNA Repair/genetics ; DNA Replication ; DNA Topoisomerases, Type I/metabolism ; Female ; *Gene Editing ; Genes, BRCA1 ; Genome/genetics ; HeLa Cells ; Humans ; Leukemia, Lymphocytic, Chronic, B-Cell/drug therapy/enzymology/genetics/pathology ; Male ; Mice ; Neoplasms/drug therapy/enzymology/*genetics/*pathology ; Phthalazines/pharmacology ; Piperazines/pharmacology ; Poly (ADP-Ribose) Polymerase-1/deficiency/genetics/*metabolism ; Poly(ADP-ribose) Polymerase Inhibitors/pharmacology ; Prostatic Neoplasms/drug therapy/enzymology/pathology ; Ribonuclease H/deficiency/genetics/metabolism ; Ribonucleotides/*genetics ; Synthetic Lethal Mutations ; Xenograft Model Antitumor Assays ; },
abstract = {The observation that BRCA1- and BRCA2-deficient cells are sensitive to inhibitors of poly(ADP-ribose) polymerase (PARP) has spurred the development of cancer therapies that use these inhibitors to target deficiencies in homologous recombination1. The cytotoxicity of PARP inhibitors depends on PARP trapping, the formation of non-covalent protein-DNA adducts composed of inhibited PARP1 bound to DNA lesions of unclear origins1-4. To address the nature of such lesions and the cellular consequences of PARP trapping, we undertook three CRISPR (clustered regularly interspersed palindromic repeats) screens to identify genes and pathways that mediate cellular resistance to olaparib, a clinically approved PARP inhibitor1. Here we present a high-confidence set of 73 genes, which when mutated cause increased sensitivity to PARP inhibitors. In addition to an expected enrichment for genes related to homologous recombination, we discovered that mutations in all three genes encoding ribonuclease H2 sensitized cells to PARP inhibition. We establish that the underlying cause of the PARP-inhibitor hypersensitivity of cells deficient in ribonuclease H2 is impaired ribonucleotide excision repair5. Embedded ribonucleotides, which are abundant in the genome of cells deficient in ribonucleotide excision repair, are substrates for cleavage by topoisomerase 1, resulting in PARP-trapping lesions that impede DNA replication and endanger genome integrity. We conclude that genomic ribonucleotides are a hitherto unappreciated source of PARP-trapping DNA lesions, and that the frequent deletion of RNASEH2B in metastatic prostate cancer and chronic lymphocytic leukaemia could provide an opportunity to exploit these findings therapeutically.},
}
@article {pmid29874289,
year = {2018},
author = {Xie, S and Cooley, A and Armendariz, D and Zhou, P and Hon, GC},
title = {Frequent sgRNA-barcode recombination in single-cell perturbation assays.},
journal = {PloS one},
volume = {13},
number = {6},
pages = {e0198635},
pmid = {29874289},
issn = {1932-6203},
support = {DP2 GM128203/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems/genetics ; Genetic Vectors/genetics ; HEK293 Cells ; Humans ; K562 Cells ; Lentivirus/genetics ; RNA, Guide/*genetics ; Sequence Analysis, RNA ; Single-Cell Analysis/*methods ; Transfection/*methods ; },
abstract = {Simultaneously detecting CRISPR-based perturbations and induced transcriptional changes in the same cell is a powerful approach to unraveling genome function. Several lentiviral approaches have been developed, some of which rely on the detection of distally located genetic barcodes as an indirect proxy of sgRNA identity. Since barcodes are often several kilobases from their corresponding sgRNAs, viral recombination-mediated swapping of barcodes and sgRNAs is feasible. Using a self-circularization-based sgRNA-barcode library preparation protocol, we estimate the recombination rate to be ~50% and we trace this phenomenon to the pooled viral packaging step. Recombination is random, and decreases the signal-to-noise ratio of the assay. Our results suggest that alternative approaches can increase the throughput and sensitivity of single-cell perturbation assays.},
}
@article {pmid29684399,
year = {2018},
author = {Qian, P and Wang, X and Yang, Z and Li, Z and Gao, H and Su, XZ and Cui, H and Yuan, J},
title = {A Cas9 transgenic Plasmodium yoelii parasite for efficient gene editing.},
journal = {Molecular and biochemical parasitology},
volume = {222},
number = {},
pages = {21-28},
doi = {10.1016/j.molbiopara.2018.04.003},
pmid = {29684399},
issn = {1872-9428},
mesh = {Animals ; CRISPR-Associated Protein 9/genetics/*metabolism ; CRISPR-Cas Systems ; Female ; Gene Deletion ; Gene Editing/*methods ; Gene Knock-In Techniques ; Life Cycle Stages ; Malaria/parasitology/*veterinary ; Male ; Mice ; Mice, Inbred ICR ; Plasmids/genetics/metabolism ; Plasmodium yoelii/*genetics/growth & development/metabolism ; Rodent Diseases/*parasitology ; },
abstract = {The RNA-guided endonuclease Cas9 has applied as an efficient gene-editing method in malaria parasite Plasmodium. However, the size (4.2 kb) of the commonly used Cas9 from Streptococcus pyogenes (SpCas9) limits its utility for genome editing in the parasites only introduced with cas9 plasmid. To establish the endogenous and constitutive expression of Cas9 protein in the rodent malaria parasite P. yoelii, we replaced the coding region of an endogenous gene sera1 with the intact SpCas9 coding sequence using the CRISPR/Cas9-mediated genome editing method, generating the cas9-knockin parasite (PyCas9ki) of the rodent malaria parasite P. yoelii. The resulted PyCas9ki parasite displays normal progression during the whole life cycle and possesses the Cas9 protein expression in asexual blood stage. By introducing the plasmid (pYCs) containing only sgRNA and homologous template elements, we successfully achieved both deletion and tagging modifications for different endogenous genes in the genome of PyCas9ki parasite. This cas9-knockin PyCas9ki parasite provides a new platform facilitating gene functions study in the rodent malaria parasite P. yoelii.},
}
@article {pmid28944418,
year = {2018},
author = {Nitika, and Truman, AW},
title = {Endogenous epitope tagging of heat shock protein 70 isoform Hsc70 using CRISPR/Cas9.},
journal = {Cell stress & chaperones},
volume = {23},
number = {3},
pages = {347-355},
pmid = {28944418},
issn = {1466-1268},
support = {R15 CA208773/CA/NCI NIH HHS/United States ; },
mesh = {Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; DNA Breaks, Double-Stranded ; *Epitope Mapping ; Green Fluorescent Proteins/metabolism ; HEK293 Cells ; HSC70 Heat-Shock Proteins/genetics/*metabolism ; Humans ; Promoter Regions, Genetic/genetics ; Protein Binding ; Protein Isoforms/metabolism ; RNA, Guide/metabolism ; Reproducibility of Results ; },
abstract = {Heat shock protein 70 (Hsp70) is an evolutionarily well-conserved molecular chaperone involved in several cellular processes such as folding of proteins, modulating protein-protein interactions, and transport of proteins across the membrane. Binding partners of Hsp70 (known as "clients") are identified on an individual basis as researchers discover their particular protein of interest binds to Hsp70. A full complement of Hsp70 interactors under multiple stress conditions remains to be determined. A promising approach to characterizing the Hsp70 "interactome" is the use of protein epitope tagging and then affinity purification followed by mass spectrometry (AP-MS/MS). AP-MS analysis is a widely used method to decipher protein-protein interaction networks and identifying protein functions. Conventionally, the proteins are overexpressed ectopically which interferes with protein complex stoichiometry, skewing AP-MS/MS data. In an attempt to solve this issue, we used CRISPR/Cas9-mediated gene editing to integrate a tandem-affinity (TAP) epitope tag into the genomic locus of HSC70. This system offers several benefits over existing expression systems including native expression, no requirement for selection, and homogeneity between cells. This cell line, freely available to chaperone researchers, will aid in small and large-scale protein interaction studies as well as the study of biochemical activities and structure-function relationships of the Hsc70 protein.},
}
@article {pmid28117345,
year = {2017},
author = {Jiang, C and Mei, M and Li, B and Zhu, X and Zu, W and Tian, Y and Wang, Q and Guo, Y and Dong, Y and Tan, X},
title = {A non-viral CRISPR/Cas9 delivery system for therapeutically targeting HBV DNA and pcsk9 in vivo.},
journal = {Cell research},
volume = {27},
number = {3},
pages = {440-443},
pmid = {28117345},
issn = {1748-7838},
support = {R35 GM119679/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; DNA, Viral/*metabolism ; Gene Targeting ; HEK293 Cells ; Hepatitis B virus/*genetics ; Humans ; Lipids/chemistry ; Liver/metabolism ; Mice ; Mice, Inbred C57BL ; NIH 3T3 Cells ; Nanoparticles/chemistry ; Proprotein Convertase 9/*metabolism ; },
}
@article {pmid28084328,
year = {2017},
author = {Zhou, Y and Wang, P and Tian, F and Gao, G and Huang, L and Wei, W and Xie, XS},
title = {Painting a specific chromosome with CRISPR/Cas9 for live-cell imaging.},
journal = {Cell research},
volume = {27},
number = {2},
pages = {298-301},
pmid = {28084328},
issn = {1748-7838},
mesh = {CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Cell Survival ; *Chromosome Painting ; Chromosomes, Human, Pair 9/*genetics ; HeLa Cells ; Humans ; *Imaging, Three-Dimensional ; RNA, Guide/metabolism ; },
}
@article {pmid27910851,
year = {2017},
author = {Liu, X and Zhang, Y and Cheng, C and Cheng, AW and Zhang, X and Li, N and Xia, C and Wei, X and Liu, X and Wang, H},
title = {CRISPR-Cas9-mediated multiplex gene editing in CAR-T cells.},
journal = {Cell research},
volume = {27},
number = {1},
pages = {154-157},
pmid = {27910851},
issn = {1748-7838},
mesh = {Animals ; Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Exons/genetics ; *Gene Editing ; Humans ; *Immunotherapy, Adoptive ; Mice ; RNA, Guide/metabolism ; T-Lymphocytes/*metabolism ; },
}
@article {pmid30635671,
year = {2019},
author = {Schuster, JA and Vogel, RF and Ehrmann, MA},
title = {Characterization and distribution of CRISPR-Cas systems in Lactobacillus sakei.},
journal = {Archives of microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00203-019-01619-x},
pmid = {30635671},
issn = {1432-072X},
support = {18552 N//AiF/ ; },
abstract = {Clustered regularly interspaced palindromic repeats (CRISPR)-Cas (CRISPR-associated) structures, known as prokaryotes 'immune system', have been successfully applied for genetic engineering and genotyping purposes for a variety of microorganisms. Here we investigated 50 Lactobacillus (L.) sakei genomes and found 13 of them as CRISPR-Cas positive. The majority of positive genomes contain type II-A system, which appears to be widespread across food born lactic acid bacteria. However, a type II-C system with low similarity in Cas protein sequence to related II-C structures is rarely present in the genomes. We depicted a correlation between prophages integrated in the genomes and the presence/absence of CRISPR-Cas systems and identified the novel protospacer adjunction motifs (PAMs) (a/g)AAA for the II-A and (g/a)(c/t)AC for the II-C system including the corresponding tracrRNAs, creating the basis for the development of new Cas-mediated genome editing tools. Moreover, we performed a PCR screening for 81 selected L. sakei isolates and identified 25 (31%) isolates as CRISPR-Cas positive with hypervariable spacer content. Comparative sequence analysis of 33 repeat-spacer arrays resulted in 18 CRISPR genotypes, revealing insights into evolutionary relationships between different strains and illustrating possible applications for the research and development of starter cultures, e.g., the usage for strain differentiation in assertiveness experiments or the development of bacteriophage-resistant strains.},
}
@article {pmid30633905,
year = {2019},
author = {Oakes, BL and Fellmann, C and Rishi, H and Taylor, KL and Ren, SM and Nadler, DC and Yokoo, R and Arkin, AP and Doudna, JA and Savage, DF},
title = {CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification.},
journal = {Cell},
volume = {176},
number = {1-2},
pages = {254-267.e16},
doi = {10.1016/j.cell.2018.11.052},
pmid = {30633905},
issn = {1097-4172},
abstract = {The ability to engineer natural proteins is pivotal to a future, pragmatic biology. CRISPR proteins have revolutionized genome modification, yet the CRISPR-Cas9 scaffold is not ideal for fusions or activation by cellular triggers. Here, we show that a topological rearrangement of Cas9 using circular permutation provides an advanced platform for RNA-guided genome modification and protection. Through systematic interrogation, we find that protein termini can be positioned adjacent to bound DNA, offering a straightforward mechanism for strategically fusing functional domains. Additionally, circular permutation enabled protease-sensing Cas9s (ProCas9s), a unique class of single-molecule effectors possessing programmable inputs and outputs. ProCas9s can sense a wide range of proteases, and we demonstrate that ProCas9 can orchestrate a cellular response to pathogen-associated protease activity. Together, these results provide a toolkit of safer and more efficient genome-modifying enzymes and molecular recorders for the advancement of precision genome engineering in research, agriculture, and biomedicine.},
}
@article {pmid30486613,
year = {2018},
author = {Lee, SH and Kim, S and Hur, JK},
title = {CRISPR and Target-Specific DNA Endonucleases for Efficient DNA Knock-in in Eukaryotic Genomes.},
journal = {Molecules and cells},
volume = {41},
number = {11},
pages = {943-952},
pmid = {30486613},
issn = {0219-1032},
mesh = {Animals ; CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; DNA/*genetics ; DNA Repair ; Deoxyribonuclease I/*metabolism ; Eukaryota/genetics ; Gene Editing ; Gene Knock-In Techniques/*methods ; Genetic Engineering ; Genetic Therapy ; Genome/*genetics ; Humans ; },
abstract = {The discovery and mechanistic understanding of target-specific genome engineering technologies has led to extremely effective and specific genome editing in higher organisms. Target-specific genetic modification technology is expected to have a leading position in future gene therapy development, and has a ripple effect on various basic and applied studies. However, several problems remain and hinder efficient and specific editing of target genomic loci. The issues are particularly critical in precise targeted insertion of external DNA sequences into genomes. Here, we discuss some recent efforts to overcome such problems and present a perspective of future genome editing technologies.},
}
@article {pmid30232196,
year = {2018},
author = {Nachmanson, D and Lian, S and Schmidt, EK and Hipp, MJ and Baker, KT and Zhang, Y and Tretiakova, M and Loubet-Senear, K and Kohrn, BF and Salk, JJ and Kennedy, SR and Risques, RA},
title = {Targeted genome fragmentation with CRISPR/Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS).},
journal = {Genome research},
volume = {28},
number = {10},
pages = {1589-1599},
pmid = {30232196},
issn = {1549-5469},
support = {R01 CA160674/CA/NCI NIH HHS/United States ; R01 CA181308/CA/NCI NIH HHS/United States ; R44 CA221426/CA/NCI NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; DNA/genetics ; DNA Fragmentation ; Female ; High-Throughput Nucleotide Sequencing ; Humans ; Ovarian Neoplasms/*genetics ; Sequence Analysis, DNA/*methods ; Tumor Suppressor Protein p53/*genetics ; },
abstract = {Next-generation sequencing methods suffer from low recovery, uneven coverage, and false mutations. DNA fragmentation by sonication is a major contributor to these problems because it produces randomly sized fragments, PCR amplification bias, and end artifacts. In addition, oligonucleotide-based hybridization capture, a common target enrichment method, has limited efficiency for small genomic regions, contributing to low recovery. This becomes a critical problem in clinical applications, which value cost-effective approaches focused on the sequencing of small gene panels. To address these issues, we developed a targeted genome fragmentation approach based on CRISPR/Cas9 digestion that produces DNA fragments of similar length. These fragments can be enriched by a simple size selection, resulting in targeted enrichment of up to approximately 49,000-fold. Additionally, homogenous length fragments significantly reduce PCR amplification bias and maximize read usability. We combined this novel target enrichment approach with Duplex Sequencing, which uses double-strand molecular tagging to correct for sequencing errors. The approach, termed CRISPR-DS, enables efficient target enrichment of small genomic regions, even coverage, ultra-accurate sequencing, and reduced DNA input. As proof of principle, we applied CRISPR-DS to the sequencing of the exonic regions of TP53 and performed side-by-side comparisons with standard Duplex Sequencing. CRISPR-DS detected previously reported pathogenic TP53 mutations present as low as 0.1% in peritoneal fluid of women with ovarian cancer, while using 10- to 100-fold less DNA than standard Duplex Sequencing. Whether used as standalone enrichment or coupled with high-accuracy sequencing methods, CRISPR-based fragmentation offers a simple solution for fast and efficient small target enrichment.},
}
@article {pmid30208656,
year = {2018},
author = {Sun, Q and Lin, L and Liu, D and Wu, D and Fang, Y and Wu, J and Wang, Y},
title = {CRISPR/Cas9-Mediated Multiplex Genome Editing of the BnWRKY11 and BnWRKY70 Genes in Brassica napus L.},
journal = {International journal of molecular sciences},
volume = {19},
number = {9},
pages = {},
pmid = {30208656},
issn = {1422-0067},
support = {2016YFD0102000//National Key Research and Development Program of China/ ; 2015CB150201//National Key Basic Research Program of China/ ; 31330057//National Natural Science Foundation of China/ ; 31601330//National Natural Science Foundation of China/ ; 2015M581867//China Postdoctoral Science Foundation/ ; 2016T90514//China Postdoctoral Science Foundation/ ; },
mesh = {Ascomycota/physiology ; Brassica napus/*genetics ; *CRISPR-Cas Systems ; Disease Resistance ; *Gene Editing ; Gene Expression Regulation, Plant ; Genome, Plant ; Mutagenesis ; Mutation ; Plant Diseases/*genetics/microbiology ; Plant Proteins/*genetics ; Plants, Genetically Modified/*genetics ; Transcription Factors/*genetics ; },
abstract = {Targeted genome editing is a desirable means of basic science and crop improvement. The clustered, regularly interspaced, palindromic repeat (CRISPR)/Cas9 (CRISPR-associated 9) system is currently the simplest and most commonly used system in targeted genomic editing in plants. Single and multiplex genome editing in plants can be achieved under this system. In Arabidopsis, AtWRKY11 and AtWRKY70 genes were involved in JA- and SA-induced resistance to pathogens, in rapeseed (Brassica napus L.), BnWRKY11 and BnWRKY70 genes were found to be differently expressed after inoculated with the pathogenic fungus, Sclerotinia sclerotiorum (Lib.) de Bary. In this study, two Cas9/sgRNA constructs targeting two copies of BnWRKY11 and four copies of BnWRKY70 were designed to generate BnWRKY11 and BnWRKY70 mutants respectively. As a result, twenty-two BnWRKY11 and eight BnWRKY70 independent transformants (T₀) were obtained, with the mutation ratios of 54.5% (12/22) and 50% (4/8) in BnWRKY11 and BnWRKY70 transformants respectively. Eight and two plants with two copies of mutated BnWRKY11 and BnWRKY70 were obtained respectively. In T₁ generation of each plant examined, new mutations on target genes were detected with high efficiency. The vast majority of BnWRKY70 mutants showed editing in three copies of BnWRKY70 in examined T₁ plants. BnWRKY70 mutants exhibited enhanced resistance to Sclerotinia, while BnWRKY11 mutants showed no significant difference in Sclerotinia resistance when compared to non-transgenic plants. In addition, plants that overexpressed BnWRKY70 showed increased sensitivity when compared to non-transgenic plants. Altogether, our results demonstrated that BnWRKY70 may function as a regulating factor to negatively control the Sclerotinia resistance and CRISPR/Cas9 system could be used to generate germplasm in B. napus with high resistance against Sclerotinia.},
}
@article {pmid30175907,
year = {2018},
author = {Alper, HS and Beisel, CL},
title = {Advances in CRISPR Technologies for Microbial Strain Engineering.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1800460},
doi = {10.1002/biot.201800460},
pmid = {30175907},
issn = {1860-7314},
mesh = {Bacteria/*genetics ; CRISPR-Cas Systems ; Fungi/*genetics ; Gene Editing/methods ; Genetic Engineering/*methods ; },
}
@article {pmid30111655,
year = {2018},
author = {Liu, K and Yu, W and Tang, M and Tang, J and Liu, X and Liu, Q and Li, Y and He, L and Zhang, L and Evans, SM and Tian, X and Lui, KO and Zhou, B},
title = {A dual genetic tracing system identifies diverse and dynamic origins of cardiac valve mesenchyme.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {18},
pages = {},
doi = {10.1242/dev.167775},
pmid = {30111655},
issn = {1477-9129},
mesh = {Animals ; Antigens, CD/metabolism ; CRISPR-Cas Systems/genetics ; Cadherins/metabolism ; DNA Nucleotidyltransferases/*metabolism ; Endothelial Cells/cytology ; Gene Knock-In Techniques ; Genetic Engineering/*methods ; Heart Valves/*embryology ; Mesoderm/*embryology ; Mice ; Mice, Inbred C57BL ; },
abstract = {In vivo genomic engineering is instrumental for studying developmental biology and regenerative medicine. Development of novel systems with more site-specific recombinases (SSRs) that complement with the commonly used Cre-loxP would be valuable for more precise lineage tracing and genome editing. Here, we introduce a new SSR system via Nigri-nox. By generating tissue-specific Nigri knock-in and its responding nox reporter mice, we show that the Nigri-nox system works efficiently in vivo by targeting specific tissues. As a new orthogonal system to Cre-loxP, Nigri-nox provides an additional control of genetic manipulation. We also demonstrate how the two orthogonal systems Nigri-nox and Cre-loxP could be used simultaneously to map the cell fate of two distinct developmental origins of cardiac valve mesenchyme in the mouse heart, providing dynamics of cellular contribution from different origins for cardiac valve mesenchyme during development. This work provides a proof-of-principle application of the Nigri-nox system for in vivo mouse genomic engineering. Coupled with other SSR systems, Nigri-nox would be valuable for more precise delineation of origins and cell fates during development, diseases and regeneration.},
}
@article {pmid29969727,
year = {2018},
author = {Ryu, N and Kim, MA and Park, D and Lee, B and Kim, YR and Kim, KH and Baek, JI and Kim, WJ and Lee, KY and Kim, UK},
title = {Effective PEI-mediated delivery of CRISPR-Cas9 complex for targeted gene therapy.},
journal = {Nanomedicine : nanotechnology, biology, and medicine},
volume = {14},
number = {7},
pages = {2095-2102},
doi = {10.1016/j.nano.2018.06.009},
pmid = {29969727},
issn = {1549-9642},
mesh = {Animals ; *CRISPR-Cas Systems ; Cell Proliferation ; *Drug Delivery Systems ; *Genetic Therapy ; Mice ; Neuroblastoma/genetics/*therapy ; *Plasmids ; Polyethyleneimine/*chemistry ; Sulfate Transporters/*antagonists & inhibitors/genetics ; Tumor Cells, Cultured ; },
abstract = {The-state-of-art CRISPR/Cas9 is one of the most powerful among the approaches being developed to rescue fundamental causes of gene-based inheritable diseases. Several strategies for delivering such genome editing materials have been developed, but the safety, efficacy over time, cost of production, and gene size limitations are still under debate and must be addressed to further improve applications. In this study, we evaluated branched forms of the polyethylenimine (PEI) - branched PEI 25 kDa (BPEI-25K) - and found that it could efficiently deliver CRISPR/Cas9 plasmids. Plasmid DNA expressing both guide RNA and Cas9 to target the Slc26a4 locus was successfully delivered into Neuro2a cells and meditated genome editing within the targeted locus. Our results demonstrated that BPEI-25K is a promising non-viral vector to deliver the CRISPR/Cas9 system in vitro to mediate targeted gene therapy, and these findings contribute to an understanding of CRISPR/Cas9 delivery that may enable development of successful in vivo techniques.},
}
@article {pmid29950674,
year = {2018},
author = {Lu, IL and Chen, C and Tung, CY and Chen, HH and Pan, JP and Chang, CH and Cheng, JS and Chen, YA and Wang, CH and Huang, CW and Kang, YN and Chang, HY and Li, LL and Chang, KP and Shih, YH and Lin, CH and Kwan, SY and Tsai, JW},
title = {Identification of genes associated with cortical malformation using a transposon-mediated somatic mutagenesis screen in mice.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2498},
pmid = {29950674},
issn = {2041-1723},
mesh = {Adolescent ; Adult ; Animals ; Biomarkers/analysis ; CRISPR-Cas Systems ; Cerebral Cortex/*abnormalities/cytology/diagnostic imaging/pathology ; Child ; Child, Preschool ; DNA Transposable Elements/genetics ; Disease Models, Animal ; Epilepsy/diagnosis/*genetics/pathology ; Female ; Functional Neuroimaging ; Gene Knockdown Techniques ; Genetic Testing/*methods ; Humans ; Male ; Malformations of Cortical Development, Group I/diagnosis/*genetics/pathology ; Mice ; Mice, Inbred C57BL ; Mice, Inbred ICR ; Mutagenesis/genetics ; Mutation ; Neurons/*pathology ; RNA Interference ; RNA, Small Interfering/metabolism ; Young Adult ; },
abstract = {Mutations in genes involved in the production, migration, or differentiation of cortical neurons often lead to malformations of cortical development (MCDs). However, many genetic mutations involved in MCD pathogenesis remain unidentified. Here we developed a genetic screening paradigm based on transposon-mediated somatic mutagenesis by in utero electroporation and the inability of mutant neuronal precursors to migrate to the cortex and identified 33 candidate MCD genes. Consistent with the screen, several genes have already been implicated in neural development and disorders. Functional disruption of the candidate genes by RNAi or CRISPR/Cas9 causes altered neuronal distributions that resemble human cortical dysplasia. To verify potential clinical relevance of these candidate genes, we analyzed somatic mutations in brain tissue from patients with focal cortical dysplasia and found that mutations are enriched in these candidate genes. These results demonstrate that this approach is able to identify potential mouse genes involved in cortical development and MCD pathogenesis.},
}
@article {pmid29917323,
year = {2018},
author = {Cao, M and Gao, M and Ploessl, D and Song, C and Shao, Z},
title = {CRISPR-Mediated Genome Editing and Gene Repression in Scheffersomyces stipitis.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700598},
doi = {10.1002/biot.201700598},
pmid = {29917323},
issn = {1860-7314},
support = {4782024//Iowa Energy Center/ ; EEC-0813570//National Science Foundation/ ; EPS-1101284//National Science Foundation/ ; MCB 1716837//National Science Foundation/ ; //Regents Innovation Fund/ ; },
mesh = {CRISPR-Cas Systems ; DNA End-Joining Repair ; Fungal Proteins/*genetics ; Gene Editing/*methods ; Gene Expression Regulation, Bacterial ; Gene Knockout Techniques ; Saccharomycetales/*genetics ; },
abstract = {Scheffersomyces stipitis, renowned for its native xylose-utilizing capacity, has recently demonstrated its potential in producing health-promoting shikimate pathway derivatives. However, its broader application is hampered by the low transformation efficiency and the lack of genetic engineering tools to enable sophisticated genomic manipulations. S. stipitis employs the predominant non-homologous end joining (NHEJ) mechanism for repairing DNA double-strand breaks (DSB), which is less desired due to its incompetence in achieving precise genome editing. Using CRISPR technology, here a ku70Δku80Δ deficient strain in which homologous recombination (HR)-based genome editing appeared dominant for the first time in S. stipitis is constructed. To build all essential tools for efficiently manipulating this highly promising nonconventional microbial host, the gene knockdown tool is also established, and repression efficiency is improved by incorporating a transcriptional repressor Mxi1 into the CRISPR-dCas9 platform. All these results are obtained with the improved transformation efficiency, which is 191-fold higher than that obtained with the traditional parameters used in yeast transformation. This work paves the way for advancing a new microbial chassis and provides a guideline for developing efficient CRISPR tools in other nonconventional yeasts.},
}
@article {pmid29864154,
year = {2018},
author = {Stratigopoulos, G and De Rosa, MC and LeDuc, CA and Leibel, RL and Doege, CA},
title = {DMSO increases efficiency of genome editing at two non-coding loci.},
journal = {PloS one},
volume = {13},
number = {6},
pages = {e0198637},
pmid = {29864154},
issn = {1932-6203},
support = {P30 DK026687/DK/NIDDK NIH HHS/United States ; R01 DK052431/DK/NIDDK NIH HHS/United States ; },
mesh = {Alpha-Ketoglutarate-Dependent Dioxygenase FTO/genetics ; CRISPR-Cas Systems/*genetics ; Cell Line ; Dimethyl Sulfoxide/*chemistry ; Gene Editing/*methods ; Genetic Loci/*genetics ; Human Embryonic Stem Cells ; Humans ; Introns/*genetics ; Polymorphism, Single Nucleotide/genetics ; },
abstract = {Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein-9 (Cas9) has become the tool of choice for genome editing. Despite the fact that it has evolved as a highly efficient means to edit/replace coding sequence, CRISPR/Cas9 efficiency for "clean" editing of non-coding DNA remains low. We set out to introduce a single base-pair substitution in two intronic SNPs at the FTO locus without altering nearby non-coding sequence. Substitution efficiency increased up to 10-fold by treatment of human embryonic stem cells (ESC) with non-toxic levels of DMSO (1%) before CRISPR/Cas9 delivery. Treatment with DMSO did not result in CRISPR/Cas9 off-target effects or compromise the chromosomal stability of the ESC. Twenty-four hour treatment of human ESC with DMSO before CRISPR/Cas9 delivery may prove a simple means to increase editing efficiency of non-coding DNA without incorporation of undesirable mutations.},
}
@article {pmid29862648,
year = {2018},
author = {Zhao, Y and Li, L and Zheng, G and Jiang, W and Deng, Z and Wang, Z and Lu, Y},
title = {CRISPR/dCas9-Mediated Multiplex Gene Repression in Streptomyces.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1800121},
doi = {10.1002/biot.201800121},
pmid = {29862648},
issn = {1860-7314},
support = {ZSYS-016//The Derivative Bank of Chinese Biological Resources, CAS/ ; 31570072//The National Natural Science Foundation of China/ ; 31770088//The National Natural Science Foundation of China/ ; 16490712100//The Science and Technology Commission of Shanghai Municipality/ ; },
mesh = {Bacterial Proteins/genetics ; CRISPR-Cas Systems ; *Down-Regulation ; Gene Editing/*methods ; Gene Expression Regulation, Bacterial ; Metabolic Engineering ; Promoter Regions, Genetic ; Streptomyces coelicolor/genetics/*growth & development ; },
abstract = {Streptomycetes are Gram-positive bacteria with the capacity to produce copious bioactive secondary metabolites, which are the main source of medically and industrially relevant drugs. However, genetic manipulation of Streptomyces strains is much more difficult than other model microorganisms like Escherichia coli and Saccharomyces cerevisiae. Recently, CRISPR/Cas9 or dCas9-mediated genetic manipulation tools have been developed and facilitated Streptomyces genome editing. However, till now, CRISPR/dCas9-based interference system (CRISPRi) is only designed to repress single gene expression. Herein, the authors developed a novel CRISPRi system for multiplex gene repression in the model strain Streptomyces coelicolor. In this system, the integrative plasmid pSET152 is used as the backbone for the expression of the dCas9/sgRNA complex and both dCas9 and sgRNAs are designed to be under the control of constitutive promoters. Using the integrative CRISPRi system, the authors achieved efficient repression of multiple genes simultaneously; the mRNA levels of four targets are reduced to 2-32% of the control. Furthermore, it is successfully employed for functional gene screening, and an orphan response regulator (RR) (encoded by SCO2013) containing an RNA-binding ANTAR domain is identified being involved in bacterial growth. Collectively, this integrative CRISPRi system is very effective for multiplex gene repression in S. coelicolor, which could be extended to other Streptomyces strains for functional gene screening as well as for metabolic engineering.},
}
@article {pmid29809313,
year = {2018},
author = {Gao, D and Smith, S and Spagnuolo, M and Rodriguez, G and Blenner, M},
title = {Dual CRISPR-Cas9 Cleavage Mediated Gene Excision and Targeted Integration in Yarrowia lipolytica.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700590},
doi = {10.1002/biot.201700590},
pmid = {29809313},
issn = {1860-7314},
support = {NNX15AU46G//National Aeronautics and Space Administration/ ; 1403099//Division of Chemical, Bioengineering, Environmental, and Transport Systems/ ; 1706134//Division of Chemical, Bioengineering, Environmental, and Transport Systems/ ; },
mesh = {CRISPR-Cas Systems ; DNA End-Joining Repair ; Fungal Proteins/*genetics ; Gene Editing/*methods ; Yarrowia/*genetics ; },
abstract = {CRISPR-Cas9 technology has been successfully applied in Yarrowia lipolytica for targeted genomic editing including gene disruption and integration; however, disruptions by existing methods typically result from small frameshift mutations caused by indels within the coding region, which usually resulted in unnatural protein. In this study, a dual cleavage strategy directed by paired sgRNAs is developed for gene knockout. This method allows fast and robust gene excision, demonstrated on six genes of interest. The targeted regions for excision vary in length from 0.3 kb up to 3.5 kb and contain both non-coding and coding regions. The majority of the gene excisions are repaired by perfect nonhomologous end-joining without indel. Based on this dual cleavage system, two targeted markerless integration methods are developed by providing repair templates. While both strategies are effective, homology mediated end joining (HMEJ) based method are twice as efficient as homology recombination (HR) based method. In both cases, dual cleavage leads to similar or improved gene integration efficiencies compared to gene excision without integration. This dual cleavage strategy will be useful for not only generating more predictable and robust gene knockout, but also for efficient targeted markerless integration, and simultaneous knockout and integration in Y. lipolytica.},
}
@article {pmid29480475,
year = {2018},
author = {Grenier, A and Sujobert, P and Olivier, S and Guermouche, H and Mondésir, J and Kosmider, O and Viollet, B and Tamburini, J},
title = {Knockdown of Human AMPK Using the CRISPR/Cas9 Genome-Editing System.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1732},
number = {},
pages = {171-194},
doi = {10.1007/978-1-4939-7598-3_11},
pmid = {29480475},
issn = {1940-6029},
mesh = {AMP-Activated Protein Kinases/*genetics ; CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Gene Knockdown Techniques/*methods ; Genetic Vectors/genetics ; HEK293 Cells ; Humans ; Lentivirus/genetics ; Protein Subunits/genetics ; RNA, Guide/genetics ; Signal Transduction/genetics ; Transfection/methods ; },
abstract = {AMP-activated protein kinase (AMPK) is a critical energy sensor, regulating signaling networks involved in pathology including metabolic diseases and cancer. This increasingly recognized role of AMPK has prompted tremendous research efforts to develop new pharmacological AMPK activators. To precisely study the role of AMPK, and the specificity and activity of AMPK activators in cellular models, genetic AMPK inactivating tools are required. We report here methods for genetic inactivation of AMPK α1/α2 catalytic subunits in human cell lines by the CRISPR/Cas9 technology, a recent breakthrough technique for genome editing.},
}
@article {pmid29330802,
year = {2018},
author = {Xin, Y and Duan, C},
title = {Microinjection of Antisense Morpholinos, CRISPR/Cas9 RNP, and RNA/DNA into Zebrafish Embryos.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1742},
number = {},
pages = {205-211},
doi = {10.1007/978-1-4939-7665-2_18},
pmid = {29330802},
issn = {1940-6029},
mesh = {Animals ; CRISPR-Cas Systems ; Embryonic Development ; Female ; Gene Expression Regulation, Developmental ; Genetic Engineering/*instrumentation ; Microinjections/*methods ; Models, Animal ; Morpholinos/administration & dosage ; Oligonucleotides, Antisense/administration & dosage ; RNA, Guide/administration & dosage ; Ribonucleoproteins/administration & dosage ; Thionucleotides ; Zebrafish/*embryology/genetics/growth & development ; Zygote/growth & development ; },
abstract = {In this chapter, we describe a stepwise protocol of microinjection. Using this method, antisense morpholinos, CRISPR-Cas9 ribonucleoprotein complexes, capped mRNA, and DNA can be delivered into fertilized zebrafish eggs to manipulate gene expression during development. This protocol can also be adapted for microinjection in other fish and amphibian species.},
}
@article {pmid29329593,
year = {2018},
author = {Sun, S and Xiao, J and Huo, J and Geng, Z and Ma, K and Sun, X and Fu, X},
title = {Targeting ectodysplasin promotor by CRISPR/dCas9-effector effectively induces the reprogramming of human bone marrow-derived mesenchymal stem cells into sweat gland-like cells.},
journal = {Stem cell research & therapy},
volume = {9},
number = {1},
pages = {8},
pmid = {29329593},
issn = {1757-6512},
mesh = {Animals ; Bone Marrow Cells/cytology ; Burns/*therapy ; CRISPR-Cas Systems ; Cell Differentiation/genetics ; Cell Line ; Cell- and Tissue-Based Therapy/*methods ; Cellular Reprogramming Techniques/*methods ; Cyclin D1/metabolism ; Disease Models, Animal ; Doxycycline/pharmacology ; Ectodysplasins/biosynthesis/*genetics ; Gene Editing ; HEK293 Cells ; Hedgehog Proteins/metabolism ; Humans ; Male ; *Mesenchymal Stem Cell Transplantation ; Mesenchymal Stem Cells/*cytology ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Promoter Regions, Genetic/genetics ; RNA, Guide/genetics ; Sweat Glands/*cytology ; },
abstract = {BACKGROUND: Patients with a deep burn injury are characterized by losing the function of perspiration and being unable to regenerate the sweat glands. Because of their easy accession, multipotency, and lower immunogenicity, bone marrow-derived mesenchymal stem cells (BM-MSCs) represent as an ideal biological source for cell therapy. The aim of this study was to identify whether targeting the promotor of ectodysplasin (EDA) by CRISPR/dCas9-effector (dCas9-E) could induce the BM-MSCs to differentiate into sweat gland-like cells (SGCs).<br><br>METHODS: Activation of EDA transcription in BM-MSCs was attained by transfection of naive BM-MSCs with the lenti-CRISPR/dCas9-effector and single-guide RNAs (sgRNAs). The impact of dCas9-E BM-MSCs on the formation of SGCs and repair of burn injury was identified and evaluated both in vitro and in a mouse model.<br><br>RESULTS: After transfection with sgRNA-guided dCas9-E, the BM-MSCs acquired significantly higher transcription and expression of EDA by doxycycline (Dox) induction. Intriguingly, the specific markers (CEA, CK7, CK14, and CK19) of sweat glands were also positive in the transfected BM-MSCs, suggesting that EDA plays a critical role in promoting BM-MSC differentiation into sweat glands. Furthermore, when the dCas9-E BM-MSCs with Dox induction were implanted into a wound in a laboratory animal model, iodine-starch perspiration tests revealed that the treated paws were positive for perspiration, while the paws treated with saline showed a negative manifestation. For the regulatory mechanism, the expression of downstream genes of NF-κB (Shh and cyclin D1) was also enhanced accordingly.<br><br>CONCLUSIONS: These results suggest that EDA is a pivotal factor for sweat gland regeneration from BM-MSCs and may also offer a new approach for destroyed sweat glands and extensive deep burns.},
}
@article {pmid30628160,
year = {2019},
author = {Hai, L and Szwarc, MM and Lanza, DG and Heaney, JD and Lydon, JP},
title = {Using CRISPR/Cas9 engineering to generate a mouse with a conditional knockout allele for the promyelocytic leukemia zinc finger transcription factor.},
journal = {Genesis (New York, N.Y. : 2000)},
volume = {},
number = {},
pages = {e23281},
doi = {10.1002/dvg.23281},
pmid = {30628160},
issn = {1526-968X},
abstract = {The promyelocytic leukemia zinc finger (PLZF) transcription factor mediates a wide-range of biological processes. Accordingly, perturbation of PLZF function results in a myriad of physiologic defects, the most conspicuous of which is abnormal skeletal patterning. Although whole body knockout of Plzf in the mouse (PlzfKO) has significantly expanded our understanding of Plzf function in vivo, a conditional knockout mouse model that enables tissue or cell-type specific ablation of Plzf has not been developed. Therefore, we used CRISPR/Cas 9 gene editing to generate a mouse model in which exon 2 of the murine Plzf gene is specifically flanked (or floxed) by LoxP sites (Plzff/f). Crossing our Plzff/f mouse with a global cre-driver mouse to generate the Plzfd/d bigenic mouse, we demonstrate that exon 2 of the Plzf gene is ablated in the Plzfd/d bigenic. Similar to the previously reported PlzfKO mouse, the Plzfd/d mouse exhibits a severe defect in skeletal patterning of the hindlimb, indicating that the Plzff/f mouse functions as designed. Therefore, studies in this short technical report demonstrate that the Plzff/f mouse will be useful to investigators who wish to explore the role of the Plzf transcription factor in a specific tissue or cell-type. This article is protected by copyright. All rights reserved.},
}
@article {pmid30298816,
year = {2018},
author = {Libby, AR and Joy, DA and So, PL and Mandegar, MA and Muncie, JM and Mendoza-Camacho, FN and Weaver, VM and Conklin, BR and McDevitt, TC},
title = {Spatiotemporal mosaic self-patterning of pluripotent stem cells using CRISPR interference.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30298816},
issn = {2050-084X},
support = {P01 HL089707/HL/NHLBI NIH HHS/United States ; Center Core Grant, NIH P30 AI027763/NH/NIH HHS/United States ; LAI-C1408015//California Institute for Regenerative Medicine/International ; P01HL089707/NH/NIH HHS/United States ; U01 HL100406/HL/NHLBI NIH HHS/United States ; NSF-CBET 0939511//Emergent Behaviors of Integrated Cellular Systems/International ; S10 RR028962/RR/NCRR NIH HHS/United States ; R01 HL130533/HL/NHLBI NIH HHS/United States ; Instrumentation Grant, NIH S10 RR028962/NH/NIH HHS/United States ; F31HL140907/HL/NHLBI NIH HHS/United States ; P30 AI027763/AI/NIAID NIH HHS/United States ; U01HL100406/NH/NIH HHS/United States ; R01HL130533/NH/NIH HHS/United States ; F31 HL140907/HL/NHLBI NIH HHS/United States ; },
mesh = {Antigens, CD/*genetics ; CRISPR-Cas Systems/genetics ; Cadherins/*genetics ; Cell Communication/genetics ; Cell Differentiation/*genetics ; Cell Lineage/genetics ; Gene Knockdown Techniques ; Humans ; Induced Pluripotent Stem Cells/*cytology/metabolism ; Morphogenesis/genetics ; rho-Associated Kinases/*genetics ; },
abstract = {Morphogenesis involves interactions of asymmetric cell populations to form complex multicellular patterns and structures comprised of distinct cell types. However, current methods to model morphogenic events lack control over cell-type co-emergence and offer little capability to selectively perturb specific cell subpopulations. Our in vitro system interrogates cell-cell interactions and multicellular organization within human induced pluripotent stem cell (hiPSC) colonies. We examined effects of induced mosaic knockdown of molecular regulators of cortical tension (ROCK1) and cell-cell adhesion (CDH1) with CRISPR interference. Mosaic knockdown of ROCK1 or CDH1 resulted in differential patterning within hiPSC colonies due to cellular self-organization, while retaining an epithelial pluripotent phenotype. Knockdown induction stimulates a transient wave of differential gene expression within the mixed populations that stabilized in coordination with observed self-organization. Mosaic patterning enables genetic interrogation of emergent multicellular properties, which can facilitate better understanding of the molecular pathways that regulate symmetry-breaking during morphogenesis.},
}
@article {pmid29855762,
year = {2018},
author = {Montoliu, L and Whitelaw, CBA},
title = {Unexpected mutations were expected and unrelated to CRISPR-Cas9 activity.},
journal = {Transgenic research},
volume = {27},
number = {4},
pages = {315-319},
pmid = {29855762},
issn = {1573-9368},
support = {//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Mice ; Mutagenesis ; Mutation/*genetics ; *Polymorphism, Genetic ; },
abstract = {The scientific journal Nature Methods have just retracted a publication that reported numerous unexpected mutations after a CRISPR-Cas9 experiment based on collecting whole genome sequencing information from one control and two experimental genome edited mice. In the intervening 10 months since publication the data presented have been strongly contested and criticized by the scientific and biotech communities, through publications, open science channels and social networks. The criticism focused on the animal used as control, which was derived from the same mouse strain as the experimental individuals but from an unrelated sub-colony, hence control and experimental mice were genetically divergent. The most plausible explanation for the vast majority of the reported unexpected mutations were the expected underlying genetic polymorphisms that normally accumulate in two different colonies of the same mouse strain which occur as a result of spontaneous mutations and genetic drift. Therefore, the reported mutations were most likely not related to CRISPR-Cas9 activity.},
}
@article {pmid29797189,
year = {2018},
author = {D'Ambrosio, C and Stigliani, AL and Giorio, G},
title = {CRISPR/Cas9 editing of carotenoid genes in tomato.},
journal = {Transgenic research},
volume = {27},
number = {4},
pages = {367-378},
pmid = {29797189},
issn = {1573-9368},
mesh = {Alleles ; CRISPR-Cas Systems/*genetics ; Carotenoids/biosynthesis/*genetics ; Genome, Plant ; Lycopersicon esculentum/*genetics/growth &amp; development ; Mutation ; Phenotype ; Plants, Genetically Modified/*genetics/growth &amp; development ; },
abstract = {CRISPR/Cas9 technology is rapidly spreading as genome editing system in crop breeding. The efficacy of CRISPR/Cas9 in tomato was tested on Psy1 and CrtR-b2, two key genes of carotenoid biosynthesis. Carotenoids are plant secondary metabolites that must be present in the diet of higher animals because they exert irreplaceable functions in important physiological processes. Psy1 and CrtR-b2 were chosen because their impairment is easily detectable as a change of fruit or flower color. Two CRISPR/Cas9 constructs were designed to target neighboring sequences on the first exon of each gene. Thirty-four out of forty-nine (69%) transformed plants showed the expected loss-of-function phenotypes due to the editing of both alleles of a locus. However, by including the seven plants edited only at one of the two homologs and showing a normal phenotype, the editing rate reaches the 84%. Although none chimeric phenotype was observed, the cloning of target region amplified fragments revealed that in the 40% of analyzed DNA samples were present more than two alleles. As concerning the type of mutation, it was possible to identify 34 new different alleles across the four transformation experiments. The sequence characterization of the CRISPR/Cas9-induced mutations showed that the most frequent repair errors were the insertion and the deletion of one base. The results of this study prove that the CRISPRCas9 system can be an efficient and quick method for the generation of useful mutations in tomato to be implemented in breeding programs.},
}
@article {pmid29427756,
year = {2018},
author = {Zhang, Z and Ursin, R and Mahapatra, S and Gallicano, GI},
title = {CRISPR/CAS9 ablation of individual miRNAs from a miRNA family reveals their individual efficacies for regulating cardiac differentiation.},
journal = {Mechanisms of development},
volume = {150},
number = {},
pages = {10-20},
doi = {10.1016/j.mod.2018.02.002},
pmid = {29427756},
issn = {1872-6356},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cell Differentiation/*genetics ; DNA-Binding Proteins/genetics ; Embryonic Stem Cells/cytology/metabolism ; Gene Expression Regulation, Developmental/genetics ; Gene Knockout Techniques ; Heart/*growth &amp; development ; Humans ; Mice ; MicroRNAs/*genetics ; Myocytes, Cardiac/cytology ; Organogenesis/*genetics ; Transcription Factors/genetics ; },
abstract = {Although it is well understood that genetic mutations, chromosomal abnormalities, and epigenetic miscues can cause congenital birth defects, many defects are still labeled idiopathic, meaning their origin is not yet understood. microRNAs are quickly entering the causal fray of developmental defects. miRNAs use a 7-8 base-pair seed sequence to target a corresponding sequence on one or multiple mRNAs resulting in rapid down-regulation of translation. miRNAs can also control protein 'amounts' in cells. As a result if miRNAs are over or under expressed during development protein homeostasis can be compromised resulting in defects in the development of organ systems. Here, we show that during differentiation of embryonic stem cells, individual miRNAs that reside in the miRNA17 family (composed of 14 miRNAs) do not share the same function even though they have the same seed sequence. The advent of CRISPR/CAS9 technology has not only yielded a true observation of individual miRNA function, it has also reconnected advanced molecular biology approaches to classical cell biology approaches such as gene rescue. We show that miRNA106a and to a lesser extent miR17 and 93 target the cardiac suppressor gene Fog2, which specifically suppress Gata-4 and Coup-TF2. However, when each miRNA is knocked out, we find that their targeting efficacies for Fog2 differ resulting in varying degrees of cardiac differentiation.},
}
@article {pmid28676649,
year = {2017},
author = {Heinze, SD and Kohlbrenner, T and Ippolito, D and Meccariello, A and Burger, A and Mosimann, C and Saccone, G and Bopp, D},
title = {CRISPR-Cas9 targeted disruption of the yellow ortholog in the housefly identifies the brown body locus.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {4582},
pmid = {28676649},
issn = {2045-2322},
mesh = {Animals ; *CRISPR-Cas Systems ; Female ; *Gene Editing ; Houseflies/*genetics ; Insect Proteins/genetics/metabolism ; Mice ; *Quantitative Trait Loci ; *Quantitative Trait, Heritable ; },
abstract = {The classic brown body (bwb) mutation in the housefly Musca domestica impairs normal melanization of the adult cuticle. In Drosophila melanogaster, a reminiscent pigmentation defect results from mutations in the yellow gene encoding dopachrome conversion enzyme (DCE). Here, we demonstrate that the bwb locus structurally and functionally represents the yellow ortholog of Musca domestica, MdY. In bwb Musca strains, we identified two mutant MdY alleles that contain lesions predicted to result in premature truncation of the MdY open reading frame. We targeted wildtype MdY by CRISPR-Cas9 RNPs and generated new mutant alleles that fail to complement existing MdY alleles, genetically confirming that MdY is the bwb locus. We further found evidence for Cas9-mediated interchromosomal recombination between wildtype and mutant bwb alleles. Our work resolves the molecular identity of the classic bwb mutation in Musca domestica and establishes the feasibility of Cas9-mediated genome editing in the Musca model.},
}
@article {pmid28667332,
year = {2017},
author = {Van der Hoek, KH and Eyre, NS and Shue, B and Khantisitthiporn, O and Glab-Ampi, K and Carr, JM and Gartner, MJ and Jolly, LA and Thomas, PQ and Adikusuma, F and Jankovic-Karasoulos, T and Roberts, CT and Helbig, KJ and Beard, MR},
title = {Viperin is an important host restriction factor in control of Zika virus infection.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {4475},
pmid = {28667332},
issn = {2045-2322},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Line ; Disease Models, Animal ; Female ; Gene Editing ; *Host-Pathogen Interactions/genetics/immunology ; Humans ; Immunity, Innate ; Macrophages/immunology/metabolism/virology ; Mice ; Mice, Knockout ; Monocytes/immunology/metabolism/virology ; Neural Stem Cells/metabolism/virology ; Placenta/metabolism/virology ; Pregnancy ; Proteins/genetics/*metabolism ; Virus Replication ; Zika Virus/*physiology ; Zika Virus Infection/genetics/immunology/*metabolism/*virology ; },
abstract = {Zika virus (ZIKV) infection has emerged as a global health threat and infection of pregnant women causes intrauterine growth restriction, spontaneous abortion and microcephaly in newborns. Here we show using biologically relevant cells of neural and placental origin that following ZIKV infection, there is attenuation of the cellular innate response characterised by reduced expression of IFN-β and associated interferon stimulated genes (ISGs). One such ISG is viperin that has well documented antiviral activity against a wide range of viruses. Expression of viperin in cultured cells resulted in significant impairment of ZIKV replication, while MEFs derived from CRISPR/Cas9 derived viperin-/- mice replicated ZIKV to higher titers compared to their WT counterparts. These results suggest that ZIKV can attenuate ISG expression to avoid the cellular antiviral innate response, thus allowing the virus to replicate unchecked. Moreover, we have identified that the ISG viperin has significant anti-ZIKV activity. Further understanding of how ZIKV perturbs the ISG response and the molecular mechanisms utilised by viperin to suppress ZIKV replication will aid in our understanding of ZIKV biology, pathogenesis and possible design of novel antiviral strategies.},
}
@article {pmid30622340,
year = {2019},
author = {Domenici, G and Aurrekoetxea-Rodríguez, I and Simões, BM and Rábano, M and Lee, SY and Millán, JS and Comaills, V and Oliemuller, E and López-Ruiz, JA and Zabalza, I and Howard, BA and Kypta, RM and Vivanco, MD},
title = {A Sox2-Sox9 signalling axis maintains human breast luminal progenitor and breast cancer stem cells.},
journal = {Oncogene},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41388-018-0656-7},
pmid = {30622340},
issn = {1476-5594},
support = {PI14/01328//Ministry of Economy and Competitiveness | Instituto de Salud Carlos III (Institute of Health Carlos III)/ ; SAF2017-84934-R//Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness)/ ; SAF2017-90604-REDT//Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness)/ ; SAF2017-84092-R//Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness)/ ; },
abstract = {Increased cancer stem cell content during development of resistance to tamoxifen in breast cancer is driven by multiple signals, including Sox2-dependent activation of Wnt signalling. Here, we show that Sox2 increases and estrogen reduces the expression of the transcription factor Sox9. Gain and loss of function assays indicate that Sox9 is implicated in the maintenance of human breast luminal progenitor cells. CRISPR/Cas knockout of Sox9 reduces growth of tamoxifen-resistant breast tumours in vivo. Mechanistically, Sox9 acts downstream of Sox2 to control luminal progenitor cell content and is required for expression of the cancer stem cell marker ALDH1A3 and Wnt signalling activity. Sox9 is elevated in breast cancer patients after endocrine therapy failure. This new regulatory axis highlights the relevance of SOX family transcription factors as potential therapeutic targets in breast cancer.},
}
@article {pmid30621855,
year = {2019},
author = {Homanics, GE},
title = {Gene-edited CRISPy Critters for alcohol research.},
journal = {Alcohol (Fayetteville, N.Y.)},
volume = {74},
number = {},
pages = {11-19},
doi = {10.1016/j.alcohol.2018.03.001},
pmid = {30621855},
issn = {1873-6823},
abstract = {Genetically engineered animals are powerful tools that have provided invaluable insights into mechanisms of alcohol action and alcohol-use disorder. Traditionally, production of gene-targeted animals was a tremendously expensive, time consuming, and technically demanding undertaking. However, the recent advent of facile methods for editing the genome at very high efficiency is revolutionizing how these animals are made. While pioneering approaches to create gene-edited animals first used zinc finger nucleases and subsequently used transcription activator-like effector nucleases, these approaches have been largely supplanted in an extremely short period of time with the recent discovery and precocious maturation of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system. CRISPR uses a short RNA sequence to guide a non-specific CRISPR-associated nuclease (Cas) to a precise, single location in the genome. Because the CRISPR/Cas system can be cheaply, rapidly, and easily reprogrammed to target nearly any genomic locus of interest simply by recoding the sequence of the guide RNA, this gene-editing system has been rapidly adopted by numerous labs around the world. With CRISPR/Cas, it is now possible to perform gene editing directly in early embryos from every species of animals that is of interest to the alcohol field. Techniques have been developed that enable the rapid production of animals in which a gene has been inactivated (knockout) or modified to harbor specific nucleotide changes (knockins). This system has also been used to insert specific DNA sequences such as reporter or recombinase genes into specific loci of interest. Genetically engineered animals created with the CRISPR/Cas system (CRISPy Critters) are being produced at an astounding pace. Animal production is no longer a significant bottleneck to new discoveries. CRISPy animal studies are just beginning to appear in the alcohol literature, but their use is expected to explode in the near future. CRISPy mice, rats, and other model organisms are sure to facilitate advances in our understanding of alcohol-use disorder.},
}
@article {pmid30394035,
year = {2018},
author = {Chen, F and Yang, P and Zhu, J},
title = {[Construction and application of PGRN and Rev-erbβ double genes knockout HEK293 cell lines].},
journal = {Sheng wu gong cheng xue bao = Chinese journal of biotechnology},
volume = {34},
number = {10},
pages = {1679-1692},
doi = {10.13345/j.cjb.180033},
pmid = {30394035},
issn = {1000-3061},
mesh = {Blotting, Western ; *CRISPR-Cas Systems ; ErbB Receptors/genetics ; Gene Expression ; Gene Expression Regulation ; *Gene Knockout Techniques ; Gene Products, rev/*genetics ; HEK293 Cells ; Humans ; Lentivirus ; Progranulins/*genetics ; Promoter Regions, Genetic ; RNA, Messenger ; },
abstract = {In order to study the molecular mechanism and physiological significance of the interaction between PGRN and Rev-erbβ, the PGRN gene in HEK293 (Rev-erbβ-/-) marked as C3-6 cell lines was knocked out by CRISPR/Cas9 system to generate the Rev-erbβ and PGRN double genes knockout HEK293 cell lines. First, four sgRNAs were designed for PGRN gene, and PGRN sgRNA2 and sgRNA3 with the higher activity were used to construct the Lentiviral vector, pLenti/CMV-Loxp-Cas9-sgRNA2-U6-sgRNA3-U6-Loxp-EF1α-Puro. Then, the lentivirus vector carrying Cas9 and double PGRN sgRNA were used to infect HEK293 C3-6 cells. Through drug screening, cloning and sequencing, we obtained the monoclonal HEK293 (Rev-erbβ-/-; PGRN-/-) marked as C3-6/23 cell lines. Using qRT-PCR and Western blotting, we detected PGRN mRNA and protein expression in C3-6/23 cell lines. Finally, genetic complementation was used to study the effect of PGRN-mediated Rev-erbβ on the regulation of the target gene promoter transcriptional activity in the C3-6/23 cell lines. In HEK293 C3-6/23 cell lines, the two DNA chains of PGRN gene were both deletion mutagenesis, and the expression mRNA and protein of PGRN did not reach the detection level. At the same time, the interaction between PGRN and Rev-erbβ enhanced the regulation of Rev-erbβ on the transcription of target gene promoter in the cell lines. Using CRISPR/Cas9 system, we successfully constructed the double knockout HEK293 (Rev-erbβ-/-; PGRN-/-) monoclonal cell lines. The study found that PGRN could affect Rev-erbβ on the regulation of target gene promoter transcription in the C3-6/23 cell lines; however, the mechanism of PGRN involvement in mediating Rev-erbβ in transcriptional regulation remains to be further studied.},
}
@article {pmid30166439,
year = {2018},
author = {Amoasii, L and Hildyard, JCW and Li, H and Sanchez-Ortiz, E and Mireault, A and Caballero, D and Harron, R and Stathopoulou, TR and Massey, C and Shelton, JM and Bassel-Duby, R and Piercy, RJ and Olson, EN},
title = {Gene editing restores dystrophin expression in a canine model of Duchenne muscular dystrophy.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6410},
pages = {86-91},
pmid = {30166439},
issn = {1095-9203},
support = {//Wellcome Trust/United Kingdom ; R01 AR067294/AR/NIAMS NIH HHS/United States ; R01 HL130253/HL/NHLBI NIH HHS/United States ; U54 HD087351/HD/NICHD NIH HHS/United States ; },
mesh = {Adenoviridae ; Animals ; CRISPR-Cas Systems ; Disease Models, Animal ; Dogs ; Dystrophin/*genetics/metabolism ; Female ; Gene Editing/*methods ; Gene Transfer Techniques ; Male ; Muscular Dystrophy, Duchenne/*therapy ; },
abstract = {Mutations in the gene encoding dystrophin, a protein that maintains muscle integrity and function, cause Duchenne muscular dystrophy (DMD). The deltaE50-MD dog model of DMD harbors a mutation corresponding to a mutational &quot;hotspot&quot; in the human DMD gene. We used adeno-associated viruses to deliver CRISPR gene editing components to four dogs and examined dystrophin protein expression 6 weeks after intramuscular delivery (n = 2) or 8 weeks after systemic delivery (n = 2). After systemic delivery in skeletal muscle, dystrophin was restored to levels ranging from 3 to 90% of normal, depending on muscle type. In cardiac muscle, dystrophin levels in the dog receiving the highest dose reached 92% of normal. The treated dogs also showed improved muscle histology. These large-animal data support the concept that, with further development, gene editing approaches may prove clinically useful for the treatment of DMD.},
}
@article {pmid30102814,
year = {2019},
author = {Ivanov Kavkova, E and Blöchl, C and Tenhaken, R},
title = {The Myo-inositol pathway does not contribute to ascorbic acid synthesis.},
journal = {Plant biology (Stuttgart, Germany)},
volume = {21 Suppl 1},
number = {},
pages = {95-102},
doi = {10.1111/plb.12898},
pmid = {30102814},
issn = {1438-8677},
support = {P25339//Austrian Science Fund/ ; },
mesh = {Arabidopsis/metabolism ; Arabidopsis Proteins/genetics/metabolism ; Ascorbic Acid/*biosynthesis ; Base Sequence ; Biosynthetic Pathways ; CRISPR-Cas Systems/genetics ; DNA, Bacterial/genetics ; Glucuronic Acid/metabolism ; Inositol/*metabolism ; Metabolome ; Mutagenesis, Insertional/genetics ; Mutation/genetics ; Plant Leaves/metabolism ; Tritium/metabolism ; },
abstract = {Ascorbic acid (AsA) biosynthesis in plants predominantly occurs via a pathway with d-mannose and l-galactose as intermediates. One alternative pathway for AsA synthesis, which is similar to the biosynthesis route in mammals, is controversially discussed for plants. Here, myo-inositol is cleaved to glucuronic acid and then converted via l-gulonate to AsA. In contrast to animals, plants have an effective recycling pathway for glucuronic acid, being a competitor for the metabolic rate. Recycling involves a phosphorylation at C1 by the enzyme glucuronokinase. Two previously described T-DNA insertion lines in the gene coding for glucuronokinase1 show wild type-like expression levels of the mRNA in our experiments and do not accumulate glucuronic acid in labelling experiments disproving that these lines are true knockouts. As suitable T-DNA insertion lines were not available, we generated frameshift mutations in the major expressed isoform glucuronokinase1 (At3g01640) to potentially redirect metabolites to AsA. However, radiotracer experiments with 3 H-myo-inositol revealed that the mutants in glucuronokinase1 accumulate only glucuronic acid and incorporate less metabolite into cell wall polymers. AsA was not labelled, suggesting that Arabidopsis cannot efficiently use glucuronic acid for AsA biosynthesis. All four mutants in glucuronokinase as well as the wild type have the same level of AsA in leaves.},
}
@article {pmid29167381,
year = {2018},
author = {Reber, S and Mechtersheimer, J and Nasif, S and Benitez, JA and Colombo, M and Domanski, M and Jutzi, D and Hedlund, E and Ruepp, MD},
title = {CRISPR-Trap: a clean approach for the generation of gene knockouts and gene replacements in human cells.},
journal = {Molecular biology of the cell},
volume = {29},
number = {2},
pages = {75-83},
pmid = {29167381},
issn = {1939-4586},
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Knockout Techniques/*methods ; HEK293 Cells ; HeLa Cells ; Humans ; },
abstract = {CRISPR/Cas9-based genome editing offers the possibility to knock out almost any gene of interest in an affordable and simple manner. The most common strategy is the introduction of a frameshift into the open reading frame (ORF) of the target gene which truncates the coding sequence (CDS) and targets the corresponding transcript for degradation by nonsense-mediated mRNA decay (NMD). However, we show that transcripts containing premature termination codons (PTCs) are not always degraded efficiently and can generate C-terminally truncated proteins which might have residual or dominant negative functions. Therefore, we recommend an alternative approach for knocking out genes, which combines CRISPR/Cas9 with gene traps (CRISPR-Trap) and is applicable to ∼50% of all spliced human protein-coding genes and a large subset of lncRNAs. CRISPR-Trap completely prevents the expression of the ORF and avoids expression of C-terminal truncated proteins. We demonstrate the feasibility of CRISPR-Trap by utilizing it to knock out several genes in different human cell lines. Finally, we also show that this approach can be used to efficiently generate gene replacements allowing for modulation of protein levels for otherwise lethal knockouts (KOs). Thus, CRISPR-Trap offers several advantages over conventional KO approaches and allows for generation of clean CRISPR/Cas9-based KOs.},
}
@article {pmid30619231,
year = {2018},
author = {Berges, M and Michel, AM and Lassek, C and Nuss, AM and Beckstette, M and Dersch, P and Riedel, K and Sievers, S and Becher, D and Otto, A and Maaß, S and Rohde, M and Eckweiler, D and Borrero-de Acuña, JM and Jahn, M and Neumann-Schaal, M and Jahn, D},
title = {Iron Regulation in Clostridioides difficile.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {3183},
doi = {10.3389/fmicb.2018.03183},
pmid = {30619231},
issn = {1664-302X},
abstract = {The response to iron limitation of several bacteria is regulated by the ferric uptake regulator (Fur). The Fur-regulated transcriptional, translational and metabolic networks of the Gram-positive, pathogen Clostridioides difficile were investigated by a combined RNA sequencing, proteomic, metabolomic and electron microscopy approach. At high iron conditions (15 μM) the C. difficile fur mutant displayed a growth deficiency compared to wild type C. difficile cells. Several iron and siderophore transporter genes were induced by Fur during low iron (0.2 μM) conditions. The major adaptation to low iron conditions was observed for the central energy metabolism. Most ferredoxin-dependent amino acid fermentations were significantly down regulated (had, etf, acd, grd, trx, bdc, hbd). The substrates of these pathways phenylalanine, leucine, glycine and some intermediates (phenylpyruvate, 2-oxo-isocaproate, 3-hydroxy-butyryl-CoA, crotonyl-CoA) accumulated, while end products like isocaproate and butyrate were found reduced. Flavodoxin (fldX) formation and riboflavin biosynthesis (rib) were enhanced, most likely to replace the missing ferredoxins. Proline reductase (prd), the corresponding ion pumping RNF complex (rnf) and the reaction product 5-aminovalerate were significantly enhanced. An ATP forming ATPase (atpCDGAHFEB) of the F0F1-type was induced while the formation of a ATP-consuming, proton-pumping V-type ATPase (atpDBAFCEKI) was decreased. The [Fe-S] enzyme-dependent pyruvate formate lyase (pfl), formate dehydrogenase (fdh) and hydrogenase (hyd) branch of glucose utilization and glycogen biosynthesis (glg) were significantly reduced, leading to an accumulation of glucose and pyruvate. The formation of [Fe-S] enzyme carbon monoxide dehydrogenase (coo) was inhibited. The fur mutant showed an increased sensitivity to vancomycin and polymyxin B. An intensive remodeling of the cell wall was observed, Polyamine biosynthesis (spe) was induced leading to an accumulation of spermine, spermidine, and putrescine. The fur mutant lost most of its flagella and motility. Finally, the CRISPR/Cas and a prophage encoding operon were downregulated. Fur binding sites were found upstream of around 20 of the regulated genes. Overall, adaptation to low iron conditions in C. difficile focused on an increase of iron import, a significant replacement of iron requiring metabolic pathways and the restructuring of the cell surface for protection during the complex adaptation phase and was only partly directly regulated by Fur.},
}
@article {pmid30400152,
year = {2018},
author = {Koslová, A and Kučerová, D and Reinišová, M and Geryk, J and Trefil, P and Hejnar, J},
title = {Genetic Resistance to Avian Leukosis Viruses Induced by CRISPR/Cas9 Editing of Specific Receptor Genes in Chicken Cells.},
journal = {Viruses},
volume = {10},
number = {11},
pages = {},
pmid = {30400152},
issn = {1999-4915},
mesh = {Animals ; Avian Leukosis/*genetics/*virology ; Avian Leukosis Virus/*physiology ; Base Sequence ; *CRISPR-Cas Systems ; Cell Line ; Chickens ; Disease Resistance/*genetics ; *Gene Editing ; Genes, Viral ; Genetic Techniques ; Genetic Vectors/genetics ; RNA, Guide ; Receptors, Virus/*genetics/metabolism ; },
abstract = {Avian leukosis viruses (ALVs), which are pathogens of concern in domestic poultry, utilize specific receptor proteins for cell entry that are both necessary and sufficient for host susceptibility to a given ALV subgroup. This unequivocal relationship offers receptors as suitable targets of selection and biotechnological manipulation with the aim of obtaining virus-resistant poultry. This approach is further supported by the existence of natural knock-outs of receptor genes that segregate in inbred lines of chickens. We used CRISPR/Cas9 genome editing tools to introduce frame-shifting indel mutations into tva, tvc, and tvj loci encoding receptors for the A, C, and J ALV subgroups, respectively. For all three loci, the homozygous frame-shifting indels generating premature stop codons induced phenotypes which were fully resistant to the virus of respective subgroup. In the tvj locus, we also obtained in-frame deletions corroborating the importance of W38 and the four amino-acids preceding it. We demonstrate that CRISPR/Cas9-mediated knock-out or the fine editing of ALV receptor genes might be the first step in the development of virus-resistant chickens.},
}
@article {pmid29496999,
year = {2018},
author = {Yokoyama, CC and Baldridge, MT and Leung, DW and Zhao, G and Desai, C and Liu, TC and Diaz-Ochoa, VE and Huynh, JP and Kimmey, JM and Sennott, EL and Hole, CR and Idol, RA and Park, S and Storek, KM and Wang, C and Hwang, S and Viehmann Milam, A and Chen, E and Kerrinnes, T and Starnbach, MN and Handley, SA and Mysorekar, IU and Allen, PM and Monack, DM and Dinauer, MC and Doering, TL and Tsolis, RM and Dworkin, JE and Stallings, CL and Amarasinghe, GK and Micchelli, CA and Virgin, HW},
title = {LysMD3 is a type II membrane protein without an in vivo role in the response to a range of pathogens.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {16},
pages = {6022-6038},
pmid = {29496999},
issn = {1083-351X},
support = {R01 AI102882/AI/NIAID NIH HHS/United States ; R01 AI109799/AI/NIAID NIH HHS/United States ; U19 AI113187/AI/NIAID NIH HHS/United States ; T32 AI007163/AI/NIAID NIH HHS/United States ; T32 GM007067/GM/NIGMS NIH HHS/United States ; T32 AI007172/AI/NIAID NIH HHS/United States ; F32 AI108089/AI/NIAID NIH HHS/United States ; R01 DK100644/DK/NIDDK NIH HHS/United States ; R01 AI095396/AI/NIAID NIH HHS/United States ; U19 AI109725/AI/NIAID NIH HHS/United States ; P30 CA091842/CA/NCI NIH HHS/United States ; P30 AR048335/AR/NIAMS NIH HHS/United States ; },
mesh = {Animals ; Autoantigens/analysis ; Bacterial Infections/genetics/immunology ; CRISPR-Cas Systems ; Female ; *Gene Deletion ; Immunity, Innate ; Inflammation/genetics/immunology ; Male ; Membrane Proteins/analysis ; Mice ; Mycoses/genetics/immunology ; Phylogeny ; Virus Diseases/genetics/immunology ; },
abstract = {Germline-encoded receptors recognizing common pathogen-associated molecular patterns are a central element of the innate immune system and play an important role in shaping the host response to infection. Many of the innate immune molecules central to these signaling pathways are evolutionarily conserved. LysMD3 is a novel molecule containing a putative peptidoglycan-binding domain that has orthologs in humans, mice, zebrafish, flies, and worms. We found that the lysin motif (LysM) of LysMD3 is likely related to a previously described peptidoglycan-binding LysM found in bacteria. Mouse LysMD3 is a type II integral membrane protein that co-localizes with GM130+ structures, consistent with localization to the Golgi apparatus. We describe here two lines of mLysMD3-deficient mice for in vivo characterization of mLysMD3 function. We found that mLysMD3-deficient mice were born at Mendelian ratios and had no obvious pathological abnormalities. They also exhibited no obvious immune response deficiencies in a number of models of infection and inflammation. mLysMD3-deficient mice exhibited no signs of intestinal dysbiosis by 16S analysis or alterations in intestinal gene expression by RNA sequencing. We conclude that mLysMD3 contains a LysM with cytoplasmic orientation, but we were unable to define a physiological role for the molecule in vivo.},
}
@article {pmid29378572,
year = {2018},
author = {Peng, R and Wang, Y and Feng, WW and Yue, XJ and Chen, JH and Hu, XZ and Li, ZF and Sheng, DH and Zhang, YM and Li, YZ},
title = {CRISPR/dCas9-mediated transcriptional improvement of the biosynthetic gene cluster for the epothilone production in Myxococcus xanthus.},
journal = {Microbial cell factories},
volume = {17},
number = {1},
pages = {15},
pmid = {29378572},
issn = {1475-2859},
support = {31471183//National Natural Science Foundation of China/ ; 31670076//National Natural Science Foundation of China/ ; 31370123//National Natural Science Foundation of China/ ; ZR2016QZ002//Key Program of Shandong Natural Science Foundation/ ; },
mesh = {CRISPR-Associated Protein 9/genetics/metabolism ; CRISPR-Cas Systems/*genetics ; Epothilones/*biosynthesis/genetics ; *Multigene Family ; Myxococcus xanthus/*genetics/metabolism ; Promoter Regions, Genetic ; RNA, Guide/genetics ; Recombinant Proteins/*genetics ; Secondary Metabolism ; *Transcription, Genetic ; Transcriptional Activation ; },
abstract = {BACKGROUND: The CRISPR/dCas9 system is a powerful tool to activate the transcription of target genes in eukaryotic or prokaryotic cells, but lacks assays in complex conditions, such as the biosynthesis of secondary metabolites.<br><br>RESULTS: In this study, to improve the transcription of the heterologously expressed biosynthetic genes for the production of epothilones, we established the CRISPR/dCas9-mediated activation technique in Myxococcus xanthus and analyzed some key factors involving in the CRISPR/dCas9 activation. We firstly optimized the cas9 codon to fit the M. xanthus cells, mutated the gene to inactivate the nuclease activity, and constructed the dCas9-activator system in an epothilone producer. We compared the improvement efficiency of different sgRNAs on the production of epothilones and the expression of the biosynthetic genes. We also compared the improvement effects of different activator proteins, the ω and α subunits of RNA polymerase, and the sigma factors σ54 and CarQ. By using a copper-inducible promoter, we determined that higher expressions of dCas9-activator improved the activation effects.<br><br>CONCLUSIONS: Our results showed that the CRISPR/dCas-mediated transcription activation is a simple and broadly applicable technique to improve the transcriptional efficiency for the production of secondary metabolites in microorganisms. This is the first time to construct the CRISPR/dCas9 activation system in myxobacteria and the first time to assay the CRISPR/dCas9 activations for the biosynthesis of microbial secondary metabolites.},
}
@article {pmid29316926,
year = {2018},
author = {Park, J and Shin, H and Lee, SM and Um, Y and Woo, HM},
title = {RNA-guided single/double gene repressions in Corynebacterium glutamicum using an efficient CRISPR interference and its application to industrial strain.},
journal = {Microbial cell factories},
volume = {17},
number = {1},
pages = {4},
pmid = {29316926},
issn = {1475-2859},
support = {2017M1A8A1072034//National Research Foundation of Korea/ ; 2017R1A2B2002566//National Research Foundation of Korea/ ; },
mesh = {CRISPR-Cas Systems ; Citrate (si)-Synthase/genetics ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Corynebacterium glutamicum/*genetics ; Gene Expression Regulation, Bacterial ; Gene Silencing/*physiology ; Genetic Vectors ; Metabolic Engineering/methods ; Plasmids ; RNA, Guide/*genetics ; Synthetic Biology/*methods ; },
abstract = {BACKGROUND: The construction of microbial cell factories requires cost-effective and rapid strain development through metabolic engineering. Recently, RNA-guided CRISPR technologies have been developed for metabolic engineering of industrially-relevant host.<br><br>RESULTS: To demonstrate the application of the CRISPR interference (CRISPRi), we developed two-plasmid CRISPRi vectors and applied the CRISPRi in Corynebacterium glutamicum to repress single target genes and double target genes simultaneously. Four-different single genes (the pyc, gltA, idsA, and glgC genes) repressions were successfully performed using the CRISPRi vectors, resulting significant mRNA reductions of the targets compared to a control. Subsequently, the phenotypes for the target gene-repressed strains were analyzed, showing the expected cell growth behaviors with different carbon sources. In addition, double gene repression (the idsA and glgC genes in a different order) by the CRISPRi resulted in an independent gene repression to each target gene simultaneously. To demonstrate an industrial application of the CRISPRi, citrate synthase (CS)-targeting DM1919 (L-lysine producer) strains with a sgRNA-gltA-r showed reduced CS activity, resulting in the improvement of L-lysine yield by 1.39-fold than the parental DM1919 (a lysine producer).<br><br>CONCLUSIONS: Single or double gene repression were successfully performed using the CRISPRi vectors and sequence specific sgRNAs. The CRISPRi can be applied for multiplex metabolic engineering to enhanced lysine production and it will promote the further rapid development of microbial cell factories of C. glutamicum.},
}
@article {pmid30615645,
year = {2019},
author = {Price, MA and Cruz, R and Baxter, S and Escalettes, F and Rosser, SJ},
title = {CRISPR-Cas9 In Situ engineering of subtilisin E in Bacillus subtilis.},
journal = {PloS one},
volume = {14},
number = {1},
pages = {e0210121},
doi = {10.1371/journal.pone.0210121},
pmid = {30615645},
issn = {1932-6203},
abstract = {CRISPR-Cas systems have become widely used across all fields of biology as a genome engineering tool. With its recent demonstration in the Gram positive industrial workhorse Bacillus subtilis, this tool has become an attractive option for rapid, markerless strain engineering of industrial production hosts. Previously described strategies for CRISPR-Cas9 genome editing in B. subtilis have involved chromosomal integrations of Cas9 and single guide RNA expression cassettes, or construction of large plasmids for simultaneous transformation of both single guide RNA and donor DNA. Here we use a flexible, co-transformation approach where the single guide RNA is inserted in a plasmid for Cas9 co-expression, and the donor DNA is supplied as a linear PCR product observing an editing efficiency of 76%. This allowed multiple, rapid rounds of in situ editing of the subtilisin E gene to incorporate a salt bridge triad present in the Bacillus clausii thermotolerant homolog, M-protease. A novel subtilisin E variant was obtained with increased thermotolerance and activity.},
}
@article {pmid30251625,
year = {2018},
author = {Emmer, BT and Hesketh, GG and Kotnik, E and Tang, VT and Lascuna, PJ and Xiang, J and Gingras, AC and Chen, XW and Ginsburg, D},
title = {The cargo receptor SURF4 promotes the efficient cellular secretion of PCSK9.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30251625},
issn = {2050-084X},
support = {R35 HL135793/HL/NHLBI NIH HHS/United States ; T32 HL007853/HL/NHLBI NIH HHS/United States ; R35-HL135793T/HL/NHLBI NIH HHS/United States ; T32-HL007853/HL/NHLBI NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Biotinylation ; CRISPR-Cas Systems/genetics ; Endoplasmic Reticulum/metabolism ; Gene Deletion ; HEK293 Cells ; Humans ; Membrane Proteins/*metabolism ; Mutagenesis/genetics ; Proprotein Convertase 9/*metabolism ; Protein Binding ; Recombinant Fusion Proteins/metabolism ; Secretory Pathway ; },
abstract = {PCSK9 is a secreted protein that regulates plasma cholesterol levels and cardiovascular disease risk. Prior studies suggested the presence of an ER cargo receptor that recruits PCSK9 into the secretory pathway, but its identity has remained elusive. Here, we apply a novel approach that combines proximity-dependent biotinylation and proteomics together with genome-scale CRISPR screening to identify SURF4, a homologue of the yeast cargo receptor Erv29p, as a primary mediator of PCSK9 secretion in HEK293T cells. The functional contribution of SURF4 to PCSK9 secretion was confirmed with multiple independent SURF4-targeting sgRNAs, clonal SURF4-deficient cell lines, and functional rescue with SURF4 cDNA. SURF4 was found to localize to the early secretory pathway where it physically interacts with PCSK9. Deletion of SURF4 resulted in ER accumulation and decreased extracellular secretion of PCSK9. These findings support a model in which SURF4 functions as an ER cargo receptor mediating the efficient cellular secretion of PCSK9.},
}
@article {pmid30202008,
year = {2018},
author = {Palin, K and Pitkänen, E and Turunen, M and Sahu, B and Pihlajamaa, P and Kivioja, T and Kaasinen, E and Välimäki, N and Hänninen, UA and Cajuso, T and Aavikko, M and Tuupanen, S and Kilpivaara, O and van den Berg, L and Kondelin, J and Tanskanen, T and Katainen, R and Grau, M and Rauanheimo, H and Plaketti, RM and Taira, A and Sulo, P and Hartonen, T and Dave, K and Schmierer, B and Botla, S and Sokolova, M and Vähärautio, A and Gladysz, K and Ongen, H and Dermitzakis, E and Bramsen, JB and Ørntoft, TF and Andersen, CL and Ristimäki, A and Lepistö, A and Renkonen-Sinisalo, L and Mecklin, JP and Taipale, J and Aaltonen, LA},
title = {Contribution of allelic imbalance to colorectal cancer.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3664},
pmid = {30202008},
issn = {2041-1723},
mesh = {*Allelic Imbalance ; CRISPR-Cas Systems ; Chromosome Aberrations ; Chromosomes, Human, Pair 8 ; Colorectal Neoplasms/*genetics/pathology ; DNA Copy Number Variations ; Denmark ; Gene Expression Profiling ; *Genetic Predisposition to Disease ; Genomics ; Genotype ; Humans ; Loss of Heterozygosity ; Microsatellite Repeats ; Phenotype ; Point Mutation ; Proto-Oncogene Proteins p21(ras)/genetics ; RNA, Small Interfering/genetics ; Transcription Factors/genetics ; Tumor Suppressor Protein p53/genetics ; Whole Genome Sequencing ; },
abstract = {Point mutations in cancer have been extensively studied but chromosomal gains and losses have been more challenging to interpret due to their unspecific nature. Here we examine high-resolution allelic imbalance (AI) landscape in 1699 colorectal cancers, 256 of which have been whole-genome sequenced (WGSed). The imbalances pinpoint 38 genes as plausible AI targets based on previous knowledge. Unbiased CRISPR-Cas9 knockout and activation screens identified in total 79 genes within AI peaks regulating cell growth. Genetic and functional data implicate loss of TP53 as a sufficient driver of AI. The WGS highlights an influence of copy number aberrations on the rate of detected somatic point mutations. Importantly, the data reveal several associations between AI target genes, suggesting a role for a network of lineage-determining transcription factors in colorectal tumorigenesis. Overall, the results unravel the contribution of AI in colorectal cancer and provide a plausible explanation why so few genes are commonly affected by point mutations in cancers.},
}
@article {pmid30178747,
year = {2018},
author = {Li, R and Bernau, K and Sandbo, N and Gu, J and Preissl, S and Sun, X},
title = {Pdgfra marks a cellular lineage with distinct contributions to myofibroblasts in lung maturation and injury response.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30178747},
issn = {2050-084X},
support = {R01 HL097134/HL/NHLBI NIH HHS/United States ; R01 HL122406/HL/NHLBI NIH HHS/United States ; R01 HL142215/HL/NHLBI NIH HHS/United States ; RO1 HL142215,RO1 HL097134,RO1 HL122406/HL/NHLBI NIH HHS/United States ; },
mesh = {Animals ; Bleomycin ; CRISPR-Cas Systems/genetics ; *Cell Lineage ; Cell Proliferation ; Disease Models, Animal ; Gene Deletion ; Gene Expression Profiling ; Gene Knock-In Techniques ; Green Fluorescent Proteins/metabolism ; Homologous Recombination/genetics ; Hyperoxia/pathology ; Lung/*growth &amp; development/metabolism/*pathology ; Mice, Transgenic ; Myofibroblasts/*metabolism/*pathology ; Pulmonary Fibrosis/pathology ; Receptor, Platelet-Derived Growth Factor alpha/*metabolism ; Single-Cell Analysis ; },
abstract = {Pdgfra-expressing (Pdgfra+) cells have been implicated as progenitors in many mesenchymal tissues. To determine lineage potential, we generated PdgfrartTA knockin mice using CRISPR/Cas9. During lung maturation, counter to a prior study reporting that Pdgfra+ cells give rise equally to myofibroblasts and lipofibroblasts, lineage tracing using PdgfrartTA;tetO-cre mice indicated that ~95% of the lineaged cells are myofibroblasts. Genetic ablation of Pdgfra+ cells using PdgfrartTA-driven diphtheria toxin (DTA) led to alveolar simplification, demonstrating that these cells are essential for building the gas exchange surface area. In the adult bleomycin model of lung fibrosis, lineaged cells increased to contribute to pathological myofibroblasts. In contrast, in a neonatal hyperoxia model of bronchopulmonary dysplasia (BPD), lineaged cells decreased and do not substantially contribute to pathological myofibroblasts. Our findings revealed complexity in the behavior of the Pdgfra-lineaged cells as exemplified by their distinct contributions to myofibroblasts in normal maturation, BPD and adult fibrosis.},
}
@article {pmid30170115,
year = {2018},
author = {Pankowicz, FP and Barzi, M and Kim, KH and Legras, X and Martins, CS and Wooton-Kee, CR and Lagor, WR and Marini, JC and Elsea, SH and Bissig-Choisat, B and Moore, DD and Bissig, KD},
title = {Rapid Disruption of Genes Specifically in Livers of Mice Using Multiplex CRISPR/Cas9 Editing.},
journal = {Gastroenterology},
volume = {155},
number = {6},
pages = {1967-1970.e6},
doi = {10.1053/j.gastro.2018.08.037},
pmid = {30170115},
issn = {1528-0012},
support = {R01 DK115461/DK/NIDDK NIH HHS/United States ; R01 HL132840/HL/NHLBI NIH HHS/United States ; R01 HL134510/HL/NHLBI NIH HHS/United States ; R56 DK115461/DK/NIDDK NIH HHS/United States ; T32 HL092332/HL/NHLBI NIH HHS/United States ; P30 CA125123/CA/NCI NIH HHS/United States ; P30 DK056338/DK/NIDDK NIH HHS/United States ; },
mesh = {ATP Binding Cassette Transporter, Subfamily B, Member 11/genetics ; Animals ; Argininosuccinate Lyase/*genetics ; CRISPR-Associated Protein 9/*administration &amp; dosage ; CRISPR-Cas Systems/*genetics ; Disease Models, Animal ; Gene Editing/*methods ; Hepatocytes/enzymology/physiology ; Liver/*enzymology ; Mice ; Mice, Knockout ; Oxidoreductases/genetics ; Phenotype ; Plasmids/genetics ; },
abstract = {BACKGROUND &amp; AIMS: Despite advances in gene editing technologies, generation of tissue-specific knockout mice is time-consuming. We used CRISPR/Cas9-mediated genome editing to disrupt genes in livers of adult mice in just a few months, which we refer to as somatic liver knockouts.<br><br>METHODS: In this system, Fah-/- mice are given hydrodynamic tail vein injections of plasmids carrying CRISPR/Cas9 designed to excise exons in Hpd; the Hpd-edited hepatocytes have a survival advantage in these mice. Plasmids that target Hpd and a separate gene of interest can therefore be used to rapidly generate mice with liver-specific deletion of nearly any gene product.<br><br>RESULTS: We used this system to create mice with liver-specific knockout of argininosuccinate lyase, which develop hyperammonemia, observed in humans with mutations in this gene. We also created mice with liver-specific knockout of ATP binding cassette subfamily B member 11, which encodes the bile salt export pump. We found that these mice have a biochemical phenotype similar to that of Abcb11-/- mice. We then used this system to knock out expression of 5 different enzymes involved in drug metabolism within the same mouse.<br><br>CONCLUSIONS: This approach might be used to develop new models of liver diseases and study liver functions of genes that are required during development.},
}
@article {pmid30082838,
year = {2018},
author = {Lee, JK and Jeong, E and Lee, J and Jung, M and Shin, E and Kim, YH and Lee, K and Jung, I and Kim, D and Kim, S and Kim, JS},
title = {Directed evolution of CRISPR-Cas9 to increase its specificity.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3048},
pmid = {30082838},
issn = {2041-1723},
mesh = {*CRISPR-Cas Systems ; DNA/genetics ; *Directed Molecular Evolution ; Escherichia coli/genetics ; Gene Editing ; HEK293 Cells ; Humans ; Plasmids/metabolism ; RNA, Guide/genetics ; Recombinant Proteins/chemistry ; Ribonucleoproteins/chemistry ; Substrate Specificity ; },
abstract = {The use of CRISPR-Cas9 as a therapeutic reagent is hampered by its off-target effects. Although rationally designed S. pyogenes Cas9 (SpCas9) variants that display higher specificities than the wild-type SpCas9 protein are available, these attenuated Cas9 variants are often poorly efficient in human cells. Here, we develop a directed evolution approach in E. coli to obtain Sniper-Cas9, which shows high specificities without killing on-target activities in human cells. Unlike other engineered Cas9 variants, Sniper-Cas9 shows WT-level on-target activities with extended or truncated sgRNAs with further reduced off-target activities and works well in a preassembled ribonucleoprotein (RNP) format to allow DNA-free genome editing.},
}
@article {pmid30082728,
year = {2018},
author = {Elster, D and Tollot, M and Schlegelmilch, K and Ori, A and Rosenwald, A and Sahai, E and von Eyss, B},
title = {TRPS1 shapes YAP/TEAD-dependent transcription in breast cancer cells.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3115},
pmid = {30082728},
issn = {2041-1723},
support = {//Wellcome Trust/United Kingdom ; },
mesh = {Acetylation ; Animals ; Binding Sites ; Breast Neoplasms/*genetics/metabolism ; CRISPR-Cas Systems ; Cell Line, Tumor ; Chromatin/metabolism ; DNA-Binding Proteins/*genetics/*metabolism ; Enhancer Elements, Genetic ; Epigenesis, Genetic ; Female ; *Gene Expression Regulation, Neoplastic ; Genomics ; HEK293 Cells ; Humans ; MCF-7 Cells ; Mice ; Mice, Inbred BALB C ; Neoplasm Transplantation ; Promoter Regions, Genetic ; RNA, Small Interfering/metabolism ; Tissue Array Analysis ; Transcription Factors/*genetics/*metabolism ; Transcriptional Activation ; },
abstract = {Yes-associated protein (YAP), the downstream transducer of the Hippo pathway, is a key regulator of organ size, differentiation and tumorigenesis. To uncover Hippo-independent YAP regulators, we performed a genome-wide CRISPR screen that identifies the transcriptional repressor protein Trichorhinophalangeal Syndrome 1 (TRPS1) as a potent repressor of YAP-dependent transactivation. We show that TRPS1 globally regulates YAP-dependent transcription by binding to a large set of joint genomic sites, mainly enhancers. TRPS1 represses YAP-dependent function by recruiting a spectrum of corepressor complexes to joint sites. Loss of TRPS1 leads to activation of enhancers due to increased H3K27 acetylation and an altered promoter-enhancer interaction landscape. TRPS1 is commonly amplified in breast cancer, which suggests that restrained YAP activity favours tumour growth. High TRPS1 activity is associated with decreased YAP activity and leads to decreased frequency of tumour-infiltrating immune cells. Our study uncovers TRPS1 as an epigenetic regulator of YAP activity in breast cancer.},
}
@article {pmid29786095,
year = {2018},
author = {Guo, X and Chavez, A and Tung, A and Chan, Y and Kaas, C and Yin, Y and Cecchi, R and Garnier, SL and Kelsic, ED and Schubert, M and DiCarlo, JE and Collins, JJ and Church, GM},
title = {High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR-Cas9 in yeast.},
journal = {Nature biotechnology},
volume = {36},
number = {6},
pages = {540-546},
pmid = {29786095},
issn = {1546-1696},
support = {P50 HG005550/HG/NHGRI NIH HHS/United States ; RM1 HG008525/HG/NHGRI NIH HHS/United States ; T32 CA009216/CA/NCI NIH HHS/United States ; },
mesh = {Base Sequence ; Biotechnology ; CRISPR-Cas Systems ; Conserved Sequence ; DNA, Fungal/*genetics ; *Gene Library ; Genetic Variation ; High-Throughput Nucleotide Sequencing ; Open Reading Frames ; Point Mutation ; RecQ Helicases/genetics ; Saccharomyces cerevisiae/enzymology/*genetics/growth &amp; development ; Saccharomyces cerevisiae Proteins/genetics ; Sequence Deletion ; },
abstract = {Construction and characterization of large genetic variant libraries is essential for understanding genome function, but remains challenging. Here, we introduce a Cas9-based approach for generating pools of mutants with defined genetic alterations (deletions, substitutions, and insertions) with an efficiency of 80-100% in yeast, along with methods for tracking their fitness en masse. We demonstrate the utility of our approach by characterizing the DNA helicase SGS1 with small tiling deletion mutants that span the length of the protein and a series of point mutations against highly conserved residues in the protein. In addition, we created a genome-wide library targeting 315 poorly characterized small open reading frames (smORFs, <100 amino acids in length) scattered throughout the yeast genome, and assessed which are vital for growth under various environmental conditions. Our strategy allows fundamental biological questions to be investigated in a high-throughput manner with precision.},
}
@article {pmid29734295,
year = {2018},
author = {Bao, Z and HamediRad, M and Xue, P and Xiao, H and Tasan, I and Chao, R and Liang, J and Zhao, H},
title = {Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.},
journal = {Nature biotechnology},
volume = {36},
number = {6},
pages = {505-508},
pmid = {29734295},
issn = {1546-1696},
mesh = {Amino Acid Sequence ; Base Sequence ; Biotechnology ; CRISPR-Cas Systems ; DNA, Fungal/genetics ; Directed Molecular Evolution ; Gene Editing/methods ; Genetic Engineering/*methods ; Genome, Fungal ; Models, Molecular ; Mutagenesis ; Recombinational DNA Repair ; Saccharomyces cerevisiae/enzymology/*genetics ; Saccharomyces cerevisiae Proteins/chemistry/genetics/metabolism ; Ubiquitin-Protein Ligases/chemistry/genetics/metabolism ; },
abstract = {We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.},
}
@article {pmid29734294,
year = {2018},
author = {Roy, KR and Smith, JD and Vonesch, SC and Lin, G and Tu, CS and Lederer, AR and Chu, A and Suresh, S and Nguyen, M and Horecka, J and Tripathi, A and Burnett, WT and Morgan, MA and Schulz, J and Orsley, KM and Wei, W and Aiyar, RS and Davis, RW and Bankaitis, VA and Haber, JE and Salit, ML and St Onge, RP and Steinmetz, LM},
title = {Multiplexed precision genome editing with trackable genomic barcodes in yeast.},
journal = {Nature biotechnology},
volume = {36},
number = {6},
pages = {512-520},
pmid = {29734294},
issn = {1546-1696},
support = {P01 HG000205/HG/NHGRI NIH HHS/United States ; 294542//European Research Council/International ; R01 GM044530/GM/NIGMS NIH HHS/United States ; U01 GM110706/GM/NIGMS NIH HHS/United States ; R01 GM121932/GM/NIGMS NIH HHS/United States ; R01 GM061766/GM/NIGMS NIH HHS/United States ; R37 GM020056/GM/NIGMS NIH HHS/United States ; },
mesh = {Amino Acid Substitution ; Biotechnology ; CRISPR-Cas Systems ; DNA Barcoding, Taxonomic/*methods ; DNA, Fungal/genetics ; Gene Editing/*methods ; Genome, Fungal ; Homologous Recombination ; Phospholipid Transfer Proteins/genetics ; Plasmids/genetics ; RNA, Fungal/genetics ; Saccharomyces cerevisiae/*genetics ; Saccharomyces cerevisiae Proteins/genetics ; },
abstract = {Our understanding of how genotype controls phenotype is limited by the scale at which we can precisely alter the genome and assess the phenotypic consequences of each perturbation. Here we describe a CRISPR-Cas9-based method for multiplexed accurate genome editing with short, trackable, integrated cellular barcodes (MAGESTIC) in Saccharomyces cerevisiae. MAGESTIC uses array-synthesized guide-donor oligos for plasmid-based high-throughput editing and features genomic barcode integration to prevent plasmid barcode loss and to enable robust phenotyping. We demonstrate that editing efficiency can be increased more than fivefold by recruiting donor DNA to the site of breaks using the LexA-Fkh1p fusion protein. We performed saturation editing of the essential gene SEC14 and identified amino acids critical for chemical inhibition of lipid signaling. We also constructed thousands of natural genetic variants, characterized guide mismatch tolerance at the genome scale, and ascertained that cryptic Pol III termination elements substantially reduce guide efficacy. MAGESTIC will be broadly useful to uncover the genetic basis of phenotypes in yeast.},
}
@article {pmid29526697,
year = {2018},
author = {Maass, PG and Barutcu, AR and Weiner, CL and Rinn, JL},
title = {Inter-chromosomal Contact Properties in Live-Cell Imaging and in Hi-C.},
journal = {Molecular cell},
volume = {69},
number = {6},
pages = {1039-1045.e3},
pmid = {29526697},
issn = {1097-4164},
support = {P01 GM099117/GM/NIGMS NIH HHS/United States ; R01 MH102416/MH/NIMH NIH HHS/United States ; U01 DA040612/DA/NIDA NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Animals ; CRISPR-Cas Systems ; Cell Line ; Chromosomes, Human/*genetics/metabolism ; Female ; Gene Editing/methods ; Humans ; Image Processing, Computer-Assisted/methods ; Kinetics ; Male ; Mice ; Microscopy, Confocal/*methods ; Mouse Embryonic Stem Cells/metabolism ; Nucleic Acid Conformation ; Protein Conformation ; Retinal Pigment Epithelium/metabolism ; Time-Lapse Imaging/*methods ; },
abstract = {Imaging (fluorescence in situ hybridization [FISH]) and genome-wide chromosome conformation capture (Hi-C) are two major approaches to the study of higher-order genome organization in the nucleus. Intra-chromosomal and inter-chromosomal interactions (referred to as non-homologous chromosomal contacts [NHCCs]) have been observed by several FISH-based studies, but locus-specific NHCCs have not been detected by Hi-C. Due to crosslinking, neither of these approaches assesses spatiotemporal properties. Toward resolving the discrepancies between imaging and Hi-C, we sought to understand the spatiotemporal properties of NHCCs in living cells by CRISPR/Cas9 live-cell imaging (CLING). In mammalian cells, we find that NHCCs are stable and occur as frequently as intra-chromosomal interactions, but NHCCs occur at farther spatial distance that could explain their lack of detection in Hi-C. By revealing the spatiotemporal properties in living cells, our study provides fundamental insights into the biology of NHCCs.},
}
@article {pmid29453285,
year = {2018},
author = {Tamura, I and Jozaki, K and Sato, S and Shirafuta, Y and Shinagawa, M and Maekawa, R and Taketani, T and Asada, H and Tamura, H and Sugino, N},
title = {The distal upstream region of insulin-like growth factor-binding protein-1 enhances its expression in endometrial stromal cells during decidualization.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {14},
pages = {5270-5280},
pmid = {29453285},
issn = {1083-351X},
mesh = {Acetylation ; CCAAT-Enhancer-Binding Protein-beta/metabolism ; CRISPR-Cas Systems ; Cyclic AMP/metabolism ; Decidua/metabolism ; E1A-Associated p300 Protein ; Embryo Implantation ; Endometrium/metabolism ; Enhancer Elements, Genetic/genetics ; Epithelial Cells/metabolism ; Female ; Forkhead Box Protein O1 ; Gene Expression Regulation/genetics ; Hep G2 Cells/metabolism ; Humans ; Insulin-Like Growth Factor Binding Protein 1/*genetics/*metabolism ; Prolactin/metabolism ; Promoter Regions, Genetic/drug effects ; Stromal Cells/metabolism ; Transcriptome/genetics ; },
abstract = {We have previously shown that decidualization of human endometrial stromal cells (ESCs) causes a genome-wide increase in the levels of acetylation of histone-H3 Lys-27 (H3K27ac). We also reported that the distal gene regions, more than 3 kb up- or downstream of gene transcription start sites have increased H3K27ac levels. Insulin-like growth factor-binding protein-1 (IGFBP-1) is a specific decidualization marker and has increased H3K27ac levels in its distal upstream region (-4701 to -7501 bp). Here, using a luciferase reporter gene construct containing this IGFBP-1 upstream region, we tested the hypothesis that it is an IGFBP-1 enhancer. To induce decidualization, we incubated ESCs with cAMP and found that cAMP increased luciferase expression, indicating that decidualization increased the transcriptional activity from the IGFBP-1 upstream region. Furthermore, CRISPR/Cas9-mediated deletion of this region in HepG2 cells significantly reduced IGFBP-1 expression, confirming its role as an IGFBP-1 enhancer. A ChIP assay revealed that cAMP increased the recruitment of the transcriptional regulators CCAAT enhancer-binding protein β (C/EBPβ), forkhead box O1 (FOXO1), and p300 to the IGFBP-1 enhancer in ESCs. Of note, C/EBPβ knockdown inhibited the stimulatory effects of cAMP on the levels of H3K27ac, chromatin opening, and p300 recruitment at the IGFBP-1 enhancer. These results indicate that the region -4701 to -7501 bp upstream of IGFBP-1 functions as an enhancer for IGFBP-1 expression in ESCs undergoing decidualization, that C/EBPβ and FOXO1 bind to the enhancer region to up-regulate IGFBP-1 expression, and that C/EBPβ induces H3K27ac by recruiting p300 to the IGFBP-1 enhancer.},
}
@article {pmid29161010,
year = {2018},
author = {Nihongaki, Y and Otabe, T and Sato, M},
title = {Emerging Approaches for Spatiotemporal Control of Targeted Genome with Inducible CRISPR-Cas9.},
journal = {Analytical chemistry},
volume = {90},
number = {1},
pages = {429-439},
doi = {10.1021/acs.analchem.7b04757},
pmid = {29161010},
issn = {1520-6882},
mesh = {Animals ; CRISPR-Associated Protein 9/chemistry/*genetics/radiation effects ; CRISPR-Cas Systems/*genetics ; Gene Targeting/*methods ; Genetic Engineering/*methods ; Genome/*genetics ; Humans ; Light ; },
}
@article {pmid30610648,
year = {2019},
author = {Park, J and Choi, S and Park, S and Yoon, J and Park, AY and Choe, S},
title = {DNA-Free Genome Editing via Ribonucleoprotein (RNP) Delivery of CRISPR/Cas in Lettuce.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1917},
number = {},
pages = {337-354},
doi = {10.1007/978-1-4939-8991-1_25},
pmid = {30610648},
issn = {1940-6029},
abstract = {CRISPR/Cas9 nuclease system is getting popular in precise genome editing of both eukaryotic and prokaryotic systems due to its accuracy, programmability, and relative ease of use. CRISPR/Cas systems can be delivered into live cells via plasmid DNA, RNA, and ribonucleoprotein (RNP). Of these, the RNP method is of special interest due to enzymatic action in shorter time and controllability over their activity. In addition, because RNP does not involve DNA, none of unwanted DNA footprints are left in the host genome. Previously, we demonstrated that plant protoplasts can be transfected with functional RNPs and the whole plants can be regenerated from an engineered protoplast. Relative to the published methods, the revised protocols described here should help increase the success rate of whole plant regeneration by reducing damages to the naked protoplast cells.},
}
@article {pmid30610633,
year = {2019},
author = {Lee, K and Zhu, H and Yang, B and Wang, K},
title = {An Agrobacterium-Mediated CRISPR/Cas9 Platform for Genome Editing in Maize.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1917},
number = {},
pages = {121-143},
doi = {10.1007/978-1-4939-8991-1_10},
pmid = {30610633},
issn = {1940-6029},
abstract = {Precise genome engineering can be efficiently made using the revolutionary tool named CRISPR/Cas (clustered regularly interspaced short palindromic repeat/CRISPR-associated protein) systems. Adapted from the bacterial immune system, CRISPR/Cas systems can generate highly specific double-strand breaks (DSBs) at the target site, and desired sequence modifications can be introduced during the DSB repair process, such as nonhomologous end-joining (NHEJ) or homology-directed repair (HDR) pathways. CRISPR/Cas9 is the most widely used genome editing tool for targeted mutagenesis, precise sequence modification, transcriptional reprogramming, epigenome editing, disease treatment, and many more. The ease of use and high specificity make CRISPR/Cas9 a great tool not only for basic researches but also for crop trait improvements, such as higher grain yield, better tolerance to abiotic stresses, enhanced disease resistance, and better nutritional contents. In this protocol, we present a step-by-step guide to the CRISPR/Cas9-mediated targeted mutagenesis in maize Hi II genotype. Detailed procedures will guide through the essential steps including gRNA design, CRISPR/Cas9 vector construction, Agrobacterium-mediated maize immature embryo transformation, and molecular analysis of the transgenic plants to identify desired mutant lines.},
}
@article {pmid30607331,
year = {2018},
author = {Bayat, H and Naderi, F and Khan, AH and Memarnejadian, A and Rahimpour, A},
title = {The Impact of CRISPR-Cas System on Antiviral Therapy.},
journal = {Advanced pharmaceutical bulletin},
volume = {8},
number = {4},
pages = {591-597},
doi = {10.15171/apb.2018.067},
pmid = {30607331},
issn = {2228-5881},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein nuclease (Cas) is identified as an adaptive immune system in archaea and bacteria. Type II of this system, CRISPR-Cas9, is the most versatile form that has enabled facile and efficient targeted genome editing. Viral infections have serious impacts on global health and conventional antiviral therapies have not yielded a successful solution hitherto. The CRISPR-Cas9 system represents a promising tool for eliminating viral infections. In this review, we highlight 1) the recent progress of CRISPR-Cas technology in decoding and diagnosis of viral outbreaks, 2) its applications to eliminate viral infections in both pre-integration and provirus stages, and 3) various delivery systems that are employed to introduce the platform into target cells.},
}
@article {pmid30606466,
year = {2018},
author = {Liu, L and Yin, M and Wang, M and Wang, Y},
title = {Phage AcrIIA2 DNA Mimicry: Structural Basis of the CRISPR and Anti-CRISPR Arms Race.},
journal = {Molecular cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.molcel.2018.11.011},
pmid = {30606466},
issn = {1097-4164},
abstract = {CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins) systems provide prokaryotic cells with adaptive immunity against invading bacteriophages. Bacteriophages counteract bacterial responses by encoding anti-CRISPR inhibitor proteins (Acr). However, the structural basis for their inhibitory actions remains largely unknown. Here, we report the crystal structure of the AcrIIA2-SpyCas9-sgRNA (single-guide RNA) complex at 3.3 Å resolution. We show that AcrIIA2 binds SpyCas9 at a position similar to the target DNA binding region. More specifically, AcrIIA2 interacts with the protospacer adjacent motif (PAM) recognition residues of Cas9, preventing target double-stranded DNA (dsDNA) detection. Thus, phage-encoded AcrIIA2 appears to act as a DNA mimic that blocks subsequent dsDNA binding by virtue of its highly acidic residues, disabling bacterial Cas9 by competing with target dsDNA binding with a binding motif distinct from AcrIIA4. Our study provides a more detailed mechanistic understanding of AcrIIA2-mediated inhibition of SpyCas9, the most widely used genome-editing tool, opening new avenues for improved regulatory precision during genome editing.},
}
@article {pmid30196057,
year = {2018},
author = {Nagasaki, A and Kato, Y and Meguro, K and Yamagishi, A and Nakamura, C and Uyeda, TQP},
title = {A genome editing vector that enables easy selection and identification of knockout cells.},
journal = {Plasmid},
volume = {98},
number = {},
pages = {37-44},
doi = {10.1016/j.plasmid.2018.08.005},
pmid = {30196057},
issn = {1095-9890},
mesh = {Actins/*antagonists &amp; inhibitors/genetics ; Aminohydrolases/genetics/metabolism ; Animals ; Base Sequence ; *CRISPR-Cas Systems ; Gene Editing/*methods ; Gene Targeting ; *Genetic Vectors ; Green Fluorescent Proteins/genetics/metabolism ; Humans ; Mice ; Nestin/*antagonists &amp; inhibitors/genetics ; Promoter Regions, Genetic ; Recombinant Fusion Proteins/*metabolism ; Sequence Homology ; },
abstract = {The CRISPR/Cas9 system is a powerful genome editing tool for disrupting the expression of specific genes in a variety of cells. However, the genome editing procedure using currently available vectors is laborious, and there is room for improvement to obtain knockout cells more efficiently. Therefore, we constructed a novel vector for high efficiency genome editing, named pGedit, which contains EGFP-Bsr as a selection marker, expression units of Cas9, and sgRNA without a terminator sequence of the U6 promoter. EGFP-Bsr is a fusion protein of EGFP and blasticidin S deaminase, and enables rapid selection and monitoring of transformants, as well as confirmation that the vector has not been integrated into the genome. By using pGedit, we targeted human ACTB, ACTG1 and mouse Nes genes coding for β-actin, γ-actin and nestin, respectively. Knockout cell lines of each gene were easily and efficiently obtained in all three cases. In this report, we show that our novel vector, pGedit, significantly facilitates genome editing.},
}
@article {pmid29714123,
year = {2018},
author = {Musunuru, K},
title = {How genome editing could be used in the treatment of cardiovascular diseases.},
journal = {Personalized medicine},
volume = {15},
number = {2},
pages = {67-69},
doi = {10.2217/pme-2017-0078},
pmid = {29714123},
issn = {1741-0541},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cardiovascular Diseases/*genetics/therapy ; Gene Editing/*methods/*trends ; Humans ; },
}
@article {pmid29691583,
year = {2018},
author = {Zhang, Y and Shi, Y and Song, D and Zhang, X and Yu, L and He, YP and Sun, ZG},
title = {[Establishment and characterization of A549 tumor monoclonal cell line with UCHL1 gene deletion].},
journal = {Sheng li xue bao : [Acta physiologica Sinica]},
volume = {70},
number = {2},
pages = {184-192},
pmid = {29691583},
issn = {0371-0874},
mesh = {A549 Cells ; CRISPR-Cas Systems ; Carcinoma, Non-Small-Cell Lung/*genetics ; Cell Cycle ; *Cell Line, Tumor ; Cell Proliferation ; Cisplatin/pharmacology ; *Gene Deletion ; Humans ; Lung Neoplasms/*genetics ; RNA, Messenger ; Signal Transduction ; Ubiquitin Thiolesterase/*genetics ; },
abstract = {The purpose of this study was to investigate the effects of ubiquitin C-terminal hydrolase-L1 (UCHL1) on non-small cell lung cancer cell line A549. UCHL1 gene knockout A549 cell line was constructed by CRISPR-CAS9 gene editing technique. The mRNA and protein levels of UCHL1 were examined by RT-PCR and Western blot, respectively. Cell proliferation and cycles were analyzed by CCK-8 method and flow cytometry, respectively. The sensitivity of A549 cells to cisplatin was detected by CCK-8 method. Migration ability of A549 cells was detected by scratch assay and Transwell test, and p-Erk expression level was assessed by Western blot. The results showed that UCHL1 gene knockout A549 cells were successfully constructed by CRISPR-CAS9 gene editing technique. After UCHL1 gene knockout, there was no significant change in cell proliferation and cell cycle ratios in A549 cells. UCHL1 gene knockout A549 cells exhibited decreased sensitivity to cisplatin and migration activity, as well as increased p-Erk expression level. These results suggest that the loss of UCHL1 gene function may reduce the sensitivity and migration ability of A549 cells, and this effect may be related to the activation of Erk1/2 signaling pathway.},
}
@article {pmid29477495,
year = {2018},
author = {Schenkwein, D and Ylä-Herttuala, S},
title = {Gene Editing of Human Embryos with CRISPR/Cas9: Great Promise Coupled with Important Caveats.},
journal = {Molecular therapy : the journal of the American Society of Gene Therapy},
volume = {26},
number = {3},
pages = {659-660},
pmid = {29477495},
issn = {1525-0024},
mesh = {*CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; *Gene Editing ; Humans ; Mutation ; },
}
@article {pmid29452643,
year = {2018},
author = {Zhao, D and Badur, MG and Luebeck, J and Magaña, JH and Birmingham, A and Sasik, R and Ahn, CS and Ideker, T and Metallo, CM and Mali, P},
title = {Combinatorial CRISPR-Cas9 Metabolic Screens Reveal Critical Redox Control Points Dependent on the KEAP1-NRF2 Regulatory Axis.},
journal = {Molecular cell},
volume = {69},
number = {4},
pages = {699-708.e7},
pmid = {29452643},
issn = {1097-4164},
support = {R01 CA188652/CA/NCI NIH HHS/United States ; R01 CA222826/CA/NCI NIH HHS/United States ; R01 HG009285/HG/NHGRI NIH HHS/United States ; },
mesh = {*CRISPR-Cas Systems ; Glycolysis ; HeLa Cells ; Homeostasis ; Humans ; Kelch-Like ECH-Associated Protein 1/antagonists &amp; inhibitors/genetics/*metabolism ; *Metabolic Networks and Pathways ; NF-E2-Related Factor 2/antagonists &amp; inhibitors/genetics/*metabolism ; Oxidation-Reduction ; Pentose Phosphate Pathway ; Signal Transduction ; *Transcriptome ; },
abstract = {The metabolic pathways fueling tumor growth have been well characterized, but the specific impact of transforming events on network topology and enzyme essentiality remains poorly understood. To this end, we performed combinatorial CRISPR-Cas9 screens on a set of 51 carbohydrate metabolism genes that represent glycolysis and the pentose phosphate pathway (PPP). This high-throughput methodology enabled systems-level interrogation of metabolic gene dispensability, interactions, and compensation across multiple cell types. The metabolic impact of specific combinatorial knockouts was validated using 13C and 2H isotope tracing, and these assays together revealed key nodes controlling redox homeostasis along the KEAP-NRF2 signaling axis. Specifically, targeting KEAP1 in combination with oxidative PPP genes mitigated the deleterious effects of these knockouts on growth rates. These results demonstrate how our integrated framework, combining genetic, transcriptomic, and flux measurements, can improve elucidation of metabolic network alterations and guide precision targeting of metabolic vulnerabilities based on tumor genetics.},
}
@article {pmid29452640,
year = {2018},
author = {Minton, DR and Nam, M and McLaughlin, DJ and Shin, J and Bayraktar, EC and Alvarez, SW and Sviderskiy, VO and Papagiannakopoulos, T and Sabatini, DM and Birsoy, K and Possemato, R},
title = {Serine Catabolism by SHMT2 Is Required for Proper Mitochondrial Translation Initiation and Maintenance of Formylmethionyl-tRNAs.},
journal = {Molecular cell},
volume = {69},
number = {4},
pages = {610-621.e5},
pmid = {29452640},
issn = {1097-4164},
support = {K22 CA193660/CA/NCI NIH HHS/United States ; T32 CA009161/CA/NCI NIH HHS/United States ; P30 CA016087/CA/NCI NIH HHS/United States ; K99 CA168940/CA/NCI NIH HHS/United States ; S10 OD016304/OD/NIH HHS/United States ; T32 GM007308/GM/NIGMS NIH HHS/United States ; S10 OD018338/OD/NIH HHS/United States ; S10 OD010584/OD/NIH HHS/United States ; R21 CA198543/CA/NCI NIH HHS/United States ; R00 CA168940/CA/NCI NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Animals ; Apoptosis ; Breast Neoplasms/*genetics/metabolism/*pathology ; CRISPR-Cas Systems ; Cell Proliferation ; Cytosol/metabolism ; Female ; Glycine Hydroxymethyltransferase/antagonists &amp; inhibitors/genetics/*metabolism ; Humans ; Mice ; Mice, Inbred NOD ; Mice, SCID ; Mitochondria/drug effects/*genetics/metabolism ; *Peptide Chain Initiation, Translational ; Protein Processing, Post-Translational ; RNA, Transfer, Met/*chemistry/genetics/metabolism ; Serine/*chemistry/genetics/metabolism ; Tetrahydrofolates/pharmacology ; Tumor Cells, Cultured ; Xenograft Model Antitumor Assays ; },
abstract = {Upon glucose restriction, eukaryotic cells upregulate oxidative metabolism to maintain homeostasis. Using genetic screens, we find that the mitochondrial serine hydroxymethyltransferase (SHMT2) is required for robust mitochondrial oxygen consumption and low glucose proliferation. SHMT2 catalyzes the first step in mitochondrial one-carbon metabolism, which, particularly in proliferating cells, produces tetrahydrofolate (THF)-conjugated one-carbon units used in cytoplasmic reactions despite the presence of a parallel cytoplasmic pathway. Impairing cytoplasmic one-carbon metabolism or blocking efflux of one-carbon units from mitochondria does not phenocopy SHMT2 loss, indicating that a mitochondrial THF cofactor is responsible for the observed phenotype. The enzyme MTFMT utilizes one such cofactor, 10-formyl THF, producing formylmethionyl-tRNAs, specialized initiator tRNAs necessary for proper translation of mitochondrially encoded proteins. Accordingly, SHMT2 null cells specifically fail to maintain formylmethionyl-tRNA pools and mitochondrially encoded proteins, phenotypes similar to those observed in MTFMT-deficient patients. These findings provide a rationale for maintaining a compartmentalized one-carbon pathway in mitochondria.},
}
@article {pmid29429924,
year = {2018},
author = {Meyer, C and Garzia, A and Mazzola, M and Gerstberger, S and Molina, H and Tuschl, T},
title = {The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression.},
journal = {Molecular cell},
volume = {69},
number = {4},
pages = {622-635.e6},
pmid = {29429924},
issn = {1097-4164},
support = {/HHMI/Howard Hughes Medical Institute/United States ; R01 GM104962/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems ; *Cell Cycle ; Cytoplasmic Granules/metabolism ; HEK293 Cells ; Humans ; RNA Splice Sites ; RNA Splicing ; RNA, Double-Stranded/genetics/metabolism ; RNA, Messenger/genetics/*metabolism ; RNA-Binding Proteins/antagonists &amp; inhibitors/*genetics/*metabolism ; Regulatory Sequences, Ribonucleic Acid ; *Stress, Physiological ; T-Cell Intracellular Antigen-1/antagonists &amp; inhibitors/genetics/*metabolism ; Uridine/metabolism ; eIF-2 Kinase/genetics/*metabolism ; },
abstract = {TIA1 and TIAL1 encode a family of U-rich element mRNA-binding proteins ubiquitously expressed and conserved in metazoans. Using PAR-CLIP, we determined that both proteins bind target sites with identical specificity in 3' UTRs and introns proximal to 5' as well as 3' splice sites. Double knockout (DKO) of TIA1 and TIAL1 increased target mRNA abundance proportional to the number of binding sites and also caused accumulation of aberrantly spliced mRNAs, most of which are subject to nonsense-mediated decay. Loss of PRKRA by mis-splicing triggered the activation of the double-stranded RNA (dsRNA)-activated protein kinase EIF2AK2/PKR and stress granule formation. Ectopic expression of PRKRA cDNA or knockout of EIF2AK2 in DKO cells rescued this phenotype. Perturbation of maturation and/or stability of additional targets further compromised cell cycle progression. Our study reveals the essential contributions of the TIA1 protein family to the fidelity of mRNA maturation, translation, and RNA-stress-sensing pathways in human cells.},
}
@article {pmid29293958,
year = {2018},
author = {Imtiaz, A and Belyantseva, IA and Beirl, AJ and Fenollar-Ferrer, C and Bashir, R and Bukhari, I and Bouzid, A and Shaukat, U and Azaiez, H and Booth, KT and Kahrizi, K and Najmabadi, H and Maqsood, A and Wilson, EA and Fitzgerald, TS and Tlili, A and Olszewski, R and Lund, M and Chaudhry, T and Rehman, AU and Starost, MF and Waryah, AM and Hoa, M and Dong, L and Morell, RJ and Smith, RJH and Riazuddin, S and Masmoudi, S and Kindt, KS and Naz, S and Friedman, TB},
title = {CDC14A phosphatase is essential for hearing and male fertility in mouse and human.},
journal = {Human molecular genetics},
volume = {27},
number = {5},
pages = {780-798},
pmid = {29293958},
issn = {1460-2083},
support = {R01 DC003544/DC/NIDCD NIH HHS/United States ; Z01 DC000039/DC/NIDCD NIH HHS/United States ; R01 DC000086/DC/NIDCD NIH HHS/United States ; R01 TW007608/TW/FIC NIH HHS/United States ; R01 DC012049/DC/NIDCD NIH HHS/United States ; R01 DC002842/DC/NIDCD NIH HHS/United States ; T32 DC000039/DC/NIDCD NIH HHS/United States ; ZIC EY000458/EY/NEI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems ; Female ; Genetic Association Studies ; Hearing Loss/*genetics/physiopathology ; Humans ; Infertility, Male/*genetics ; Male ; Mice, Mutant Strains ; Pedigree ; Phosphoric Monoester Hydrolases/chemistry/*genetics ; Protein Tyrosine Phosphatases/*genetics/metabolism ; Testis/physiopathology ; Zebrafish/embryology/genetics ; Zebrafish Proteins/genetics/metabolism ; },
abstract = {The Cell Division-Cycle-14 gene encodes a dual-specificity phosphatase necessary in yeast for exit from mitosis. Numerous disparate roles of vertebrate Cell Division-Cycle-14 (CDC14A) have been proposed largely based on studies of cultured cancer cells in vitro. The in vivo functions of vertebrate CDC14A are largely unknown. We generated and analyzed mutations of zebrafish and mouse CDC14A, developed a computational structural model of human CDC14A protein and report four novel truncating and three missense alleles of CDC14A in human families segregating progressive, moderate-to-profound deafness. In five of these families segregating pathogenic variants of CDC14A, deaf males are infertile, while deaf females are fertile. Several recessive mutations of mouse Cdc14a, including a CRISPR/Cas9-edited phosphatase-dead p.C278S substitution, result in substantial perinatal lethality, but survivors recapitulate the human phenotype of deafness and male infertility. CDC14A protein localizes to inner ear hair cell kinocilia, basal bodies and sound-transducing stereocilia. Auditory hair cells of postnatal Cdc14a mutants develop normally, but subsequently degenerate causing deafness. Kinocilia of germ-line mutants of mouse and zebrafish have normal lengths, which does not recapitulate the published cdc14aa knockdown morphant phenotype of short kinocilia. In mutant male mice, degeneration of seminiferous tubules and spermiation defects result in low sperm count, and abnormal sperm motility and morphology. These findings for the first time define a new monogenic syndrome of deafness and male infertility revealing an absolute requirement in vivo of vertebrate CDC14A phosphatase activity for hearing and male fertility.},
}
@article {pmid29281027,
year = {2018},
author = {Giannelli, SG and Luoni, M and Castoldi, V and Massimino, L and Cabassi, T and Angeloni, D and Demontis, GC and Leocani, L and Andreazzoli, M and Broccoli, V},
title = {Cas9/sgRNA selective targeting of the P23H Rhodopsin mutant allele for treating retinitis pigmentosa by intravitreal AAV9.PHP.B-based delivery.},
journal = {Human molecular genetics},
volume = {27},
number = {5},
pages = {761-779},
doi = {10.1093/hmg/ddx438},
pmid = {29281027},
issn = {1460-2083},
mesh = {Alleles ; Animals ; CRISPR-Cas Systems ; Electroporation/methods ; Fibroblasts ; Gene Targeting/*methods ; Genetic Therapy/methods ; *Genetic Vectors ; HEK293 Cells ; Humans ; Mice, Inbred C57BL ; Mice, Mutant Strains ; Mice, Transgenic ; Mutation ; RNA, Guide ; Retina/pathology/*physiology ; Retinal Degeneration/genetics/*therapy ; Rhodopsin/*genetics ; },
abstract = {P23H is the most common mutation in the RHODOPSIN (RHO) gene leading to a dominant form of retinitis pigmentosa (RP), a rod photoreceptor degeneration that invariably causes vision loss. Specific disruption of the disease P23H RHO mutant while preserving the wild-type (WT) functional allele would be an invaluable therapy for this disease. However, various technologies tested in the past failed to achieve effective changes and consequently therapeutic benefits. We validated a CRISPR/Cas9 strategy to specifically inactivate the P23H RHO mutant, while preserving the WT allele in vitro. We, then, translated this approach in vivo by delivering the CRISPR/Cas9 components in murine Rho+/P23H mutant retinae. Targeted retinae presented a high rate of cleavage in the P23H but not WT Rho allele. This gene manipulation was sufficient to slow photoreceptor degeneration and improve retinal functions. To improve the translational potential of our approach, we tested intravitreal delivery of this system by means of adeno-associated viruses (AAVs). To this purpose, the employment of the AAV9-PHP.B resulted the most effective in disrupting the P23H Rho mutant. Finally, this approach was translated successfully in human cells engineered with the homozygous P23H RHO gene mutation. Overall, this is a significant proof-of-concept that gene allele specific targeting by CRISPR/Cas9 technology is specific and efficient and represents an unprecedented tool for treating RP and more broadly dominant genetic human disorders affecting the eye, as well as other tissues.},
}
@article {pmid29247079,
year = {2018},
author = {Boëte, C},
title = {Public engagement and communication: who is in charge?.},
journal = {EMBO reports},
volume = {19},
number = {1},
pages = {1-2},
pmid = {29247079},
issn = {1469-3178},
mesh = {Animals ; *CRISPR-Cas Systems ; Communicable Disease Control/methods ; Communication ; Community Participation/*methods ; Gene Editing/economics/*ethics ; *Genome ; Humans ; Malaria/prevention &amp; control ; Plants/genetics ; *Public Opinion ; },
}
@article {pmid29191977,
year = {2018},
author = {Reichardt, I and Bonnay, F and Steinmann, V and Loedige, I and Burkard, TR and Meister, G and Knoblich, JA},
title = {The tumor suppressor Brat controls neuronal stem cell lineages by inhibiting Deadpan and Zelda.},
journal = {EMBO reports},
volume = {19},
number = {1},
pages = {102-117},
pmid = {29191977},
issn = {1469-3178},
support = {250342//European Research Council/International ; 695642//European Research Council/International ; I 552//Austrian Science Fund FWF/Austria ; Z 153//Austrian Science Fund FWF/Austria ; },
mesh = {Animals ; Basic Helix-Loop-Helix Transcription Factors/antagonists &amp; inhibitors/*genetics/metabolism ; Brain/metabolism/pathology ; CRISPR-Cas Systems ; Carcinogenesis/*genetics/metabolism/pathology ; Cell Differentiation ; Cell Lineage/*genetics ; DNA-Binding Proteins/*genetics/metabolism ; Drosophila Proteins/antagonists &amp; inhibitors/*genetics/metabolism ; Drosophila melanogaster/*genetics/growth &amp; development/metabolism ; Gene Editing ; Gene Expression Regulation ; Larva/genetics/growth &amp; development/metabolism ; Neural Stem Cells/*metabolism/pathology ; Nuclear Proteins/antagonists &amp; inhibitors/*genetics/metabolism ; Proteolysis ; RNA, Small Interfering/genetics/metabolism ; Signal Transduction ; Transcription Factors/antagonists &amp; inhibitors/*genetics/metabolism ; },
abstract = {The TRIM-NHL protein Brain tumor (Brat) acts as a tumor suppressor in the Drosophila brain, but how it suppresses tumor formation is not completely understood. Here, we combine temperature-controlled brat RNAi with transcriptome analysis to identify the immediate Brat targets in Drosophila neuroblasts. Besides the known target Deadpan (Dpn), our experiments identify the transcription factor Zelda (Zld) as a critical target of Brat. Our data show that Zld is expressed in neuroblasts and required to allow re-expression of Dpn in transit-amplifying intermediate neural progenitors. Upon neuroblast division, Brat is enriched in one daughter cell where its NHL domain directly binds to specific motifs in the 3'UTR of dpn and zld mRNA to mediate their degradation. In brat mutants, both Dpn and Zld continue to be expressed, but inhibition of either transcription factor prevents tumorigenesis. Our genetic and biochemical data indicate that Dpn inhibition requires higher Brat levels than Zld inhibition and suggest a model where stepwise post-transcriptional inhibition of distinct factors ensures sequential generation of fates in a stem cell lineage.},
}
@article {pmid29610279,
year = {2018},
author = {Huang, Y and Gu, L and Li, GM},
title = {H3K36me3-mediated mismatch repair preferentially protects actively transcribed genes from mutation.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {20},
pages = {7811-7823},
pmid = {29610279},
issn = {1083-351X},
support = {R01 GM112702/GM/NIGMS NIH HHS/United States ; R21 CA192003/CA/NCI NIH HHS/United States ; },
mesh = {CD79 Antigens/genetics/metabolism ; CRISPR-Cas Systems ; Calreticulin/genetics/metabolism ; Cell Proliferation ; Chromatin/chemistry/metabolism ; *DNA Mismatch Repair ; DNA-Binding Proteins/genetics/metabolism ; G1 Phase Cell Cycle Checkpoints/genetics ; GATA1 Transcription Factor/genetics/metabolism ; Gene Editing ; Gene Expression Regulation ; HeLa Cells ; Histone-Lysine N-Methyltransferase/genetics/metabolism ; Histones/*genetics/metabolism ; Humans ; MutS Proteins/*genetics/metabolism ; *Mutation ; Proto-Oncogene Proteins c-myc/genetics/metabolism ; Signal Transduction ; *Transcription, Genetic ; Tumor Suppressor Protein p53/genetics/metabolism ; Whole Genome Sequencing ; },
abstract = {Histone H3 trimethylation at lysine 36 (H3K36me3) is an important histone mark involved in both transcription elongation and DNA mismatch repair (MMR). It is known that H3K36me3 recruits the mismatch-recognition protein MutSα to replicating chromatin via its physical interaction with MutSα's PWWP domain, but the exact role of H3K36me3 in transcription is undefined. Using ChIP combined with whole-genome DNA sequencing analysis, we demonstrate here that H3K36me3, together with MutSα, is involved in protecting against mutation, preferentially in actively transcribed genomic regions. We found that H3K36me3 and MutSα are much more co-enriched in exons and actively transcribed regions than in introns and nontranscribed regions. The H3K36me3-MutSα co-enrichment correlated with a much lower mutation frequency in exons and actively transcribed regions than in introns and nontranscribed regions. Correspondingly, depleting H3K36me3 or disrupting the H3K36me3-MutSα interaction elevated the spontaneous mutation frequency in actively transcribed genes, but it had little influence on the mutation frequency in nontranscribed or transcriptionally inactive regions. Similarly, H2O2-induced mutations, which mainly cause base oxidations, preferentially occurred in actively transcribed genes in MMR-deficient cells. The data presented here suggest that H3K36me3-mediated MMR preferentially safeguards actively transcribed genes not only during replication by efficiently correcting mispairs in early replicating chromatin but also during transcription by directly or indirectly removing DNA lesions associated with a persistently open chromatin structure.},
}
@article {pmid29530977,
year = {2018},
author = {Zhang, Y and Guan, Q and Liu, Y and Zhang, Y and Chen, Y and Chen, J and Liu, Y and Su, Z},
title = {Regulation of hepatic gluconeogenesis by nuclear factor Y transcription factor in mice.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {20},
pages = {7894-7904},
pmid = {29530977},
issn = {1083-351X},
mesh = {Animals ; Binding Sites ; CCAAT-Binding Factor/deficiency/*genetics ; CREB-Binding Protein/genetics/metabolism ; CRISPR-Cas Systems ; Cell Line ; Cyclic AMP/pharmacology ; Fasting/metabolism ; Gene Deletion ; Gene Expression Regulation ; Glucagon/pharmacology ; Gluconeogenesis/drug effects/*genetics ; Glucose/*metabolism ; Glucose-6-Phosphatase/*genetics/metabolism ; Hepatocytes/cytology/drug effects/*metabolism ; Liver/*metabolism ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Phosphoenolpyruvate Carboxykinase (GTP)/*genetics/metabolism ; Primary Cell Culture ; Promoter Regions, Genetic ; Protein Binding ; Signal Transduction ; },
abstract = {Hepatic gluconeogenesis is essential to maintain blood glucose levels, and its abnormal activation leads to hyperglycemia and type 2 diabetes. However, the molecular mechanisms in the regulation of hepatic gluconeogenesis remain to be fully defined. In this study, using murine hepatocytes and a liver-specific knockout mouse model, we explored the physiological role of nuclear factor Y (NF-Y) in regulating hepatic glucose metabolism and the underlying mechanism. We found that NF-Y targets the gluconeogenesis pathway in the liver. Hepatic NF-Y expression was effectively induced by cAMP, glucagon, and fasting in vivo Lentivirus-mediated NF-Y overexpression in Hepa1-6 hepatocytes markedly raised the gluconeogenic gene expression and cellular glucose production compared with empty vector control cells. Conversely, CRISPR/Cas9-mediated knockdown of NF-Y subunit A (NF-YA) attenuated gluconeogenic gene expression and glucose production. We also provide evidence indicating that CRE-loxP-mediated, liver-specific NF-YA knockout compromises hepatic glucose production. Mechanistically, luciferase reporter gene assays and ChIP analysis indicated that NF-Y activates transcription of the gluconeogenic genes Pck1 and G6pc, by encoding phosphoenolpyruvate carboxykinase (PEPCK) and the glucose-6-phosphatase catalytic subunit (G6Pase), respectively, via directly binding to the CCAAT regulatory sequence motif in their promoters. Of note, NF-Y enhanced gluconeogenesis by interacting with cAMP-responsive element-binding protein (CREB). Overall, our results reveal a previously unrecognized physiological function of NF-Y in controlling glucose metabolism by up-regulating the gluconeogenic genes Pck1 and G6pc Modulation of hepatic NF-Y expression may therefore offer an attractive therapeutic approach to manage type 2 diabetes.},
}
@article {pmid29413750,
year = {2018},
author = {Zhong, C and Chen, Z and Luo, X and Wang, C and Jiang, H and Shao, J and Guan, M and Huang, L and Huang, X and Wang, J},
title = {Barhl1 is required for the differentiation of inner ear hair cell-like cells from mouse embryonic stem cells.},
journal = {The international journal of biochemistry &amp; cell biology},
volume = {96},
number = {},
pages = {79-89},
doi = {10.1016/j.biocel.2018.01.013},
pmid = {29413750},
issn = {1878-5875},
mesh = {Animals ; CRISPR-Cas Systems ; *Cell Differentiation ; Cell Line ; Deafness/genetics/metabolism/pathology ; Gene Deletion ; Hair Cells, Auditory, Inner/*metabolism/pathology ; Mice ; Mouse Embryonic Stem Cells/*metabolism/pathology ; Nerve Tissue Proteins/genetics/*metabolism ; Repressor Proteins/genetics/*metabolism ; },
abstract = {Inner ear hair cells are mechanoreceptors responsible for hearing. Pathogenic defects of hair cell-specific genes are one of the major causes of deafness. The BarH class homeobox gene Barhl1 is a deafness gene expressed in developing hair cells, yet the role of Barhl1 during hair cell development remains poorly understood. In the present study, we first established an in vitro differentiation system to efficiently obtain mouse embryonic stem cell (mESC)-derived hair cell-like cells. Subsequently, a mESC line carrying a targeted disruption of Barhl1 was generated using CRISPR/Cas9 technology and subjected to the established in vitro hair cell differentiation protocol. Targeted disruption of Barhl1 does not affect the induction of mESCs toward early primitive ectoderm-like (EPL) cells and otic progenitors but strongly inhibits the differentiation of hair cell-like cells. Using RNA-sequencing and bioinformatics, we further unravel the molecular mechanism underlying Barhl1-mediated hair cell development. Our data demonstrate the essential role of Barhl1 during hair cell development and provide a basis for the treatment of Barhl1 mutation-based deafness.},
}
@article {pmid27684187,
year = {2016},
author = {Rosenbluh, J and Mercer, J and Shrestha, Y and Oliver, R and Tamayo, P and Doench, JG and Tirosh, I and Piccioni, F and Hartenian, E and Horn, H and Fagbami, L and Root, DE and Jaffe, J and Lage, K and Boehm, JS and Hahn, WC},
title = {Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in β-Catenin-Active Cancers.},
journal = {Cell systems},
volume = {3},
number = {3},
pages = {302-316.e4},
pmid = {27684187},
issn = {2405-4712},
support = {U01 CA199253/CA/NCI NIH HHS/United States ; U24 CA194107/CA/NCI NIH HHS/United States ; U01 CA176058/CA/NCI NIH HHS/United States ; R01 CA154480/CA/NCI NIH HHS/United States ; R01 CA121941/CA/NCI NIH HHS/United States ; P50 CA127003/CA/NCI NIH HHS/United States ; R01 MH109903/MH/NIMH NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Editing ; Genetic Therapy ; Humans ; Neoplasms ; *Proteomics ; RNA, Guide ; RNA, Small Interfering ; beta Catenin ; },
abstract = {Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches. We interrogated 177 genes that we classified as essential for the proliferation of cancer cells exhibiting constitutive β-catenin activity and integrated data for each of the candidates, derived from orthogonal short hairpin RNA (shRNA) knockdown and clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9-mediated gene editing knockout screens, to yield 69 validated genes. We then characterized the relationships between sets of these genes using complementary assays: medium-throughput stable isotope labeling by amino acids in cell culture (SILAC)-based mass spectrometry, yielding 3,639 protein-protein interactions, and a CRISPR-mediated pairwise double knockout screen, yielding 375 combinations exhibiting greater- or lesser-than-additive phenotypic effects indicating genetic interactions. These studies identify previously unreported regulators of β-catenin, define functional networks required for the survival of β-catenin-active cancers, and provide an experimental strategy that may be applied to define other signaling networks.},
}
@article {pmid30523254,
year = {2018},
author = {Yamaguchi, H and Hopf, FW and Li, SB and de Lecea, L},
title = {In vivo cell type-specific CRISPR knockdown of dopamine beta hydroxylase reduces locus coeruleus evoked wakefulness.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5211},
pmid = {30523254},
issn = {2041-1723},
support = {R01 AG047671/AG/NIA NIH HHS/United States ; R01 MH087592/MH/NIMH NIH HHS/United States ; R01 MH102638/MH/NIMH NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Dopamine beta-Hydroxylase/*genetics/metabolism ; Electric Stimulation ; Female ; Locus Coeruleus/cytology/*metabolism/physiology ; Male ; Mice ; Mice, Knockout ; Mice, Transgenic ; NIH 3T3 Cells ; Neurons/metabolism/physiology ; Norepinephrine/metabolism ; Sleep/genetics/physiology ; Wakefulness/*genetics/physiology ; },
abstract = {Locus coeruleus (LC) neurons in the brainstem have long been associated with attention and arousal. Optogenetic stimulation of LC-NE neurons induces immediate sleep-to-wake transitions. However, LC neurons also secrete other neurotransmitters in addition to NE. To interrogate the role of NE derived from the LC in regulating wakefulness, we applied in vivo cell type-specific CRISPR/Cas9 technology to disrupt the dopamine beta hydroxylase (dbh) gene selectively in adult LC-NE neurons. Unilateral dbh gene disruption abolished immediate arousal following optogenetic stimulation of LC. Bilateral LC-specific dbh disruption significantly reduced NE concentration in LC projection areas and reduced wake length even in the presence of salient stimuli. These results suggest that NE may be crucial for the awakening effect of LC stimulation and serve as proof-of-principle that CRISPR gene editing in adult neurons can be used to interrogate gene function within genetically-defined neuronal circuitry associated with complex behaviors.},
}
@article {pmid30504842,
year = {2018},
author = {Rice, CM and Davies, LC and Subleski, JJ and Maio, N and Gonzalez-Cotto, M and Andrews, C and Patel, NL and Palmieri, EM and Weiss, JM and Lee, JM and Annunziata, CM and Rouault, TA and Durum, SK and McVicar, DW},
title = {Tumour-elicited neutrophils engage mitochondrial metabolism to circumvent nutrient limitations and maintain immune suppression.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5099},
doi = {10.1038/s41467-018-07505-2},
pmid = {30504842},
issn = {2041-1723},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cells, Cultured ; Flow Cytometry ; Immunoblotting ; Immunohistochemistry ; Mice ; Mice, Knockout ; Microscopy, Confocal ; Mitochondria/*metabolism ; Neutrophils/metabolism/*physiology ; Oxidation-Reduction ; Oxidative Phosphorylation ; Oxidative Stress ; Reactive Oxygen Species/metabolism ; Signal Transduction/physiology ; },
abstract = {Neutrophils are a vital component of immune protection, yet in cancer they may promote tumour progression, partly by generating reactive oxygen species (ROS) that disrupts lymphocyte functions. Metabolically, neutrophils are often discounted as purely glycolytic. Here we show that immature, c-Kit+ neutrophils subsets can engage in oxidative mitochondrial metabolism. With limited glucose supply, oxidative neutrophils use mitochondrial fatty acid oxidation to support NADPH oxidase-dependent ROS production. In 4T1 tumour-bearing mice, mitochondrial fitness is enhanced in splenic neutrophils and is driven by c-Kit signalling. Concordantly, tumour-elicited oxidative neutrophils are able to maintain ROS production and T cell suppression when glucose utilisation is restricted. Consistent with these findings, peripheral blood neutrophils from patients with cancer also display increased immaturity, mitochondrial content and oxidative phosphorylation. Together, our data suggest that the glucose-restricted tumour microenvironment induces metabolically adapted, oxidative neutrophils to maintain local immune suppression.},
}
@article {pmid30461029,
year = {2018},
author = {Jansson, S},
title = {Gene-edited plants: What is happening now?.},
journal = {Physiologia plantarum},
volume = {164},
number = {4},
pages = {370-371},
doi = {10.1111/ppl.12853},
pmid = {30461029},
issn = {1399-3054},
mesh = {Agriculture/legislation &amp; jurisprudence/methods/trends ; *CRISPR-Cas Systems ; Gene Editing/legislation &amp; jurisprudence/*methods/trends ; Plants/*genetics ; Plants, Genetically Modified ; },
}
@article {pmid30349006,
year = {2018},
author = {Daou, S and Barbour, H and Ahmed, O and Masclef, L and Baril, C and Sen Nkwe, N and Tchelougou, D and Uriarte, M and Bonneil, E and Ceccarelli, D and Mashtalir, N and Tanji, M and Masson, JY and Thibault, P and Sicheri, F and Yang, H and Carbone, M and Therrien, M and Affar, EB},
title = {Monoubiquitination of ASXLs controls the deubiquitinase activity of the tumor suppressor BAP1.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4385},
pmid = {30349006},
issn = {2041-1723},
support = {R01 CA198138/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Cell Cycle/genetics/physiology ; Cell Line ; Cell Line, Tumor ; Cells, Cultured ; Drosophila ; Drosophila Proteins/genetics/*metabolism ; Fluorescent Antibody Technique ; Humans ; Immunoblotting ; Immunoprecipitation ; RNA, Small Interfering/genetics ; Repressor Proteins/genetics/metabolism ; Tumor Suppressor Proteins/genetics/*metabolism ; Ubiquitin Thiolesterase/genetics/*metabolism ; Ubiquitin-Conjugating Enzymes/genetics/metabolism ; Ubiquitination/genetics/physiology ; },
abstract = {The tumor suppressor and deubiquitinase (DUB) BAP1 and its Drosophila ortholog Calypso assemble DUB complexes with the transcription regulators Additional sex combs-like (ASXL1, ASXL2, ASXL3) and Asx respectively. ASXLs and Asx use their DEUBiquitinase ADaptor (DEUBAD) domain to stimulate BAP1/Calypso DUB activity. Here we report that monoubiquitination of the DEUBAD is a general feature of ASXLs and Asx. BAP1 promotes DEUBAD monoubiquitination resulting in an increased stability of ASXL2, which in turn stimulates BAP1 DUB activity. ASXL2 monoubiquitination is directly catalyzed by UBE2E family of Ubiquitin-conjugating enzymes and regulates mammalian cell proliferation. Remarkably, Calypso also regulates Asx monoubiquitination and transgenic flies expressing monoubiquitination-defective Asx mutant exhibit developmental defects. Finally, the protein levels of ASXL2, BAP1 and UBE2E enzymes are highly correlated in mesothelioma tumors suggesting the importance of this signaling axis for tumor suppression. We propose that monoubiquitination orchestrates a molecular symbiosis relationship between ASXLs and BAP1.},
}
@article {pmid30213032,
year = {2018},
author = {Ho, BX and Loh, SJH and Chan, WK and Soh, BS},
title = {In Vivo Genome Editing as a Therapeutic Approach.},
journal = {International journal of molecular sciences},
volume = {19},
number = {9},
pages = {},
pmid = {30213032},
issn = {1422-0067},
mesh = {CRISPR-Cas Systems/genetics/physiology ; Gene Editing/*methods ; Hemophilia A/genetics/metabolism ; Humans ; Mucopolysaccharidosis II/genetics/metabolism ; Mutation/genetics ; Transcription Activator-Like Effector Nucleases/*genetics ; Zinc Finger Nucleases/genetics/metabolism ; },
abstract = {Genome editing has been well established as a genome engineering tool that enables researchers to establish causal linkages between genetic mutation and biological phenotypes, providing further understanding of the genetic manifestation of many debilitating diseases. More recently, the paradigm of genome editing technologies has evolved to include the correction of mutations that cause diseases via the use of nucleases such as zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and more recently, Cas9 nuclease. With the aim of reversing disease phenotypes, which arise from somatic gene mutations, current research focuses on the clinical translatability of correcting human genetic diseases in vivo, to provide long-term therapeutic benefits and potentially circumvent the limitations of in vivo cell replacement therapy. In this review, in addition to providing an overview of the various genome editing techniques available, we have also summarized several in vivo genome engineering strategies that have successfully demonstrated disease correction via in vivo genome editing. The various benefits and challenges faced in applying in vivo genome editing in humans will also be discussed.},
}
@article {pmid30111820,
year = {2018},
author = {Manzano, M and Patil, A and Waldrop, A and Dave, SS and Behdad, A and Gottwein, E},
title = {Gene essentiality landscape and druggable oncogenic dependencies in herpesviral primary effusion lymphoma.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3263},
pmid = {30111820},
issn = {2041-1723},
support = {CA210904//U.S. Department of Health &amp; Human Services | NIH | National Cancer Institute (NCI)/International ; CA180813//U.S. Department of Health &amp; Human Services | NIH | National Cancer Institute (NCI)/International ; },
mesh = {CRISPR-Cas Systems ; Cell Cycle/drug effects/genetics ; Cell Line, Tumor ; Cell Survival/drug effects/genetics ; *Gene Expression Regulation, Neoplastic ; Genes, Essential/*genetics ; HEK293 Cells ; Herpesvirus 4, Human/physiology ; Herpesvirus 8, Human/physiology ; Host-Pathogen Interactions ; Humans ; Lymphoma, Primary Effusion/*genetics/metabolism/virology ; Oncogenes/*genetics ; Piperazines/pharmacology ; Pyridines/pharmacology ; Pyrimidines/pharmacology ; Thiophenes/pharmacology ; },
abstract = {Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus. Our understanding of PEL is poor and therefore treatment strategies are lacking. To address this need, we conducted genome-wide CRISPR/Cas9 knockout screens in eight PEL cell lines. Integration with data from unrelated cancers identifies 210 genes as PEL-specific oncogenic dependencies. Genetic requirements of PEL cell lines are largely independent of Epstein-Barr virus co-infection. Genes of the NF-κB pathway are individually non-essential. Instead, we demonstrate requirements for IRF4 and MDM2. PEL cell lines depend on cellular cyclin D2 and c-FLIP despite expression of viral homologs. Moreover, PEL cell lines are addicted to high levels of MCL1 expression, which are also evident in PEL tumors. Strong dependencies on cyclin D2 and MCL1 render PEL cell lines highly sensitive to palbociclib and S63845. In summary, this work comprehensively identifies genetic dependencies in PEL cell lines and identifies novel strategies for therapeutic intervention.},
}
@article {pmid30066981,
year = {2018},
author = {Nomura, W},
title = {Development of Toolboxes for Precision Genome/Epigenome Editing and Imaging of Epigenetics.},
journal = {Chemical record (New York, N.Y.)},
volume = {18},
number = {12},
pages = {1717-1726},
doi = {10.1002/tcr.201800036},
pmid = {30066981},
issn = {1528-0691},
support = {25410171//JSPS KAKENHI/ ; 16K01931//JSPS KAKENHI/ ; 24119506//Scientific Research on Innovative Areas/ ; 26119703//Scientific Research on Innovative Areas/ ; },
mesh = {CRISPR-Cas Systems/genetics ; DNA Methylation ; DNA-Binding Proteins/genetics/metabolism ; *Epigenomics ; *Gene Editing ; Histones/metabolism ; Humans ; Luminescent Proteins/genetics/metabolism ; Transcription Activator-Like Effector Nucleases/genetics/metabolism ; Zinc Fingers/*genetics ; },
abstract = {Zinc finger (ZF) proteins are composed of repeated ββα modules and coordinate a zinc ion. ZF domains recognizing specific DNA target sequences can be substituted for the binding domains of various DNA-modifying enzymes to create designer nucleases, recombinases, and methyltransferases with programmable sequence specificity. Enzymatic genome editing and modification can be applied to many fields of basic research and medicine. The recent development of new platforms using transcription activator-like effector (TALE) proteins or the CRISPR-Cas9 system has expanded the range of possibilities for genome-editing technologies. In addition, these DNA binding domains can also be utilized to build a toolbox for epigenetic controls by fusing them with protein- or DNA-modifying enzymes. Here, our research on epigenome editing including the development of artificial zinc finger recombinase (ZFR), split DNA methyltransferase, and fluorescence imaging of histone proteins by ZIP tag-probe system is introduced. Advances in the ZF, TALE, and CRISPR-Cas9 platforms have paved the way for the next generation of genome/epigenome engineering approaches.},
}
@article {pmid30061575,
year = {2018},
author = {Zhao, XY and Xiong, X and Liu, T and Mi, L and Peng, X and Rui, C and Guo, L and Li, S and Li, X and Lin, JD},
title = {Long noncoding RNA licensing of obesity-linked hepatic lipogenesis and NAFLD pathogenesis.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2986},
pmid = {30061575},
issn = {2041-1723},
support = {K99 DK106664/DK/NIDDK NIH HHS/United States ; P30 DK089503/DK/NIDDK NIH HHS/United States ; P60 DK020572/DK/NIDDK NIH HHS/United States ; DK084771//U.S. Department of Health &amp; Human Services | NIH | National Institute of Diabetes and Digestive and Kidney Diseases (National Institute of Diabetes &amp; Digestive &amp; Kidney Diseases)/International ; R01 DK102456/DK/NIDDK NIH HHS/United States ; DK089503//U.S. Department of Health &amp; Human Services | NIH | National Institute of Diabetes and Digestive and Kidney Diseases (National Institute of Diabetes &amp; Digestive &amp; Kidney Diseases)/International ; P30 DK020572/DK/NIDDK NIH HHS/United States ; DK106664//U.S. Department of Health &amp; Human Services | NIH | National Institute of Diabetes and Digestive and Kidney Diseases (National Institute of Diabetes &amp; Digestive &amp; Kidney Diseases)/International ; DK020572//U.S. Department of Health &amp; Human Services | NIH | National Institute of Diabetes and Digestive and Kidney Diseases (National Institute of Diabetes &amp; Digestive &amp; Kidney Diseases)/International ; DK102456//U.S. Department of Health &amp; Human Services | NIH | National Institute of Diabetes and Digestive and Kidney Diseases (National Institute of Diabetes &amp; Digestive &amp; Kidney Diseases)/International ; },
mesh = {Adipose Tissue/metabolism ; Animals ; Bile Acids and Salts/chemistry ; CRISPR-Cas Systems ; Calmodulin-Binding Proteins/metabolism ; Disease Models, Animal ; Fatty Liver ; Gene Expression Profiling ; HEK293 Cells ; Hepatocytes/metabolism ; Humans ; Insulin Resistance ; Lipogenesis/*genetics ; Liver/physiopathology ; Liver X Receptors/metabolism ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Non-alcoholic Fatty Liver Disease/*genetics/metabolism ; Obesity/*complications/genetics ; Protein Interaction Mapping ; Proteomics ; RNA, Long Noncoding/*genetics ; Sterol Regulatory Element Binding Protein 1/metabolism ; Transcription, Genetic ; },
abstract = {Hepatic lipogenesis is aberrantly induced in nonalcoholic fatty liver disease (NAFLD) via activation of the LXR-SREBP1c pathway. To date, a number of protein factors impinging on the transcriptional activity of LXR and SREBP1c have been elucidated. However, whether this regulatory axis interfaces with long noncoding RNAs (lncRNAs) remains largely unexplored. Here we show that hepatic expression of the lncRNA Blnc1 is strongly elevated in obesity and NAFLD in mice. Blnc1 is required for the induction of SREBP1c and hepatic lipogenic genes in response to LXR activation. Liver-specific inactivation of Blnc1 abrogates high-fat diet-induced hepatic steatosis and insulin resistance and protects mice from diet-induced nonalcoholic steatohepatitis. Proteomic analysis of the Blnc1 ribonucleoprotein complex identified EDF1 as a component of the LXR transcriptional complex that acts in concert with Blnc1 to activate the lipogenic gene program. These findings illustrate a lncRNA transcriptional checkpoint that licenses excess hepatic lipogenesis to exacerbate insulin resistance and NAFLD.},
}
@article {pmid30042426,
year = {2018},
author = {Sasaguri, H and Nagata, K and Sekiguchi, M and Fujioka, R and Matsuba, Y and Hashimoto, S and Sato, K and Kurup, D and Yokota, T and Saido, TC},
title = {Introduction of pathogenic mutations into the mouse Psen1 gene by Base Editor and Target-AID.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2892},
pmid = {30042426},
issn = {2041-1723},
mesh = {Animals ; Base Pairing/*genetics ; Base Sequence ; *CRISPR-Cas Systems ; Cytidine Deaminase/*genetics/metabolism ; Female ; Gene Editing/*methods ; Male ; Mice, Inbred C57BL ; Mice, Inbred ICR ; Mice, Knockout ; *Mutation ; Presenilin-1/*genetics/metabolism ; Reproducibility of Results ; Sequence Homology, Nucleic Acid ; },
abstract = {Base Editor (BE) and Target-AID (activation-induced cytidine deaminase) are engineered genome-editing proteins composed of Cas9 and cytidine deaminases. These base-editing tools convert C:G base pairs to T:A at target sites. Here, we inject either BE or Target-AID mRNA together with identical single-guide RNAs (sgRNAs) into mouse zygotes, and compare the base-editing efficiencies of the two distinct tools in vivo. BE consistently show higher base-editing efficiency (10.0-62.8%) compared to that of Target-AID (3.4-29.8%). However, unexpected base substitutions and insertion/deletion formations are also more frequently observed in BE-injected mice or zygotes. We are able to generate multiple mouse lines harboring point mutations in the mouse presenilin 1 (Psen1) gene by injection of BE or Target-AID. These results demonstrate that BE and Target-AID are highly useful tools to generate mice harboring pathogenic point mutations and to analyze the functional consequences of the mutations in vivo.},
}
@article {pmid30026560,
year = {2018},
author = {Scaglione, A and Patzig, J and Liang, J and Frawley, R and Bok, J and Mela, A and Yattah, C and Zhang, J and Teo, SX and Zhou, T and Chen, S and Bernstein, E and Canoll, P and Guccione, E and Casaccia, P},
title = {PRMT5-mediated regulation of developmental myelination.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2840},
pmid = {30026560},
issn = {2041-1723},
support = {R37 NS042925-14//U.S. Department of Health &amp; Human Services | NIH | National Institute of Neurological Disorders and Stroke (NINDS)/International ; R01 NS052738-10//U.S. Department of Health &amp; Human Services | NIH | National Institute of Neurological Disorders and Stroke (NINDS)/International ; FG-1507-05262//National Multiple Sclerosis Society (National MS Society)/International ; R01 CA154683/CA/NCI NIH HHS/United States ; R01 NS052738/NS/NINDS NIH HHS/United States ; R01 052738-10//U.S. Department of Health &amp; Human Services | NIH | National Institute of Neurological Disorders and Stroke (NINDS)/International ; R37 NS042925/NS/NINDS NIH HHS/United States ; R01CA154683//U.S. Department of Health &amp; Human Services | NIH | National Cancer Institute (NCI)/International ; },
mesh = {Animals ; CRISPR-Cas Systems ; Cell Differentiation/genetics ; Cell Line ; Cell Proliferation/genetics ; Cell Survival/genetics ; Cells, Cultured ; Gene Expression Profiling ; HEK293 Cells ; Histones/metabolism ; Humans ; Methylation ; Mice, Inbred C57BL ; Mice, Knockout ; Myelin Sheath/*metabolism ; Oligodendroglia/cytology/*metabolism ; Protein-Arginine N-Methyltransferases/genetics/*metabolism ; Stem Cells/*metabolism ; },
abstract = {Oligodendrocytes (OLs) are the myelin-forming cells of the central nervous system. They are derived from differentiation of oligodendrocyte progenitors through a process requiring cell cycle exit and histone modifications. Here we identify the histone arginine methyl-transferase PRMT5, a molecule catalyzing symmetric methylation of histone H4R3, as critical for developmental myelination. PRMT5 pharmacological inhibition, CRISPR/cas9 targeting, or genetic ablation decrease p53-dependent survival and impair differentiation without affecting proliferation. Conditional ablation of Prmt5 in progenitors results in hypomyelination, reduced survival and differentiation. Decreased histone H4R3 symmetric methylation is followed by increased nuclear acetylation of H4K5, and is rescued by pharmacological inhibition of histone acetyltransferases. Data obtained using purified histones further validate the results obtained in mice and in cultured oligodendrocyte progenitors. Together, these results identify PRMT5 as critical for oligodendrocyte differentiation and developmental myelination by modulating the cross-talk between histone arginine methylation and lysine acetylation.},
}
@article {pmid29897959,
year = {2018},
author = {Olive, JF and Qin, Y and DeCristo, MJ and Laszewski, T and Greathouse, F and McAllister, SS},
title = {Accounting for tumor heterogeneity when using CRISPR-Cas9 for cancer progression and drug sensitivity studies.},
journal = {PloS one},
volume = {13},
number = {6},
pages = {e0198790},
pmid = {29897959},
issn = {1932-6203},
support = {R01 CA166284/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; Antineoplastic Agents/*therapeutic use ; CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Disease Progression ; Gene Editing ; Humans ; Mice ; Mice, Inbred NOD ; Mice, SCID ; Neoplasm Metastasis ; Neoplasms/*drug therapy/genetics/pathology ; Osteopontin/analysis/deficiency/genetics ; Phenotype ; Receptor, ErbB-2/genetics/metabolism ; Transplantation, Heterologous ; },
abstract = {Gene editing protocols often require the use of a subcloning step to isolate successfully edited cells, the behavior of which is then compared to the aggregate parental population and/or other non-edited subclones. Here we demonstrate that the inherent functional heterogeneity present in many cell lines can render these populations inappropriate controls, resulting in erroneous interpretations of experimental findings. We describe a novel CRISPR/Cas9 protocol that incorporates a single-cell cloning step prior to gene editing, allowing for the generation of appropriately matched, functionally equivalent control and edited cell lines. As a proof of concept, we generated matched control and osteopontin-knockout Her2+ and Estrogen receptor-negative murine mammary carcinoma cell lines and demonstrated that the osteopontin-knockout cell lines exhibit the expected biological phenotypes, including unaffected primary tumor growth kinetics and reduced metastatic outgrowth in female FVB mice. Using these matched cell lines, we discovered that osteopontin-knockout mammary tumors were more sensitive than control tumors to chemotherapy in vivo. Our results demonstrate that heterogeneity must be considered during experimental design when utilizing gene editing protocols and provide a solution to account for it.},
}
@article {pmid29499139,
year = {2018},
author = {Dugar, G and Leenay, RT and Eisenbart, SK and Bischler, T and Aul, BU and Beisel, CL and Sharma, CM},
title = {CRISPR RNA-Dependent Binding and Cleavage of Endogenous RNAs by the Campylobacter jejuni Cas9.},
journal = {Molecular cell},
volume = {69},
number = {5},
pages = {893-905.e7},
pmid = {29499139},
issn = {1097-4164},
support = {R35 GM119561/GM/NIGMS NIH HHS/United States ; T32 GM008776/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Associated Protein 9/genetics/*metabolism ; CRISPR-Cas Systems/*physiology ; Campylobacter jejuni/*enzymology/genetics ; DNA, Bacterial/genetics/metabolism ; Protein Domains ; RNA Stability/*physiology ; RNA, Bacterial/genetics/*metabolism ; RNA, Messenger/genetics/*metabolism ; },
abstract = {Cas9 nucleases naturally utilize CRISPR RNAs (crRNAs) to silence foreign double-stranded DNA. While recent work has shown that some Cas9 nucleases can also target RNA, RNA recognition has required nuclease modifications or accessory factors. Here, we show that the Campylobacter jejuni Cas9 (CjCas9) can bind and cleave complementary endogenous mRNAs in a crRNA-dependent manner. Approximately 100 transcripts co-immunoprecipitated with CjCas9 and generally can be subdivided through their base-pairing potential to the four crRNAs. A subset of these RNAs was cleaved around or within the predicted binding site. Mutational analyses revealed that RNA binding was crRNA and tracrRNA dependent and that target RNA cleavage required the CjCas9 HNH domain. We further observed that RNA cleavage was PAM independent, improved with greater complementarity between the crRNA and the RNA target, and was programmable in vitro. These findings suggest that C. jejuni Cas9 is a promiscuous nuclease that can coordinately target both DNA and RNA.},
}
@article {pmid29456189,
year = {2018},
author = {Rousseau, BA and Hou, Z and Gramelspacher, MJ and Zhang, Y},
title = {Programmable RNA Cleavage and Recognition by a Natural CRISPR-Cas9 System from Neisseria meningitidis.},
journal = {Molecular cell},
volume = {69},
number = {5},
pages = {906-914.e4},
pmid = {29456189},
issn = {1097-4164},
support = {K99 GM117268/GM/NIGMS NIH HHS/United States ; R00 GM117268/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Associated Protein 9/genetics/metabolism ; CRISPR-Cas Systems/*physiology ; Neisseria meningitidis/genetics/*metabolism ; RNA Stability/*physiology ; RNA, Bacterial/genetics/*metabolism ; },
abstract = {The microbial CRISPR systems enable adaptive defense against mobile elements and also provide formidable tools for genome engineering. The Cas9 proteins are type II CRISPR-associated, RNA-guided DNA endonucleases that identify double-stranded DNA targets by sequence complementarity and protospacer adjacent motif (PAM) recognition. Here we report that the type II-C CRISPR-Cas9 from Neisseria meningitidis (Nme) is capable of programmable, RNA-guided, site-specific cleavage and recognition of single-stranded RNA targets and that this ribonuclease activity is independent of the PAM sequence. We define the mechanistic feature and specificity constraint for RNA cleavage by NmeCas9 and also show that nuclease null dNmeCas9 binds to RNA target complementary to CRISPR RNA. Finally, we demonstrate that NmeCas9-catalyzed RNA cleavage can be blocked by three families of type II-C anti-CRISPR proteins. These results fundamentally expand the targeting capacities of CRISPR-Cas9 and highlight the potential utility of NmeCas9 as a single platform to target both RNA and DNA.},
}
@article {pmid29310060,
year = {2018},
author = {Xu, G and Guo, D and Wu, F and Abbas, N and Lai, K and Yuan, F and You, K and Liu, Y and Zhuang, Y and Wu, Y and Xu, Y and Chen, Y and Yang, F and Pan, T and Li, YX},
title = {Generation of a GDE heterozygous mutation human embryonic stem cell line WAe001-A-14 by CRISPR/Cas9 editing.},
journal = {Stem cell research},
volume = {27},
number = {},
pages = {38-41},
doi = {10.1016/j.scr.2017.12.009},
pmid = {29310060},
issn = {1876-7753},
mesh = {CRISPR-Cas Systems/*genetics ; Cell Line ; Glycogen Debranching Enzyme System/*genetics ; Heterozygote ; Human Embryonic Stem Cells/*metabolism ; Humans ; Mutation/genetics ; Real-Time Polymerase Chain Reaction ; },
abstract = {Glycogen debranching enzyme (GDE) plays a critical role in glycogenolysis. Mutations in the GDE gene are associated with a metabolic disease known as glycogen storage disease type III (GSDIII). We generated a mutant GDE human embryonic stem cell line, WAe001-A-14, using the CRISPR/Cas9 editing system. This cell line contains a 24-nucleotide deletion within exon-13 of GDE, resulting in 8 amino acids (TRLGISSL) missing of the GDE protein from amino acid position 567 to 575. The WAe001-A-14 cell line maintains typical stem cell morphology, pluripotency and in vitro differentiation potential, and a normal karyotype.},
}
@article {pmid29291512,
year = {2018},
author = {Chang, CW and Chang, CC and Hsia, KC and Tsai, SY},
title = {Generation of FHL2 homozygous knockout lines from human embryonic stem cells by CRISPR/Cas9-mediated ablation.},
journal = {Stem cell research},
volume = {27},
number = {},
pages = {21-24},
doi = {10.1016/j.scr.2017.12.015},
pmid = {29291512},
issn = {1876-7753},
mesh = {CRISPR-Cas Systems/genetics/*physiology ; Cell Differentiation/genetics/physiology ; Cell Line ; Cells, Cultured ; Exons/genetics ; Gene Knockout Techniques ; Hepatocytes/metabolism ; Human Embryonic Stem Cells/*metabolism ; Humans ; Karyotype ; LIM-Homeodomain Proteins/*genetics ; Muscle Proteins/*genetics ; Transcription Factors/*genetics ; },
abstract = {Cardiovascular disease is the leading cause of morbidity and mortality in the world. Mutations in the FHL2 (Four and a half LIM domains protein 2) gene are associated with cardiomyopathy in patients. Here, we generated two homozygous knockout lines using CRISPR/Cas9-mediated ablation in a human embryonic stem cell (hESC) WA09 line. These knockout lines exhibit a normal karyotype without expressing FHL2 protein, while maintaining pluripotency and differentiation properties. These isogenic mutation lines will be provided as a disease model for cardiomyopathy studies and drug screening.},
}
@article {pmid29278761,
year = {2018},
author = {Wu, F and Gao, G and Pan, T and Yang, Z and Xu, G and Abbas, N and Liu, Y and Chen, Y and Tan, S and You, K and Ke, X and Zhuang, Y and Lin, X and Yang, F and Li, YX},
title = {Generation of a SMO homozygous knockout human embryonic stem cell line WAe001-A-16 by CRISPR/Cas9 editing.},
journal = {Stem cell research},
volume = {27},
number = {},
pages = {5-9},
doi = {10.1016/j.scr.2017.12.002},
pmid = {29278761},
issn = {1876-7753},
mesh = {CRISPR-Cas Systems/genetics/physiology ; Cell Differentiation/genetics/physiology ; Cell Line ; Cilia/genetics/metabolism ; Embryonic Stem Cells/cytology/*metabolism ; Human Embryonic Stem Cells/*metabolism ; Humans ; Karyotype ; Open Reading Frames/genetics ; Smoothened Receptor/genetics/*metabolism ; },
abstract = {The human SMO protein encoded by the smoothened (SMO) gene acts as a positive mediator for Hedgehog signaling. This pathway regulates many cellular activities, developmental morphogenesis, and tumorigenesis. Using CRISPR/Cas9 to edit human embryonic stem cell line WA01 (H1), we established a SMO mutant cell line (WAe001-A-16). This cell line has a 40bp homozygous deletion in exon 2 of SMO leading to a shift in the open reading frame and early termination at amino acid position 287. WAe001-A-16 maintains a normal karyotype, parental cell morphology, pluripotency markers, and the capacity to differentiate into all three germline layers.},
}
@article {pmid29220093,
year = {2018},
author = {Parry, G and Jose, S},
title = {Separate product from process: framing the debate that surrounds the potential uptake of new breeding technologies.},
journal = {Physiologia plantarum},
volume = {164},
number = {4},
pages = {372-377},
doi = {10.1111/ppl.12680},
pmid = {29220093},
issn = {1399-3054},
support = {BB/M004376/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Agriculture/legislation &amp; jurisprudence/methods/trends ; *CRISPR-Cas Systems ; European Union ; Food, Genetically Modified ; Gene Editing/legislation &amp; jurisprudence/*methods/trends ; Genes, Plant/*genetics ; Genome, Plant/*genetics ; Plant Breeding/legislation &amp; jurisprudence/*methods ; Plants/*genetics ; Plants, Genetically Modified ; },
}
@article {pmid29087016,
year = {2018},
author = {Ashraf, J and Zuo, D and Wang, Q and Malik, W and Zhang, Y and Abid, MA and Cheng, H and Yang, Q and Song, G},
title = {Recent insights into cotton functional genomics: progress and future perspectives.},
journal = {Plant biotechnology journal},
volume = {16},
number = {3},
pages = {699-713},
pmid = {29087016},
issn = {1467-7652},
mesh = {CRISPR-Cas Systems ; Genome, Plant/*genetics ; Genomics/*methods ; Genotype ; Gossypium/*genetics ; },
abstract = {Functional genomics has transformed from futuristic concept to well-established scientific discipline during the last decade. Cotton functional genomics promise to enhance the understanding of fundamental plant biology to systematically exploit genetic resources for the improvement of cotton fibre quality and yield, as well as utilization of genetic information for germplasm improvement. However, determining the cotton gene functions is a much more challenging task, which has not progressed at a rapid pace. This article presents a comprehensive overview of the recent tools and resources available with the major advances in cotton functional genomics to develop elite cotton genotypes. This effort ultimately helps to filter a subset of genes that can be used to assemble a final list of candidate genes that could be employed in future novel cotton breeding programme. We argue that next stage of cotton functional genomics requires the draft genomes refinement, re-sequencing broad diversity panels with the development of high-throughput functional genomics tools and integrating multidisciplinary approaches in upcoming cotton improvement programmes.},
}
@article {pmid28898216,
year = {2017},
author = {Sheridan, C},
title = {CRISPR patent estate splinters.},
journal = {Nature biotechnology},
volume = {35},
number = {9},
pages = {808-809},
pmid = {28898216},
issn = {1546-1696},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*legislation &amp; jurisprudence ; Humans ; Patents as Topic/*legislation &amp; jurisprudence ; },
}
@article {pmid28898212,
year = {2017},
author = {Aschheim, K},
title = {Precision editing in the human embryo.},
journal = {Nature biotechnology},
volume = {35},
number = {9},
pages = {832},
pmid = {28898212},
issn = {1546-1696},
mesh = {CRISPR-Cas Systems/*genetics ; Embryo, Mammalian/physiology ; Embryonic Development/*genetics ; *Gene Editing ; Humans ; },
}
@article {pmid28700549,
year = {2017},
author = {Gray, BN and Spruill, WM},
title = {CRISPR-Cas9 claim sets and the potential to stifle innovation.},
journal = {Nature biotechnology},
volume = {35},
number = {7},
pages = {630-633},
pmid = {28700549},
issn = {1546-1696},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*legislation &amp; jurisprudence ; Humans ; Intellectual Property ; Patents as Topic/*legislation &amp; jurisprudence ; },
}
@article {pmid28656978,
year = {2017},
author = {Tang, W and Hu, JH and Liu, DR},
title = {Aptazyme-embedded guide RNAs enable ligand-responsive genome editing and transcriptional activation.},
journal = {Nature communications},
volume = {8},
number = {},
pages = {15939},
pmid = {28656978},
issn = {2041-1723},
support = {R01 EB022376/EB/NIBIB NIH HHS/United States ; R35 GM118062/GM/NIGMS NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems ; *Gene Editing ; HEK293 Cells ; Humans ; Ligands ; Nucleic Acid Conformation ; RNA, Catalytic/genetics/*metabolism ; RNA, Guide/chemistry/genetics/*metabolism ; *Transcriptional Activation ; },
abstract = {Programmable sequence-specific genome editing agents such as CRISPR-Cas9 have greatly advanced our ability to manipulate the human genome. Although canonical forms of genome-editing agents and programmable transcriptional regulators are constitutively active, precise temporal and spatial control over genome editing and transcriptional regulation activities would enable the more selective and potentially safer use of these powerful technologies. Here, by incorporating ligand-responsive self-cleaving catalytic RNAs (aptazymes) into guide RNAs, we developed a set of aptazyme-embedded guide RNAs that enable small molecule-controlled nuclease-mediated genome editing and small molecule-controlled base editing, as well as small molecule-dependent transcriptional activation in mammalian cells.},
}
@article {pmid28653169,
year = {2018},
author = {Guttinger, S},
title = {Trust in Science: CRISPR-Cas9 and the Ban on Human Germline Editing.},
journal = {Science and engineering ethics},
volume = {24},
number = {4},
pages = {1077-1096},
pmid = {28653169},
issn = {1471-5546},
support = {324186//European Research Council/International ; },
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; *Gene Editing ; *Genetic Engineering ; Genome ; *Germ Cells ; Humans ; *Social Control, Formal ; *Trust ; Uncertainty ; },
abstract = {In 2015 scientists called for a partial ban on genome editing in human germline cells. This call was a response to the rapid development of the CRISPR-Cas9 system, a molecular tool that allows researchers to modify genomic DNA in living organisms with high precision and ease of use. Importantly, the ban was meant to be a trust-building exercise that promises a 'prudent' way forward. The goal of this paper is to analyse whether the ban can deliver on this promise. To do so the focus will be put on the precedent on which the current ban is modelled, namely the Asilomar ban on recombinant DNA technology. The analysis of this case will show (a) that the Asilomar ban was successful because of a specific two-step containment strategy it employed and (b) that this two-step approach is also key to making the current ban work. It will be argued, however, that the Asilomar strategy cannot be transferred to human genome editing and that the current ban therefore fails to deliver on its promise. The paper will close with a reflection on the reasons for this failure and on what can be learned from it about the regulation of novel molecular tools.},
}
@article {pmid30595438,
year = {2018},
author = {Jiang, F and Liu, JJ and Osuna, BA and Xu, M and Berry, JD and Rauch, BJ and Nogales, E and Bondy-Denomy, J and Doudna, JA},
title = {Temperature-Responsive Competitive Inhibition of CRISPR-Cas9.},
journal = {Molecular cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.molcel.2018.11.016},
pmid = {30595438},
issn = {1097-4164},
abstract = {CRISPR-Cas immune systems utilize RNA-guided nucleases to protect bacteria from bacteriophage infection. Bacteriophages have in turn evolved inhibitory &quot;anti-CRISPR&quot; (Acr) proteins, including six inhibitors (AcrIIA1-AcrIIA6) that can block DNA cutting and genome editing by type II-A CRISPR-Cas9 enzymes. We show here that AcrIIA2 and its more potent homolog, AcrIIA2b, prevent Cas9 binding to DNA by occluding protein residues required for DNA binding. Cryo-EM-determined structures of AcrIIA2 or AcrIIA2b bound to S. pyogenes Cas9 reveal a mode of competitive inhibition of DNA binding that is distinct from other known Acrs. Differences in the temperature dependence of Cas9 inhibition by AcrIIA2 and AcrIIA2b arise from differences in both inhibitor structure and the local inhibitor-binding environment on Cas9. These findings expand the natural toolbox for regulating CRISPR-Cas9 genome editing temporally, spatially, and conditionally.},
}
@article {pmid30479331,
year = {2018},
author = {Zhou, W and Hu, L and Ying, L and Zhao, Z and Chu, PK and Yu, XF},
title = {A CRISPR-Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {5012},
pmid = {30479331},
issn = {2041-1723},
mesh = {Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; DNA/*analysis ; Fluorescence ; HEK293 Cells ; Humans ; Nucleic Acid Amplification Techniques/*methods ; Nucleotides/genetics ; },
abstract = {Although polymerase chain reaction (PCR) is the most widely used method for DNA amplification, the requirement of thermocycling limits its non-laboratory applications. Isothermal DNA amplification techniques are hence valuable for on-site diagnostic applications in place of traditional PCR. Here we describe a true isothermal approach for amplifying and detecting double-stranded DNA based on a CRISPR-Cas9-triggered nicking endonuclease-mediated Strand Displacement Amplification method (namely CRISDA). CRISDA takes advantage of the high sensitivity/specificity and unique conformational rearrangements of CRISPR effectors in recognizing the target DNA. In combination with a peptide nucleic acid (PNA) invasion-mediated endpoint measurement, the method exhibits attomolar sensitivity and single-nucleotide specificity in detection of various DNA targets under a complex sample background. Additionally, by integrating the technique with a Cas9-mediated target enrichment approach, CRISDA exhibits sub-attomolar sensitivity. In summary, CRISDA is a powerful isothermal tool for ultrasensitive and specific detection of nucleic acids in point-of-care diagnostics and field analyses.},
}
@article {pmid30478310,
year = {2018},
author = {Chin, HS and Li, MX and Tan, IKL and Ninnis, RL and Reljic, B and Scicluna, K and Dagley, LF and Sandow, JJ and Kelly, GL and Samson, AL and Chappaz, S and Khaw, SL and Chang, C and Morokoff, A and Brinkmann, K and Webb, A and Hockings, C and Hall, CM and Kueh, AJ and Ryan, MT and Kluck, RM and Bouillet, P and Herold, MJ and Gray, DHD and Huang, DCS and van Delft, MF and Dewson, G},
title = {VDAC2 enables BAX to mediate apoptosis and limit tumor development.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4976},
pmid = {30478310},
issn = {2041-1723},
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems/genetics ; Carcinogenesis/*metabolism/*pathology ; Embryonic Development ; HCT116 Cells ; HeLa Cells ; Humans ; Mice, Inbred C57BL ; Mitochondria/metabolism ; Promoter Regions, Genetic/genetics ; Voltage-Dependent Anion Channel 2/*metabolism ; bcl-2 Homologous Antagonist-Killer Protein/metabolism ; bcl-2-Associated X Protein/*metabolism ; },
abstract = {Intrinsic apoptosis is critical to prevent tumor formation and is engaged by many anti-cancer agents to eliminate tumor cells. BAX and BAK, the two essential mediators of apoptosis, are thought to be regulated through similar mechanisms and act redundantly to drive apoptotic cell death. From an unbiased genome-wide CRISPR/Cas9 screen, we identified VDAC2 (voltage-dependent anion channel 2) as important for BAX, but not BAK, to function. Genetic deletion of VDAC2 abrogated the association of BAX and BAK with mitochondrial complexes containing VDAC1, VDAC2, and VDAC3, but only inhibited BAX apoptotic function. Deleting VDAC2 phenocopied the loss of BAX in impairing both the killing of tumor cells by anti-cancer agents and the ability to suppress tumor formation. Together, our studies show that efficient BAX-mediated apoptosis depends on VDAC2, and reveal a striking difference in how BAX and BAK are functionally impacted by their interactions with VDAC2.},
}
@article {pmid30464460,
year = {2018},
author = {Cheng, WJ and Chen, LC and Ho, HO and Lin, HL and Sheu, MT},
title = {Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy.},
journal = {International journal of nanomedicine},
volume = {13},
number = {},
pages = {7079-7094},
pmid = {30464460},
issn = {1178-2013},
mesh = {Animals ; B7-H1 Antigen/*metabolism ; CRISPR-Associated Protein 9/metabolism ; CRISPR-Cas Systems/*genetics ; Cell Death ; Cell Line, Tumor ; Cell Survival ; Endocytosis ; Gene Silencing ; Humans ; *Immunotherapy ; Mice ; Nanoparticles/*chemistry/ultrastructure ; Particle Size ; Plasmids/metabolism ; Polyethyleneimine/*chemistry ; Proton Magnetic Resonance Spectroscopy ; RNA, Small Interfering/genetics/*metabolism ; Serum Albumin, Human/*chemistry ; Static Electricity ; Stearic Acids/*chemistry ; Transfection ; },
abstract = {Purpose: In this study, a double emulsion method for complexing plasmids with stearyl poly-ethylenimine (stPEI) as the core to form human serum albumin (HSA) (plasmid/stPEI/HSA) nanoparticles (NPs) was developed for gene delivery by non-covalently binding onto plasmid/stPEI/HSA nanoparticles with CRISPR/Cas9 or siRNA, which disrupts or silences the expression of programmed cell death ligand-1 (PD-L1) for immunotherapy.<br><br>Materials and methods: Chemically synthesized stearyl-polyethyenimine (stPEI)/plasmids/HSA nanoparticles were maded by double emulsion method. They were characterized by dynamic light scattering (DLS), transmission electron microscope and also evaluated by in vitro study on CT 26 cells.<br><br>Results: stPEI was synthesized by an N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC)-N-hydroxysuccinimide (NHS) reaction, and we found that the degree of substitution was ~1.0 when the ratio of PEI to stearic acid was 1:7 in the reaction. Then, two sgRNA sequences were selected and evaluated for their ability to knock out PD-L1 by decreasing its expression by about 20%. Based on the trend of particle size/zeta potential values as a function of ratio, F25P1 containing 25 μg of plasmid/stPEI/HSA NPs noncovalently bound to 1 μg plasmids via charge-charge interactions was found to be optimal. Its particle size was about 202.7±4.5 nm, and zeta potential was 12.60±0.15 mV. In an in vitro study, these NPs showed little cytotoxicity but high cellular uptake. Moreover, they revealed the potential for transfection and PD-L1 knockout in an in vitro cell model. Furthermore, F25P1S0.5 containing 25 μg of plasmid/stPEI/HSA NPs noncovalently bound to 1 μg of plasmids and 0.5 μg siRNA was prepared to simultaneously deliver plasmids and siRNA. An in vitro study demonstrated that the siRNA did not interfere with the transfection of plasmids and showed a high-transfection efficiency with a synergistic effect on inhibition of PD-L1 expression by 21.95%.<br><br>Conclusion: The plasmids/stPEI/HSA NPs could be a promising tool for gene delivery and improved immunotherapy.},
}
@article {pmid30323337,
year = {2018},
author = {Ding, Y and Gong, C and Huang, and Chen, R and Sui, P and Lin, KH and Liang, G and Yuan, L and Xiang, H and Chen, J and Yin, T and Alexander, PB and Wang, QF and Song, EW and Li, QJ and Wood, KC and Wang, XF},
title = {Synthetic lethality between HER2 and transaldolase in intrinsically resistant HER2-positive breast cancers.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4274},
pmid = {30323337},
issn = {2041-1723},
support = {F30 CA206348/CA/NCI NIH HHS/United States ; P50 CA190991/CA/NCI NIH HHS/United States ; W81XWH-16-1-0703//U.S. Department of Defense (DOD)/International ; W81XWH-16-1-0618//U.S. Department of Defense (DOD)/International ; },
mesh = {Breast Neoplasms/*genetics/metabolism ; CRISPR-Cas Systems ; Cell Death/drug effects ; Cell Line, Tumor ; Drug Resistance, Neoplasm/*genetics ; Female ; Genetic Testing ; HEK293 Cells ; Humans ; Lapatinib/pharmacology ; Metabolic Flux Analysis ; NADP/metabolism ; Pentose Phosphate Pathway ; Receptor, ErbB-2/*genetics ; Synthetic Lethal Mutations/*genetics ; Transaldolase/*genetics ; },
abstract = {Intrinsic resistance to anti-HER2 therapy in breast cancer remains an obstacle in the clinic, limiting its efficacy. However, the biological basis for intrinsic resistance is poorly understood. Here we performed a CRISPR/Cas9-mediated loss-of-function genetic profiling and identified TALDO1, which encodes the rate-limiting transaldolase (TA) enzyme in the non-oxidative pentose phosphate pathway, as essential for cellular survival following pharmacological HER2 blockade. Suppression of TA increases cell susceptibility to HER2 inhibition in two intrinsically resistant breast cancer cell lines with HER2 amplification. Mechanistically, TA depletion combined with HER2 inhibition significantly reduces cellular NADPH levels, resulting in excessive ROS production and deficient lipid and nucleotide synthesis. Importantly, higher TA expression correlates with poor response to HER2 inhibition in a breast cancer patient cohort. Together, these results pinpoint TA as a novel metabolic enzyme possessing synthetic lethality with HER2 inhibition that can potentially be exploited as a biomarker or target for combination therapy.},
}
@article {pmid30213958,
year = {2018},
author = {Lager, AM and Corradin, OG and Cregg, JM and Elitt, MS and Shick, HE and Clayton, BLL and Allan, KC and Olsen, HE and Madhavan, M and Tesar, PJ},
title = {Rapid functional genetics of the oligodendrocyte lineage using pluripotent stem cells.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3708},
pmid = {30213958},
issn = {2041-1723},
support = {F31 NS083354/NS/NINDS NIH HHS/United States ; S10 OD016164/OD/NIH HHS/United States ; P30 CA043703/CA/NCI NIH HHS/United States ; R01 NS093357/NS/NINDS NIH HHS/United States ; R01 NS095280/NS/NINDS NIH HHS/United States ; },
mesh = {Alleles ; Animals ; CRISPR-Cas Systems ; Cell Differentiation/genetics ; *Cell Lineage ; DNA Mutational Analysis ; Genetic Association Studies ; Genetic Engineering ; Genotype ; Induced Pluripotent Stem Cells ; Lentivirus ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Neurons/metabolism ; Oligodendroglia/*cytology ; Pluripotent Stem Cells/*cytology ; },
abstract = {Oligodendrocyte dysfunction underlies many neurological disorders, but rapid assessment of mutation-specific effects in these cells has been impractical. To enable functional genetics in oligodendrocytes, here we report a highly efficient method for generating oligodendrocytes and their progenitors from mouse embryonic and induced pluripotent stem cells, independent of mouse strain or mutational status. We demonstrate that this approach, when combined with genome engineering, provides a powerful platform for the expeditious study of genotype-phenotype relationships in oligodendrocytes.},
}
@article {pmid29414415,
year = {2018},
author = {Tu, J and Huo, Z and Liu, M and Wang, D and Xu, A and Zhou, R and Zhu, D and Gingold, J and Shen, J and Zhao, R and Lee, DF},
title = {Generation of human embryonic stem cell line with heterozygous RB1 deletion by CRIPSR/Cas9 nickase.},
journal = {Stem cell research},
volume = {28},
number = {},
pages = {29-32},
pmid = {29414415},
issn = {1876-7753},
support = {K99 CA181496/CA/NCI NIH HHS/United States ; R00 CA181496/CA/NCI NIH HHS/United States ; },
mesh = {Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Cell Culture Techniques/*methods ; Cell Differentiation ; Cell Line ; Deoxyribonuclease I/*metabolism ; *Gene Deletion ; Heterozygote ; Human Embryonic Stem Cells/*cytology ; Humans ; Male ; Retinoblastoma Protein/*genetics ; },
abstract = {The Retinoblastoma 1 (RB1) tumor suppressor, a member of the Retinoblastoma gene family, functions as a pocket protein for the functional binding of E2F transcription factors. About 1/3 of retinoblastoma patients harbor a germline RB1 mutation or deletion, leading to the development of retinoblastoma. Here, we demonstrate generation of a heterozygous deletion of the RB1 gene in the H1 human embryonic stem cell line using CRISPR/Cas9 nickase genome editing. The RB1 heterozygous knockout H1 cell line shows a normal karyotype, maintains a pluripotent state, and is capable of differentiation to the three germline layers.},
}
@article {pmid28634346,
year = {2017},
author = {Knuepfer, E and Napiorkowska, M and van Ooij, C and Holder, AA},
title = {Generating conditional gene knockouts in Plasmodium - a toolkit to produce stable DiCre recombinase-expressing parasite lines using CRISPR/Cas9.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {3881},
pmid = {28634346},
issn = {2045-2322},
mesh = {Animals ; Animals, Genetically Modified ; *CRISPR-Cas Systems ; Gene Editing ; *Gene Expression ; Gene Knockout Techniques ; Genes, Reporter ; Genome, Protozoan ; Integrases/*genetics ; Plasmids/genetics ; Plasmodium/*genetics ; Plasmodium falciparum/genetics ; Recombination, Genetic ; },
abstract = {Successful establishment of CRISPR/Cas9 genome editing technology in Plasmodium spp. has provided a powerful tool to transform Plasmodium falciparum into a genetically more tractable organism. Conditional gene regulation approaches are required to study the function of gene products critical for growth and erythrocyte invasion of blood stage parasites. Here we employ CRISPR/Cas9 to facilitate use of the dimerisable Cre-recombinase (DiCre) that is frequently used to mediate the excision and loss of loxP-flanked DNA sequences in a rapamycin controlled manner. We describe novel CRISPR/Cas9 transfection plasmids and approaches for the speedy, stable and marker-free introduction of transgenes encoding the DiCre recombinase into genomic loci dispensable for blood stage development. Together these plasmids form a toolkit that will allow the rapid generation of transgenic DiCre-expressing P. falciparum lines in any genetic background. Furthermore, the newly developed 3D7-derived parasite lines, constitutively and stably expressing DiCre, generated using this toolkit will prove useful for the analysis of gene products. Lastly, we introduce an improved treatment protocol that uses a lower rapamycin concentration and shorter treatment times, leading to loxP-guided recombination with close to 100% efficiency within the same replication cycle.},
}
@article {pmid28596588,
year = {2017},
author = {Xie, Z and Pang, D and Wang, K and Li, M and Guo, N and Yuan, H and Li, J and Zou, X and Jiao, H and Ouyang, H and Li, Z and Tang, X},
title = {Optimization of a CRISPR/Cas9-mediated Knock-in Strategy at the Porcine Rosa26 Locus in Porcine Foetal Fibroblasts.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {3036},
pmid = {28596588},
issn = {2045-2322},
mesh = {Animals ; Base Sequence ; *CRISPR-Cas Systems ; Cell Line ; Electroporation ; Fibroblasts/*metabolism ; Gene Expression ; *Gene Knock-In Techniques ; *Gene Targeting/methods ; Genes, Reporter ; *Genetic Loci ; Humans ; Swine ; Transgenes ; },
abstract = {Genetically modified pigs have important roles in agriculture and biomedicine. However, genome-specific knock-in techniques in pigs are still in their infancy and optimal strategies have not been extensively investigated. In this study, we performed electroporation to introduce a targeting donor vector (a non-linearized vector that did not contain a promoter or selectable marker) into Porcine Foetal Fibroblasts (PFFs) along with a CRISPR/Cas9 vector. After optimization, the efficiency of the EGFP site-specific knock-in could reach up to 29.6% at the pRosa26 locus in PFFs. Next, we used the EGFP reporter PFFs to address two key conditions in the process of achieving transgenic pigs, the limiting dilution method and the strategy to evaluate the safety and feasibility of the knock-in locus. This study demonstrates that we establish an efficient procedures for the exogenous gene knock-in technique and creates a platform to efficiently generate promoter-less and selectable marker-free transgenic PFFs through the CRISPR/Cas9 system. This study should contribute to the generation of promoter-less and selectable marker-free transgenic pigs and it may provide insights into sophisticated site-specific genome engineering techniques for additional species.},
}
@article {pmid28596534,
year = {2017},
author = {Zhang, S and Chen, P and Jin, H and Yi, J and Xie, X and Yang, M and Gao, T and Yang, L and Hu, C and Zhang, X and Yu, X},
title = {Circulating 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF) levels are associated with hyperglycemia and β cell dysfunction in a Chinese population.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {3114},
pmid = {28596534},
issn = {2045-2322},
mesh = {*Asian Continental Ancestry Group ; CRISPR-Associated Protein 9/genetics/metabolism ; CRISPR-Cas Systems ; China ; Furans/*blood ; Humans ; Hyperglycemia/*blood ; Insulin-Secreting Cells/*metabolism ; Mutation ; Propionates/*blood ; },
abstract = {Several recent clinical studies have suggested that the levels of circulating 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF) are significantly higher in patients with gestational diabetes mellitus (GDM), impaired glucose tolerance (IGT), and type 2 diabetes mellitus (T2DM). This study recruited a total of 516 participants. The following patient populations were enrolled: 99 newly diagnosed cases with T2DM, 219 cases with prediabetes [82 with isolated impaired glucose tolerance (I - IGT), 66 with isolated impaired fasting glucose (I - IFG) and 71 with impaired glucose tolerance and impaired fasting glucose (IGT + IFG)], and 198 cases with normal glucose tolerance [NGT, including 99 first-degree relatives of type 2 diabetes patients (FDRs) and 99 non-FDRs]. We investigated the circulating CMPF levels in subjects with different glucose metabolism statuses and examined the potential link between CMPF and β cell function. Our results indicate that the serum CMPF levels were elevated in the prediabetes, T2DM, and FDRs groups compared to the NGT group. Additionally, the serum CMPF concentrations were independently and negatively associated with the triglyceride levels and Stumvoll first-phase insulin secretion index. Cumulatively, our findings suggest that the circulating CMPF levels can predict glycolipid metabolism disorders. Furthermore, elevated serum CMPF concentrations may determine hyperglycemia and β cell dysfunction.},
}
@article {pmid30594894,
year = {2018},
author = {Fang, L and Hung, SSC and Yek, J and El Wazan, L and Nguyen, T and Khan, S and Lim, SY and Hewitt, AW and Wong, RCB},
title = {A Simple Cloning-free Method to Efficiently Induce Gene Expression Using CRISPR/Cas9.},
journal = {Molecular therapy. Nucleic acids},
volume = {14},
number = {},
pages = {184-191},
doi = {10.1016/j.omtn.2018.11.008},
pmid = {30594894},
issn = {2162-2531},
abstract = {Gain-of-function studies often require the tedious cloning of transgene cDNA into vectors for overexpression beyond the physiological expression levels. The rapid development of CRISPR/Cas technology presents promising opportunities to address these issues. Here, we report a simple, cloning-free method to induce gene expression at an endogenous locus using CRISPR/Cas9 activators. Our strategy utilizes synthesized sgRNA expression cassettes to direct a nuclease-null Cas9 complex fused with transcriptional activators (VP64, p65, and Rta) for site-specific induction of endogenous genes. This strategy allows rapid initiation of gain-of-function studies in the same day. Using this approach, we tested two CRISPR activation systems, dSpCas9VPR and dSaCas9VPR, for induction of multiple genes in human and rat cells. Our results showed that both CRISPR activators allow efficient induction of six different neural development genes (CRX, RORB, RAX, OTX2, ASCL1, and NEUROD1) in human cells, whereas the rat cells exhibit more variable and less-efficient levels of gene induction, as observed in three different genes (Ascl1, Neurod1, Nrl). Altogether, this study provides a simple method to efficiently activate endogenous gene expression using CRISPR/Cas9 activators, which can be applied as a rapid workflow to initiate gain-of-function studies for a range of molecular- and cell-biology disciplines.},
}
@article {pmid30213538,
year = {2018},
author = {Suzuki, M and Hayashi, T and Inoue, T and Agata, K and Hirayama, M and Suzuki, M and Shigenobu, S and Takeuchi, T and Yamamoto, T and Suzuki, KT},
title = {Cas9 ribonucleoprotein complex allows direct and rapid analysis of coding and noncoding regions of target genes in Pleurodeles waltl development and regeneration.},
journal = {Developmental biology},
volume = {443},
number = {2},
pages = {127-136},
doi = {10.1016/j.ydbio.2018.09.008},
pmid = {30213538},
issn = {1095-564X},
mesh = {Animals ; Animals, Genetically Modified ; Breeding/methods ; CRISPR-Associated Protein 9/*genetics/metabolism ; CRISPR-Cas Systems ; Developmental Biology/methods ; Gene Knockout Techniques ; Phenotype ; Pleurodeles/*genetics/metabolism ; Regeneration/*genetics ; Ribonucleoproteins/genetics/metabolism ; Sequence Analysis, DNA/methods ; },
abstract = {Newts have remarkable ability to regenerate their organs and have been used in research for centuries. However, the laborious work of breeding has hampered reverse genetics strategies in newt. Here, we present simple and efficient gene knockout using Cas9 ribonucleoprotein complex (RNP) in Pleurodeles waltl, a species suitable for regenerative biology studies using reverse genetics. Most of the founders exhibited severe phenotypes against each target gene (tyrosinase, pax6, tbx5); notably, all tyrosinase Cas9 RNP-injected embryos showed complete albinism. Moreover, amplicon sequencing analysis of Cas9 RNP-injected embryos revealed virtually complete biallelic disruption at target loci in founders, allowing direct phenotype analysis in the F0 generation. In addition, we demonstrated the generation of tyrosinase null F1 offspring within a year. Finally, we expanded this approach to the analysis of noncoding regulatory elements by targeting limb-specific enhancer of sonic hedgehog, known as the zone of polarizing activity regulatory sequence (ZRS; also called MFCS1). Disruption of ZRS led to digit deformation in limb regeneration. From these results, we are confident that this highly efficient gene knockout method will accelerate gene functional analysis in the post-genome era of salamanders.},
}
@article {pmid30087332,
year = {2018},
author = {Ghini, F and Rubolino, C and Climent, M and Simeone, I and Marzi, MJ and Nicassio, F},
title = {Endogenous transcripts control miRNA levels and activity in mammalian cells by target-directed miRNA degradation.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3119},
pmid = {30087332},
issn = {2041-1723},
support = {2016-0615//Fondazione Cariplo (Cariplo Foundation)/International ; 2015-0590//Fondazione Cariplo (Cariplo Foundation)/International ; IG14085//Associazione Italiana per la Ricerca sul Cancro (Italian Association for Cancer Research)/International ; },
mesh = {3' Untranslated Regions ; Animals ; Apoptosis ; CRISPR-Cas Systems ; Cell Cycle ; Fibroblasts/*metabolism ; Gene Deletion ; Gene Expression ; Gene Expression Profiling ; Gene Expression Regulation ; Mice ; MicroRNAs/*genetics/metabolism ; Mutation ; Phenotype ; RNA Stability ; Sequence Analysis, RNA ; Serpin E2/genetics/*metabolism ; },
abstract = {Little is known about miRNA decay. A target-directed miRNA degradation mechanism (TDMD) has been suggested, but further investigation on endogenous targets is necessary. Here, we identify hundreds of targets eligible for TDMD and show that an endogenous RNA (Serpine1) controls the degradation of two miRNAs (miR-30b-5p and miR-30c-5p) in mouse fibroblasts. In our study, TDMD occurs when the target is expressed at relatively low levels, similar in range to those of its miRNAs (100-200 copies per cell), and becomes more effective at high target:miRNA ratios (>10:1). We employ CRISPR/Cas9 to delete the miR-30 responsive element within Serpine1 3'UTR and interfere with TDMD. TDMD suppression increases miR-30b/c levels and boosts their activity towards other targets, modulating gene expression and cellular phenotypes (i.e., cell cycle re-entry and apoptosis). In conclusion, a sophisticated regulatory layer of miRNA and gene expression mediated by specific endogenous targets exists in mammalian cells.},
}
@article {pmid29924856,
year = {2018},
author = {McHugh, DR and Steele, MS and Valerio, DM and Miron, A and Mann, RJ and LePage, DF and Conlon, RA and Cotton, CU and Drumm, ML and Hodges, CA},
title = {A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.},
journal = {PloS one},
volume = {13},
number = {6},
pages = {e0199573},
pmid = {29924856},
issn = {1932-6203},
mesh = {Animals ; CRISPR-Cas Systems ; Cells, Cultured ; *Codon, Nonsense ; Cystic Fibrosis/genetics/metabolism/*therapy ; Cystic Fibrosis Transmembrane Conductance Regulator/*genetics/metabolism ; *Disease Models, Animal ; Female ; Genetic Therapy/*methods ; Intestines ; Male ; Mice, Inbred C57BL ; *Mice, Transgenic ; Organoids/drug effects/metabolism ; RNA, Messenger/metabolism ; Tissue Culture Techniques ; },
abstract = {Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.},
}
@article {pmid29266160,
year = {2018},
author = {Yue, H and Zhou, X and Cheng, M and Xing, D},
title = {Graphene oxide-mediated Cas9/sgRNA delivery for efficient genome editing.},
journal = {Nanoscale},
volume = {10},
number = {3},
pages = {1063-1071},
doi = {10.1039/c7nr07999k},
pmid = {29266160},
issn = {2040-3372},
mesh = {*CRISPR-Cas Systems ; Cell Line ; *Gene Editing ; *Graphite ; Green Fluorescent Proteins ; Humans ; Oxides ; RNA, Guide/*genetics ; },
abstract = {Direct cellular delivery of CRISPR/Cas9 complexes is of great significance for genome editing and other recently developed applications, such as gene expression regulation and RNA/DNA imaging. Here, we first constructed a graphene oxide (GO)-polyethylene glycol (PEG)-polyethylenimine (PEI) nanocarrier for the delivery of high-molecular-weight Cas9/single-guide RNA (sgRNA) complexes for endocytosis, endosomal escape, nuclear entry, and gene editing. The results demonstrate that the nanocarrier can be used successfully for efficient gene editing in human AGS cells with an efficiency of ∼39%. The results also show that this nanocarrier can protect sgRNA from enzymatic degradation, thus exhibiting extremely high stability, which is critical for future in vivo applications. Thus, this GO-mediated Cas9/sgRNA delivery system has potential as a new approach for biomedical research and targeted gene engineering applications.},
}
@article {pmid28921815,
year = {2018},
author = {Sánchez-León, S and Gil-Humanes, J and Ozuna, CV and Giménez, MJ and Sousa, C and Voytas, DF and Barro, F},
title = {Low-gluten, nontransgenic wheat engineered with CRISPR/Cas9.},
journal = {Plant biotechnology journal},
volume = {16},
number = {4},
pages = {902-910},
pmid = {28921815},
issn = {1467-7652},
mesh = {*CRISPR-Cas Systems ; Gene Editing ; Genetic Engineering/*methods ; Gliadin/*genetics ; Glutens/*genetics/metabolism ; Mutation ; Phenotype ; Plants, Genetically Modified ; RNA, Guide ; Triticum/*genetics ; },
abstract = {Coeliac disease is an autoimmune disorder triggered in genetically predisposed individuals by the ingestion of gluten proteins from wheat, barley and rye. The α-gliadin gene family of wheat contains four highly stimulatory peptides, of which the 33-mer is the main immunodominant peptide in patients with coeliac. We designed two sgRNAs to target a conserved region adjacent to the coding sequence for the 33-mer in the α-gliadin genes. Twenty-one mutant lines were generated, all showing strong reduction in α-gliadins. Up to 35 different genes were mutated in one of the lines of the 45 different genes identified in the wild type, while immunoreactivity was reduced by 85%. Transgene-free lines were identified, and no off-target mutations have been detected in any of the potential targets. The low-gluten, transgene-free wheat lines described here could be used to produce low-gluten foodstuff and serve as source material to introgress this trait into elite wheat varieties.},
}
@article {pmid28905515,
year = {2018},
author = {Wang, X and Tu, M and Wang, D and Liu, J and Li, Y and Li, Z and Wang, Y and Wang, X},
title = {CRISPR/Cas9-mediated efficient targeted mutagenesis in grape in the first generation.},
journal = {Plant biotechnology journal},
volume = {16},
number = {4},
pages = {844-855},
pmid = {28905515},
issn = {1467-7652},
mesh = {Botrytis/pathogenicity ; *CRISPR-Cas Systems ; Disease Resistance/genetics ; Gene Editing ; Gene Knockout Techniques ; Genetic Vectors ; Homozygote ; Mutagenesis ; Mutagenesis, Site-Directed ; Mutation ; Plant Breeding/*methods ; Plant Diseases/genetics/microbiology ; Plant Proteins/genetics ; *Plants, Genetically Modified ; Transcription Factors/genetics ; Vitis/*genetics/microbiology ; },
abstract = {The clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR/Cas9) system is a powerful tool for editing plant genomes. Efficient genome editing of grape (Vitis vinifera) suspension cells using the type II CRISPR/Cas9 system has been demonstrated; however, it has not been established whether this system can be applied to get biallelic mutations in the first generation of grape. In this current study, we designed four guide RNAs for the VvWRKY52 transcription factor gene for using with the CRISPR/Cas9 system, and obtained transgenic plants via Agrobacterium-mediated transformation, using somatic embryos of the Thompson Seedless cultivar. Analysis of the first-generation transgenic plants verified 22 mutant plants of the 72 T-DNA-inserted plants. Of these, 15 lines carried biallelic mutations and seven were heterozygous. A range of RNA-guided editing events, including large deletions, were found in the mutant plants, while smaller deletions comprised the majority of the detected mutations. Sequencing of potential off-target sites for all four targets revealed no off-target events. In addition, knockout of VvWRKY52 in grape increased the resistance to Botrytis cinerea. We conclude that the CRISPR/Cas9 system allows precise genome editing in the first generation of grape and represents a useful tool for gene functional analysis and grape molecular breeding.},
}
@article {pmid28600547,
year = {2017},
author = {Guo, D and Liu, H and Ruzi, A and Gao, G and Nasir, A and Liu, Y and Yang, F and Wu, F and Xu, G and Li, YX},
title = {Modeling Congenital Hyperinsulinism with ABCC8-Deficient Human Embryonic Stem Cells Generated by CRISPR/Cas9.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {3156},
pmid = {28600547},
issn = {2045-2322},
mesh = {C-Peptide/antagonists &amp; inhibitors/biosynthesis ; *CRISPR-Cas Systems ; Cell Differentiation ; Congenital Hyperinsulinism/genetics/metabolism/pathology ; Gastrointestinal Agents/pharmacology ; Gene Editing/methods ; Human Embryonic Stem Cells/cytology/drug effects/*metabolism ; Humans ; Insulin/biosynthesis ; Insulin Antagonists/pharmacology ; Insulin-Secreting Cells/cytology/drug effects/*metabolism ; *Models, Biological ; Nicorandil/pharmacology ; Nifedipine/pharmacology ; Octreotide/pharmacology ; Phenotype ; Potassium Chloride/pharmacology ; Sulfonylurea Receptors/deficiency/*genetics ; Vasodilator Agents/pharmacology ; },
abstract = {Congenital hyperinsulinism (CHI) is a rare genetic disorder characterized by excess insulin secretion, which results in hypoglycemia. Mutation of sulfonylurea receptor 1 (SUR1), encoded by the ABCC8 gene, is the main cause of CHI. Here, we captured the phenotype of excess insulin secretion through pancreatic differentiation of ABCC8-deficient stem cells generated by the CRISPR/Cas9 system. ABCC8-deficient insulin-producing cells secreted higher insulin than their wild-type counterparts, and the excess insulin secretion was rescued by nifedipine, octreotide and nicorandil. Further, we tested the role of SUR1 in response to different potassium levels and found that dysfunction of SUR1 decreased the insulin secretion rate in low and high potassium environments. Hence, pancreatic differentiation of ABCC8-deficient cells recapitulated the CHI disease phenotype in vitro, which represents an attractive model to further elucidate the function of SUR1 and to develop and screen for novel therapeutic drugs.},
}
@article {pmid30587106,
year = {2018},
author = {Hwang, GH and Park, J and Lim, K and Kim, S and Yu, J and Yu, E and Kim, ST and Eils, R and Kim, JS and Bae, S},
title = {Web-based design and analysis tools for CRISPR base editing.},
journal = {BMC bioinformatics},
volume = {19},
number = {1},
pages = {542},
doi = {10.1186/s12859-018-2585-4},
pmid = {30587106},
issn = {1471-2105},
abstract = {BACKGROUND: As a result of its simplicity and high efficiency, the CRISPR-Cas system has been widely used as a genome editing tool. Recently, CRISPR base editors, which consist of deactivated Cas9 (dCas9) or Cas9 nickase (nCas9) linked with a cytidine or a guanine deaminase, have been developed. Base editing tools will be very useful for gene correction because they can produce highly specific DNA substitutions without the introduction of any donor DNA, but dedicated web-based tools to facilitate the use of such tools have not yet been developed.<br><br>RESULTS: We present two web tools for base editors, named BE-Designer and BE-Analyzer. BE-Designer provides all possible base editor target sequences in a given input DNA sequence with useful information including potential off-target sites. BE-Analyzer, a tool for assessing base editing outcomes from next generation sequencing (NGS) data, provides information about mutations in a table and interactive graphs. Furthermore, because the tool runs client-side, large amounts of targeted deep sequencing data (< 1 GB) do not need to be uploaded to a server, substantially reducing running time and increasing data security. BE-Designer and BE-Analyzer can be freely accessed at http://www.rgenome.net/be-designer/ and http://www.rgenome.net/be-analyzer /, respectively.<br><br>CONCLUSION: We develop two useful web tools to design target sequence (BE-Designer) and to analyze NGS data from experimental results (BE-Analyzer) for CRISPR base editors.},
}
@article {pmid30477421,
year = {2018},
author = {Zhang, S and Zhang, R and Song, G and Gao, J and Li, W and Han, X and Chen, M and Li, Y and Li, G},
title = {Targeted mutagenesis using the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system in common wheat.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {302},
pmid = {30477421},
issn = {1471-2229},
support = {2016YFD0100500//Ministry of Science and Technology of the People's Republic of China (CN)/ ; 2017GNC10113//Key R&amp;D Programme of Shandong Province/ ; 31601301//the National Natural Science Foundation of China/ ; 31501312//the National Natural Science Foundation of China/ ; ZR2014CM006//the Natural Science Foundation of Shandong Province/ ; 2016YQN01//the Youth Foundation of Shandong Academy of Agricultural Science/ ; 2018ZX0800910B-002//National Science and Technology Major Project of Breeding New Varieties of Genetically Modified Organisms/ ; 31701428//he National Natural Science Foundation of China/ ; CXGC2016C09//the Agricultural Science and Technology Innovation Project of Shandong Academy of Agricultural Sciences/ ; },
mesh = {Agrobacterium tumefaciens/*genetics ; *CRISPR-Cas Systems ; *Gene Targeting ; Genes, Plant ; *Mutagenesis ; Triticum/*genetics ; },
abstract = {BACKGROUND: Recently, the CRISPR/Cas9 system has been widely used to precisely edit plant genomes. Due to the difficulty in Agrobacterium-mediated genetic transformation of wheat, the reported applications in CRISPR/Cas9 system were all based on the biolistic transformation.<br><br>RESULTS: In the present study, we efficiently applied targeted mutagenesis in common wheat (Triticum aestivum L.) protoplasts and transgenic T0 plants using the CRISPR/Cas9 system delivered via Agrobacterium tumefaciens. Seven target sites in three genes (Pinb, waxy and DA1) were selected to construct individual expression vectors. The activities of the sgRNAs were evaluated by transforming the constructed vectors into wheat protoplasts. Mutations in the targets were detected by Illumina sequencing. Genome editing, including insertions or deletions at the target sites, was found in the wheat protoplast cells. The highest mutation efficiency was 6.8% in the DA1 gene. The CRISPR/Cas9 binary vector targeting the DA1 gene was then transformed into common wheat plants by Agrobacterium tumefaciens-mediated transformation, resulting in efficient target gene editing in the T0 generation. Thirteen mutant lines were generated, and the mutation efficiency was 54.17%. Mutations were found in the A and B genomes of the transgenic plants but not in the D genome. In addition, off-target mutations were not detected in regions that were highly homologous to the sgRNA sequences.<br><br>CONCLUSIONS: Our results showed that our Agrobacterium-mediated CRISPR/Cas9 system can be used for targeted mutations and facilitated wheat genetic improvement.},
}
@article {pmid29874204,
year = {2018},
author = {Sheridan, C},
title = {Mammoth, Arbor and Beam launch new wave of CRISPR startups.},
journal = {Nature biotechnology},
volume = {36},
number = {6},
pages = {479-480},
pmid = {29874204},
issn = {1546-1696},
mesh = {CRISPR-Cas Systems/*genetics ; Communicable Diseases/*diagnostic imaging/genetics ; Humans ; Neoplasms/*diagnosis/genetics ; },
}
@article {pmid29292253,
year = {2017},
author = {Wang, CB and Kang, QZ and Ding, C and Li, YW and Liang, TT and Zhang, CL and Wang, W and Wang, T},
title = {[Construction of a stable 4.1R gene knockout cell model in RAW264.7 cells using CRISPR/Cas9 technique].},
journal = {Nan fang yi ke da xue xue bao = Journal of Southern Medical University},
volume = {37},
number = {12},
pages = {1609-1614},
pmid = {29292253},
issn = {1673-4254},
mesh = {Animals ; *CRISPR-Cas Systems ; *Gene Knockout Techniques ; Mice ; Microfilament Proteins/*genetics ; RAW 264.7 Cells ; RNA, Guide/*genetics ; },
abstract = {OBJECTIVE: To construct a cell model of 4.1R gene knockout in murine macrophage cell line RAW264.7 using CRISPR/Cas9 technique.<br><br>METHODS: Three high?grade small?guide RNAs (sgRNAs) that could specifically identify 4.1R gene were synthesized and inserted into lentiCRISPRv2 plasmid. RAW264.7 cells were infected with sgRNA?Cas9 lentivirus from 293T cells transfected with the recombinant sgRNA?lentiCRISPRv2 plasmid, and the positive cells were screened using puromycin and the monoclonal cells were obtained. The expression of 4.1R protein in the monoclonal cells was measured by Western blotting, and the mutation site was confirmed by sequence analysis. Result A 4.1R gene knockout RAW264.7 cell line was obtained, which showed a 19?bp deletion mutation in the 4.1R gene sequence and obviously enhanced proliferation.<br><br>CONCLUSION: We successfully constructed a 4.1R gene knockout macrophage cell line using CRISPR/Cas9 technique, which may facilitate further investigation of the function of 4.1R in macrophages.},
}
@article {pmid28600500,
year = {2017},
author = {White, CW and Vanyai, HK and See, HB and Johnstone, EKM and Pfleger, KDG},
title = {Using nanoBRET and CRISPR/Cas9 to monitor proximity to a genome-edited protein in real-time.},
journal = {Scientific reports},
volume = {7},
number = {1},
pages = {3187},
pmid = {28600500},
issn = {2045-2322},
mesh = {CRISPR-Cas Systems/*genetics ; Energy Transfer/*genetics ; Gene Editing ; Humans ; Ligands ; Luciferases/*chemistry/genetics ; Nanoparticles/chemistry ; Protein Binding ; Proteins/chemistry/genetics ; Signal Transduction/genetics ; beta-Arrestins/chemistry/*genetics ; },
abstract = {Bioluminescence resonance energy transfer (BRET) has been a vital tool for understanding G protein-coupled receptor (GPCR) function. It has been used to investigate GPCR-protein and/or -ligand interactions as well as GPCR oligomerisation. However the utility of BRET is limited by the requirement that the fusion proteins, and in particular the donor, need to be exogenously expressed. To address this, we have used CRISPR/Cas9-mediated homology-directed repair to generate protein-Nanoluciferase (Nluc) fusions under endogenous promotion, thus allowing investigation of proximity between the genome-edited protein and an exogenously expressed protein by BRET. Here we report BRET monitoring of GPCR-mediated β-arrestin2 recruitment and internalisation where the donor luciferase was under endogenous promotion, in live cells and in real time. We have investigated the utility of CRISPR/Cas9 genome editing to create genome-edited fusion proteins that can be used as BRET donors and propose that this strategy can be used to overcome the need for exogenous donor expression.},
}
@article {pmid30586440,
year = {2018},
author = {Cheleuitte-Nieves, C and Gulvik, CA and McQuiston, JR and Humrighouse, BW and Bell, ME and Villarma, A and Fischetti, VA and Westblade, LF and Lipman, NS},
title = {Genotypic differences between strains of the opportunistic pathogen Corynebacterium bovis isolated from humans, cows, and rodents.},
journal = {PloS one},
volume = {13},
number = {12},
pages = {e0209231},
doi = {10.1371/journal.pone.0209231},
pmid = {30586440},
issn = {1932-6203},
abstract = {Corynebacterium bovis is an opportunistic bacterial pathogen shown to cause eye and prosthetic joint infections as well as abscesses in humans, mastitis in dairy cattle, and skin disease in laboratory mice and rats. Little is known about the genetic characteristics and genomic diversity of C. bovis because only a single draft genome is available for the species. The overall aim of this study was to sequence and compare the genome of C. bovis isolates obtained from different species, locations, and time points. Whole-genome sequencing was conducted on 20 C. bovis isolates (six human, four bovine, nine mouse and one rat) using the Illumina MiSeq platform and submitted to various comparative analysis tools. Sequencing generated high-quality contigs (over 2.53 Mbp) that were comparable to the only reported assembly using C. bovis DSM 20582T (97.8 ± 0.36% completeness). The number of protein-coding DNA sequences (2,174 ± 12.4) was similar among all isolates. A Corynebacterium genus neighbor-joining tree was created, which revealed Corynebacterium falsenii as the nearest neighbor to C. bovis (95.87% similarity), although the reciprocal comparison shows Corynebacterium jeikeium as closest neighbor to C. falsenii. Interestingly, the average nucleotide identity demonstrated that the C. bovis isolates clustered by host, with human and bovine isolates clustering together, and the mouse and rat isolates forming a separate group. The average number of genomic islands and putative virulence factors were significantly higher (p<0.001) in the mouse and rat isolates as compared to human/bovine isolates. Corynebacterium bovis' pan-genome contained a total of 3,067 genes of which 1,354 represented core genes. The known core genes of all isolates were primarily related to ''metabolism&quot; and ''information storage/processing.&quot; However, most genes were classified as ''function unknown&quot; or &quot;unclassified&quot;. Surprisingly, no intact prophages were found in any isolate; however, almost all isolates had at least one complete CRISPR-Cas system.},
}
@article {pmid30583753,
year = {2018},
author = {Caux, F},
title = {[What's new in research?].},
journal = {Annales de dermatologie et de venereologie},
volume = {145 Suppl 7},
number = {},
pages = {VIIS17-VIIS23},
doi = {10.1016/S0151-9638(18)31285-7},
pmid = {30583753},
issn = {0151-9638},
abstract = {A traditional lecture given during the annual meeting of the French Society of Dermatology in Paris summarizes the highlights of the scientific literature over the past year. In the current article the selection of the 2017-2018 period retains the following areas of interest: role of microbiome in the response to anti-PD-1 and in autoimmunity, PI3Kδ inhibitors in autoimmune bullous diseases, diagnostic and therapeutic applications of CRISPR/Cas, arrival of CAR-T cells therapy into clinical practice, gene therapy successes, use of targeted therapies in genodermatoses and integration of genetics in primary care. © 2018 Elsevier Masson SAS. All rights reserved.},
}
@article {pmid30583736,
year = {2018},
author = {Häcker, I and Schetelig, MF},
title = {Molecular tools to create new strains for mosquito sexing and vector control.},
journal = {Parasites &amp; vectors},
volume = {11},
number = {Suppl 2},
pages = {645},
doi = {10.1186/s13071-018-3209-6},
pmid = {30583736},
issn = {1756-3305},
abstract = {Vector control programs based on population reduction by matings with mass-released sterile insects require the release of only male mosquitoes, as the release of females, even if sterile, would increase the number of biting and potentially disease-transmitting individuals. While small-scale releases demonstrated the applicability of sterile males releases to control the yellow fever mosquito Aedes aegypti, large-scale programs for mosquitoes are currently prevented by the lack of efficient sexing systems in any of the vector species.Different approaches of sexing are pursued, including classical genetic and mechanical methods of sex separation. Another strategy is the development of transgenic sexing systems. Such systems already exist in other insect pests. Genome modification tools could be used to apply similar strategies to mosquitoes. Three major tools to modify mosquito genomes are currently used: transposable elements, site-specific recombination systems, and genome editing via TALEN or CRISPR/Cas. All three can serve the purpose of developing sexing systems and vector control strains in mosquitoes in two ways: first, via their use in basic research. A better understanding of mosquito biology, including the sex-determining pathways and the involved genes can greatly facilitate the development of sexing strains. Moreover, basic research can help to identify other regulatory elements and genes potentially useful for the construction of transgenic sexing systems. Second, these genome modification tools can be used to apply the gained knowledge to build and test mosquito sexing strains for vector control.},
}
@article {pmid30583622,
year = {2018},
author = {Qiu, JR and Su, YK and Song, ZQ and Fang, XS and Li, JY and Zhang, J and Wang, JH},
title = {[Directing construction of CRISPR/Cas9 vector of SmPAL1 in Salvia miltiorrhiza by target efficiency detection in vitro].},
journal = {Zhongguo Zhong yao za zhi = Zhongguo zhongyao zazhi = China journal of Chinese materia medica},
volume = {43},
number = {21},
pages = {4226-4230},
pmid = {30583622},
issn = {1001-5302},
abstract = {To construct CRISPR/Cas9 vectors for the editing of SmPAL1 in the phenylpropane metabolic pathway of Salvia miltiorrhiza, CIRSPR/Cas9 target sites of SmPAL1 were designed by online software. Its target efficiencies were detected in vitro by enzyme digestion and sequences with highly efficiency were constructed into CRISPR/Cas9 vectors. Three possible CRISPR target sequences (SmPAL1-g1, SmPAL1-g2, SmPAL1-g3) were designed and the enzyme digestion efficiencies were 53.3%, 76.6% and 10.0%. SmPAL1-g1 and SmPAL1-g2 were constructed into vector VK005-03 named as VK005-03-g1 and VK005-03-g2. The results of sequencing showed that the two CRISPR/Cas target sequences were all constructed into VK005-03. Here we first laid the foundation for the study of SmPAL1 and provided an effective strategy for the screening of sgRNA.},
}
@article {pmid30583530,
year = {2018},
author = {da Silva Duarte, V and Giaretta, S and Campanaro, S and Treu, L and Armani, A and Tarrah, A and Oliveira de Paula, S and Giacomini, A and Corich, V},
title = {A Cryptic Non-Inducible Prophage Confers Phage-Immunity on the Streptococcus thermophilus M17PTZA496.},
journal = {Viruses},
volume = {11},
number = {1},
pages = {},
doi = {10.3390/v11010007},
pmid = {30583530},
issn = {1999-4915},
support = {Fapemig//Fundação de Amparo à Pesquisa do Estado de Minas Gerais/ ; CAPES//Coordenacão de Aperfeiçoamento de Pessoal de Nível Superior/ ; CNPq//Conselho Nacional de Desenvolvimento Científico e Tecnológico/ ; SisNANO/MCTI//Sistema Nacional de Laboratórios em Nanotecnologias/Ministério da ciência, tecnologia e Informação/ ; },
abstract = {Streptococcus thermophilus is considered one of the most important species for the dairy industry. Due to their diffusion in dairy environments, bacteriophages can represent a threat to this widely used bacterial species. Despite the presence of a CRISPR-Cas system in the S. thermophilus genome, some lysogenic strains harbor cryptic prophages that can increase the phage-host resistance defense. This characteristic was identified in the dairy strain S. thermophilus M17PTZA496, which contains two integrated prophages 51.8 and 28.3 Kb long, respectively. In the present study, defense mechanisms, such as a lipoprotein-encoding gene and Siphovirus Gp157, the last associated to the presence of a noncoding viral DNA element, were identified in the prophage M17PTZA496 genome. The ability to overexpress genes involved in these defense mechanisms under specific stressful conditions, such as phage attack, has been demonstrated. Despite the addition of increasing amounts of Mitomycin C, M17PTZA496 was found to be non-inducible. However, the transcriptional activity of the phage terminase large subunit was detected in the presence of the antagonist phage vB_SthS-VA460 and of Mitomycin C. The discovery of an additional immune mechanism, associated with bacteriophage-insensitive strains, is of utmost importance, for technological applications and industrial processes. To our knowledge, this is the first study reporting the capability of a prophage integrated into the S. thermophilus genome expressing different phage defense mechanisms. Bacteriophages are widespread entities that constantly threaten starter cultures in the dairy industry. In cheese and yogurt manufacturing, the lysis of Streptococcus thermophilus cultures by viral attacks can lead to huge economic losses. Nowadays S. thermophilus is considered a well-stablished model organism for the study of natural adaptive immunity (CRISPR-Cas) against phage and plasmids, however, the identification of novel bacteriophage-resistance mechanisms, in this species, is strongly desirable. Here, we demonstrated that the presence of a non-inducible prophage confers phage-immunity to an S. thermophilus strain, by the presence of ltp and a viral noncoding region. S. thermophilus M17PTZA496 arises as an unconventional model to study phage resistance and potentially represents an alternative starter strain for dairy productions.},
}
@article {pmid30226608,
year = {2018},
author = {Takao, A and Yoshikawa, K and Karnan, S and Ota, A and Uemura, H and De Velasco, MA and Kura, Y and Suzuki, S and Ueda, R and Nishino, T and Hosokawa, Y},
title = {Generation of PTEN‑knockout (‑/‑) murine prostate cancer cells using the CRISPR/Cas9 system and comprehensive gene expression profiling.},
journal = {Oncology reports},
volume = {40},
number = {5},
pages = {2455-2466},
doi = {10.3892/or.2018.6683},
pmid = {30226608},
issn = {1791-2431},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; *Genetic Therapy ; Humans ; Immunity, Cellular/immunology ; Male ; Mice ; MicroRNAs/genetics ; Microarray Analysis ; PTEN Phosphohydrolase/*genetics ; Prostate/immunology/pathology ; Prostatic Neoplasms/*genetics/immunology/pathology ; Proto-Oncogene Proteins c-akt/genetics ; },
abstract = {Phosphatase and tensin homolog (PTEN) deficiency is associated with development, progression, and metastasis of various cancers. However, changes in gene expression associated with PTEN deficiency have not been fully characterized. To explore genes with altered expression in PTEN‑deficient cells, the present study generated a PTEN‑knockout cell line (ΔPTEN) from a mouse prostate cancer‑derived cell line using the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR‑associated protein 9 (CRISPR/Cas9) gene editing system. Following transfection of the CRISPR/Cas9 construct, DNA sequencing was performed to identify deletion of the Pten locus and PTEN inactivation was verified by western blotting. The ΔPTEN cell line exhibited enhanced RAC‑alpha serine/threonine‑protein kinase phosphorylation and cyclin D1 expression. In addition, an increase in cell proliferation and colony formation was observed in the ΔPTEN cell line. Gene expression profiling experiments were analyzed with microarray and microRNA (miRNA) arrays. In the microarray analysis, 111 genes exhibited ≥10‑fold increased expression compared with the parent strain and mock cell line and 23 genes were downregulated. The only miRNA with increased expression of 10‑fold or more was mmu‑miR‑210‑3p. Genes with enhanced expression included genes involved in the development, progression, and metastasis of cancer such as Tet methylcytosine dioxygenase 1, twist family BHLH transcription factor 2, C‑fos‑induced growth factor and Wingless‑Type MMTV Integration Site Family, Member 3, and genes involved in immunosuppression such as Arginase 1. The results of the present study suggest that PTEN deficiency mobilizes a variety of genes critical for cancer cell survival and host immune evasion.},
}
@article {pmid30191429,
year = {2018},
author = {Baltz, RH},
title = {Bacteriophage-resistant industrial fermentation strains: from the cradle to CRISPR/Cas9.},
journal = {Journal of industrial microbiology &amp; biotechnology},
volume = {45},
number = {11},
pages = {1003-1006},
pmid = {30191429},
issn = {1476-5535},
mesh = {Bacteriophages/*genetics ; *CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Escherichia coli/genetics ; *Fermentation ; Gene Targeting ; Genetic Engineering ; Humans ; Industrial Microbiology ; Insulin/biosynthesis ; Lysogeny ; Propylene Glycols/chemistry ; },
abstract = {Bacteriophage contamination and cell lysis have been recurring issues with some actinomycetes used in the pharmaceutical fermentation industry since the commercialization of streptomycin in the 1940s. In the early years, spontaneous phage-resistant mutants or lysogens were isolated to address the problem. In some cases, multiple phages were isolated from different contaminated fermentors, so strains resistant to multiple phages were isolated to stabilize the fermentation processes. With the advent of recombinant DNA technology, the early scaleup of the Escherichia coli fermentation process for the production of human insulin A and B chains encountered contamination with multiple coliphages. A genetic engineering solution was to clone and express a potent restriction/modification system in the production strains. Very recently, an E. coli fermentation of 1,3-propanediol was contaminated by a coliphage related to T1. CRISPR/Cas9 technology was applied to block future contamination by targeting seven different phage genes for double-strand cleavage. These approaches employing spontaneous mutation, genetic engineering, and synthetic biology can be applied to many current and future microorganisms used in the biotechnology industry.},
}
@article {pmid29907766,
year = {2018},
author = {Usman, WM and Pham, TC and Kwok, YY and Vu, LT and Ma, V and Peng, B and Chan, YS and Wei, L and Chin, SM and Azad, A and He, AB and Leung, AYH and Yang, M and Shyh-Chang, N and Cho, WC and Shi, J and Le, MTN},
title = {Efficient RNA drug delivery using red blood cell extracellular vesicles.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2359},
pmid = {29907766},
issn = {2041-1723},
support = {81770099//National Natural Science Foundation of China (National Science Foundation of China)/International ; 81602514, 81773246//National Natural Science Foundation of China (National Science Foundation of China)/International ; 9211101//Food and Health Bureau of the Government of the Hong Kong Special Administrative Region | Health and Medical Research Fund (HMRF)/International ; 21106616//Research Grants Council, University Grants Committee (RGC, UGC)/International ; 9610343, 9667133, 7200475//City University of Hong Kong (CityU)/International ; },
mesh = {Animals ; Breast Neoplasms/genetics/metabolism ; CRISPR-Cas Systems ; Cell Line, Tumor ; *Drug Delivery Systems ; Erythrocytes/*metabolism ; *Extracellular Vesicles ; Female ; Humans ; Mice ; Mice, Nude ; Mice, SCID ; MicroRNAs/genetics ; Neoplasm Transplantation ; Oligonucleotides, Antisense/genetics ; RNA/*analysis ; *RNA, Guide ; },
abstract = {Most of the current methods for programmable RNA drug therapies are unsuitable for the clinic due to low uptake efficiency and high cytotoxicity. Extracellular vesicles (EVs) could solve these problems because they represent a natural mode of intercellular communication. However, current cellular sources for EV production are limited in availability and safety in terms of horizontal gene transfer. One potentially ideal source could be human red blood cells (RBCs). Group O-RBCs can be used as universal donors for large-scale EV production since they are readily available in blood banks and they are devoid of DNA. Here, we describe and validate a new strategy to generate large-scale amounts of RBC-derived EVs for the delivery of RNA drugs, including antisense oligonucleotides, Cas9 mRNA, and guide RNAs. RNA drug delivery with RBCEVs shows highly robust microRNA inhibition and CRISPR-Cas9 genome editing in both human cells and xenograft mouse models, with no observable cytotoxicity.},
}
@article {pmid29904071,
year = {2018},
author = {McKitterick, AC and Seed, KD},
title = {Anti-phage islands force their target phage to directly mediate island excision and spread.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2348},
pmid = {29904071},
issn = {2041-1723},
support = {R01 AI127652/AI/NIAID NIH HHS/United States ; R01AI127652//U.S. Department of Health &amp; Human Services | NIH | National Institute of Allergy and Infectious Diseases (NIAID)/International ; },
mesh = {Bacteriophages/genetics/*metabolism ; CRISPR-Cas Systems ; Conserved Sequence ; DNA, Bacterial ; Genome, Bacterial ; Genomics ; *Interspersed Repetitive Sequences ; Open Reading Frames ; Polymerase Chain Reaction ; Protein Domains ; Recombination, Genetic ; Vibrio cholerae/*genetics/virology ; Viral Proteins/genetics/*metabolism ; },
abstract = {Vibrio cholerae, the causative agent of the diarrheal disease cholera, is antagonized by the lytic phage ICP1 in the aquatic environment and in human hosts. Mobile genetic elements called PLEs (phage-inducible chromosomal island-like elements) protect V. cholerae from ICP1 infection and initiate their anti-phage response by excising from the chromosome. Here, we show that PLE 1 encodes a large serine recombinase, Int, that exploits an ICP1-specific protein as a recombination directionality factor (RDF) to excise PLE 1 in response to phage infection. We show that this phage-encoded protein is sufficient to direct Int-mediated recombination in vitro and that it is highly conserved in all sequenced ICP1 genomes. Our results uncover an aspect of the molecular specificity underlying the conflict between a single predatory phage and V. cholerae PLE and contribute to our understanding of long-term evolution between phage and their bacterial hosts.},
}
@article {pmid29889212,
year = {2018},
author = {Gu, B and Posfai, E and Rossant, J},
title = {Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos.},
journal = {Nature biotechnology},
volume = {36},
number = {7},
pages = {632-637},
pmid = {29889212},
issn = {1546-1696},
mesh = {Animals ; Bacterial Proteins/genetics ; Biotin/analogs &amp; derivatives/genetics ; Blastocyst ; CRISPR-Cas Systems/*genetics ; DNA Repair/genetics ; Gene Editing/*methods ; Gene Expression Regulation, Developmental ; Gene Knock-In Techniques ; *Gene Transfer Techniques ; Genome/*genetics ; Homologous Recombination/genetics ; Mice ; },
abstract = {Rapid, efficient generation of knock-in mice with targeted large insertions remains a major hurdle in mouse genetics. Here, we describe two-cell homologous recombination (2C-HR)-CRISPR, a highly efficient gene-editing method based on introducing CRISPR reagents into embryos at the two-cell stage, which takes advantage of the open chromatin structure and the likely increase in homologous-recombination efficiency during the long G2 phase. Combining 2C-HR-CRISPR with a modified biotin-streptavidin approach to localize repair templates to target sites, we achieved a more-than-tenfold increase (up to 95%) in knock-in efficiency over standard methods. We targeted 20 endogenous genes expressed in blastocysts with fluorescent reporters and generated reporter mouse lines. We also generated triple-color blastocysts with all three lineages differentially labeled, as well as embryos carrying the two-component auxin-inducible degradation system for probing protein function. We suggest that 2C-HR-CRISPR is superior to random transgenesis or standard genome-editing protocols, because it ensures highly efficient insertions at endogenous loci and defined 'safe harbor' sites.},
}
@article {pmid29593341,
year = {2018},
author = {Zhou, P and Ding, X and Wan, X and Liu, L and Yuan, X and Zhang, W and Hui, X and Meng, G and Xiao, H and Li, B and Zhong, J and Hou, F and Deng, L and Zhang, Y},
title = {MLL5 suppresses antiviral innate immune response by facilitating STUB1-mediated RIG-I degradation.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {1243},
pmid = {29593341},
issn = {2041-1723},
mesh = {Animals ; Antiviral Agents/pharmacology ; CRISPR-Cas Systems ; Cytoplasm/metabolism ; DEAD Box Protein 58/*metabolism ; DNA Damage ; DNA-Binding Proteins/metabolism ; Female ; HEK293 Cells ; Histone-Lysine N-Methyltransferase/*metabolism ; Humans ; *Immunity, Innate ; Male ; Mice ; Mice, Inbred C57BL ; Proteasome Endopeptidase Complex/metabolism ; RNA Interference ; Rhabdoviridae Infections/*immunology ; Signal Transduction ; Ubiquitin-Protein Ligases/*metabolism ; Ubiquitination ; Vesicular stomatitis Indiana virus ; Virus Replication ; },
abstract = {Trithorax group protein MLL5 is an important epigenetic modifier that controls cell cycle progression, chromatin architecture maintenance, and hematopoiesis. However, whether MLL5 has a role in innate antiviral immunity is largely unknown. Here we show that MLL5 suppresses the RIG-I-mediated anti-viral immune response. Mll5-deficient mice infected with vesicular stomatitis virus show enhanced anti-viral innate immunity, reduced morbidity, and viral load. Mechanistically, a fraction of MLL5 located in the cytoplasm interacts with both RIG-I and its E3 ubiquitin ligase STUB1, which promotes K48-linked polyubiquitination and proteasomal degradation of RIG-I. MLL5 deficiency attenuates the RIG-I and STUB1 association, reducing K48-linked polyubiquitination and accumulation of RIG-I protein in cells. Upon virus infection, nuclear MLL5 protein translocates from the nucleus to the cytoplasm inducing STUB1-mediated degradation of RIG-I. Our study uncovers a previously unrecognized role for MLL5 in antiviral innate immune responses and suggests a new target for controlling viral infection.},
}
@article {pmid29482624,
year = {2018},
author = {Wattanapanitch, M and Damkham, N and Potirat, P and Trakarnsanga, K and Janan, M and U-Pratya, Y and Kheolamai, P and Klincumhom, N and Issaragrisil, S},
title = {One-step genetic correction of hemoglobin E/beta-thalassemia patient-derived iPSCs by the CRISPR/Cas9 system.},
journal = {Stem cell research &amp; therapy},
volume = {9},
number = {1},
pages = {46},
pmid = {29482624},
issn = {1757-6512},
mesh = {Autografts ; *CRISPR-Cas Systems ; Female ; *Gene Editing ; *Hemoglobin E/genetics/metabolism ; Humans ; Induced Pluripotent Stem Cells/*metabolism ; Male ; Mutation ; Stem Cell Transplantation ; *beta-Thalassemia/genetics/metabolism/therapy ; },
abstract = {BACKGROUND: Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia.<br><br>METHODS: We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression.<br><br>RESULTS: The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein.<br><br>CONCLUSIONS: Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.},
}
@article {pmid29621557,
year = {2018},
author = {Islam, W},
title = {CRISPR-Cas9; an efficient tool for precise plant genome editing.},
journal = {Molecular and cellular probes},
volume = {39},
number = {},
pages = {47-52},
doi = {10.1016/j.mcp.2018.03.006},
pmid = {29621557},
issn = {1096-1194},
mesh = {CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Genetic Engineering ; *Genome, Plant ; },
abstract = {Efficient plant genome editing is dependent upon induction of double stranded DNA breaks (DSBs) through site specified nucleases. These DSBs initiate the process of DNA repair which can either base upon homologous recombination (HR) or non-homologous end jointing (NHEJ). Recently, CRISPR-Cas9 mechanism got highlighted as revolutionizing genetic tool due to its simpler frame work along with the broad range of adaptability and applications. So, in this review, I have tried to sum up the application of this biotechnological tool in plant genome editing. Furthermore, I have tried to explain successful adaptation of CRISPR in various plant species where it is used for the successful generation of stable mutations in a steadily growing number of species through NHEJ. The review also sheds light upon other biotechnological approaches relying upon single DNA lesion induction such as genomic deletion or pair wise nickases for evasion of offsite effects.},
}
@article {pmid30573681,
year = {2018},
author = {Ogawa, S and Matsuoka, Y and Takada, M and Matsui, K and Yamane, F and Kubota, E and Yasuhara, S and Hieda, K and Kanayama, N and Hatano, N and Tokumitsu, H and Magari, M},
title = {IL-34 cell surface localization regulated by the 78 kDa glucose-regulated protein facilitates the differentiation of monocytic cells.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.006226},
pmid = {30573681},
issn = {1083-351X},
abstract = {Interleukin 34 (IL-34) constitutes a cytokine that shares a common receptor, colony stimulating factor-1 receptor (CSF-1R), with CSF-1. We recently identified a novel type of monocytic cell termed follicular dendritic cell-induced monocytic cells (FDMCs), whose differentiation was dependent on CSF-1R signaling through the IL-34 produced from a follicular dendritic cell line, FL-Y. Here, we report the functional mechanisms of the IL-34-mediated CSF-1R signaling underlying FDMC differentiation. CRIPSR/Cas9-mediated knockout of the Il34 gene confirmed that the ability of FL-Y cells to induce FDMCs completely depends on the IL-34 expressed by FL-Y cells. Transwell culture experiments revealed that FDMC differentiation requires a signal from a membrane-anchored form of IL-34 on the FL-Y cell surface, but not from a secreted form, in a direct interaction between FDMC precursor cells and FL-Y cells. Furthermore, flow cytometric analysis using an anti-IL-34 antibody indicated that IL-34 was also expressed on the FL-Y cell surface. Thus, we explored proteins interacting with IL-34 in FL-Y cells. Mass spectrometry analysis and pull down assay identified that IL-34 was associated with the molecular chaperon 78 kDa glucose-regulated protein (GRP78) in the plasma membrane fraction of FL-Y cells. Consistent with this finding, GRP78-heterozygous FL-Y cells expressed a lower level of IL-34 protein on their cell surface and exhibited a reduced competency to induce FDMC differentiation compared with the original FL-Y cells. These results indicated a novel GRP78-dependent localization and specific function of IL-34 in FL-Y cells related to monocytic cell differentiation.},
}
@article {pmid30572690,
year = {2018},
author = {Aman, R and Mahas, A and Butt, H and Aljedaani, F and Mahfouz, M},
title = {Engineering RNA Virus Interference via the CRISPR/Cas13 Machinery in Arabidopsis.},
journal = {Viruses},
volume = {10},
number = {12},
pages = {},
doi = {10.3390/v10120732},
pmid = {30572690},
issn = {1999-4915},
support = {CRG4//King Abdullah University of Science and Technology/ ; },
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) systems are key immune mechanisms helping prokaryotic species fend off RNA and DNA viruses. CRISPR/Cas9 has broad applications in basic research and biotechnology and has been widely used across eukaryotic species for genome engineering and functional analysis of genes. The recently developed CRISPR/Cas13 systems target RNA rather than DNA and thus offer new potential for transcriptome engineering and combatting RNA viruses. Here, we used CRISPR/LshCas13a to stably engineer Arabidopsis thaliana for interference against the RNA genome of Turnip mosaic virus (TuMV). Our data demonstrate that CRISPR RNAs (crRNAs) guiding Cas13a to the sequences encoding helper component proteinase silencing suppressor (HC-Pro) or GFP target 2 (GFP-T2) provide better interference compared to crRNAs targeting other regions of the TuMV RNA genome. This work demonstrates the exciting potential of CRISPR/Cas13 to be used as an antiviral strategy to obstruct RNA viruses, and encourages the search for more robust and effective Cas13 variants or CRISPR systems that can target RNA.},
}
@article {pmid30568213,
year = {2018},
author = {Knoepfler, P},
title = {Gene editing: sloppy definitions mislead.},
journal = {Nature},
volume = {564},
number = {7736},
pages = {345},
doi = {10.1038/d41586-018-07802-2},
pmid = {30568213},
issn = {1476-4687},
mesh = {CRISPR-Cas Systems ; *Gene Editing ; *Genome ; },
}
@article {pmid29610531,
year = {2018},
author = {Ma, X and Chen, X and Jin, Y and Ge, W and Wang, W and Kong, L and Ji, J and Guo, X and Huang, J and Feng, XH and Fu, J and Zhu, S},
title = {Small molecules promote CRISPR-Cpf1-mediated genome editing in human pluripotent stem cells.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {1303},
pmid = {29610531},
issn = {2041-1723},
mesh = {Apoptosis ; Bacterial Proteins ; *CRISPR-Cas Systems ; Cell Differentiation ; Cell Line ; Electroporation ; Endonucleases ; *Gene Editing ; Genetic Engineering ; *Genome, Human ; HEK293 Cells ; High-Throughput Screening Assays ; Humans ; Pluripotent Stem Cells/*metabolism ; Regenerative Medicine ; },
abstract = {Human pluripotent stem cells (hPSCs) have potential applications in biological studies and regenerative medicine. However, precise genome editing in hPSCs remains time-consuming and labor-intensive. Here we demonstrate that the recently identified CRISPR-Cpf1 can be used to efficiently generate knockout and knockin hPSC lines. The unique properties of CRISPR-Cpf1, including shorter crRNA length and low off-target activity, are very attractive for many applications. In particular, we develop an unbiased drug-selection-based platform feasible for high-throughput screening in hPSCs and this screening system enables us to identify small molecules VE-822 and AZD-7762 that can promote CRISPR-Cpf1-mediated precise genome editing. Significantly, the combination of CRISPR-Cpf1 and small molecules provides a simple and efficient strategy for precise genome engineering.},
}
@article {pmid29327641,
year = {2017},
author = {Henser-Brownhill, T and Monserrat, J and Scaffidi, P},
title = {Generation of an arrayed CRISPR-Cas9 library targeting epigenetic regulators: from high-content screens to in vivo assays.},
journal = {Epigenetics},
volume = {12},
number = {12},
pages = {1065-1075},
pmid = {29327641},
issn = {1559-2308},
support = {FC001152//Cancer Research UK/United Kingdom ; FC001152//Medical Research Council/United Kingdom ; FC001152//Wellcome Trust/United Kingdom ; C50796/A19448//Cancer Research UK/United Kingdom ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Cloning, Molecular/methods ; *Epigenesis, Genetic ; *Gene Library ; Genetic Vectors/genetics ; Hep G2 Cells ; Humans ; Lentivirus/genetics ; Male ; Mice ; Mice, Inbred NOD ; Mice, SCID ; RNA, Guide/*genetics ; },
abstract = {The CRISPR-Cas9 system has revolutionized genome engineering, allowing precise modification of DNA in various organisms. The most popular method for conducting CRISPR-based functional screens involves the use of pooled lentiviral libraries in selection screens coupled with next-generation sequencing. Screens employing genome-scale pooled small guide RNA (sgRNA) libraries are demanding, particularly when complex assays are used. Furthermore, pooled libraries are not suitable for microscopy-based high-content screens or for systematic interrogation of protein function. To overcome these limitations and exploit CRISPR-based technologies to comprehensively investigate epigenetic mechanisms, we have generated a focused sgRNA library targeting 450 epigenetic regulators with multiple sgRNAs in human cells. The lentiviral library is available both in an arrayed and pooled format and allows temporally-controlled induction of gene knock-out. Characterization of the library showed high editing activity of most sgRNAs and efficient knock-out at the protein level in polyclonal populations. The sgRNA library can be used for both selection and high-content screens, as well as for targeted investigation of selected proteins without requiring isolation of knock-out clones. Using a variety of functional assays we show that the library is suitable for both in vitro and in vivo applications, representing a unique resource to study epigenetic mechanisms in physiological and pathological conditions.},
}
@article {pmid29311279,
year = {2018},
author = {Tan, SZ and Reisch, CR and Prather, KLJ},
title = {A Robust CRISPR Interference Gene Repression System in Pseudomonas.},
journal = {Journal of bacteriology},
volume = {200},
number = {7},
pages = {},
pmid = {29311279},
issn = {1098-5530},
mesh = {CRISPR-Cas Systems/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; *Gene Expression Regulation, Bacterial ; *Gene Silencing ; Genomics ; Pseudomonas/*genetics ; Pseudomonas aeruginosa/genetics ; Pseudomonas fluorescens/genetics ; Pseudomonas putida/genetics ; beta-Galactosidase/genetics ; },
abstract = {Pseudomonas spp. are widely used model organisms in different areas of research. Despite the relevance of Pseudomonas in many applications, the use of protein depletion tools in this host remains limited. Here, we developed the CRISPR interference system for gene repression in Pseudomonas spp. using a nuclease-null Streptococcus pasteurianus Cas9 variant (dead Cas9, or dCas9). We demonstrate a robust and titratable gene depletion system with up to 100-fold repression in β-galactosidase activity in P. aeruginosa and 300-fold repression in pyoverdine production in Pseudomonas putida This inducible system enables the study of essential genes, as shown by ftsZ depletions in P. aeruginosa, P. putida, and Pseudomonas fluorescens that led to phenotypic changes consistent with depletion of the targeted gene. Additionally, we performed the first in vivo characterization of protospacer adjacent motif (PAM) site preferences of S. pasteurianus dCas9 and identified NNGCGA as a functional PAM site that resulted in repression efficiencies comparable to the consensus NNGTGA sequence. This discovery significantly expands the potential genomic targets of S. pasteurianus dCas9, especially in GC-rich organisms.IMPORTANCEPseudomonas spp. are prevalent in a variety of environments, such as the soil, on the surface of plants, and in the human body. Although Pseudomonas spp. are widely used as model organisms in different areas of research, existing tools to deplete a protein of interest in these organisms remain limited. We have developed a robust and inducible gene repression tool in P. aeruginosa, P. putida, and P. fluorescens using the Streptococcus pasteurianus dCas9. This method of protein depletion is superior to existing methods, such as promoter replacements and addition of degradation tags, because it does not involve genomic modifications of the target protein, is titratable, and is capable of repressing multiple genes simultaneously. This gene repression system now enables easy depletion of specific proteins in Pseudomonas, accelerating the study and engineering of this widely used model organism.},
}
@article {pmid30572386,
year = {2018},
author = {Liang, WJ and Cui, CC and Duan, GC and Liu, HY and Xu, YK and Xi, YL and Yang, HY and Chen, SY},
title = {[Identification and evaluation on methods with upstream flank sequences of CRISPR1, regarding Escherichia coli and Shigella].},
journal = {Zhonghua liu xing bing xue za zhi = Zhonghua liuxingbingxue zazhi},
volume = {39},
number = {12},
pages = {1607-1610},
pmid = {30572386},
issn = {0254-6450},
support = {2013ZX10004607//National Science and Technology Major Project of China/ ; XTCX-2015-PY4//Henan Innovation Center of Molecular Diagnosis and Laboratory Medicine/ ; XYBSKYZZ201805//Doctor Initiated Project Xinxiang Medical University/ ; },
abstract = {Objective: To analyze the effect of the identification and evaluation of Escherichia (E.) coli and Shigella, based on the upstream flanking sequences of CRISPR1. Methods: Both CRISPR and cas sequences were obtained through the BLAST with repeating sequences against the publicly complete genome in GenBank that related to E. coli and Shigella. Clustal X was used to perform multi-sequences alignment of the flanking sequences. PCR method was used to amplify the upstream flanking sequences of CRISPR1 in order to appraise the effect of identification and evaluation of upstream flanking sequences on E. coli and Shigella, which were based on the upstream flanking sequences of CRISPR1. Results: The results showed that 73.4% of the strains containing the I-E CRISPR/Cas that belonged to the phylogroups A, B1, D while 8.4% strains carried the I-F CRISPR/Cas. Another 17.2% of the strains owned CRISPR3-4 (non-CRISPR/Cas) only belonged to the phylogroups B2. All the Shigella strains carried I-E CRISPR/Cas. More than 99% of similarity the CRISPR1 upstream-flanking sequences was seen in E. coli (except B2) and Shigella and E. coli (B2). Both sensitivity and specificity were greater than 91% after PCR amplification in the region to identify the E.coli and Shigella. Conclusion: The upstream of CRISPR1 could achieve a preliminary identification effect on E.coli and Shigella.},
}
@article {pmid30571788,
year = {2018},
author = {Chakraborty, S and Mentzer, AV and Begum, YA and Manzur, M and Hasan, M and Ghosh, AN and Hossain, MA and Camilli, A and Qadri, F},
title = {Phenotypic and genomic analyses of bacteriophages targeting environmental and clinical CS3-expressing enterotoxigenic Escherichia coli (ETEC) strains.},
journal = {PloS one},
volume = {13},
number = {12},
pages = {e0209357},
doi = {10.1371/journal.pone.0209357},
pmid = {30571788},
issn = {1932-6203},
abstract = {Diarrhea due to infection of enterotoxigenic Escherichia coli (ETEC) is of great concern in several low and middle-income countries. ETEC infection is considered to be the most common cause of diarrhea in Bangladesh and is mainly spread through contaminated water and food. ETEC pathogenesis is mediated by the expression of enterotoxins and colonization factors (CFs) that target the intestinal mucosa. ETEC can survive for extended time periods in water, where they are likely to be attacked by bacteriophages. Antibiotic resistance is common amongst enteric pathogens and therefore is the use of bacteriophages (phage) as a therapeutic tool an interesting approach. This study was designed to identify novel phages that specifically target ETEC virulence factors. In total, 48 phages and 195 ETEC isolates were collected from water sources and stool samples. Amongst the identified ETEC specific phages, an enterobacteria phage T7, designated as IMM-002, showed a significant specificity towards colonization factor CS3-expressing ETEC isolates. Antibody-blocking and phage-neutralization assays revealed that CS3 is used as a host receptor for the IMM-002 phage. The bacterial CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR-associated) defence mechanism can invoke immunity against phages. Genomic analyses coupled with plaque assay experiments indicate that the ETEC CRISPR-Cas system is involved in the resistance against the CS3-specific phage (IMM-002) and the previously identified CS7-specific phage (IMM-001). As environmental water serves as a reservoir for ETEC, it is important to search for new antimicrobial agents such as phages in environmental water as well as the human gut. A better understanding of how the interplay between ETEC-specific phages and ETEC isolates affects the ETEC diversity, both in environmental ecosystems and within the host, is important for the development of new treatments for ETEC infections.},
}
@article {pmid30569414,
year = {2018},
author = {Dadheech, N and James Shapiro, AM},
title = {Human Induced Pluripotent Stem Cells in the Curative Treatment of Diabetes and Potential Impediments Ahead.},
journal = {Advances in experimental medicine and biology},
volume = {},
number = {},
pages = {},
doi = {10.1007/5584_2018_305},
pmid = {30569414},
issn = {0065-2598},
abstract = {The successful landmark discovery of mouse and human inducible pluripotential stem cells (iPSC's) by Takahashi and Yamanaka in 2006 and 2007 has triggered a revolution in the potential generation of self-compatible cells for regenerative medicine, and further opened up a new avenue for &quot;disease in dish&quot; drug screening of self-target cells (Neofytou et al. 2015). The introduction of four 'Yamanaka' transcription factors through viral or other transfection of mature cells can induce pluripotency and acquired plasticity. These factors include transduction with octamer-binding transcription factor-4 (Oct-4), nanog homeobox (Nanog), sex-determining region Y-box-2 (Sox-2) and MYC protooncogene (cMyc). Such cells become iPSC's (Takahashi and Yamanaka 2006). These reprogrammed cells exhibit increased telomerase activity and have a hypomethylated gene promotor region similar to embryonic stem cells (ESC's). These milestone discoveries have generated immense hope that diseases such as diabetes could be treated and effectively cured by transplantation of self-compatible, personalized autologous stem cell transplantation of β-cells that release physiological insulin under glycemic control (Maehr et al. 2009; Park et al. 2008) (Fig. 1). Diabetes is a profligate disease of disordered glucose metabolism resulting from an absolute or relative deficiency of insulin, the consequences of which lead to immense socio-economic societal burden. While there are many different types of diabetes, the two major types (type 1 diabetes (T1DM) and type 2 diabetes (T2DM) are caused respectively by immune-mediated destruction (T1DM) or malfunctioning (T2DM) insulin-producing β-cells within the endocrine pancreas, the islets of Langerhans (Atkinson et al. 2011; Holman et al. 2015; You and Henneberg 2016). Almost 425 million people are affected by the global burden of diabetes, and this is predicted to increase by 48% (629 million) by 2045 (International Diabetes Federation Atlas 8th Ed 2018). Whole pancreas or islet cell transplantation offer an effective alternative to injected insulin, but both require lifelong potent immunosuppression to control both allo-and autoimmunity. Whole pancreas transplantation involves invasive complex surgery and is associated with greater morbidity and occasional mortality, while islet transplantation involves a minimally invasive intraportal hepatic infusion. Generally, whole pancreas transplantation provides greater metabolic reserve, but this may be matched by cumulative multiple islet infusions to achieve insulin independence. An additional challenge of islet transplantation is progressive loss of complete insulin independence over time, which may be multifactorial, the dominant factor however being ineffective control of autoimmunity. Both whole pancreas and islet transplantation are restricted to patients at risk of severe hypoglycemia that cannot be stabilized by alternate means, or in recipients that are already immunosuppressed in order to sustain a kidney or other solid organ transplant. The risks of chronic immunosuppression and the scarcity of human organ donors mean that both of these transplantation therapies cannot presently be extended to the broader diabetic population (Shapiro 2011; Shapiro et al. 2006). Recent progress in xenotransplantation of multiple knock-out 'humanized' pig islets could offer one potential solution, perhaps aided by clustered regularly interspaced short palindromic repeats/CRISPR associated-9 (CRISPR/Cas-9) gene editing approaches, but this remains to be proven in practice. Human stem cell derived new β-cell products could effectively address the global supply challenge for broad application across all forms of diabetes, but recurrent autoimmunity may still remain an insurmountable challenge. Considerable progress in the generation of human stem cell derived SC-β cells from ESC, iPS and other adult cell sources such as mesenchymal stem cells (MSCs) offer huge hope that a personalized, 'syngeneic' cell could be transplanted without risk of alloimmunity, thereby securing sufficient supply to meet future global demand (Cito et al. 2018). Fig. 1 Schematic representation of inducible pluripotent stem cell (iPSC) generation from somatic cells and their application in the patient-specific iPSC-based personalized-medicine based diabetes therapy. Disease-free iPSCs may be potentially generated from healthy individual- or diabetic patient-derived somatic cells using reprogramming with viral, DNA-, RNA-, protein-, miRNA-, or small molecule-mediated reprogramming systems. iPSC's derived from patients can be further differentiated into insulin-secreting pancreatic for transplantation into patients with diabetes for cell-based therapy.},
}
@article {pmid30566855,
year = {2018},
author = {Li, B and Zeng, C and Li, W and Zhang, X and Luo, X and Zhao, W and Zhang, C and Dong, Y},
title = {Synthetic Oligonucleotides Inhibit CRISPR-Cpf1-Mediated Genome Editing.},
journal = {Cell reports},
volume = {25},
number = {12},
pages = {3262-3272.e3},
doi = {10.1016/j.celrep.2018.11.079},
pmid = {30566855},
issn = {2211-1247},
abstract = {Previously, researchers discovered a series of anti-CRISPR proteins that inhibit CRISPR-Cas activity, such as Cas9 and Cpf1 (Cas12a). Herein, we constructed crRNA variants consisting of chemically modified DNA-crRNA and RNA-crRNA duplexes and identified that phosphorothioate (PS)-modified DNA-crRNA duplex completely blocked the function of Cpf1. More important, without prehybridization, these PS-modified DNA oligonucleotides showed the ability to suppress DNA double-strand breaks induced by two Cpf1 orthologs, AsCpf1 and LbCpf1. Time-dependent inhibitory effects were validated in multiple loci of different human cells. Further studies demonstrated that PS-modified DNA oligonucleotides were able to serve as Cpf1 inhibitors in a sequence-independent manner. Mechanistic studies indicate that PS-modified DNA oligonucleotides hinder target DNA binding and recognition by Cpf1. Consequently, these synthetic DNA molecules expand the sources of CRISPR inhibitors, providing a platform to inactivate Cpf1-mediated genome editing.},
}
@article {pmid30560399,
year = {2018},
author = {Hryhorowicz, M and Grześkowiak, B and Mazurkiewicz, N and Śledziński, P and Lipiński, D and Słomski, R},
title = {Improved Delivery of CRISPR/Cas9 System Using Magnetic Nanoparticles into Porcine Fibroblast.},
journal = {Molecular biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s12033-018-0145-9},
pmid = {30560399},
issn = {1559-0305},
support = {INNOMED/I/17/NCBR/2014//Narodowe Centrum Badań i Rozwoju/ ; },
abstract = {Genetically modified pigs play an important role in agriculture and biomedical research; hence, new efficient methods are needed to obtain genetically engineered cells and animals. The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas (CRISPR-associated) system represents an effective genome editing tool. It consists of two key molecules: single guide RNA (sgRNA) and the Cas9 endonuclease that can be introduced into the cells as one plasmid. Typical delivery methods for CRISPR/Cas9 components are limited by low transfection efficiency or toxic effects on cells. Here, we describe the use of magnetic nanoparticles and gradient magnetic field to improve delivery of CRISPR/Cas9 constructs into porcine fetal fibroblasts. Polyethylenimine-coated nanoparticles with magnetic iron oxide core were used to form magnetic plasmid DNA lipoplexes. CRISPR/Cas9 construct was prepared to induce site-specific cutting at the porcine H11 locus. Quantitative assessment of genomic cleavage by sequence trace decomposition demonstrated that the magnetofection efficiency was more than 3.5 times higher compared to the classic lipofection method. The Tracking of Indels by Decomposition web tool precisely determined the spectrum of indels that occurred. Simultaneously, no additional cytotoxicity associated with the utilization of magnetic nanoparticles was observed. Our results indicate that magnetofection enables effective delivery of the CRISPR/Cas9 construct into porcine fetal fibroblasts with low cell toxicity.},
}
@article {pmid30558714,
year = {2018},
author = {Faure, JD and Napier, JA},
title = {Europe's first and last field trial of gene-edited plants?.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
doi = {10.7554/eLife.42379},
pmid = {30558714},
issn = {2050-084X},
support = {BBS/E/C/000I0420//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {On 5 June this year the first field trial of a CRISPR-Cas-9 gene-edited crop began at Rothamsted Research in the UK, having been approved by the UK Department for Environment, Food &amp; Rural Affairs. However, in late July 2018, after the trial had started, the European Court of Justice ruled that techniques such as gene editing fall within the European Union's 2001 GMO directive, meaning that our gene-edited Camelina plants should be considered as genetically modified (GM). Here we describe our experience of running this trial and the legal transformation of our plants. We also consider the future of European plant research using gene-editing techniques, which now fall under the burden of GM regulation, and how this will likely impede translation of publicly funded basic research.},
}
@article {pmid30548045,
year = {2018},
author = {Tong, Y and Weber, T and Lee, SY},
title = {CRISPR/Cas-based genome engineering in natural product discovery.},
journal = {Natural product reports},
volume = {},
number = {},
pages = {},
doi = {10.1039/c8np00089a},
pmid = {30548045},
issn = {1460-4752},
abstract = {Covering: up to February, 2018This review briefly introduces and summarizes current knowledge about the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) - CRISPR/Cas system and how it was engineered to become one of the most important and versatile genome editing techniques that are currently revolutionizing the whole field of molecular biology. It aims to highlight and discuss the applications and remaining challenges of CRISPR/Cas (mainly focusing on CRISPR/SpCas9)-based genome editing in natural product discovery. The organisms covered include bacteria such as Streptomyces, Corynebacteria, and Myxobacteria; filamentous fungi such as Aspergillus, Beauveria, and Ganoderma; microalgae; and some plants. As closing remarks, the prospects of using CRISPR/Cas in natural product discovery will be discussed.},
}
@article {pmid30546095,
year = {2019},
author = {Fineran, PC},
title = {CRISPR-Cas impedes archaeal mating.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {2-3},
doi = {10.1038/s41564-018-0326-0},
pmid = {30546095},
issn = {2058-5276},
}
@article {pmid30544778,
year = {2018},
author = {Mayo-Muñoz, D and He, F and Jørgensen, JB and Madsen, PK and Bhoobalan-Chitty, Y and Peng, X},
title = {Anti-CRISPR-Based and CRISPR-Based Genome Editing of Sulfolobus islandicus Rod-Shaped Virus 2.},
journal = {Viruses},
volume = {10},
number = {12},
pages = {},
doi = {10.3390/v10120695},
pmid = {30544778},
issn = {1999-4915},
support = {DFF-7017-00060//Danish Council for Independent Research/Technology and Production/ ; NNF17OC0031154//Novo Nordisk Foundation/Hallas-Møller Ascending Investigator Grant/ ; },
abstract = {Genetic engineering of viruses has generally been challenging. This is also true for archaeal rod-shaped viruses, which carry linear double-stranded DNA genomes with hairpin ends. In this paper, we describe two different genome editing approaches to mutate the Sulfolobus islandicus rod-shaped virus 2 (SIRV2) using the archaeon Sulfolobus islandicus LAL14/1 and its derivatives as hosts. The anti-CRISPR (Acr) gene acrID1, which inhibits CRISPR-Cas subtype I-D immunity, was first used as a selection marker to knock out genes from SIRV2M, an acrID1-null mutant of SIRV2. Moreover, we harnessed the endogenous CRISPR-Cas systems of the host to knock out the accessory genes consecutively, which resulted in a genome comprised solely of core genes of the 11 SIRV members. Furthermore, infection of this series of knockout mutants in the CRISPR-null host of LAL14/1 (Δarrays) confirmed the non-essentiality of the deleted genes and all except the last deletion mutant propagated as efficiently as the WT SIRV2. This suggested that the last gene deleted, SIRV2 gp37, is important for the efficient viral propagation. The generated viral mutants will be useful for future functional studies including searching for new Acrs and the approaches described in this case are applicable to other viruses.},
}
@article {pmid30523077,
year = {2018},
author = {Yan, WX and Hunnewell, P and Alfonse, LE and Carte, JM and Keston-Smith, E and Sothiselvam, S and Garrity, AJ and Chong, S and Makarova, KS and Koonin, EV and Cheng, DR and Scott, DA},
title = {Functionally diverse type V CRISPR-Cas systems.},
journal = {Science (New York, N.Y.)},
volume = {},
number = {},
pages = {},
doi = {10.1126/science.aav7271},
pmid = {30523077},
issn = {1095-9203},
abstract = {Type V CRISPR-Cas systems are distinguished by a single RNA-guided RuvC domain-containing effector, Cas12. Although effectors of subtypes V-A (Cas12a) and V-B (Cas12b) have been studied in detail, the distinct domain architectures and diverged RuvC sequences of uncharacterized Cas12 proteins suggest unexplored functional diversity. Here, we identify and characterize Cas12c, g, h, and i. Cas12c, h, and i demonstrate RNA-guided double-stranded (ds) DNA interference activity. Cas12i exhibits markedly different efficiencies of crRNA spacer complementary and non-complementary strand cleavage resulting in predominant dsDNA nicking. Cas12g is an RNA-guided RNase with collateral RNase and single-stranded DNase activities. Our study reveals the functional diversity emerging along different routes of type V CRISPR-Cas evolution and expands the CRISPR toolbox.},
}
@article {pmid30530241,
year = {2018},
author = {Goh, YJ and Barrangou, R},
title = {Harnessing CRISPR-Cas systems for precision engineering of designer probiotic lactobacilli.},
journal = {Current opinion in biotechnology},
volume = {56},
number = {},
pages = {163-171},
doi = {10.1016/j.copbio.2018.11.009},
pmid = {30530241},
issn = {1879-0429},
abstract = {Our evolving understanding on the mechanisms underlying the health-promoting attributes of probiotic lactobacilli, together with an expanding genome editing toolbox have made this genus an ideal chassis for the development of living therapeutics. The rising adoption of CRISPR-based technologies for prokaryotic engineering has demonstrated precise, efficient and scalable genome editing and tunable transcriptional regulation that can be translated into next-generation development of probiotic lactobacilli with enhanced robustness and designer functionalities. Here, we discuss how these tools in conjunction with the naturally abundant and diverse native CRISPR-Cas systems can be harnessed for Lactobacillus cell surface engineering and the delivery of biotherapeutics.},
}
@article {pmid30526490,
year = {2018},
author = {Li, X and Ma, Y and Liang, S and Tian, Y and Yin, S and Xie, S and Xie, H},
title = {Comparative genomics of 84 Pectobacterium genomes reveals the variations related to a pathogenic lifestyle.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {889},
pmid = {30526490},
issn = {1471-2164},
support = {BAIC07//Earmarked Fund for Beijing Innovation Consortium of Agriculture Research System/ ; },
abstract = {BACKGROUND: Pectobacterium spp. are necrotrophic bacterial plant pathogens of the family Pectobacteriaceae, responsible for a wide spectrum of diseases of important crops and ornamental plants including soft rot, blackleg, and stem wilt. P. carotovorum is a genetically heterogeneous species consisting of three valid subspecies, P. carotovorum subsp. brasiliense (Pcb), P. carotovorum subsp. carotovorum (Pcc), and P. carotovorum subsp. odoriferum (Pco).<br><br>RESULTS: Thirty-two P. carotovorum strains had their whole genomes sequenced, including the first complete genome of Pco and another circular genome of Pcb, as well as the high-coverage genome sequences for 30 additional strains covering Pcc, Pcb, and Pco. In combination with 52 other publicly available genome sequences, the comparative genomics study of P. carotovorum and other four closely related species P. polaris, P. parmentieri, P. atrosepticum, and Candidatus P. maceratum was conducted focusing on CRISPR-Cas defense systems and pathogenicity determinants. Our analysis identified two CRISPR-Cas types (I-F and I-E) in Pectobacterium, as well as another I-C type in Dickeya that is not found in Pectobacterium. The core pathogenicity factors (e.g., plant cell wall-degrading enzymes) were highly conserved, whereas some factors (e.g., flagellin, siderophores, polysaccharides, protein secretion systems, and regulatory factors) were varied among these species and/or subspecies. Notably, a novel type of T6SS as well as the sorbitol metabolizing srl operon was identified to be specific to Pco in Pectobacterium.<br><br>CONCLUSIONS: This study not only advances the available knowledge about the genetic differentiation of individual subspecies of P. carotovorum, but also delineates the general genetic features of P. carotovorum by comparison with its four closely related species, thereby substantially enriching the extent of information now available for functional genomic investigations about Pectobacterium.},
}
@article {pmid30526040,
year = {2018},
author = {Shabbir, MA and Wu, Q and Shabbir, MZ and Sajid, A and Ahmed, S and Sattar, A and Tang, Y and Li, J and Maan, MK and Hao, H and Yuan, Z},
title = {The CRISPR-cas system promotes antimicrobial resistance in Campylobacter jejuni.},
journal = {Future microbiology},
volume = {},
number = {},
pages = {},
doi = {10.2217/fmb-2018-0234},
pmid = {30526040},
issn = {1746-0921},
abstract = {AIM: The purpose of current study is to find out relationship between cas9 gene and antimicrobial resistance in C. jejuni NCTC11168.<br><br>MATERIALS &amp; METHODS: The involvement of the cas9 gene in antimicrobial resistance of C. jejuni was determined by assessment of minimum inhibitory concentration, clustered regularly interspaced short palindromic repeats (CRISPR)-cas gene expression in standard strains, in vitro resistance development and transcriptome analysis of a cas9 deletion mutant and wild strains.<br><br>RESULTS: Increased expression of CRISPR-related genes was observed in standard strains. We also observed that Δcas9 mutant strain is more sensitive to antibiotics than its wild strain. Transcriptome analysis revealed that cas9 gene regulate several genes to promote antimicrobial resistance in C. jejuni.<br><br>CONCLUSION: CRISPR-cas system plays role in the enhancement of antimicrobial resistance in C. jejuni.},
}
@article {pmid30520985,
year = {2018},
author = {Toymentseva, AA and Altenbuchner, J},
title = {New CRISPR-Cas9 vectors for genetic modifications of Bacillus species.},
journal = {FEMS microbiology letters},
volume = {},
number = {},
pages = {},
doi = {10.1093/femsle/fny284},
pmid = {30520985},
issn = {1574-6968},
abstract = {Genetic manipulation is a fundamental procedure for the study of gene and operon functions and new characteristics acquisition. Modern CRISPR-Cas technology allows genome editing more precise and increases the efficiency of transferring mutations in a variety of hard to manipulate organisms. Here, we describe new CRISPR-Cas vectors for genetic modifications in bacillary species. Our plasmids are single CRISPR-Cas plasmids comprising all components for genome editing and should be functional in a broad host range. They are highly efficient (up to 97%) and precise. The employment and delivery of these plasmids to bacillary strains can be easily achieved by conjugation from E. coli. During our research we also demonstrated the absence of compatibility between CRISPR-Cas system and NHEJ in B. subtilis.},
}
@article {pmid30520167,
year = {2018},
author = {Zhou, Q and Zhan, H and Liao, X and Fang, L and Liu, Y and Xie, H and Yang, K and Gao, Q and Ding, M and Cai, Z and Huang, W and Liu, Y},
title = {A revolutionary tool: CRISPR technology plays an important role in construction of intelligentized gene circuits.},
journal = {Cell proliferation},
volume = {},
number = {},
pages = {e12552},
doi = {10.1111/cpr.12552},
pmid = {30520167},
issn = {1365-2184},
support = {81772737//National Natural Science Foundation of China/ ; 2017A020215120//Guangdong Provincial Department of Science and Technology/ ; 2016031638//High Level University's Medical Discipline Construction project/ ; JCYJ20170413161749433//Shenzhen Municipal Government of China/ ; JSGG20160301161836370//Shenzhen Municipal Government of China/ ; 2014CB745201//National Key Basic Research Program of China (973 Program)/ ; SZSM201412018//Sanming Project of Shenzhen Health and Family Planning Commission/ ; SZSM201512037//Sanming Project of Shenzhen Health and Family Planning Commission/ ; },
abstract = {With the development of synthetic biology, synthetic gene circuits have shown great applied potential in medicine, biology, and as commodity chemicals. An ultimate challenge in the construction of gene circuits is the lack of effective, programmable, secure and sequence-specific gene editing tools. The clustered regularly interspaced short palindromic repeat (CRISPR) system, a CRISPR-associated RNA-guided endonuclease Cas9 (CRISPR-associated protein 9)-targeted genome editing tool, has recently been applied in engineering gene circuits for its unique properties-operability, high efficiency and programmability. The traditional single-targeted therapy cannot effectively distinguish tumour cells from normal cells, and gene therapy for single targets has poor anti-tumour effects, which severely limits the application of gene therapy. Currently, the design of gene circuits using tumour-specific targets based on CRISPR/Cas systems provides a new way for precision cancer therapy. Hence, the application of intelligentized gene circuits based on CRISPR technology effectively guarantees the safety, efficiency and specificity of cancer therapy. Here, we assessed the use of synthetic gene circuits and if the CRISPR system could be used, especially artificial switch-inducible Cas9, to more effectively target and treat tumour cells. Moreover, we also discussed recent advances, prospectives and underlying challenges in CRISPR-based gene circuit development.},
}
@article {pmid30518723,
year = {2018},
author = {Ayabe, S and Nakashima, K and Yoshiki, A},
title = {Off- and on-target effects of genome editing in mouse embryos.},
journal = {The Journal of reproduction and development},
volume = {},
number = {},
pages = {},
doi = {10.1262/jrd.2018-128},
pmid = {30518723},
issn = {1348-4400},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas-based genome editing technology has enabled manipulation of the embryonic genome. Unbiased whole genome sequencing comparing parents to progeny has revealed that the rate of Cas9-induced mutagenesis in mouse embryos is indistinguishable from the background rate of de novo mutation. However, establishing the best practice to confirm on-target alleles of interest remains a challenge. We believe that improvement in editing strategies and screening methods for founder mice will contribute to the generation of quality-controlled animals, thereby ensuring reproducibility of results in animal studies and advancing the 3Rs (replacement, reduction, and refinement).},
}
@article {pmid30503774,
year = {2018},
author = {Wang, L and Mo, CY and Wasserman, MR and Rostøl, JT and Marraffini, LA and Liu, S},
title = {Dynamics of Cas10 Govern Discrimination between Self and Non-self in Type III CRISPR-Cas Immunity.},
journal = {Molecular cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.molcel.2018.11.008},
pmid = {30503774},
issn = {1097-4164},
support = {DP1 GM128184/GM/NIGMS NIH HHS/United States ; R00 GM107365/GM/NIGMS NIH HHS/United States ; },
abstract = {Adaptive immune systems must accurately distinguish between self and non-self in order to defend against invading pathogens while avoiding autoimmunity. Type III CRISPR-Cas systems employ guide RNA to recognize complementary RNA targets, which triggers the degradation of both the invader's transcripts and their template DNA. These systems can broadly eliminate foreign targets with multiple mutations but circumvent damage to the host genome. To explore the molecular basis for these features, we use single-molecule fluorescence microscopy to study the interaction between a type III-A ribonucleoprotein complex and various RNA substrates. We find that Cas10-the DNase effector of the complex-displays rapid conformational fluctuations on foreign RNA targets, but is locked in a static configuration on self RNA. Target mutations differentially modulate Cas10 dynamics and tune the CRISPR interference activity in vivo. These findings highlight the central role of the internal dynamics of CRISPR-Cas complexes in self versus non-self discrimination and target specificity.},
}
@article {pmid30503773,
year = {2018},
author = {Jia, N and Mo, CY and Wang, C and Eng, ET and Marraffini, LA and Patel, DJ},
title = {Type III-A CRISPR-Cas Csm Complexes: Assembly, Periodic RNA Cleavage, DNase Activity Regulation, and Autoimmunity.},
journal = {Molecular cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.molcel.2018.11.007},
pmid = {30503773},
issn = {1097-4164},
abstract = {Type ΙΙΙ CRISPR-Cas systems provide robust immunity against foreign RNA and DNA by sequence-specific RNase and target RNA-activated sequence-nonspecific DNase and RNase activities. We report on cryo-EM structures of Thermococcus onnurineus CsmcrRNA binary, CsmcrRNA-target RNA and CsmcrRNA-target RNAanti-tag ternary complexes in the 3.1 Å range. The topological features of the crRNA 5'-repeat tag explains the 5'-ruler mechanism for defining target cleavage sites, with accessibility of positions -2 to -5 within the 5'-repeat serving as sensors for avoidance of autoimmunity. The Csm3 thumb elements introduce periodic kinks in the crRNA-target RNA duplex, facilitating cleavage of the target RNA with 6-nt periodicity. Key Glu residues within a Csm1 loop segment of CsmcrRNA adopt a proposed autoinhibitory conformation suggestive of DNase activity regulation. These structural findings, complemented by mutational studies of key intermolecular contacts, provide insights into CsmcrRNA complex assembly, mechanisms underlying RNA targeting and site-specific periodic cleavage, regulation of DNase cleavage activity, and autoimmunity suppression.},
}
@article {pmid30503210,
year = {2018},
author = {You, L and Ma, J and Wang, J and Artamonova, D and Wang, M and Liu, L and Xiang, H and Severinov, K and Zhang, X and Wang, Y},
title = {Structure Studies of the CRISPR-Csm Complex Reveal Mechanism of Co-transcriptional Interference.},
journal = {Cell},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.cell.2018.10.052},
pmid = {30503210},
issn = {1097-4172},
abstract = {Csm, a type III-A CRISPR-Cas interference complex, is a CRISPR RNA (crRNA)-guided RNase that also possesses target RNA-dependent DNase and cyclic oligoadenylate (cOA) synthetase activities. However, the structural features allowing target RNA-binding-dependent activation of DNA cleavage and cOA generation remain unknown. Here, we report the structure of Csm in complex with crRNA together with structures of cognate or non-cognate target RNA bound Csm complexes. We show that depending on complementarity with the 5' tag of crRNA, the 3' anti-tag region of target RNA binds at two distinct sites of the Csm complex. Importantly, the interaction between the non-complementary anti-tag region of cognate target RNA and Csm1 induces a conformational change at the Csm1 subunit that allosterically activates DNA cleavage and cOA generation. Together, our structural studies provide crucial insights into the mechanistic processes required for crRNA-meditated sequence-specific RNA cleavage, RNA target-dependent non-specific DNA cleavage, and cOA generation.},
}
@article {pmid30503205,
year = {2018},
author = {Stella, S and Mesa, P and Thomsen, J and Paul, B and Alcón, P and Jensen, SB and Saligram, B and Moses, ME and Hatzakis, NS and Montoya, G},
title = {Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.},
journal = {Cell},
volume = {175},
number = {7},
pages = {1856-1871.e21},
doi = {10.1016/j.cell.2018.10.045},
pmid = {30503205},
issn = {1097-4172},
abstract = {Cas12a, also known as Cpf1, is a type V-A CRISPR-Cas RNA-guided endonuclease that is used for genome editing based on its ability to generate specific dsDNA breaks. Here, we show cryo-EM structures of intermediates of the cleavage reaction, thus visualizing three protein regions that sense the crRNA-DNA hybrid assembly triggering the catalytic activation of Cas12a. Single-molecule FRET provides the thermodynamics and kinetics of the conformational activation leading to phosphodiester bond hydrolysis. These findings illustrate why Cas12a cuts its target DNA and unleashes unspecific cleavage activity, degrading ssDNA molecules after activation. In addition, we show that other crRNAs are able to displace the R-loop inside the protein after target DNA cleavage, terminating indiscriminate ssDNA degradation. We propose a model whereby the conformational activation of the enzyme results in indiscriminate ssDNA cleavage. The displacement of the R-loop by a new crRNA molecule will reset Cas12a specificity, targeting new DNAs.},
}
@article {pmid30502320,
year = {2018},
author = {Wang, M and Sintim, HO},
title = {Discriminating cyclic from linear nucleotides - CRISPR/Cas-related cyclic hexaadenosine monophosphate as a case study.},
journal = {Analytical biochemistry},
volume = {567},
number = {},
pages = {21-26},
doi = {10.1016/j.ab.2018.11.022},
pmid = {30502320},
issn = {1096-0309},
abstract = {Nucleic acids exist in biological systems as linear and cyclic forms and in most cases the biology of the cyclic form is different from the linear form of exactly the same sequence. Case examples are cyclic nucleotides, second messengers in both prokaryotes and eukaryotes whereby the cyclic forms account for their interesting biological profiles and the actions of the cyclic nucleotides are terminated upon phosphodiesterase hydrolysis into linear forms. For mono and dinucleotides, it has been shown that vast conformational changes that accompany the hydrolysis of the cyclized form allow for discrimination between the cyclized and linear forms. As the ring size increases, it becomes difficult to use conformational or structural differences alone to discriminate between cyclic and linear nucleotides. Here we reveal that for the recently discovered CRISPR/Cas-related cyclic hexaadenosine monophosphate, it is possible to discriminate between the cyclized and linear forms. The structures of c-HexaAMP and linear form are different in acidic media and this structural difference facilitated a simple and practical detection platform for this interesting and new bacterial immunity-related molecule, and we also demonstrate that it is possible to distinguish between linear and cyclized polynucleotides using simple spectroscopic techniques, such as CD and fluorescence-based methods.},
}
@article {pmid30515147,
year = {2018},
author = {Lima, ARJ and Siqueira, AS and de Vasconcelos, JM and Pereira, JS and de Azevedo, JSN and Moraes, PHG and Aguiar, DCF and de Lima, CPS and Vianez-Júnior, JLSG and Nunes, MRT and Xavier, LP and Dall'Agnol, LT and Goncalves, EC},
title = {Insights Into Limnothrix sp. Metabolism Based on Comparative Genomics.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {2811},
pmid = {30515147},
issn = {1664-302X},
abstract = {Currently only four genome sequences for Limnothrix spp. are publicly available, and information on the genetic properties of cyanobacteria belonging to this genus is limited. In this study, we report the draft genome of Limnothrix sp. CACIAM 69d, isolated from the reservoir of a hydroelectric dam located in the Amazon ecosystem, from where cyanobacterial genomic data are still scarce. Comparative genomic analysis of Limnothrix revealed the presence of key enzymes in the cyanobacterial central carbon metabolism and how it is well equipped for environmental sulfur and nitrogen acquisition. Additionally, this work covered the analysis of Limnothrix CRISPR-Cas systems, pathways related to biosynthesis of secondary metabolites and assembly of extracellular polymeric substances and their exportation. A trans-AT PKS gene cluster was identified in two strains, possibly related to the novel toxin Limnothrixin biosynthesis. Overall, the draft genome of Limnothrix sp. CACIAM 69d adds new data to the small Limnothrix genome library and contributes to a growing representativeness of cyanobacterial genomes from the Amazon region. The comparative genomic analysis of Limnothrix made it possible to highlight unique genes for each strain and understand the overall features of their metabolism.},
}
@article {pmid30514786,
year = {2018},
author = {Lee, J and Mir, A and Edraki, A and Garcia, B and Amrani, N and Lou, HE and Gainetdinov, I and Pawluk, A and Ibraheim, R and Gao, XD and Liu, P and Davidson, AR and Maxwell, KL and Sontheimer, EJ},
title = {Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
pmid = {30514786},
issn = {2150-7511},
support = {R01 GM125797/GM/NIGMS NIH HHS/United States ; },
abstract = {In their natural settings, CRISPR-Cas systems play crucial roles in bacterial and archaeal adaptive immunity to protect against phages and other mobile genetic elements, and they are also widely used as genome engineering technologies. Previously we discovered bacteriophage-encoded Cas9-specific anti-CRISPR (Acr) proteins that serve as countermeasures against host bacterial immunity by inactivating their CRISPR-Cas systems (A. Pawluk, N. Amrani, Y. Zhang, B. Garcia, et al., Cell 167:1829-1838.e9, 2016, https://doi.org/10.1016/j.cell.2016.11.017). We hypothesized that the evolutionary advantages conferred by anti-CRISPRs would drive the widespread occurrence of these proteins in nature (K. L. Maxwell, Mol Cell 68:8-14, 2017, https://doi.org/10.1016/j.molcel.2017.09.002; A. Pawluk, A. R. Davidson, and K. L. Maxwell, Nat Rev Microbiol 16:12-17, 2018, https://doi.org/10.1038/nrmicro.2017.120; E. J. Sontheimer and A. R. Davidson, Curr Opin Microbiol 37:120-127, 2017, https://doi.org/10.1016/j.mib.2017.06.003). We have identified new anti-CRISPRs using the same bioinformatic approach that successfully identified previous Acr proteins (A. Pawluk, N. Amrani, Y. Zhang, B. Garcia, et al., Cell 167:1829-1838.e9, 2016, https://doi.org/10.1016/j.cell.2016.11.017) against Neisseria meningitidis Cas9 (NmeCas9). In this work, we report two novel anti-CRISPR families in strains of Haemophilus parainfluenzae and Simonsiella muelleri, both of which harbor type II-C CRISPR-Cas systems (A. Mir, A. Edraki, J. Lee, and E. J. Sontheimer, ACS Chem Biol 13:357-365, 2018, https://doi.org/10.1021/acschembio.7b00855). We characterize the type II-C Cas9 orthologs from H. parainfluenzae and S. muelleri, show that the newly identified Acrs are able to inhibit these systems, and define important features of their inhibitory mechanisms. The S. muelleri Acr is the most potent NmeCas9 inhibitor identified to date. Although inhibition of NmeCas9 by anti-CRISPRs from H. parainfluenzae and S. muelleri reveals cross-species inhibitory activity, more distantly related type II-C Cas9s are not inhibited by these proteins. The specificities of anti-CRISPRs and divergent Cas9s appear to reflect coevolution of their strategies to combat or evade each other. Finally, we validate these new anti-CRISPR proteins as potent off-switches for Cas9 genome engineering applications.IMPORTANCE As one of their countermeasures against CRISPR-Cas immunity, bacteriophages have evolved natural inhibitors known as anti-CRISPR (Acr) proteins. Despite the existence of such examples for type II CRISPR-Cas systems, we currently know relatively little about the breadth of Cas9 inhibitors, and most of their direct Cas9 targets are uncharacterized. In this work we identify two new type II-C anti-CRISPRs and their cognate Cas9 orthologs, validate their functionality in vitro and in bacteria, define their inhibitory spectrum against a panel of Cas9 orthologs, demonstrate that they act before Cas9 DNA binding, and document their utility as off-switches for Cas9-based tools in mammalian applications. The discovery of diverse anti-CRISPRs, the mechanistic analysis of their cognate Cas9s, and the definition of Acr inhibitory mechanisms afford deeper insight into the interplay between Cas9 orthologs and their inhibitors and provide greater scope for exploiting Acrs for CRISPR-based genome engineering.},
}
@article {pmid30514784,
year = {2018},
author = {Musharova, O and Vyhovskyi, D and Medvedeva, S and Guzina, J and Zhitnyuk, Y and Djordjevic, M and Severinov, K and Savitskaya, E},
title = {Avoidance of Trinucleotide Corresponding to Consensus Protospacer Adjacent Motif Controls the Efficiency of Prespacer Selection during Primed Adaptation.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
pmid = {30514784},
issn = {2150-7511},
support = {R01 GM104071/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR DNA arrays of unique spacers separated by identical repeats ensure prokaryotic immunity through specific targeting of foreign nucleic acids complementary to spacers. New spacers are acquired into a CRISPR array in a process of CRISPR adaptation. Selection of foreign DNA fragments to be integrated into CRISPR arrays relies on PAM (protospacer adjacent motif) recognition, as only those spacers will be functional against invaders. However, acquisition of different PAM-associated spacers proceeds with markedly different efficiency from the same DNA. Here, we used a combination of bioinformatics and experimental approaches to understand factors affecting the efficiency of acquisition of spacers by the Escherichia coli type I-E CRISPR-Cas system, for which two modes of CRISPR adaptation have been described: naive and primed. We found that during primed adaptation, efficiency of spacer acquisition is strongly negatively affected by the presence of an AAG trinucleotide-a consensus PAM-within the sequence being selected. No such trend is observed during naive adaptation. The results are consistent with a unidirectional spacer selection process during primed adaptation and provide a specific signature for identification of spacers acquired through primed adaptation in natural populations.IMPORTANCE Adaptive immunity of prokaryotes depends on acquisition of foreign DNA fragments into CRISPR arrays as spacers followed by destruction of foreign DNA by CRISPR interference machinery. Different fragments are acquired into CRISPR arrays with widely different efficiencies, but the factors responsible are not known. We analyzed the frequency of spacers acquired during primed adaptation in an E. coli CRISPR array and found that AAG motif was depleted from highly acquired spacers. AAG is also a consensus protospacer adjacent motif (PAM) that must be present upstream from the target of the CRISPR spacer for its efficient destruction by the interference machinery. These results are important because they provide new information on the mechanism of primed spacer acquisition. They add to other previous evidence in the field that pointed out to a &quot;directionality&quot; in the capture of new spacers. Our data strongly suggest that the recognition of an AAG PAM by the interference machinery components prior to spacer capture occludes downstream AAG sequences, thus preventing their recognition by the adaptation machinery.},
}
@article {pmid30513193,
year = {2018},
author = {Lainšček, D and Kadunc, L and Manček-Keber, M and Hafner-Bratkovič, I and Romih, R and Jerala, R},
title = {Delivery of an artificial transcription regulator dCas9-VPR by extracellular vesicles for therapeutic gene activation.},
journal = {ACS synthetic biology},
volume = {},
number = {},
pages = {},
doi = {10.1021/acssynbio.8b00192},
pmid = {30513193},
issn = {2161-5063},
abstract = {The CRISPR/Cas system has been developed as a potent tool for genome engineering and transcription regulation. However, the efficiency of its delivery into cells, particularly for therapeutic in vivo applications, remains a major bottleneck. Extracellular vesicles (EVs), released by eukaryotic cells, can mediate the transfer of different molecules, including nucleic acids and proteins. Here we show packaging and delivery of the CRISPR/Cas system via EVs to target cells, combining the advantages of both technological platforms. A GEDEX (genome editing with designed extracellular vesicles) system generated by the producer cells can transfer the designed transcriptional regulator dCas9-VPR complexed with appropriate targeting gRNAs enabling gene transcription activation. We show functional delivery in mammalian cells as well in the animals. By in vivo delivery of dCas9-VPR/sgRNA GEDEX therapeutic efficiency is demonstrated in a mouse model of liver damage counteracted by upregulation of the endogenous hepatocyte growth factor, demonstrating the potentials for therapeutic applications.},
}
@article {pmid30510770,
year = {2018},
author = {Teng, F and Cui, T and Feng, G and Guo, L and Xu, K and Gao, Q and Li, T and Li, J and Zhou, Q and Li, W},
title = {Repurposing CRISPR-Cas12b for mammalian genome engineering.},
journal = {Cell discovery},
volume = {4},
number = {},
pages = {63},
pmid = {30510770},
issn = {2056-5968},
abstract = {The prokaryotic CRISPR-Cas adaptive immune systems provide valuable resources to develop genome editing tools, such as CRISPR-Cas9 and CRISPR-Cas12a/Cpf1. Recently, CRISPR-Cas12b/C2c1, a distinct type V-B system, has been characterized as a dual-RNA-guided DNA endonuclease system. Though being active in vitro, its cleavage activity at endogenous genome remains to be explored. Furthermore, the optimal cleavage temperature of the reported Cas12b orthologs is higher than 40 °C, which is unsuitable for mammalian applications. Here, we report the identification of a Cas12b system from the Alicyclobacillus acidiphilus (AaCas12b), which maintains optimal nuclease activity over a wide temperature range (31 °C-59 °C). AaCas12b can be repurposed to engineer mammalian genomes for versatile applications, including single and multiplex genome editing, gene activation, and generation of gene mutant mouse models. Moreover, whole-genome sequencing reveals high specificity and minimal off-target effects of AaCas12b-meditated genome editing. Our findings establish CRISPR-Cas12b as a versatile tool for mammalian genome engineering.},
}
@article {pmid30510202,
year = {2018},
author = {Møller-Olsen, C and Ho, SFS and Shukla, RD and Feher, T and Sagona, AP},
title = {Engineered K1F bacteriophages kill intracellular Escherichia coli K1 in human epithelial cells.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {17559},
pmid = {30510202},
issn = {2045-2322},
support = {BB/N011872/1//Biotechnology and Biological Sciences Research Council (BBSRC)/ ; },
abstract = {Bacterial infections can be treated with bacteriophages that show great specificity towards their bacterial host and can be genetically modified for different applications. However, whether and how bacteriophages can kill intracellular bacteria in human cells remains elusive. Here, using CRISPR/Cas selection, we have engineered a fluorescent bacteriophage specific for E. coli K1, a nosocomial pathogen responsible for urinary tract infections, neonatal meningitis and sepsis. By confocal and live microscopy, we show that engineered bacteriophages K1F-GFP and E. coli EV36-RFP bacteria displaying the K1 capsule, enter human cells via phagocytosis. Importantly, we show that bacteriophage K1F-GFP efficiently kills intracellular E. coli EV36-RFP in T24 human urinary bladder epithelial cells. Finally, we provide evidence that bacteria and bacteriophages are degraded by LC3-associated phagocytosis and xenophagy.},
}
@article {pmid30510171,
year = {2018},
author = {Daly, RA and Roux, S and Borton, MA and Morgan, DM and Johnston, MD and Booker, AE and Hoyt, DW and Meulia, T and Wolfe, RA and Hanson, AJ and Mouser, PJ and Moore, JD and Wunch, K and Sullivan, MB and Wrighton, KC and Wilkins, MJ},
title = {Viruses control dominant bacteria colonizing the terrestrial deep biosphere after hydraulic fracturing.},
journal = {Nature microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41564-018-0312-6},
pmid = {30510171},
issn = {2058-5276},
abstract = {The deep terrestrial biosphere harbours a substantial fraction of Earth's biomass and remains understudied compared with other ecosystems. Deep biosphere life primarily consists of bacteria and archaea, yet knowledge of their co-occurring viruses is poor. Here, we temporally catalogued viral diversity from five deep terrestrial subsurface locations (hydraulically fractured wells), examined virus-host interaction dynamics and experimentally assessed metabolites from cell lysis to better understand viral roles in this ecosystem. We uncovered high viral diversity, rivalling that of peatland soil ecosystems, despite low host diversity. Many viral operational taxonomic units were predicted to infect Halanaerobium, the dominant microorganism in these ecosystems. Examination of clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins (CRISPR-Cas) spacers elucidated lineage-specific virus-host dynamics suggesting active in situ viral predation of Halanaerobium. These dynamics indicate repeated viral encounters and changing viral host range across temporally and geographically distinct shale formations. Laboratory experiments showed that prophage-induced Halanaerobium lysis releases intracellular metabolites that can sustain key fermentative metabolisms, supporting the persistence of microorganisms in this ecosystem. Together, these findings suggest that diverse and active viral populations play critical roles in driving strain-level microbial community development and resource turnover within this deep terrestrial subsurface ecosystem.},
}
@article {pmid30487289,
year = {2018},
author = {Miao, K and Zhang, X and Su, SM and Zeng, J and Huang, Z and Chan, UI and Xu, X and Deng, CX},
title = {Optimizing CRISPR/Cas9 technology for precise correction of the Fgfr3-Gly374Arg mutation in achondroplasia in mice.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.006496},
pmid = {30487289},
issn = {1083-351X},
abstract = {CRISPR/Cas9 is a powerful technology widely used for genome editing, with the potential to be used for correcting a wide variety of deleterious disease-causing mutations. However, the technique tends to generate more indels (insertions and deletions) than precise modifications at the target sites, which might not resolve the mutation and could instead exacerbate the initial genetic disruption. We sought to develop an improved protocol for CRISPR/Cas9 that would correct mutations without unintended consequences. As a case study, we focused on achondroplasia, a common genetic form of dwarfism defined by missense mutation in the Fgfr3 gene that results in glycine-to-arginine substitution at position 374 in mice in fibroblast growth factor receptor 3 (Fgfr3-Gly374Arg), which corresponds to Gly380Arg in humans. First, we designed a GFP reporter system that can evaluate the cutting efficiency and specificity of sgRNAs. Using the sgRNA selected based on our GFP reporter system, we conducted targeted therapy of achondroplasia in mice. We found that we achieved higher frequency of precise correction of Fgfr3-Gly374Arg mutation using Cas9 protein rather than Cas9 mRNA. We further demonstrated that targeting oligos of 100nt and 200nt precisely corrected the mutation at equal efficiency. We showed that our strategy completely suppressed phenotypes of achondroplasia and whole genome sequencing detected no off-target effects. These data indicate that improved protocols can enable the precise CRISPR/Cas9 mediated correction of individual mutations with high fidelity.},
}
@article {pmid30485515,
year = {2018},
author = {Zhang, Y and Wang, Y and Wang, X and Ji, Y and Cheng, S and Wang, M and Zhang, C and Yu, X and Zhao, R and Zhang, W and Jin, J and Li, T and Zuo, Q and Li, B},
title = {Acetyl-coenzyme A acyltransferase 2 promote the differentiation of sheep precursor adipocytes into adipocytes.},
journal = {Journal of cellular biochemistry},
volume = {},
number = {},
pages = {},
doi = {10.1002/jcb.28080},
pmid = {30485515},
issn = {1097-4644},
support = {//Joint International Research Laboratory of Agriculture and Agri-Product Safety of Ministry of Education of China, Yangzhou University/ ; //Outstanding backbone Teachers of Yangzhou University (2016)/ ; //Institutes of Agricultural Science and Technology Development, Yangzhou University/ ; //The Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions/ ; BE2015362//the Primary Research &amp; Developement Plan of Jiangsu Province/ ; BK20150440//Natural Science Foundation of Jiangsu Province/ ; BK20161331//Natural Science Foundation of Jiangsu Province/ ; },
abstract = {The acetyl CoA acyltransferase 2 (ACAA2) is a key enzyme of the fatty acid oxidation pathway, catalyzing the last step of the mitochondrial beta oxidation, thus playing an important role in the fatty acid metabolism. The purpose of this study was to investigate the effect of knocking out ACAA2 on the expression of genes lipoprteinlipase (LPL), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase, fat mass and obesity-associated gene, adipocyte fatty acid-binding protein (AP2) in precursor adipocytes and their differentiation into adipocytes. The knockout vector was constructed using CRISPR-Cas RNA-guided nuclease technology with an efficiency of 23.80%, and the vector was transfected into precursor adipocyte cells, while an overexpression vector of the ACAA2 gene was also transfected in another group of preadipocytes. Quantitative polymerase chain reaction showed that the expression of the PPAR-γ, LPL, and AP2 was significantly lower in the knockout compared with the overexpression group, while there was no difference in cell growth. After induction of adipocyte precursor cells into adipocytes using dexamethasone, insulin, and IBMX, oil red staining showed a significantly different number of lipid droplets in the knockout group. These results provide a preliminary indication for a possible involvement of the ACAA2 gene in adipocyte differentiation in vitro.},
}
@article {pmid30483283,
year = {2018},
author = {Nadakuduti, SS and Buell, CR and Voytas, DF and Starker, CG and Douches, DS},
title = {Genome Editing for Crop Improvement - Applications in Clonally Propagated Polyploids With a Focus on Potato (Solanum tuberosum L.).},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1607},
pmid = {30483283},
issn = {1664-462X},
abstract = {Genome-editing has revolutionized biology. When coupled with a recently streamlined regulatory process by the U.S. Department of Agriculture and the potential to generate transgene-free varieties, genome-editing provides a new avenue for crop improvement. For heterozygous, polyploid and vegetatively propagated crops such as cultivated potato, Solanum tuberosum Group Tuberosum L., genome-editing presents tremendous opportunities for trait improvement. In potato, traits such as improved resistance to cold-induced sweetening, processing efficiency, herbicide tolerance, modified starch quality and self-incompatibility have been targeted utilizing CRISPR/Cas9 and TALEN reagents in diploid and tetraploid clones. However, limited progress has been made in other such crops including sweetpotato, strawberry, grapes, citrus, banana etc., In this review we summarize the developments in genome-editing platforms, delivery mechanisms applicable to plants and then discuss the recent developments in regulation of genome-edited crops in the United States and The European Union. Next, we provide insight into the challenges of genome-editing in clonally propagated polyploid crops, their current status for trait improvement with future prospects focused on potato, a global food security crop.},
}
@article {pmid30483260,
year = {2018},
author = {Bray, C and Wright, D and Haupt, S and Thomas, S and Stauss, H and Zamoyska, R},
title = {Crispr/Cas Mediated Deletion of PTPN22 in Jurkat T Cells Enhances TCR Signaling and Production of IL-2.},
journal = {Frontiers in immunology},
volume = {9},
number = {},
pages = {2595},
pmid = {30483260},
issn = {1664-3224},
abstract = {A single nucleotide polymorphism, C1858T, in the gene encoding the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) results in one of the strongest genetic traits associated with autoimmune disease outside of the Major Histocompatibility Complex (MHC) genes. However, the consequences of this polymorphism, which introduces an arginine to tryptophan substitution at amino acid 620, for the function of PTPN22 protein is unclear and conflicting results have been obtained in human compared to mouse cells expressing this variant phosphatase. In mouse the variant appears to be a loss-of-function allele resembling a milder form of the null allele, while studies in human cells have reported it to be a gain-of-function mutation. To address whether the phosphatase has distinct functions in mouse vs. human T cells, we used CRISPR gene-editing to generate the first example of human PTPN22-KnockOut (KO) T cells. By comparing isogenic human T cells which express or lack PTPN22, we showed that PTPN22 KO T cells displayed enhanced expression of IL-2 and CD69 upon stimulation with cognate antigen. PTPN22 KO cells also showed increased Erk phosphorylation upon stimulation with weak antigen, but the difference was diminished in response to strong antigen, indicating that PTPN22 plays a more critical role in regulating weak-antigen responses. These data are in keeping with a role for PTPN22 in determining the threshold of stimulation required to activate T cells, a critical function of autoimmune pathogenesis. Our data indicate that PTPN22 has comparable functions in mouse and human T cells, and that the conflicting results in the literature regarding the impact of the point mutation are not due to differences in the activity of PTPN22 itself, but may be related to interactions with other proteins or splice variation.},
}
@article {pmid30478289,
year = {2019},
author = {Turgeman-Grott, I and Joseph, S and Marton, S and Eizenshtein, K and Naor, A and Soucy, SM and Stachler, AE and Shalev, Y and Zarkor, M and Reshef, L and Altman-Price, N and Marchfelder, A and Gophna, U},
title = {Pervasive acquisition of CRISPR memory driven by inter-species mating of archaea can limit gene transfer and influence speciation.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {177-186},
doi = {10.1038/s41564-018-0302-8},
pmid = {30478289},
issn = {2058-5276},
abstract = {CRISPR-Cas systems provide prokaryotes with sequence-specific immunity against viruses and plasmids based on DNA acquired from these invaders, known as spacers. Surprisingly, many archaea possess spacers that match chromosomal genes of related species, including those encoding core housekeeping genes. By sequencing genomes of environmental archaea isolated from a single site, we demonstrate that inter-species spacers are common. We show experimentally, by mating Haloferax volcanii and Haloferax mediterranei, that spacers are indeed acquired chromosome-wide, although a preference for integrated mobile elements and nearby regions of the chromosome exists. Inter-species mating induces increased spacer acquisition and may result in interactions between the acquisition machinery of the two species. Surprisingly, many of the spacers acquired following inter-species mating target self-replicons along with those originating from the mating partner, indicating that the acquisition machinery cannot distinguish self from non-self under these conditions. Engineering the chromosome of one species to be targeted by the other's CRISPR-Cas reduces gene exchange between them substantially. Thus, spacers acquired during inter-species mating could limit future gene transfer, resulting in a role for CRISPR-Cas systems in microbial speciation.},
}
@article {pmid30473704,
year = {2018},
author = {Teague, WJ and Jones, MLM and Hawkey, L and Smyth, IM and Catubig, A and King, SK and Sarila, G and Li, R and Hutson, JM},
title = {FGF10 and the Mystery of Duodenal Atresia in Humans.},
journal = {Frontiers in genetics},
volume = {9},
number = {},
pages = {530},
pmid = {30473704},
issn = {1664-8021},
abstract = {Background: Duodenal atresia (DA) is a congenital obstruction of the duodenum, which affects 1 in 7000 pregnancies and requires major surgery in the 1st days of life. Three morphological DA types are described. In humans, the association between DA and Down syndrome suggests an underlying, albeit elusive, genetic etiology. In mice, interruption of fibroblast growth factor 10 (Fgf10) gene signaling results in DA in 30-50% of embryos, supporting a genetic etiology. This study aims to validate the spectrum of DA in two novel strains of Fgf10 knock-out mice, in preparation for future and translational research. Methods: Two novel CRISPR Fgf10 knock-out mouse strains were derived and embryos generated by heterozygous plug-mating. E15.5-E19.5 embryos were genotyped with respect to Fgf10 and micro-dissected to determine the presence and type of DA. Results: One twenty seven embryos (32 wild-type, 34 heterozygous, 61 null) were analyzed. No wild-type or heterozygous embryos had DA. However, 74% of Fgf10 null embryos had DA (49% type 1, 18% type 2, and 33% type 3). Conclusion: Our CRISPR-derived strains showed higher penetrance of DA due to single-gene deletion of Fgf10 in mice than previously reported. Further, the DA type distribution in these mice more closely reiterated that observed in humans. Future experiments will document RNA and protein expression of FGF10 and its key downstream signaling targets in normal and atretic duodenum. This includes exploitation of modern, high-fidelity developmental tools, e.g., Fgf10flox/+-tomatoflox/flox mice.},
}
@article {pmid30467400,
year = {2018},
author = {Yan, Y and Finnigan, GC},
title = {Development of a multi-locus CRISPR gene drive system in budding yeast.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {17277},
pmid = {30467400},
issn = {2045-2322},
support = {P20 GM103418/GM/NIGMS NIH HHS/United States ; P20 GM103418//U.S. Department of Health &amp; Human Services | NIH | National Institute of General Medical Sciences (NIGMS)/ ; Hatch Project 1013520//USDA | National Institute of Food and Agriculture (NIFA)/ ; },
abstract = {The discovery of CRISPR/Cas gene editing has allowed for major advances in many biomedical disciplines and basic research. One arrangement of this biotechnology, a nuclease-based gene drive, can rapidly deliver a genetic element through a given population and studies in fungi and metazoans have demonstrated the success of such a system. This methodology has the potential to control biological populations and contribute to eradication of insect-borne diseases, agricultural pests, and invasive species. However, there remain challenges in the design, optimization, and implementation of gene drives including concerns regarding biosafety, containment, and control/inhibition. Given the numerous gene drive arrangements possible, there is a growing need for more advanced designs. In this study, we use budding yeast to develop an artificial multi-locus gene drive system. Our minimal setup requires only a single copy of S. pyogenes Cas9 and three guide RNAs to propagate three gene drives. We demonstrate how this system could be used for targeted allele replacement of native genes and to suppress NHEJ repair systems by modifying DNA Ligase IV. A multi-locus gene drive configuration provides an expanded suite of options for complex attributes including pathway redundancy, combatting evolved resistance, and safeguards for control, inhibition, or reversal of drive action.},
}
@article {pmid30466900,
year = {2018},
author = {Monteiro, R and Pires, DP and Costa, AR and Azeredo, J},
title = {Phage Therapy: Going Temperate?.},
journal = {Trends in microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tim.2018.10.008},
pmid = {30466900},
issn = {1878-4380},
abstract = {Strictly lytic phages have been consensually preferred for phage therapy purposes. In contrast, temperate phages have been avoided due to an inherent capacity to mediate transfer of genes between bacteria by specialized transduction - an event that may increase bacterial virulence, for example, by promoting antibiotic resistance. Now, advances in sequencing technologies and synthetic biology are providing new opportunities to explore the use of temperate phages for therapy against bacterial infections. By doing so we can considerably expand our armamentarium against the escalating threat of antibiotic-resistant bacteria.},
}
@article {pmid30466578,
year = {2018},
author = {Pandiarajan, R and Grover, A},
title = {In vivo promoter engineering in plants: Are we ready?.},
journal = {Plant science : an international journal of experimental plant biology},
volume = {277},
number = {},
pages = {132-138},
doi = {10.1016/j.plantsci.2018.10.011},
pmid = {30466578},
issn = {1873-2259},
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Genome, Plant/*genetics ; Promoter Regions, Genetic/*genetics ; },
abstract = {Engineering plant promoter sequence for optimal expression of a gene has been a long standing goal for plant scientists. In recent times, Sequence Specific Nucleases (SSNs) like CRISPR/Cas9 are enabling researchers to achieve this goal, in vivo in the genome. It is well known that SSNs have met with unprecedented success in rapid transgene free crop improvement largely by targeting the coding sequence. Here, we discuss the strategies being employed by plant scientists in targeting SSNs to non-coding promoter regions/Cis Regulatory Elements (CRE). We collectively refer all such endeavors as in vivo promoter engineering (IPE). We further classify the IPE efforts into CRE addition, CRE deletion/disruption, promoter swap/insertion and targeted promoter polymorphism. Till date, IPE has proven useful in altering plant architecture in tomato, developing resistance against Xanthomonas sp in rice and citrus, and engineering drought tolerance in maize. However it is quite challenging to achieve predictable changes in gene expression using IPE at this point. In future years, data generated from high throughput techniques to investigate non coding genome may immensely augment the efforts in this direction. As IPE does not involve addition of the transgene for modifying crop traits, it will be relatively more conducive to public acceptance in crop improvement programs.},
}
@article {pmid30466456,
year = {2018},
author = {Wong, NK and Huang, CL and Islam, R and Yip, SP},
title = {Long non-coding RNAs in hematological malignancies: translating basic techniques into diagnostic and therapeutic strategies.},
journal = {Journal of hematology &amp; oncology},
volume = {11},
number = {1},
pages = {131},
pmid = {30466456},
issn = {1756-8722},
support = {99QP//Hong Kong Polytechnic University/ ; 1-ZVJB//Hong Kong Polytechnic University/ ; G-YBX3//Hong Kong Polytechnic University/ ; 31701192//National Natural Science Foundation of China/ ; },
abstract = {Recent studies have revealed that non-coding regions comprise the vast majority of the human genome and long non-coding RNAs (lncRNAs) are a diverse class of non-coding RNAs that has been implicated in a variety of biological processes. Abnormal expression of lncRNAs has also been linked to different human diseases including cancers, yet the regulatory mechanisms and functional effects of lncRNAs are still ambiguous, and the molecular details also need to be confirmed. Unlike protein-coding gene, it is much more challenging to unravel the roles of lncRNAs owing to their unique and complex features such as functional diversity and low conservation among species, which greatly hamper their experimental characterization. In this review, we summarize and discuss both conventional and advanced approaches for the identification and functional characterization of lncRNAs related to hematological malignancies. In particular, the utility and advancement of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system as gene-editing tools are envisioned to facilitate the molecular dissection of lncRNAs via different knock-in/out strategies. Besides experimental considerations specific to lncRNAs, the roles of lncRNAs in the pathogenesis and progression of leukemia are also highlighted in the review. We expect that these insights may ultimately lead to clinical applications including development of biomarkers and novel therapeutic approaches targeting lncRNAs.},
}
@article {pmid30463938,
year = {2018},
author = {Gas-Pascual, E and Ichikawa, HT and Sheikh, MO and Serji, MI and Deng, B and Mandalasi, M and Bandini, G and Samuelson, J and Wells, L and West, CM},
title = {CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.006072},
pmid = {30463938},
issn = {1083-351X},
support = {R01 GM037539/GM/NIGMS NIH HHS/United States ; R21 AI123161/AI/NIAID NIH HHS/United States ; P41 GM103390/GM/NIGMS NIH HHS/United States ; P41 RR018502/RR/NCRR NIH HHS/United States ; P41 GM103490/GM/NIGMS NIH HHS/United States ; R01 GM084383/GM/NIGMS NIH HHS/United States ; R01 AI110638/AI/NIAID NIH HHS/United States ; },
abstract = {Infection with the protozoan parasite Toxoplasma gondii is a major health risk owing to birth defects, its chronic nature, ability to reactivate to cause blindness and encephalitis, and high prevalence in human populations. Unlike most eukaryotes, Toxoplasma propagates in intracellular parasitophorous vacuoles, but as for nearly all other eukaryotes, Toxoplasma glycosylates many cellular proteins and lipids and assembles polysaccharides. Toxoplasma glycans resemble those of other eukaryotes but species-specific variations have prohibited deeper investigations into their roles in parasite biology and virulence. The Toxoplasma genome encodes a suite of likely glycogenes expected to assemble N-glycans, O-glycans, a C-glycan, GPI-anchors, and polysaccharides, along with their precursors and membrane transporters. To investigate the roles of specific glycans in Toxoplasma, here we coupled genetic and glycomics approaches to map the connections between 67 glycogenes, their enzyme products, the glycans to which they contribute, and cellular functions. We applied a double-CRISPR/Cas9 strategy, in which two guide RNAs promote replacement of a candidate gene with a resistance gene; adapted MS-based glycomics workflows to test for effects on glycan formation; and infected fibroblast monolayers to assess cellular effects. By editing 17 glycogenes, we discovered novel Glc0-2-Man6-GlcNAc2-type N-glycans, a novel HexNAc-GalNAc-mucin-type O-glycan, and Tn-antigen, identified the glycosyltransferases for assembling a novel nuclear O-Fuc-type and cell surface Glc-Fuc-type O-glycans, and showed that they are important for in vitro growth. The guide sequences, editing constructs, and mutant strains are freely available to researchers to investigate the roles of glycans in their favorite biological processes.},
}
@article {pmid30462638,
year = {2018},
author = {LaRoche-Johnston, F and Monat, C and Coulombe, S and Cousineau, B},
title = {Bacterial group II introns generate genetic diversity by circularization and trans-splicing from a population of intron-invaded mRNAs.},
journal = {PLoS genetics},
volume = {14},
number = {11},
pages = {e1007792},
pmid = {30462638},
issn = {1553-7404},
abstract = {Group II introns are ancient retroelements that significantly shaped the origin and evolution of contemporary eukaryotic genomes. These self-splicing ribozymes share a common ancestor with the telomerase enzyme, the spliceosome machinery as well as the highly abundant spliceosomal introns and non-LTR retroelements. More than half of the human genome thus consists of various elements that evolved from ancient group II introns, which altogether significantly contribute to key functions and genetic diversity in eukaryotes. Similarly, group II intron-related elements in bacteria such as abortive phage infection (Abi) retroelements, diversity generating retroelements (DGRs) and some CRISPR-Cas systems have evolved to confer important functions to their hosts. In sharp contrast, since bacterial group II introns are scarce, irregularly distributed and frequently spread by lateral transfer, they have mainly been considered as selfish retromobile elements with no beneficial function to their host. Here we unveil a new group II intron function that generates genetic diversity at the RNA level in bacterial cells. We demonstrate that Ll.LtrB, the model group II intron from Lactococcus lactis, recognizes specific sequence motifs within cellular mRNAs by base pairing, and invades them by reverse splicing. Subsequent splicing of ectopically inserted Ll.LtrB, through circularization, induces a novel trans-splicing pathway that generates exon 1-mRNA and mRNA-mRNA intergenic chimeras. Our data also show that recognition of upstream alternative circularization sites on intron-interrupted mRNAs release Ll.LtrB circles harboring mRNA fragments of various lengths at their splice junction. Intergenic trans-splicing and alternative circularization both produce novel group II intron splicing products with potential new functions. Overall, this work describes new splicing pathways in bacteria that generate, similarly to the spliceosome in eukaryotes, genetic diversity at the RNA level while providing additional functional and evolutionary links between group II introns, spliceosomal introns and the spliceosome.},
}
@article {pmid30459943,
year = {2018},
author = {Tang, Y and Fu, Y},
title = {Class 2 CRISPR/Cas: an expanding biotechnology toolbox for and beyond genome editing.},
journal = {Cell &amp; bioscience},
volume = {8},
number = {},
pages = {59},
pmid = {30459943},
issn = {2045-3701},
abstract = {Artificial nuclease-dependent DNA cleavage systems (zinc-finger nuclease, ZFN; transcription activator like effectors, TALENs) and exogenous nucleic acid defense systems (CRISPR/Cas) have been used in the new era for genome modification. The most widely used toolbox for genome editing, modulation and detection contains Types II, V and VI of CRISPR/Cas Class 2 systems, categorized and characterized by Cas9, Cas12a and Cas13 respectively. In this review, we (1) elaborate on the definition, classification, structures of CRISPR/Cas Class 2 systems; (2) advance our understanding of new molecular mechanisms and recent progress in their applications, especially beyond genome-editing applications; (3) provide the insights on the specificity, efficiency and versatility of each tool; (4) elaborate the enhancement on specificity and efficiency of the CRISPR/Cas toolbox. The expanding and concerted usage of the CRISPR/Cas tools is making them more powerful in genome editing and other biotechnology applications.},
}
@article {pmid30451839,
year = {2018},
author = {Bolukbasi, MF and Liu, P and Luk, K and Kwok, SF and Gupta, A and Amrani, N and Sontheimer, EJ and Zhu, LJ and Wolfe, SA},
title = {Orthogonal Cas9-Cas9 chimeras provide a versatile platform for genome editing.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4856},
pmid = {30451839},
issn = {2041-1723},
support = {R01 AI117839/AI/NIAID NIH HHS/United States ; R01 GM115911/GM/NIGMS NIH HHS/United States ; R01 HL093766/HL/NHLBI NIH HHS/United States ; },
mesh = {Bacterial Proteins/*genetics/metabolism ; *Base Sequence ; *CRISPR-Cas Systems ; Carrier Proteins/genetics/metabolism ; Endonucleases/*genetics/metabolism ; Gene Editing/*methods ; Genetic Engineering ; Genome, Human ; HEK293 Cells ; Humans ; Jurkat Cells ; K562 Cells ; Mutant Chimeric Proteins/*genetics/metabolism ; Neisseria meningitidis/enzymology/genetics ; Nuclear Proteins/genetics/metabolism ; *Sequence Deletion ; Staphylococcus aureus/enzymology/genetics ; },
abstract = {The development of robust, versatile and accurate toolsets is critical to facilitate therapeutic genome editing applications. Here we establish RNA-programmable Cas9-Cas9 chimeras, in single- and dual-nuclease formats, as versatile genome engineering systems. In both of these formats, Cas9-Cas9 fusions display an expanded targeting repertoire and achieve highly specific genome editing. Dual-nuclease Cas9-Cas9 chimeras have distinct advantages over monomeric Cas9s including higher target site activity and the generation of predictable precise deletion products between their target sites. At a therapeutically relevant site within the BCL11A erythroid enhancer, Cas9-Cas9 nucleases produced precise deletions that comprised up to 97% of all sequence alterations. Thus Cas9-Cas9 chimeras represent an important tool that could be particularly valuable for therapeutic genome editing applications where a precise cleavage position and defined sequence end products are desirable.},
}
@article {pmid30451675,
year = {2018},
author = {Croteau, FR and Rousseau, GM and Moineau, S},
title = {[The CRISPR-Cas system: beyond genome editing].},
journal = {Medecine sciences : M/S},
volume = {34},
number = {10},
pages = {813-819},
doi = {10.1051/medsci/2018215},
pmid = {30451675},
issn = {1958-5381},
abstract = {CRISPR-Cas is an adaptive immune system used by many microbes to defend against nucleic acids invasion such as viral genomes. The microbial system uses its CRISPR locus to store genetic information that will generate short CRISPR RNAs. The latter with endonucleases (Cas) prevent future viral infections. Parts of this system were exploited to develop a powerful genome editing tool that was adapted for a variety of organisms. The ability of the CRISPR-Cas9 technology to effectively and precisely cut a targeted genomic DNA region has the potential to may be one day cure genetic diseases. The malleability of this editing tool also offers a wide range of possibilities from modulations of gene expression to epigenetic modifications. The natural CRISPR loci found in bacteria can be used to differentiate microbial strains or to study the interactions between bacteria and its habitat. Addressing CRISPR-Cas fundamentals in microbes and its popular use in eukaryotes, this review presents an update on a system that has revolutionized biological sciences.},
}
@article {pmid30446870,
year = {2018},
author = {Liu, Q and Wang, C and Jiao, X and Zhang, H and Song, L and Li, Y and Gao, C and Wang, K},
title = {Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems.},
journal = {Science China. Life sciences},
volume = {},
number = {},
pages = {},
doi = {10.1007/s11427-018-9402-9},
pmid = {30446870},
issn = {1869-1889},
abstract = {The CRISPR/Cas system has been extensively applied to make precise genetic modifications in various organisms. Despite its importance and widespread use, large-scale mutation screening remains time-consuming, labour-intensive and costly. Here, we developed Hi-TOM (available at https://doi.org/www.hi-tom.net/hi-tom/), an online tool to track the mutations with precise percentage for multiple samples and multiple target sites. We also described a corresponding next-generation sequencing (NGS) library construction strategy by fixing the bridge sequences and barcoding primers. Analysis of the samples from rice, hexaploid wheat and human cells reveals that the Hi-TOM tool has high reliability and sensitivity in tracking various mutations, especially complex chimeric mutations frequently induced by genome editing. Hi-TOM does not require special design of barcode primers, cumbersome parameter configuration or additional data analysis. Thus, the streamlined NGS library construction and comprehensive result output make Hi-TOM particularly suitable for high-throughput identification of all types of mutations induced by CRISPR/Cas systems.},
}
@article {pmid30446639,
year = {2018},
author = {Wang, H and Shi, Y and Wang, L and Liu, S and Wu, S and Yang, Y and Feyereisen, R and Wu, Y},
title = {CYP6AE gene cluster knockout in Helicoverpa armigera reveals role in detoxification of phytochemicals and insecticides.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4820},
pmid = {30446639},
issn = {2041-1723},
mesh = {Animals ; Base Sequence ; CRISPR-Associated Protein 9/genetics/metabolism ; CRISPR-Cas Systems ; Cytochrome P-450 Enzyme System/deficiency/*genetics ; Embryo, Nonmammalian ; Female ; Gene Editing/methods ; Gene Expression ; *Genome, Insect ; Inactivation, Metabolic/*genetics ; Insect Proteins/deficiency/*genetics ; Insecticide Resistance/*genetics ; Insecticides/*metabolism/pharmacology ; Larva/drug effects/enzymology/genetics/growth &amp; development ; Lethal Dose 50 ; Male ; Moths/drug effects/enzymology/*genetics/growth &amp; development ; Multigene Family ; Mutation ; RNA, Guide/genetics/metabolism ; Reverse Genetics ; },
abstract = {The cotton bollworm Helicoverpa armigera, is one of the world's major pest of agriculture, feeding on over 300 hosts in 68 plant families. Resistance cases to most insecticide classes have been reported for this insect. Management of this pest in agroecosystems relies on a better understanding of how it copes with phytochemical or synthetic toxins. We have used genome editing to knock out a cluster of nine P450 genes and show that this significantly reduces the survival rate of the insect when exposed to two classes of host plant chemicals and two classes of insecticides. Functional expression of all members of this gene cluster identified the P450 enzymes capable of metabolism of these xenobiotics. The CRISPR-Cas9-based reverse genetics approach in conjunction with in vitro metabolism can rapidly identify the contributions of insect P450s in xenobiotic detoxification and serve to identify candidate genes for insecticide resistance.},
}
@article {pmid30444997,
year = {2018},
author = {Mo, CY and Marraffini, LA},
title = {If You'd Like to Stop a Type III CRISPR Ribonuclease, Then You Should Put a Ring (Nuclease) on It.},
journal = {Molecular cell},
volume = {72},
number = {4},
pages = {608-609},
doi = {10.1016/j.molcel.2018.10.048},
pmid = {30444997},
issn = {1097-4164},
abstract = {Athukoralage et al. (2018) identify a new class of nuclease that degrades cyclic oligoadenylate (cOA), a second messenger that activates non-specific RNA degradation by the type III CRISPR-Cas accessory RNase Csm6/Csx1. This discovery provides a mechanism for regulating the degradation of foreign transcripts during the type III CRISPR immune response.},
}
@article {pmid30443021,
year = {2018},
author = {Riad, A and Zeng, C and Weng, CC and Winters, H and Xu, K and Makvandi, M and Metz, T and Carlin, S and Mach, RH},
title = {Sigma-2 Receptor/TMEM97 and PGRMC-1 Increase the Rate of Internalization of LDL by LDL Receptor through the Formation of a Ternary Complex.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16845},
pmid = {30443021},
issn = {2045-2322},
abstract = {CRISPR/Cas gene studies were conducted in HeLa cells where either PGRMC1, TMEM97 or both proteins were removed via gene editing. A series of radioligand binding studies, confocal microscopy studies, and internalization of radiolabeled or fluorescently tagged LDL particles were then conducted in these cells. The results indicate that PGRMC1 knockout (KO) did not reduce the density of binding sites for the sigma-2 receptor (σ2R) radioligands, [125I]RHM-4 or [3H]DTG, but a reduction in the receptor affinity of both radioligands was observed. TMEM97 KO resulted in a complete loss of binding of [125I]RHM-4 and a significant reduction in binding of [3H]DTG. TMEM97 KO and PGRMC1 KO resulted in an equal reduction in the rate of uptake of fluorescently-tagged or 3H-labeled LDL, and knocking out both proteins did not result in a further rate of reduction of LDL uptake. Confocal microscopy and Proximity Ligation Assay studies indicated a clear co-localization of LDLR, PGRMC1 and TMEM97. These data indicate that the formation of a ternary complex of LDLR-PGRMC1-TMEM97 is necessary for the rapid internalization of LDL by LDLR.},
}
@article {pmid30442934,
year = {2018},
author = {Lee, HK and Willi, M and Miller, SM and Kim, S and Liu, C and Liu, DR and Hennighausen, L},
title = {Targeting fidelity of adenine and cytosine base editors in mouse embryos.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4804},
pmid = {30442934},
issn = {2041-1723},
support = {R01 EB022376/EB/NIBIB NIH HHS/United States ; R35 GM118062/GM/NIGMS NIH HHS/United States ; RM1 HG009490/HG/NHGRI NIH HHS/United States ; U01 AI142756/AI/NIAID NIH HHS/United States ; },
mesh = {Adenine/*metabolism ; Alleles ; Animals ; Animals, Genetically Modified ; CRISPR-Associated Protein 9/genetics/metabolism ; *CRISPR-Cas Systems ; Cytosine/*metabolism ; Embryo, Mammalian ; Gene Editing/*methods ; Genetic Loci ; Mice ; Microinjections ; *Point Mutation ; RNA, Guide/genetics/metabolism ; Reproducibility of Results ; Sensitivity and Specificity ; Zygote ; },
abstract = {Base editing directly converts a target base pair into a different base pair in the genome of living cells without introducing double-stranded DNA breaks. While cytosine base editors (CBE) and adenine base editors (ABE) are used to install and correct point mutations in a wide range of organisms, the extent and distribution of off-target edits in mammalian embryos have not been studied in detail. We analyze on-target and proximal off-target editing at 13 loci by a variety of CBEs and ABE in more than 430 alleles generated from mouse zygotic injections using newly generated and published sequencing data. ABE predominantly generates anticipated A•T-to-G•C edits. Among CBEs, SaBE3 and BE4, result in the highest frequencies of anticipated C•G-to-T•A products relative to editing byproducts. Together, these findings highlight the remarkable fidelity of ABE in mouse embryos and identify preferred CBE variants when fidelity in vivo is critical.},
}
@article {pmid30442929,
year = {2018},
author = {Koh, B and Abdul Qayum, A and Srivastava, R and Fu, Y and Ulrich, BJ and Janga, SC and Kaplan, MH},
title = {A conserved enhancer regulates Il9 expression in multiple lineages.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4803},
pmid = {30442929},
issn = {2041-1723},
support = {R01 AI129241/AI/NIAID NIH HHS/United States ; P30 CA082709/CA/NCI NIH HHS/United States ; R03 AI135356/AI/NIAID NIH HHS/United States ; U54 DK106846/DK/NIDDK NIH HHS/United States ; T32 DK007519/DK/NIDDK NIH HHS/United States ; R01 AI057459/AI/NIAID NIH HHS/United States ; },
mesh = {Animals ; Binding Sites ; CRISPR-Cas Systems ; Cell Differentiation ; Cell Lineage/genetics/*immunology ; Conserved Sequence ; *Enhancer Elements, Genetic ; Female ; Gene Editing ; Gene Expression Regulation ; Humans ; Interleukin-9/*genetics/immunology ; Male ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Primary Cell Culture ; Protein Binding ; T-Lymphocytes, Helper-Inducer/cytology/*immunology ; Transcription Factors/*genetics/immunology ; },
abstract = {Cytokine genes are regulated by multiple regulatory elements that confer tissue-specific and activation-dependent expression. The cis-regulatory elements of the gene encoding IL-9, a cytokine that promotes allergy, autoimmune inflammation and tumor immunity, have not been defined. Here we identify an enhancer (CNS-25) upstream of the Il9 gene that binds most transcription factors (TFs) that promote Il9 gene expression. Deletion of the enhancer in the mouse germline alters transcription factor binding to the remaining Il9 regulatory elements, and results in diminished IL-9 production in multiple cell types including Th9 cells, and attenuates IL-9-dependent immune responses. Moreover, deletion of the homologous enhancer (CNS-18) in primary human Th9 cultures results in significant decrease of IL-9 production. Thus, Il9 CNS-25/IL9 CNS-18 is a critical and conserved regulatory element for IL-9 production.},
}
@article {pmid30429256,
year = {2018},
author = {Strich, JR and Chertow, DS},
title = {CRISPR-Cas Biology and Infectious Diseases Applications.},
journal = {Journal of clinical microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1128/JCM.01307-18},
pmid = {30429256},
issn = {1098-660X},
abstract = {Infectious diseases remain a global threat contributing to excess morbidity and mortality annually with persistent potential for destabilizing pandemics. Improved understanding of the pathogenesis of bacteria, viruses, fungi, and parasites, along with rapid diagnosis and treatment of human infections are essential to improving infectious diseases outcomes worldwide. Genomic loci in bacteria and archea, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) proteins, function as an adaptive immune system for prokaryotes protecting against foreign invaders. CRISPR-Cas9 is now routinely applied for efficient gene editing contributing to advances in biomedical science. In the past decade improved understanding of other diverse CRISPR-Cas systems has expanded CRISPR applications, including in the field of infectious diseases. In this review, we summarize the biology of CRISPR-Cas systems and discuss existing and emerging applications to evaluate mechanisms of host-pathogen interactions, to develop accurate and portable diagnostics, and to advance prevention and treatment of infectious diseases.},
}
@article {pmid30426198,
year = {2018},
author = {Hahn, F and Nekrasov, V},
title = {CRISPR/Cas precision: do we need to worry about off-targeting in plants?.},
journal = {Plant cell reports},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00299-018-2355-9},
pmid = {30426198},
issn = {1432-203X},
support = {BB/P016855/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
abstract = {The CRISPR/Cas technology has recently become the tool of choice for targeted genome modification in plants and beyond. Although CRSIPR/Cas offers a rapid and facile way of introducing changes at genomic loci of interest, its application is associated with off-targeting, i.e. introduction of unintended mutations at off-target sites within the genome, which has been reported frequently in the mammalian field. Here we summarise the current knowledge on the precision of CRISPR/Cas in plant systems and provide a summary of state-of the-art strategies for avoiding off-target mutations, as well as unintended on-target changes, in plants. These include using natural (e.g. Cas12a) or engineered (e.g. SpCas9-HF) CRISPR/Cas nucleases characterised by higher precision, as compared to the commonly used wild type SpCas9. In addition, we discuss the usage of CRISPR/Cas nucleases in the form of ribonucleoproteins (RNPs) as an option for reducing off-targeting in plants. Finally, we conclude that the most important factor for reducing CRISPR/Cas off-targeting remains careful selection of target sequences, for which we provide an overview of available online software tools and experimental guidance.},
}
@article {pmid30425154,
year = {2018},
author = {Høyland-Kroghsbo, NM and Muñoz, KA and Bassler, BL},
title = {Temperature, by Controlling Growth Rate, Regulates CRISPR-Cas Activity in Pseudomonas aeruginosa.},
journal = {mBio},
volume = {9},
number = {6},
pages = {},
pmid = {30425154},
issn = {2150-7511},
support = {R37 GM065859/GM/NIGMS NIH HHS/United States ; },
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR)-associated (CRISPR-Cas) systems are adaptive defense systems that protect bacteria and archaea from invading genetic elements. In Pseudomonas aeruginosa, quorum sensing (QS) induces the CRISPR-Cas defense system at high cell density when the risk of bacteriophage infection is high. Here, we show that another cue, temperature, modulates P. aeruginosa CRISPR-Cas. Increased CRISPR adaptation occurs at environmental (i.e., low) temperatures compared to that at body (i.e., high) temperature. This increase is a consequence of the accumulation of CRISPR-Cas complexes, coupled with reduced P. aeruginosa growth rate at the lower temperature, the latter of which provides additional time prior to cell division for CRISPR-Cas to patrol the cell and successfully eliminate and/or acquire immunity to foreign DNA. Analyses of a QS mutant and synthetic QS compounds show that the QS and temperature cues act synergistically. The diversity and level of phage encountered by P. aeruginosa in the environment exceed that in the human body, presumably warranting increased reliance on CRISPR-Cas at environmental temperatures.IMPORTANCEP. aeruginosa is a soil dwelling bacterium and a plant pathogen, and it also causes life-threatening infections in humans. Thus, P. aeruginosa thrives in diverse environments and over a broad range of temperatures. Some P. aeruginosa strains rely on the CRISPR-Cas adaptive immune system as a phage defense mechanism. Our discovery that low temperatures increase CRISPR adaptation suggests that the rarely occurring but crucial naive adaptation events may take place predominantly under conditions of slow growth, e.g., during the bacterium's soil dwelling existence and during slow growth in biofilms.},
}
@article {pmid30418590,
year = {2018},
author = {Gordeeva, J and Morozova, N and Sierro, N and Isaev, A and Sinkunas, T and Tsvetkova, K and Matlashov, M and Truncaite, L and Morgan, RD and Ivanov, NV and Siksnys, V and Zeng, L and Severinov, K},
title = {BREX system of Escherichia coli distinguishes self from non-self by methylation of a specific DNA site.},
journal = {Nucleic acids research},
volume = {},
number = {},
pages = {},
doi = {10.1093/nar/gky1125},
pmid = {30418590},
issn = {1362-4962},
abstract = {Prokaryotes evolved numerous systems that defend against predation by bacteriophages. In addition to well-known restriction-modification and CRISPR-Cas immunity systems, many poorly characterized systems exist. One class of such systems, named BREX, consists of a putative phosphatase, a methyltransferase and four other proteins. A Bacillus cereus BREX system provides resistance to several unrelated phages and leads to modification of specific motif in host DNA. Here, we study the action of BREX system from a natural Escherichia coli isolate. We show that while it makes cells resistant to phage λ infection, induction of λ prophage from cells carrying BREX leads to production of viruses that overcome the defense. The induced phage DNA contains a methylated adenine residue in a specific motif. The same modification is found in the genome of BREX-carrying cells. The results establish, for the first time, that immunity to BREX system defense is provided by an epigenetic modification.},
}
@article {pmid30418108,
year = {2018},
author = {Aung, MS and San, T and San, N and Oo, WM and Ko, PM and Thet, KT and Urushibara, N and Kawaguchiya, M and Sumi, A and Kobayashi, N},
title = {Molecular characterization of Staphylococcus argenteus in Myanmar: identification of novel genotypes/clusters in staphylocoagulase, protein A, alpha-haemolysin and other virulence factors.},
journal = {Journal of medical microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1099/jmm.0.000869},
pmid = {30418108},
issn = {1473-5644},
abstract = {PURPOSE: Staphylococcus argenteus is a novel emerging species of coagulase-positive staphylococcus that is genetically closely related to Staphylococcus aureus. To elucidate the molecular differences in the virulence factors (staphylocoagulase, protein A, alpha-haemolysin, enterotoxin-like toxin and staphylokinase) between these staphylococcal species, S. argenteus that had recently been isolated in Myanmar (five nasal isolates and four clinical isolates) were analysed.<br><br>METHODOLOGY: The nucleotide sequences of the virulence factors were determined by PCR and direct sequencing, followed by phylogenetic analysis by mega6 and multiple alignment by clustalw using the published sequence data for S. aureus and S. argenteus.<br><br>RESULTS: Six S. argenteus isolates belonged to MLST sequence type (ST) 2250, while others belonged to ST4625, ST2198 and ST2854. The novel staphylocoagulase (coa) genotype XIV and the novel coa-XI subtype (XId) were identified in an ST2198 isolate and all other isolates, respectively. Among the S. argenteus isolates, the protein A and alpha-haemolysin genes showed high sequence identity (96-98 % and >99 %, respectively), while lower identity was observed between S. argenteus and S. aureus (88-91 % and 86 %, respectively), with both species showing phylogenetically distinct clusters. Similar findings were found for the staphylococcal enterotoxin (SE)-like toxin genes selw, selx and sely. In contrast, the staphylokinase genes were almost identical between these two species. All of the coa-XId isolates had a CRISPR/Cas locus at the site of orfX without having SCCmec, whereas an ST2198 isolate lacked this locus.<br><br>CONCLUSION: The primary virulence factors (staphylocoagulase, protein A andalpha-haemolysin) as well as the SE-like toxins of S. argenteus were genetically discriminated from those of S. aureus, revealing the presence of the novel coa-type/subtype (coa-IXd, XIV) in S. argenteus.},
}
@article {pmid30417194,
year = {2018},
author = {Liu, BY and He, XY and Zhuo, RX and Cheng, SX},
title = {Reversal of tumor malignization and modulation of cell behaviors through genome editing mediated by a multi-functional nanovector.},
journal = {Nanoscale},
volume = {10},
number = {45},
pages = {21209-21218},
doi = {10.1039/c8nr07321j},
pmid = {30417194},
issn = {2040-3372},
mesh = {Aptamers, Nucleotide/*chemistry/metabolism ; CRISPR-Cas Systems/genetics ; Cell Movement ; Cell Survival ; Drug Carriers/chemistry ; Focal Adhesion Protein-Tyrosine Kinases/deficiency/genetics ; Gene Editing/*methods ; HEK293 Cells ; HeLa Cells ; Humans ; Microscopy, Confocal ; Mucin-1/genetics/metabolism ; Nanoparticles/*chemistry ; Oligodeoxyribonucleotides/chemistry/metabolism ; Plasmids/chemistry/metabolism ; Tumor Suppressor Protein p53/genetics/metabolism ; },
abstract = {To effectively reverse tumor malignization by genome editing, a multi-functional self-assembled nanovector for the delivery of a genome editing plasmid specifically to tumor cells was developed. The nanovector core consisting of protamine and calcium carbonate entrapping the CRISPR-Cas9 plasmid is decorated by aptamer incorporated heparin. Owing to a high affinity between a MUC1 specific aptamer and mucin 1 (MUC1) overexpressed in tumor cells as well as the interaction between AS1411 and nucleolin on the tumor cell surface and cell nuclei, the nanovector can target the nuclei of tumorous cells for the knockout of focal adhesion kinase (FAK). Notably, the genome editing mediated by our delivery systems can effectively modulate cell behaviors and thus reverse tumor malignization. Up-regulated p53, p16, p21, E-cadherin, CD80, MICA, MICB and Fas, together with down-regulated MMP-9, vimentin, VEGF, TGF-β, CD47 and CD133 in genome edited cells indicate that the genome editing system can inhibit cancerous cell growth, prevent tumor invasion and metastasis, reverse tumor-induced immune suppression, and inhibit cancer stemness. More importantly, the edited cells can maintain the modulated cellular function after succeeding subcultures.},
}
@article {pmid30413649,
year = {2018},
author = {Li, CJ and Jiang, C and Liu, Y and Bell, T and Ma, W and Ye, Y and Huang, S and Guo, H and Zhang, H and Wang, L and Wang, J and Nomie, K and Zhang, L and Wang, M},
title = {Pleiotropic Action of Novel Bruton's Tyrosine Kinase Inhibitor BGB-3111 in Mantle Cell Lymphoma.},
journal = {Molecular cancer therapeutics},
volume = {},
number = {},
pages = {},
doi = {10.1158/1535-7163.MCT-18-0478},
pmid = {30413649},
issn = {1538-8514},
support = {P30 CA016672/CA/NCI NIH HHS/United States ; R21 CA202104/CA/NCI NIH HHS/United States ; },
abstract = {Bruton's tyrosine kinase (BTK) is a key mediator of BCR-dependent cell growth signaling and a clinically effective therapeutic target in mantle cell lymphoma (MCL). The molecular impact of BTK inhibition remains unclear particularly in hematopoietic malignancies. We analyzed the molecular mechanisms of BTK inhibition with the novel inhibitor BGB-3111 (zanubrutinib) in MCL models. The efficacy of BGB-3111 was investigated using growth proliferation/cell viability and apoptosis assays in MCL cell lines and patient-derived xenograft (PDX) MCL cells. The activity and mechanisms of BGB-3111 were further confirmed using a cell line xenograft model, an MCL PDX mouse model, and a human phosphokinase profiler array and reverse phase protein array. Lastly, the mechanisms related to resistance to BTK inhibition were analyzed by creating cell lines with low levels of BTK using CRISPR/Cas 9 genome editing. We found that inhibition of BTK leads to suppression of tumor growth, which was mediated via potent suppression of Akt/mTOR, apoptosis, and metabolic stress. Moreover, targeted disruption of the BTK gene in MCL cells resulted in resistance to BTK inhibition and the emergence of novel survival mechanisms. Our studies suggest a general efficacy of BTK inhibition in MCL and potential drug resistance mechanism via alternative signaling pathways.},
}
@article {pmid30397647,
year = {2018},
author = {Chatterjee, P and Jakimo, N and Jacobson, JM},
title = {Minimal PAM specificity of a highly similar SpCas9 ortholog.},
journal = {Science advances},
volume = {4},
number = {10},
pages = {eaau0766},
pmid = {30397647},
issn = {2375-2548},
abstract = {RNA-guided DNA endonucleases of the CRISPR-Cas system are widely used for genome engineering and thus have numerous applications in a wide variety of fields. CRISPR endonucleases, however, require a specific protospacer adjacent motif (PAM) flanking the target site, thus constraining their targetable sequence space. In this study, we demonstrate the natural PAM plasticity of a highly similar, yet previously uncharacterized, Cas9 from Streptococcus canis (ScCas9) through rational manipulation of distinguishing motif insertions. To this end, we report affinity to minimal 5'-NNG-3' PAM sequences and demonstrate the accurate editing capabilities of the ortholog in both bacterial and human cells. Last, we build an automated bioinformatics pipeline, the Search for PAMs by ALignment Of Targets (SPAMALOT), which further explores the microbial PAM diversity of otherwise overlooked Streptococcus Cas9 orthologs. Our results establish that ScCas9 can be used both as an alternative genome editing tool and as a functional platform to discover novel Streptococcus PAM specificities.},
}
@article {pmid30397343,
year = {2019},
author = {Özcan, A and Pausch, P and Linden, A and Wulf, A and Schühle, K and Heider, J and Urlaub, H and Heimerl, T and Bange, G and Randau, L},
title = {Type IV CRISPR RNA processing and effector complex formation in Aromatoleum aromaticum.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {89-96},
doi = {10.1038/s41564-018-0274-8},
pmid = {30397343},
issn = {2058-5276},
abstract = {Type IV CRISPR-Cas modules belong to class 1 prokaryotic adaptive immune systems, which are defined by the presence of multisubunit effector complexes. They usually lack the known Cas proteins involved in adaptation and target cleavage, and their function has not been experimentally addressed. To investigate RNA and protein components of this CRISPR-Cas type, we located a complete type IV cas gene locus and an adjacent CRISPR array on a megaplasmid of Aromatoleum aromaticum EbN1, which contains an additional type I-C system on its chromosome. RNA sequencing analyses verified CRISPR RNA (crRNA) production and maturation for both systems. Type IV crRNAs were shown to harbour unusually short 7 nucleotide 5'-repeat tags and stable 3' hairpin structures. A unique Cas6 variant (Csf5) was identified that generates crRNAs that are specifically incorporated into type IV CRISPR-ribonucleoprotein (crRNP) complexes. Structures of RNA-bound Csf5 were obtained. Recombinant production and purification of the type IV Cas proteins, together with electron microscopy, revealed that Csf2 acts as a helical backbone for type IV crRNPs that include Csf5, Csf3 and a large subunit (Csf1). Mass spectrometry analyses identified protein-protein and protein-RNA contact sites. These results highlight evolutionary connections between type IV and type I CRISPR-Cas systems and demonstrate that type IV CRISPR-Cas systems employ crRNA-guided effector complexes.},
}
@article {pmid30394685,
year = {2018},
author = {Li, P and Fu, X and Zhang, L and Li, S},
title = {CRISPR/Cas-based screening of a gene activation library in Saccharomyces cerevisiae identifies a crucial role of OLE1 in thermotolerance.},
journal = {Microbial biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1751-7915.13333},
pmid = {30394685},
issn = {1751-7915},
support = {21506113//National Natural Science Foundation of China/ ; 31470229//National Natural Science Foundation of China/ ; 31600067//National Natural Science Foundation of China/ ; 2016YFE0108500//National Key R&amp;D Program of China/ ; 2017T100064//China Postdoctoral Science Foundation/ ; 2015M581074//China Postdoctoral Science Foundation/ ; },
abstract = {CRISPR/Cas-based (clustered regularly interspaced short palindromic repeats/CRISPR-associated) screening has been proved to be an efficient method to study functional genomics from yeast to human. In this study, we report the development of a focused CRISPR/Cas-based gene activation library in Saccharomyces cerevisiae and its application in gene identification based on functional screening towards improved thermotolerance. The gene activation library was subjected to screening at 42°C, and the same library cultured at 30°C was set as a control group. After five successive subcultures, five clones were randomly picked from the libraries cultured at 30 and 42°C, respectively. The five clones selected at 30°C contain the specificity sequences of five different single guide RNAs, whereas all the five clones selected at 42°C contain the specificity sequence of one sgRNA that targets the promoter region of OLE1. A crucial role of OLE1 in thermotolerance was identified: the overexpression of OLE1 increased fatty acid unsaturation, and thereby helped counter lipid peroxidation caused by heat stress, rendering the yeast thermotolerant. This study described the application of CRISPR/Cas-based gene activation screening with an example of thermotolerant yeast screening, demonstrating that this method can be used to identify functional genes in yeast.},
}
@article {pmid30394652,
year = {2018},
author = {Borton, MA and Daly, RA and O'Banion, B and Hoyt, DW and Marcus, DN and Welch, S and Hastings, SS and Meulia, T and Wolfe, RA and Booker, AE and Sharma, S and Cole, DR and Wunch, K and Moore, JD and Darrah, TH and Wilkins, MJ and Wrighton, KC},
title = {Comparative genomics and physiology of the genus Methanohalophilus, a prevalent methanogen in hydraulically fractured shale.},
journal = {Environmental microbiology},
volume = {20},
number = {12},
pages = {4596-4611},
doi = {10.1111/1462-2920.14467},
pmid = {30394652},
issn = {1462-2920},
support = {1342701//National Science Foundation Dimensions of Biodiversity/ ; FE0024297//Department of Energy's National Energy Technology Laboratory/ ; //U.S. Department of Energy Joint Genome Institute/ ; DE-AC02-05CH11231//Office of Science of the U.S. Department of Energy/ ; },
abstract = {About 60% of natural gas production in the United States comes from hydraulic fracturing of unconventional reservoirs, such as shales or organic-rich micrites. This process inoculates and enriches for halotolerant microorganisms in these reservoirs over time, resulting in a saline ecosystem that includes methane producing archaea. Here, we survey the biogeography of methanogens across unconventional reservoirs, and report that members of genus Methanohalophilus are recovered from every hydraulically fractured unconventional reservoir sampled by metagenomics. We provide the first genomic sequencing of three isolate genomes, as well as two metagenome assembled genomes (MAGs). Utilizing six other previously sequenced isolate genomes and MAGs, we perform comparative analysis of the 11 genomes representing this genus. This genomic investigation revealed distinctions between surface and subsurface derived genomes that are consistent with constraints encountered in each environment. Genotypic differences were also uncovered between isolate genomes recovered from the same well, suggesting niche partitioning among closely related strains. These genomic substrate utilization predictions were then confirmed by physiological investigation. Fine-scale microdiversity was observed in CRISPR-Cas systems of Methanohalophilus, with genomes from geographically distinct unconventional reservoirs sharing spacers targeting the same viral population. These findings have implications for augmentation strategies resulting in enhanced biogenic methane production in hydraulically fractured unconventional reservoirs.},
}
@article {pmid30394044,
year = {2018},
author = {Ali, S and Park, SK and Kim, WC},
title = {The pragmatic introduction and expression of microbial transgenes in plants.},
journal = {Journal of microbiology and biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.4014/jmb.1808.08029},
pmid = {30394044},
issn = {1738-8872},
abstract = {Several genetic strategies have been proposed for the successful transformation and expression of microbial transgenes in model and crop plants. Here, we bring into focus the prominent applications of microbial transgenes in plants for the development of disease resistance; mitigation of stress conditions; augmentation of food quality; and use of plants as &quot;bioreactors&quot; for the production of recombinant proteins, industrially important enzymes, vaccines, antimicrobial compounds, and other valuable secondary metabolites. We discuss the applicable and cost-effective approaches of transgenesis in different plants, as well as the limitations thereof. We subsequently present the contemporary developments in targeted genome editing systems that have facilitated the process of genetic modification and manifested stable and consumer-friendly genetically modified plants and their products. Finally, this article presents the different approaches and demonstrates the introduction and expression of microbial transgenes for the improvement of plant resistance to pathogens and abiotic stress conditions and the production of valuable compounds, together with the promising research progress in targeted genome editing technology. We include a special discussion on the highly efficient CRISPR-Cas system helpful in microbial transgene editing in plants.},
}
@article {pmid30393777,
year = {2018},
author = {Zhang, F and Zhao, S and Ren, C and Zhu, Y and Zhou, H and Lai, Y and Zhou, F and Jia, Y and Zheng, K and Huang, Z},
title = {CRISPRminer is a knowledge base for exploring CRISPR-Cas systems in microbe and phage interactions.},
journal = {Communications biology},
volume = {1},
number = {},
pages = {180},
pmid = {30393777},
issn = {2399-3642},
abstract = {CRISPR-Cas systems not only play key roles in prokaryotic acquired immunity, but can also be adapted as powerful genome editing tools. Understanding the native role of CRISPR-Cas systems in providing adaptive immunity can lead to new CRISPR-based technologies. Here, we develop CRISPRminer, a knowledge base and web server to comprehensively collect and investigate the knowledge of CRISPR-Cas systems and generate instructive annotations, including CRISPR arrays and Cas protein annotation, CRISPR-Cas system classification, self-targeting events detection, microbe-phage interaction inference, and anti-CRISPR annotation. CRISPRminer is user-friendly and freely available at http://www.microbiome-bigdata.com/CRISPRminer.},
}
@article {pmid30393194,
year = {2019},
author = {Hussain, W and Mahmood, T and Hussain, J and Ali, N and Shah, T and Qayyum, S and Khan, I},
title = {CRISPR/Cas system: A game changing genome editing technology, to treat human genetic diseases.},
journal = {Gene},
volume = {685},
number = {},
pages = {70-75},
doi = {10.1016/j.gene.2018.10.072},
pmid = {30393194},
issn = {1879-0038},
abstract = {Genes, are the functional units of heredity that used as an instructors to make proteins either to become the functional or structural part of the cell. Hence, the proteins get more attention because most of the life functions depends on it. Any mutation or alteration in genome sequences results in complete loss of function or formation of abnormal protein which leads to hereditary disorder. Gene therapy on the other hand, used as a remedy, a process that make correction in the gene which is responsible for genomic disorders. The treatment of disease state depends on the understanding of their genetic basis. While, numerous molecular genome editing tools have been developed and are being utilized to translate the abstract of gene therapy into reality, but the problem is still a mystery. The genome editing molecular scissors can be applied to dictate the selected genetic products that can have the therapeutic power. Thus, editing the specific sequences depends on the type of strategies being used by a molecule such is HDR or NHEJ. CRISPR/Cas9 editing technology can use in disease model to study the genitival disorders. One side the CRISPR technology seemed to be extremely accurate but on the other side it has some harmful effects i.e. Cas9 proteins sometimes cuts the similar sequences other than the specific targeted and Off-targeting Sequences etc. Urgent attention and improvement are needed for various implication of CRISPR/Cas9 technology, including the delivery, precision and control over the mention system. This review presents the current scenario of genome editing in vivo and its implications for the future of human genetic disease treatment as well as genome throughput potency.},
}
@article {pmid30391232,
year = {2018},
author = {Chen, H and Li, Y and Du, C and Li, Y and Zhao, J and Zheng, X and Mao, Q and Xia, H},
title = {Aptazyme-mediated direct modulation of post-transcriptional sgRNA level for conditional genome editing and gene expression.},
journal = {Journal of biotechnology},
volume = {288},
number = {},
pages = {23-29},
doi = {10.1016/j.jbiotec.2018.10.011},
pmid = {30391232},
issn = {1873-4863},
abstract = {RNA-guided endonuclease Cas9 derived from microbial CRISPR-Cas adaptive immune systems is a powerful tool for genome editing, which has been widely used in eukaryotic systems, prokaryotic systems, and plants. However, the off-target effects caused by Cas9/sgRNA remain a major concern. Currently, the efforts to reduce the off-target effects mainly focus on improving the targeting specificity of sgRNA/Cas9, regulating the activity of the Cas9 protein or the sgRNA, and controlling the time window of their expression. In this study, a novel system was established to regulate the post-transcriptional sgRNA level by small molecule-controlled aptazyme. This system was shown to reduce the off-target effects caused by Cas9/sgRNA, while enabling precise temporal control over gene editing and regulatory activity. This new system could provide a potentially safer and more powerful tool for genome editing and therapeutic application.},
}
@article {pmid30389787,
year = {2018},
author = {Lynch, JM and Li, B and Katoli, P and Xiang, C and Leehy, B and Rangaswamy, N and Saenz-Vash, V and Wang, YK and Lei, H and Nicholson, TB and Meredith, E and Rice, D and Prasanna, G and Chen, A},
title = {Binding of a glaucoma-associated myocilin variant to the αB-crystallin chaperone impedes protein clearance in trabecular meshwork cells.},
journal = {The Journal of biological chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1074/jbc.RA118.004325},
pmid = {30389787},
issn = {1083-351X},
abstract = {Myocilin (MYOC) was discovered more than 20 years ago and is the gene whose mutations are most commonly observed in individuals with glaucoma. Despite extensive research efforts, the function of wild-type (wt) MYOC has remained elusive and how mutant MYOC is linked to glaucoma is unclear. Mutant MYOC is believed to be misfolded within the endoplasmic reticulum (ER), and under normal physiological conditions misfolded MYOC should be retro-translocated to the cytoplasm for degradation. To better understand mutant MYOC pathology, we CRISPR-engineered a rat to have a MYOC Y435H substitution which is the equivalent of the pathologic human MYOC Y437H mutation. Using this engineered animal model, we discovered that the chaparone αB-crystallin (CRYAB) is a MYOC-binding partner and that co-expression of these two proteins increases protein aggregates. Our results suggest that the misfolded mutant MYOC aggregates with cytoplasmic CRYAB and thereby compromises protein clearance mechanisms in trabecular meshwork cells and this process represents the primary mode of mutant MYOC pathology. We propose a model by which mutant MYOC causes glaucoma, and we propose that therapeutic treatment of patients having a MYOC mutation may focus on disrupting the MYOC-CRYAB complexes.},
}
@article {pmid30388811,
year = {2018},
author = {Dion, MB and Labrie, SJ and Shah, SA and Moineau, S},
title = {CRISPRStudio: A User-Friendly Software for Rapid CRISPR Array Visualization.},
journal = {Viruses},
volume = {10},
number = {11},
pages = {},
pmid = {30388811},
issn = {1999-4915},
support = {143924//Canadian Institutes of Health Research/Canada ; 259257//Fonds de Recherche du Québec - Nature et Technologies/ ; 950-227645//Canada Research Chairs/ ; RGPIN/05132-2014//Natural Sciences and Engineering Research Council of Canada/ ; },
abstract = {The CRISPR-Cas system biologically serves as an adaptive defense mechanism against phages. However, there is growing interest in exploiting the hypervariable nature of the CRISPR locus, often of viral origin, for microbial typing and tracking. Moreover, the spacer content of any given strain provides a phage resistance profile. Large-scale CRISPR typing studies require an efficient method for showcasing CRISPR array similarities across multiple isolates. Historically, CRISPR arrays found in microbes have been represented by colored shapes based on nucleotide sequence identity and, while this approach is now routinely used, only scarce computational resources are available to automate the process, making it very time-consuming for large datasets. To alleviate this tedious task, we introduce CRISPRStudio, a command-line tool developed to accelerate CRISPR analysis and standardize the preparation of CRISPR array figures. It first compares nucleotide spacer sequences present in a dataset and then clusters them based on sequence similarity to assign a meaningful representative color. CRISPRStudio offers versatility to suit different biological contexts by including options such as automatic sorting of CRISPR loci and highlighting of shared spacers, while remaining fast and user-friendly.},
}
@article {pmid30388409,
year = {2018},
author = {Terns, MP},
title = {CRISPR-Based Technologies: Impact of RNA-Targeting Systems.},
journal = {Molecular cell},
volume = {72},
number = {3},
pages = {404-412},
pmid = {30388409},
issn = {1097-4164},
support = {R35 GM118160/GM/NIGMS NIH HHS/United States ; },
abstract = {DNA-targeting CRISPR-Cas systems, such as those employing the RNA-guided Cas9 or Cas12 endonucleases, have revolutionized our ability to predictably edit genomes and control gene expression. Here, I summarize information on RNA-targeting CRISPR-Cas systems and describe recent advances in converting them into powerful and programmable RNA-binding and cleavage tools with a wide range of novel and important biotechnological and biomedical applications.},
}
@article {pmid30387552,
year = {2018},
author = {Kumlehn, J and Pietralla, J and Hensel, G and Pacher, M and Puchta, H},
title = {The CRISPR/Cas revolution continues: From efficient gene editing for crop breeding to plant synthetic biology.},
journal = {Journal of integrative plant biology},
volume = {60},
number = {12},
pages = {1127-1153},
doi = {10.1111/jipb.12734},
pmid = {30387552},
issn = {1744-7909},
support = {FKZ 031B0192//German Federal Ministry of Education and Research/ ; },
abstract = {Since the discovery that nucleases of the bacterial CRISPR (clustered regularly interspaced palindromic repeat)-associated (Cas) system can be used as easily programmable tools for genome engineering, their application massively transformed different areas of plant biology. In this review, we assess the current state of their use for crop breeding to incorporate attractive new agronomical traits into specific cultivars of various crop plants. This can be achieved by the use of Cas9/12 nucleases for double-strand break induction, resulting in mutations by non-homologous recombination. Strategies for performing such experiments - from the design of guide RNA to the use of different transformation technologies - are evaluated. Furthermore, we sum up recent developments regarding the use of nuclease-deficient Cas9/12 proteins, as DNA-binding moieties for targeting different kinds of enzyme activities to specific sites within the genome. Progress in base deamination, transcriptional induction and transcriptional repression, as well as in imaging in plants, is also discussed. As different Cas9/12 enzymes are at hand, the simultaneous application of various enzyme activities, to multiple genomic sites, is now in reach to redirect plant metabolism in a multifunctional manner and pave the way for a new level of plant synthetic biology.},
}
@article {pmid30386377,
year = {2018},
author = {Guzina, J and Chen, WH and Stankovic, T and Djordjevic, M and Zdobnov, E and Djordjevic, M},
title = {In silico Analysis Suggests Common Appearance of scaRNAs in Type II Systems and Their Association With Bacterial Virulence.},
journal = {Frontiers in genetics},
volume = {9},
number = {},
pages = {474},
pmid = {30386377},
issn = {1664-8021},
abstract = {In addition to its well-established defense function, CRISPR/Cas can also exhibit crucial non-canonical activity through endogenous gene expression regulation, which was found to mainly affect bacterial virulence. These non-canonical functions depend on scaRNA, which is a small RNA encoded outside of CRISPR array, that is typically flanked by a transcription start site (TSS) and a terminator, and is in part complementary to another small CRISPR/Cas-associated RNA (tracrRNAs). Identification of scaRNAs is however largely complicated by the scarcity of RNA-Seq data across different bacteria, so that they were identified only in a relatively rare CRISPR/Cas subtype (IIB), and the possibility of finding them in other Type II systems is currently unclear. This study presents the first effort toward systematic detection of small CRISPR/Cas-associated regulatory RNAs, where obtained predictions can guide future experiments. The core of our approach is ab initio detection of small RNAs from bacterial genome, which is based on jointly predicting transcription signals - TSS and terminators - and homology to CRISPR array repeat. Particularly, we employ our improved approach for detecting bacterial TSS, since accurate TSS detection is the main limiting factor for accurate small RNA prediction. We also explore how our predictions match to available RNA-Seq data and analyze their conservation across related bacterial species. In Type IIB systems, our predictions are consistent with experimental data, and we systematically identify scaRNAs throughout this subtype. Furthermore, we identify scaRNA:tracrRNA pairs in a number of IIA/IIC systems, where the appearance of scaRNAs co-occurs with the strains being pathogenic. RNA-Seq and conservation analysis show that our method is well suited for predicting CRISPR/Cas-associated small RNAs. We also find possible existence of a modified mechanism of CRISPR-associated small RNA action, which, interestingly, closely resembles the setup employed in biotechnological applications. Overall, our findings indicate that scaRNA:tracrRNA pairs are present in all subtypes of Type II systems, and point to an underlying connection with bacterial virulence. In addition to formulating these hypotheses, careful manual curation that we performed, makes an important first step toward fully automated predictor of CRISPR/Cas-associated small RNAs, which will allow their large scale analysis across diverse bacterial genomes.},
}
@article {pmid30386178,
year = {2018},
author = {Shankar, S and Sreekumar, A and Prasad, D and Das, AV and Pillai, MR},
title = {Genome editing of oncogenes with ZFNs and TALENs: caveats in nuclease design.},
journal = {Cancer cell international},
volume = {18},
number = {},
pages = {169},
pmid = {30386178},
issn = {1475-2867},
abstract = {Background: Gene knockout technologies involving programmable nucleases have been used to create knockouts in several applications. Gene editing using Zinc-finger nucleases (ZFNs), Transcription activator like effectors (TALEs) and CRISPR/Cas systems has been used to create changes in the genome in order to make it non-functional. In the present study, we have looked into the possibility of using six fingered CompoZr ZFN pair to target the E6 gene of HPV 16 genome.<br><br>Methods: HPV 16+ve cell lines; SiHa and CaSki were used for experiments. CompoZr ZFNs targeting E6 gene were designed and constructed by Sigma-Aldrich. TALENs targeting E6 and E7 genes were made using TALEN assembly kit. Gene editing was monitored by T7E1 mismatch nuclease and Nuclease resistance assays. Levels of E6 and E7 were further analyzed by RT-PCR, western blot as well as immunoflourescence analyses. To check if there is any interference due to methylation, cell lines were treated with sodium butyrate, and Nocodazole.<br><br>Results: Although ZFN editing activity in yeast based MEL-I assay was high, it yielded very low activity in tumor cell lines; only 6% editing in CaSki and negligible activity in SiHa cell lines. Though editing efficiency was better in CaSki, no significant reduction in E6 protein levels was observed in immunocytochemical analysis. Further, in silico analysis of DNA binding prediction revealed that some of the ZFN modules bound to sequence that did not match the target sequence. Hence, alternate ZFN pairs for E6 and E7 were not synthesized since no further active sites could be identified by in silico analyses. Then we designed TALENs to target E6 and E7 gene. TALENs designed to target E7 gene led to reduction of E7 levels in CaSki and SiHa cervical cancer cell lines. However, TALEN designed to target E6 gene did not yield any editing activity.<br><br>Conclusions: Our study highlights that designed nucleases intended to obtain bulk effect should have a reasonable editing activity which reflects phenotypically as well. Nucleases with low editing efficiency, intended for generation of knockout cell lines nucleases could be obtained by single cell cloning. This could serve as a criterion for designing ZFNs and TALENs.},
}
@article {pmid30385564,
year = {2018},
author = {Kofler, N and Collins, JP and Kuzma, J and Marris, E and Esvelt, K and Nelson, MP and Newhouse, A and Rothschild, LJ and Vigliotti, VS and Semenov, M and Jacobsen, R and Dahlman, JE and Prince, S and Caccone, A and Brown, T and Schmitz, OJ},
title = {Editing nature: Local roots of global governance.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6414},
pages = {527-529},
doi = {10.1126/science.aat4612},
pmid = {30385564},
issn = {1095-9203},
mesh = {Animals ; Anthozoa/genetics ; *Bioethical Issues ; *CRISPR-Cas Systems ; Conservation of Natural Resources/*methods ; Coral Reefs ; Gene Editing/*ethics/*methods ; *Gene-Environment Interaction ; },
}
@article {pmid30382180,
year = {2018},
author = {Wang, HC and Wang, P and Chen, YW and Zhang, Y},
title = {Bevacizumab or fibronectin gene editing inhibits the osteoclastogenic effects of fibroblasts derived from human radicular cysts.},
journal = {Acta pharmacologica Sinica},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41401-018-0172-x},
pmid = {30382180},
issn = {1745-7254},
abstract = {Fibronectin (FN) is a main component of extracellular matrix (ECM) in most adult tissues. Under pathological conditions, particularly inflammation, wound healing and tumors, an alternatively spliced exon extra domain A (EDA) is included in the FN protein (EDA+FN), which facilitates cellular proliferation, motility, and aggressiveness in different lesions. In this study we investigated the effects of EDA+FN on bone destruction in human radicular cysts and explored the possibility of editing FN gene or blocking the related paracrine signaling pathway to inhibit the osteoclastogenesis. The specimens of radicular cysts were obtained from 20 patients. We showed that the vessel density was positively associated with both the lesion size (R = 0.49, P = 0.001) and EDA+FN staining (R = 0.26, P = 0.022) in the specimens. We isolated fibroblasts from surgical specimens, and used the CRISPR/Cas system to knockout the EDA exon, or used IST-9 antibody and bevacizumab to block EDA+FN and VEGF, respectively. Compared to control fibroblasts, the fibroblasts from radicular cysts exhibited significantly more Trap+MNCs, the relative expression level of VEGF was positively associated with both the ratio of EDA+FN/total FN (R = 0.271, P = 0.019) and with the number of Trap+MNCs (R = 0.331, P = 0.008). The knockout of the EDA exon significantly decreased VEGF expression in the fibroblasts derived from radicular cysts, leading to significantly decreased osteoclastogenesis; similar results were observed using bevacizumab to block VEGF, but block of EDA+FN with IST-9 antibody had no effect. Furthermore, the inhibitory effects of gene editing on Trap+MNC development were restored by exogenous VEGF. These results suggest that EDA+FN facilitates osteoclastogenesis in the fibrous capsule of radicular cysts, through a mechanism mediated by VEGF via an autocrine effect on the fibroblasts. Bevacizumab inhibits osteoclastogenesis in radicular cysts as effectively as the exclusion of the EDA exon by gene editing.},
}
@article {pmid30377319,
year = {2018},
author = {Wight, AJ},
title = {Strict EU ruling on gene-edited crops squeezes science.},
journal = {Nature},
volume = {563},
number = {7729},
pages = {15-16},
doi = {10.1038/d41586-018-07166-7},
pmid = {30377319},
issn = {1476-4687},
mesh = {Agriculture/economics/*legislation &amp; jurisprudence ; Animals ; Belgium ; Brazil ; Breeding/legislation &amp; jurisprudence ; CRISPR-Cas Systems/genetics ; Crops, Agricultural/economics/*genetics ; *European Union ; Evaluation Studies as Topic ; France ; Gene Editing/*legislation &amp; jurisprudence ; Humans ; Plants, Genetically Modified/*genetics ; },
}
@article {pmid30375719,
year = {2018},
author = {Pickett, CJ and Zeller, RW},
title = {Efficient genome editing using CRISPR-Cas-mediated homology directed repair in the ascidian Ciona robusta.},
journal = {Genesis (New York, N.Y. : 2000)},
volume = {},
number = {},
pages = {e23260},
doi = {10.1002/dvg.23260},
pmid = {30375719},
issn = {1526-968X},
support = {R21 DC013180/DC/NIDCD NIH HHS/United States ; 1R21DC01318001A1//National Institutes of Health/ ; IOS-0951347IOS-1557448//National Science Foundation/ ; },
abstract = {Eliminating or silencing a gene's level of activity is one of the classic approaches developmental biologists employ to determine a gene's function. A recently developed method of gene perturbation called CRISPR-Cas, which was derived from a prokaryotic adaptive immune system, has been adapted for use in eukaryotic cells. This technology has been established in several model organisms as a powerful and efficient tool for knocking out or knocking down the function of a gene of interest. It has been recently shown that CRISPR-Cas functions with fidelity and efficiency in Ciona robusta. Here, we show that in C. robusta CRISPR-Cas mediated genomic knock-ins can be efficiently generated. Electroporating a tissue-specific transgene driving Cas9 and a U6-driven gRNA transgene together with a fluorescent protein-containing homology directed repair (FP-HDR) template results in gene-specific patterns of fluorescence consistent with a targeted genomic insertion. Using the Tyrosinase locus to optimize reagents, we first characterize a new Pol III promoter for expressing gRNAs from the Ciona savignyi H1 gene, and then adapt technology that flanks gRNAs by ribozymes allowing cell-specific expression from Pol II promoters. Next, we examine homology arm-length efficiencies of FP-HDR templates. Reagents were then developed for targeting Brachyury and Pou4 that resulted in expected patterns of fluorescence, and sequenced PCR amplicons derived from single embryos validated predicted genomic insertions. Finally, using two differentially colored FP-HDR templates, we show that biallelic FP-HDR template insertion can be detected in live embryos of the F0 generation.},
}
@article {pmid30374457,
year = {2018},
author = {England, WE and Kim, T and Whitaker, RJ},
title = {Metapopulation Structure of CRISPR-Cas Immunity in Pseudomonas aeruginosa and Its Viruses.},
journal = {mSystems},
volume = {3},
number = {5},
pages = {},
pmid = {30374457},
issn = {2379-5077},
support = {T32 AI078876/AI/NIAID NIH HHS/United States ; },
abstract = {Viruses that infect the widespread opportunistic pathogen Pseudomonas aeruginosa have been shown to influence physiology and critical clinical outcomes in cystic fibrosis (CF) patients. To understand how CRISPR-Cas immune interactions may contribute to the distribution and coevolution of P. aeruginosa and its viruses, we reconstructed CRISPR arrays from a highly sampled longitudinal data set from CF patients attending the Copenhagen Cystic Fibrosis Clinic in Copenhagen, Denmark (R. L. Marvig, L. M. Sommer, S. Molin, and H. K. Johansen, Nat Genet 47:57-64, 2015, https://doi.org/10.1038/ng.3148). We show that new spacers are not added to or deleted from CRISPR arrays over time within a single patient but do vary among patients in this data set. We compared assembled CRISPR arrays from this data set to CRISPR arrays extracted from 726 additional publicly available P. aeruginosa sequences to show that local diversity in this population encompasses global diversity and that there is no evidence for population structure associated with location or environment sampled. We compare over 3,000 spacers from our global data set to 98 lytic and temperate viruses and proviruses and find a subset of related temperate virus clusters frequently targeted by CRISPR spacers. Highly targeted viruses are matched by different spacers in different arrays, resulting in a pattern of distributed immunity within the global population. Understanding the multiple immune contexts that P. aeruginosa viruses face can be applied to study of P. aeruginosa gene transfer, the spread of epidemic strains in cystic fibrosis patients, and viral control of P. aeruginosa infection. IMPORTANCE Pseudomonas aeruginosa is a widespread opportunistic pathogen and a major cause of morbidity and mortality in cystic fibrosis patients. Microbe-virus interactions play a critical role in shaping microbial populations, as viral infections can kill microbial populations or contribute to gene flow among microbes. Investigating how P. aeruginosa uses its CRISPR immune system to evade viral infection aids our understanding of how this organism spreads and evolves alongside its viruses in humans and the environment. Here, we identify patterns of CRISPR targeting and immunity that indicate P. aeruginosa and its viruses evolve in both a broad global population and in isolated human &quot;islands.&quot; These data set the stage for exploring metapopulation dynamics occurring within and between isolated &quot;island&quot; populations associated with CF patients, an essential step to inform future work predicting the specificity and efficacy of virus therapy and the spread of invasive viral elements and pathogenic epidemic bacterial strains.},
}
@article {pmid30367000,
year = {2019},
author = {Šulčius, S and Šimoliūnas, E and Alzbutas, G and Gasiūnas, G and Jauniškis, V and Kuznecova, J and Miettinen, S and Nilsson, E and Meškys, R and Roine, E and Paškauskas, R and Holmfeldt, K},
title = {Genomic Characterization of Cyanophage vB_AphaS-CL131 Infecting Filamentous Diazotrophic Cyanobacterium Aphanizomenon flos-aquae Reveals Novel Insights into Virus-Bacterium Interactions.},
journal = {Applied and environmental microbiology},
volume = {85},
number = {1},
pages = {},
doi = {10.1128/AEM.01311-18},
pmid = {30367000},
issn = {1098-5336},
abstract = {While filamentous cyanobacteria play a crucial role in food web dynamics and biogeochemical cycling of many aquatic ecosystems around the globe, the knowledge regarding the phages infecting them is limited. Here, we describe the complete genome of the virulent cyanophage vB_AphaS-CL131 (here, CL 131), a Siphoviridae phage that infects the filamentous diazotrophic bloom-forming cyanobacterium Aphanizomenon flos-aquae in the brackish Baltic Sea. CL 131 features a 112,793-bp double-stranded DNA (dsDNA) genome encompassing 149 putative open reading frames (ORFs), of which the majority (86%) lack sequence homology to genes with known functions in other bacteriophages or bacteria. Phylogenetic analysis revealed that CL 131 possibly represents a new evolutionary lineage within the group of cyanophages infecting filamentous cyanobacteria, which form a separate cluster from phages infecting unicellular cyanobacteria. CL 131 encodes a putative type V-U2 CRISPR-Cas system with one spacer (out of 10) targeting a DNA primase pseudogene in a cyanobacterium and a putative type II toxin-antitoxin system, consisting of a GNAT family N-acetyltransferase and a protein of unknown function containing the PRK09726 domain (characteristic of HipB antitoxins). Comparison of CL 131 proteins to reads from Baltic Sea and other available fresh- and brackish-water metagenomes and analysis of CRISPR-Cas arrays in publicly available A. flos-aquae genomes demonstrated that phages similar to CL 131 are present and dynamic in the Baltic Sea and share a common history with their hosts dating back at least several decades. In addition, different CRISPR-Cas systems within individual A. flos-aquae genomes targeted several sequences in the CL 131 genome, including genes related to virion structure and morphogenesis. Altogether, these findings revealed new genomic information for exploring viral diversity and provide a model system for investigation of virus-host interactions in filamentous cyanobacteria.IMPORTANCE The genomic characterization of novel cyanophage vB_AphaS-CL131 and the analysis of its genomic features in the context of other viruses, metagenomic data, and host CRISPR-Cas systems contribute toward a better understanding of aquatic viral diversity and distribution in general and of brackish-water cyanophages infecting filamentous diazotrophic cyanobacteria in the Baltic Sea in particular. The results of this study revealed previously undescribed features of cyanophage genomes (e.g., self-excising intein-containing putative dCTP deaminase and putative cyanophage-encoded CRISPR-Cas and toxin-antitoxin systems) and can therefore be used to predict potential interactions between bloom-forming cyanobacteria and their cyanophages.},
}
@article {pmid30363939,
year = {2018},
author = {Donà, V and Perreten, V},
title = {Comparative Genomics of the First and Complete Genome of &quot;Actinobacillus porcitonsillarum&quot; Supports the Novel Species Hypothesis.},
journal = {International journal of genomics},
volume = {2018},
number = {},
pages = {5261719},
pmid = {30363939},
issn = {2314-436X},
abstract = {&quot;Actinobacillus porcitonsillarum&quot; is considered a nonpathogenic member of the Pasteurellaceae family, which phenotypically resembles the pathogen Actinobacillus pleuropneumoniae. Previous studies suggested that &quot;A. porcitonsillarum&quot; may represent a new species closely related to Actinobacillus minor, yet no full genome has been sequenced so far. We implemented the Oxford Nanopore and Illumina sequencing technologies to obtain the highly accurate and complete genome sequence of the &quot;A. porcitonsillarum&quot; strain 9953L55. After validating our de novo assembly strategy by comparing the A. pleuropneumoniae S4074T genome sequence obtained by Oxford Nanopore Technology combined with Illumina reads with a PacBio-sequenced S4074T genome from the NCBI database, we performed comparative analyses of the 9953L55 genome with the A. minor type strain NM305T, A. minor strain 202, and A. pleuropneumoniae S4074T. The 2,263,191 bp circular genome of 9953L55 consisted of 2168 and 2033 predicted genes and proteins, respectively. The lipopolysaccharide cluster resembled the genetic organization of A. pleuropneumoniae serotypes 1, 9, and 11, possibly explaining the positive reactions observed previously in serotyping tests. In contrast to NM305T, we confirmed the presence of a complete apxIICABD operon in 9953L55 and 202 accounting for their hemolytic phenotype and Christie-Atkins-Munch-Petersen (CAMP) reaction positivity. Orthologous gene cluster analysis provided insight into the differential ability of strains of the A. minor/&quot;porcitonsillarum&quot; complex and A. pleuropneumoniae to ferment lactose, raffinose, trehalose, and mannitol. The four strains showed distinct and shared transposable elements, CRISPR/Cas systems, and integrated prophages. Genome comparisons based on average nucleotide identity and in silico DNA-DNA hybridization confirmed the close relationship among strains belonging to the A. minor/&quot;porcitonsillarum&quot; complex compared to other Actinobacillus spp., but also suggested that 9953L55 and 202 belong to the same novel species closely related to A. minor, namely, &quot;A. porcitonsillarum.&quot; Recognition of the taxon as a separate species would improve diagnostics and control strategies of pig pleuropneumonia.},
}
@article {pmid30362590,
year = {2018},
author = {Khambhati, K and Bhattacharjee, G and Singh, V},
title = {Current progress in CRISPR-based diagnostic platforms.},
journal = {Journal of cellular biochemistry},
volume = {},
number = {},
pages = {},
doi = {10.1002/jcb.27690},
pmid = {30362590},
issn = {1097-4644},
support = {//The Puri Foundation for Education in India/ ; },
abstract = {The CRISPR-Cas system is a key technology for genome editing and regulation in a wide range of organisms and cell types. Recently, CRISPR-Cas-based diagnostic platform has shown idealistic properties for pathogen detection. Integrating the CRISPR-Cas platform along with lateral flow system allows rapid, sensitive, specific, cheap, and reliable diagnostic. It has the potential to be in frontline for not only pathogen detection during the epidemic outbreak, but also cancer, and genetic diseases.},
}
@article {pmid30361373,
year = {2018},
author = {Kratochwil, CF and Liang, Y and Gerwin, J and Woltering, JM and Urban, S and Henning, F and Machado-Schiaffino, G and Hulsey, CD and Meyer, A},
title = {Agouti-related peptide 2 facilitates convergent evolution of stripe patterns across cichlid fish radiations.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6413},
pages = {457-460},
doi = {10.1126/science.aao6809},
pmid = {30361373},
issn = {1095-9203},
mesh = {Agouti-Related Protein/genetics/*physiology ; Animals ; *Biological Evolution ; CRISPR-Cas Systems ; Chromosome Mapping ; Cichlids/*anatomy &amp; histology/genetics/*physiology ; Gene Knockout Techniques ; Genetic Loci ; Mutation ; *Skin Pigmentation/genetics ; },
abstract = {The color patterns of African cichlid fishes provide notable examples of phenotypic convergence. Across the more than 1200 East African rift lake species, melanic horizontal stripes have evolved numerous times. We discovered that regulatory changes of the gene agouti-related peptide 2 (agrp2) act as molecular switches controlling this evolutionarily labile phenotype. Reduced agrp2 expression is convergently associated with the presence of stripe patterns across species flocks. However, cis-regulatory mutations are not predictive of stripes across radiations, suggesting independent regulatory mechanisms. Genetic mapping confirms the link between the agrp2 locus and stripe patterns. The crucial role of agrp2 is further supported by a CRISPR-Cas9 knockout that reconstitutes stripes in a nonstriped cichlid. Thus, we unveil how a single gene affects the convergent evolution of a complex color pattern.},
}
@article {pmid30357987,
year = {2018},
author = {Binder, WH},
title = {The Past 40 Years of Macromolecular Sciences: Reflections on Challenges in Synthetic Polymer and Material Science.},
journal = {Macromolecular rapid communications},
volume = {},
number = {},
pages = {e1800610},
doi = {10.1002/marc.201800610},
pmid = {30357987},
issn = {1521-3927},
support = {//DFG/ ; //EU/ ; //FWF/ ; //MLU-Halle-Wittenberg/ ; },
abstract = {Technology and science are often successful in discontinuities (&quot;disruptive innovations&quot; or &quot;leapfrogging&quot;), in turn allowing true, big societal development by entire changes in technology rather than by minuscule stepwise improvements. Examples are the emergence of modern computer science by inventing the field-effect transistor rather than further fine-tuning the &quot;Röhrentransistor&quot;; the development of (organic) light-emitting diodes in advance of the &quot;Gasglühstrumpf&quot;; CRISPR/Cas exceeding any previous genetic method or Ziegler-Natta polymerization enabling stereoregular polypropylene (PP) and high-density polyethylene (HDPE) in advance of free-radical polymerization. Where may the frogs in polymer science in the future &quot;jump&quot; to? Contemplating past achievements in (synthetic) polymer science, such as living polymerization, &quot;click&quot; chemistry, supramolecular chemistry, the potentially &quot;leaping&quot; areas of self-healing and (bio)degradable materials, amyloids, and biomaterials are reflected upon.},
}
@article {pmid30357478,
year = {2018},
author = {Baliga, P and Shekar, M and Venugopal, MN},
title = {Investigation of direct repeats, spacers and proteins associated with clustered regularly interspaced short palindromic repeat (CRISPR) system of Vibrio parahaemolyticus.},
journal = {Molecular genetics and genomics : MGG},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00438-018-1504-8},
pmid = {30357478},
issn = {1617-4623},
support = {BT/BI/04/049/99//Department of Biotechnology, Ministry of Science and Technology/ ; },
abstract = {Vibrio parahaemolyticus, a ubiquitous bacterium of the marine environment is an important food-borne pathogen responsible for gastroenteritis worldwide. In this study, we aimed to investigate the occurrence and diversity of the CRISPR-Cas system in V. parahaemolyticus genomes using a bioinformatics approach. The CRISPR-Cas system functions as an adaptive immune system in prokaryotes that provides immunity against foreign genetic elements. In total, 570 genomes V. parahaemolyticus genomes were analyzed of which 200 confirmed for the presence of CRISPR-Cas system. The CRISPR-Cas loci were further analyzed for their repeats, spacers and associated Cas proteins. Among the 200 V. parahaemolyticus strains analyzed, 16 (8%) strains possessed the CRISPR-Cas system of complete subtype I-F, while the remaining 184 (92%) harbored the minimalistic type, a subtype I-F variant. Orphan CRISPR repeats and Cas genes were found in one strain each. The CRISPR-associated direct repeat had an unit length of 28 bases. The number of repeat units in each array ranged from 3 to 5 or 5-41 depending on whether they belonged to the minimalistic or complete subtype-IF CRISPR-Cas system, respectively. Of the 768 spacers analyzed in this study, 295 were found to be unique to V. parahaemolyticus. Homology analysis of the conserved spacers revealed matches to plasmids, phages and gut viruses and self chromosomes. Among the CRISPR-associated proteins, Cas5 and Cas7 proteins were found to be conserved. However, variations were seen in the Cas6 protein, which could be grouped into four different types based on their protein length as well as amino acid composition. We present here the diversity and main features of the CRISPR-Cas system in V. parahaemolyticus, which could provide valuable insights in elucidating the role and mechanism of CRISPR/Cas elements in this pathogen.},
}
@article {pmid30357163,
year = {2018},
author = {Zheng, L and Shi, J and Mu, Y},
title = {Dynamics changes of CRISPR-Cas9 systems induced by high fidelity mutations.},
journal = {Physical chemistry chemical physics : PCCP},
volume = {20},
number = {43},
pages = {27439-27448},
doi = {10.1039/c8cp04226h},
pmid = {30357163},
issn = {1463-9084},
mesh = {Bacterial Proteins/genetics/*metabolism ; CRISPR-Associated Protein 9 ; CRISPR-Cas Systems ; Endonucleases/genetics/*metabolism ; *Mutation ; Protein Binding/genetics ; Protein Domains ; Static Electricity ; },
abstract = {CRISPR-Cas9, a powerful genome editing tool, has widely been applied in biological fields. Since the discovery of CRISPR-Cas9 as an adaptive immune system, it has been gradually modified to perform precise genome editing in eukaryotic cells by creating double-strand breaks. Although it is robust and efficient, the current CRISPR-Cas9 system faces a major flaw: off-target effects, which are not well understood. Several Cas9 mutants show significant improvement, with very low off-target effects; however, they also show relatively lower cleavage efficiency for on-target sequences. In this study, the dynamics of wild-type Cas9 from Streptococcus pyogenes and a high fidelity Cas9 mutant have been explored using molecular dynamics simulations. It was found that the mutations cause decreased electrostatic interactions between Cas9 and the R-loop. Consequently, the flexibility of the tDNA/sgRNA heteroduplex is decreased, which may explain the lower tolerance of mismatches in the heteroduplex region. The mutations also affect the protein dynamics and the correlation networks among Cas9 domains. In mutant Cas9, weakened communications between two catalytic domains as well as a slight opening of the conformation induced by the mutations account for the lower on-target cleavage efficiency and probably the lower off-target efficiency as well. These findings will facilitate more precise Cas9 engineering in future.},
}
@article {pmid30356064,
year = {2018},
author = {Wang, X and Li, X and Wang, T and Wu, SP and Jeong, JW and Kim, TH and Young, SL and Lessey, BA and Lanz, RB and Lydon, JP and DeMayo, FJ},
title = {SOX17 regulates uterine epithelial-stromal cross-talk acting via a distal enhancer upstream of Ihh.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4421},
pmid = {30356064},
issn = {2041-1723},
support = {HD-042311//U.S. Department of Health &amp; Human Services | NIH | Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD)/International ; Z1AES103311-01//U.S. Department of Health &amp; Human Services | NIH | National Institute of Environmental Health Sciences (NIEHS)/International ; },
abstract = {Mammalian pregnancy depends on the ability of the uterus to support embryo implantation. Previous studies reveal the Sox17 gene as a downstream target of the Pgr-Gata2-dependent transcription network that directs genomic actions in the uterine endometrium receptive for embryo implantation. Here, we report that ablating Sox17 in the uterine epithelium impairs leukemia inhibitory factor (LIF) and Indian hedgehog homolog (IHH) signaling, leading to failure of embryo implantation. In vivo deletion of the SOX17-binding region 19 kb upstream of the Ihh locus by CRISPR-Cas technology reduces Ihh expression specifically in the uterus and alters proper endometrial epithelial-stromal interactions, thereby impairing pregnancy. This SOX17-binding interval is also bound by GATA2, FOXA2, and PGR. This cluster of transcription factor binding is common in 737 uterine genes and may represent a key regulatory element essential for uterine epithelial gene expression.},
}
@article {pmid30355950,
year = {2018},
author = {Xu, J and Barone, S and Zahedi, K and Brooks, M and Soleimani, M},
title = {Slc4a8 in the Kidney: Expression, Subcellular Localization and Role in Salt Reabsorption.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {50},
number = {4},
pages = {1361-1375},
doi = {10.1159/000494596},
pmid = {30355950},
issn = {1421-9778},
mesh = {Animals ; Bicarbonates/metabolism ; CRISPR-Cas Systems/genetics ; Diuresis/drug effects ; Dogs ; Furosemide/pharmacology ; In Situ Hybridization ; Kidney/*metabolism ; Kidney Tubules, Collecting/metabolism ; Madin Darby Canine Kidney Cells ; Mice ; Mice, Knockout ; Oligoribonucleotides, Antisense/metabolism ; Plasmids/genetics/metabolism ; Sodium/urine ; Sodium Chloride/metabolism ; Sodium-Bicarbonate Symporters/deficiency/genetics/*metabolism ; },
abstract = {BACKGROUND/AIMS: The sodium-dependent bicarbonate transporter Slc4a8 (a.k.a NDCBE) mediates the co-transport of sodium and bicarbonate in exchange for chloride. It is abundantly detected in the brain, with low expression levels in the kidney. The cell distribution and subcellular localization of Slc4a8 in the kidney and its role in acid/base and electrolyte homeostasis has been the subject of conflicting reports. There are no conclusive localization or functional studies to pinpoint the location and demonstrate the function of Slc4a8 in the kidney.<br><br>METHODS: Molecular techniques, including RT-PCR and in situ hybridization, were performed on kidney sections and tagged epitopes were used to examine the membrane targeting of Slc4a8 in polarized kidney cells. Crispr/Cas9 was used to generate and examine Slc4a8 KO mice.<br><br>RESULTS: Zonal distribution and in situ hybridization studies showed very little expression for Slc4a8 (NDCBE) in the cortex or in cortical collecting ducts (CCD). Slc4a8 was predominantly detected in the outer and inner medullary collecting ducts (OMCD and IMCD), and was targeted to the basolateral membrane of osmotically tolerant MDCK cells. Slc4a8 KO mice did not show any abnormal salt or bicarbonate wasting under baseline conditions or in response to bicarbonate loading, salt restriction or furosemide-induced diuresis.<br><br>CONCLUSION: Slc4a8 (NDCBE) is absent in the CCD and is predominantly localized on the basolateral membrane of medullary collecting duct cells. Further, Slc4a8 deletion does not cause significant acid base or electrolyte abnormalities in pathophysiologic states. Additional studies are needed to examine the role of Slc4a8 (NDCBE) in intracellular pH and volume regulation in medullary collecting duct cells.},
}
@article {pmid30354961,
year = {2018},
author = {Pasricha, SR and Drakesmith, H},
title = {Hemoglobinopathies in the Fetal Position.},
journal = {The New England journal of medicine},
volume = {379},
number = {17},
pages = {1675-1677},
doi = {10.1056/NEJMcibr1809628},
pmid = {30354961},
issn = {1533-4406},
mesh = {Anemia, Sickle Cell/*drug therapy/genetics ; CRISPR-Cas Systems ; Carrier Proteins/genetics ; Erythroid Cells/metabolism ; Fetal Hemoglobin/*genetics ; *Gene Expression Regulation ; Humans ; Molecular Targeted Therapy ; eIF-2 Kinase/*antagonists &amp; inhibitors/genetics/metabolism ; },
}
@article {pmid30354846,
year = {2018},
author = {Yu, N and Yang, J and Mishina, Y and Giannobile, WV},
title = {Genome Editing: A New Horizon for Oral and Craniofacial Research.},
journal = {Journal of dental research},
volume = {},
number = {},
pages = {22034518805978},
doi = {10.1177/0022034518805978},
pmid = {30354846},
issn = {1544-0591},
abstract = {Precise and efficient genetic manipulations have enabled researchers to understand gene functions in disease and development, providing a platform to search for molecular cures. Over the past decade, the unprecedented advancement of genome editing techniques has revolutionized the biological research fields. Early genome editing strategies involved many naturally occurring nucleases, including meganucleases, zinc finger nucleases, and transcription activator-like effector-based nucleases. More recently, the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated nucleases (CRISPR/Cas) system has greatly enriched genetic manipulation methods in conducting research. Those nucleases generate double-strand breaks in the target gene sequences and then utilize DNA repair mechanisms to permit precise yet versatile genetic manipulations. The oral and craniofacial field harbors a plethora of diseases and developmental defects that require genetic models that can exploit these genome editing techniques. This review provides an overview of the genome editing techniques, particularly the CRISPR/Cas9 technique, for the oral and craniofacial research community. We also discuss the details about the emerging applications of genome editing in oral and craniofacial biology.},
}
@article {pmid30354811,
year = {2018},
author = {Waghulde, H and Cheng, X and Galla, S and Mell, B and Cai, J and Pruett-Miller, SM and Vazquez, G and Patterson, A and Vijay Kumar, M and Joe, B},
title = {Attenuation of Microbiotal Dysbiosis and Hypertension in a CRISPR/Cas9 Gene Ablation Rat Model of GPER1.},
journal = {Hypertension (Dallas, Tex. : 1979)},
volume = {72},
number = {5},
pages = {1125-1132},
pmid = {30354811},
issn = {1524-4563},
support = {R01 HL020176/HL/NHLBI NIH HHS/United States ; R01 HL112641/HL/NHLBI NIH HHS/United States ; R37 HL020176/HL/NHLBI NIH HHS/United States ; },
abstract = {G-protein-coupled estrogen receptor, Gper1, has been implicated in cardiovascular disease, but its mechanistic role in blood pressure control is poorly understood. Here, we demonstrate that genetically salt-sensitive hypertensive rats with complete genomic excision of Gper1 by a multiplexed guide RNA CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR associated proteins) approach present with lower blood pressure, which was accompanied by altered microbiota, different levels of circulating short chain fatty acids, and improved vascular relaxation. Microbiotal transplantation from hypertensive Gper1+/+ rats reversed the cardiovascular protective effect exerted by the genomic deletion of Gper1. Thus, this study reveals a role for Gper1 in promoting microbiotal alterations that contribute to cardiovascular pathology. However, the exact mechanism by which Gper1 regulates blood pressure is still unknown. Our results indicate that the function of Gper1 is contextually dependent on the microbiome, whereby, contemplation of using Gper1 as a target for therapy of cardiovascular disease requires caution.},
}
@article {pmid30352624,
year = {2018},
author = {Majeed, M and Soliman, H and Kumar, G and El-Matbouli, M and Saleh, M},
title = {Editing the genome of Aphanomyces invadans using CRISPR/Cas9.},
journal = {Parasites &amp; vectors},
volume = {11},
number = {1},
pages = {554},
pmid = {30352624},
issn = {1756-3305},
support = {P29294-B25//Austrian Science Fund/ ; },
mesh = {Animals ; Aphanomyces/enzymology/*genetics/pathogenicity ; CRISPR-Cas Systems ; Fish Diseases/parasitology ; Gene Targeting ; Genome ; Perciformes/parasitology ; Ribonucleoproteins/genetics ; Serine Proteases/genetics ; },
abstract = {BACKGROUND: The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is increasingly being used for genome editing experiments. It is a system to add, delete and/or replace parts of a gene in situ in a time- and cost-efficient manner. The genome of many organisms has been edited using this system. We tested the CRISPR/Cas9 system in Aphanomyces invadans, an oomycete, which is the causative agent of epizootic ulcerative syndrome (EUS) in many fish species. Extracellular proteases produced by this oomycete are believed to play a role in EUS virulence.<br><br>METHODS: We designed three single guide-RNAs (gRNA) to target A. invadans serine protease gene. These gRNAs were individually combined with the Cas9 to form ribo-nucleo-protein (RNP) complex. A. invadans protoplasts were then transfected with RNP complexes. After the transfection, the target gene was amplified and subjected to sequencing. Zoospores of A. invadans were also transfected with the RNP complex. Three groups of dwarf gourami (Trichogaster lalius) were then experimentally inoculated with (i) non-treated A. invadans zoospores; (ii) RNP-treated A. invadans zoospores; and (iii) autoclaved pond water as negative control, to investigate the effect of edited serine protease gene on the virulence of A. invadans in vivo.<br><br>RESULTS: Fluorescence microscopy showed sub-cellular localization of RNP complex in A. invadans protoplasts and zoospores. Sequencing results from the protoplast DNA revealed a point mutation in the target gene. A matching mutation was also detected in zoospores after similar treatment with the same RNP complex. In vivo results showed that the CRISPR/Cas9-treated A. invadans zoospores did not produce EUS clinical signs in the fish. These results were then confirmed by histopathological staining of the muscle sections using Gomori's methenamine silver nitrate and hematoxylin and eosin stains.<br><br>CONCLUSIONS: Results obtained in this study indicate that the RNP complex caused effective mutation in the target gene. This hindered the production of serine protease, which ultimately impeded the manifestation of EUS in the fish. Our methods thus establish a promising approach for functional genomics studies in A. invadans and provide novel avenues to develop effective strategies to control this pathogen.},
}
@article {pmid30352492,
year = {2018},
author = {Lee, HW},
title = {Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript.},
journal = {Molecules and cells},
volume = {41},
number = {10},
pages = {917-922},
pmid = {30352492},
issn = {0219-1032},
mesh = {4-1BB Ligand/*genetics ; *CRISPR-Cas Systems ; Gene Editing/*methods ; Genomics/*methods ; Humans ; },
abstract = {The CRISPR-Cas system is a well-established RNA-guided DNA editing technique widely used to modify genomic DNA sequences. I used the CRISPR-Cas9 system to change the second and third nucleotides of the triplet TCT of human TNSFSF9 in HepG2 cells to TAG to create an amber stop codon. The TCT triplet is the codon for Ser at the 172nd position of TNSFSF9. The two substituted nucleotides, AG, were confirmed by DNA sequencing of the PCR product followed by PCR amplification of the genomic TNFSF9 gene. Interestingly, sequencing of the cDNA of transcripts of the edited TNFSF9 gene revealed that the TAG had been re-edited to the wild type triplet TCT, and 1 or 2 bases just before the triplet had been deleted. These observations indicate that CRISPR-Cas9-mediated editing of bases in target genomic DNA can be followed by spontaneous re-editing (correcting) of the bases during transcription.},
}
@article {pmid30346516,
year = {2018},
author = {Markusková, B and Lichvariková, A and Szemes, T and Korenová, J and Kuchta, T and Drahovská, H},
title = {Genome analysis of lactic acid bacterial strains selected as potential starters for traditional Slovakian bryndza cheese.},
journal = {FEMS microbiology letters},
volume = {365},
number = {23},
pages = {},
doi = {10.1093/femsle/fny257},
pmid = {30346516},
issn = {1574-6968},
abstract = {Genomes of 21 strains of lactic acid bacteria isolated from Slovakian traditional cheeses were sequenced on an Illumina MiSeq platform. Subsequently, they were analysed regarding taxonomic classification, presence of genes encoding defence systems, antibiotic resistance and production of biogenic amines. Thirteen strains were found to carry genes encoding at least one bacteriocin, 18 carried genes encoding at least one restriction-modification system, all strains carried 1-6 prophages and 9 strains had CRISPR-Cas systems. CRISPR-Cas type II-A was the most common, containing 0-24 spacers. Only 10% spacers were found to be homological to known bacteriophage or plasmid sequences in databases. Two Enterococcus faecium strains and a Lactococcus lactis strain carried antibiotic resistance genes. Genes encoding for ornithine decarboxylase were detected in four strains and genes encoding for agmatine deiminase were detected in four strains. Lactobacillus paraplantarum 251 L appeared to be the most interesting strain, as it contained genes encoding for two bacteriocins, a restriction-modification system, two CRISPR-Cas systems, four prophages and no genes connected with antibiotic resistance or production of biogenic amines.},
}
@article {pmid30345399,
year = {2018},
author = {Yao, R and Liu, D and Jia, X and Zheng, Y and Liu, W and Xiao, Y},
title = {CRISPR-Cas9/Cas12a biotechnology and application in bacteria.},
journal = {Synthetic and systems biotechnology},
volume = {3},
number = {3},
pages = {135-149},
pmid = {30345399},
issn = {2405-805X},
abstract = {CRISPR-Cas technologies have greatly reshaped the biology field. In this review, we discuss the CRISPR-Cas with a particular focus on the associated technologies and applications of CRISPR-Cas9 and CRISPR-Cas12a, which have been most widely studied and used. We discuss the biological mechanisms of CRISPR-Cas as immune defense systems, recently-discovered anti-CRISPR-Cas systems, and the emerging Cas variants (such as xCas9 and Cas13) with unique characteristics. Then, we highlight various CRISPR-Cas biotechnologies, including nuclease-dependent genome editing, CRISPR gene regulation (including CRISPR interference/activation), DNA/RNA base editing, and nucleic acid detection. Last, we summarize up-to-date applications of the biotechnologies for synthetic biology and metabolic engineering in various bacterial species.},
}
@article {pmid30344094,
year = {2018},
author = {Mohr, G and Silas, S and Stamos, JL and Makarova, KS and Markham, LM and Yao, J and Lucas-Elío, P and Sanchez-Amat, A and Fire, AZ and Koonin, EV and Lambowitz, AM},
title = {A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition.},
journal = {Molecular cell},
volume = {72},
number = {4},
pages = {700-714.e8},
pmid = {30344094},
issn = {1097-4164},
support = {R01 GM037706/GM/NIGMS NIH HHS/United States ; R01 GM037949/GM/NIGMS NIH HHS/United States ; ZIA LM000073-22/NULL/Intramural NIH HHS/United States ; },
abstract = {Prokaryotic CRISPR-Cas systems provide adaptive immunity by integrating portions of foreign nucleic acids (spacers) into genomic CRISPR arrays. Cas6 proteins then process CRISPR array transcripts into spacer-derived RNAs (CRISPR RNAs; crRNAs) that target Cas nucleases to matching invaders. We find that a Marinomonas mediterranea fusion protein combines three enzymatic domains (Cas6, reverse transcriptase [RT], and Cas1), which function in both crRNA biogenesis and spacer acquisition from RNA and DNA. We report a crystal structure of this divergent Cas6, identify amino acids required for Cas6 activity, show that the Cas6 domain is required for RT activity and RNA spacer acquisition, and demonstrate that CRISPR-repeat binding to Cas6 regulates RT activity. Co-evolution of putative interacting surfaces suggests a specific structural interaction between the Cas6 and RT domains, and phylogenetic analysis reveals repeated, stable association of free-standing Cas6s with CRISPR RTs in multiple microbial lineages, indicating that a functional interaction between these proteins preceded evolution of the fusion.},
}
@article {pmid30343903,
year = {2018},
author = {Dillard, KE and Brown, MW and Johnson, NV and Xiao, Y and Dolan, A and Hernandez, E and Dahlhauser, SD and Kim, Y and Myler, LR and Anslyn, EV and Ke, A and Finkelstein, IJ},
title = {Assembly and Translocation of a CRISPR-Cas Primed Acquisition Complex.},
journal = {Cell},
volume = {175},
number = {4},
pages = {934-946.e15},
doi = {10.1016/j.cell.2018.09.039},
pmid = {30343903},
issn = {1097-4172},
abstract = {CRISPR-Cas systems confer an adaptive immunity against viruses. Following viral injection, Cas1-Cas2 integrates segments of the viral genome (spacers) into the CRISPR locus. In type I CRISPR-Cas systems, efficient &quot;primed&quot; spacer acquisition and viral degradation (interference) require both the Cascade complex and the Cas3 helicase/nuclease. Here, we present single-molecule characterization of the Thermobifida fusca (Tfu) primed acquisition complex (PAC). We show that TfuCascade rapidly samples non-specific DNA via facilitated one-dimensional diffusion. Cas3 loads at target-bound Cascade and the Cascade/Cas3 complex translocates via a looped DNA intermediate. Cascade/Cas3 complexes stall at diverse protein roadblocks, resulting in a double strand break at the stall site. In contrast, Cas1-Cas2 samples DNA transiently via 3D collisions. Moreover, Cas1-Cas2 associates with Cascade and translocates with Cascade/Cas3, forming the PAC. PACs can displace different protein roadblocks, suggesting a mechanism for long-range spacer acquisition. This work provides a molecular basis for the coordinated steps in CRISPR-based adaptive immunity.},
}
@article {pmid30340417,
year = {2018},
author = {Van Houdt, R and Provoost, A and Van Assche, A and Leys, N and Lievens, B and Mijnendonckx, K and Monsieurs, P},
title = {Cupriavidus metallidurans Strains with Different Mobilomes and from Distinct Environments Have Comparable Phenomes.},
journal = {Genes},
volume = {9},
number = {10},
pages = {},
pmid = {30340417},
issn = {2073-4425},
support = {C90356//Federaal Wetenschapsbeleid/ ; },
abstract = {Cupriavidus metallidurans has been mostly studied because of its resistance to numerous heavy metals and is increasingly being recovered from other environments not typified by metal contamination. They host a large and diverse mobile gene pool, next to their native megaplasmids. Here, we used comparative genomics and global metabolic comparison to assess the impact of the mobilome on growth capabilities, nutrient utilization, and sensitivity to chemicals of type strain CH34 and three isolates (NA1, NA4 and H1130). The latter were isolated from water sources aboard the International Space Station (NA1 and NA4) and from an invasive human infection (H1130). The mobilome was expanded as prophages were predicted in NA4 and H1130, and a genomic island putatively involved in abietane diterpenoids metabolism was identified in H1130. An active CRISPR-Cas system was identified in strain NA4, providing immunity to a plasmid that integrated in CH34 and NA1. No correlation between the mobilome and isolation environment was found. In addition, our comparison indicated that the metal resistance determinants and properties are conserved among these strains and thus maintained in these environments. Furthermore, all strains were highly resistant to a wide variety of chemicals, much broader than metals. Only minor differences were observed in the phenomes (measured by phenotype microarrays), despite the large difference in mobilomes and the variable (shared by two or three strains) and strain-specific genomes.},
}
@article {pmid30338908,
year = {2018},
author = {Zhou, L and Peng, R and Zhang, R and Li, J},
title = {The applications of CRISPR/Cas system in molecular detection.},
journal = {Journal of cellular and molecular medicine},
volume = {22},
number = {12},
pages = {5807-5815},
pmid = {30338908},
issn = {1582-4934},
support = {81871721//National Natural Science Foundation of China/ ; 81772273//National Natural Science Foundation of China/ ; 7174345//Natural Science Foundation of Beijing Municipality/ ; BJ-2018-136//Beijing Hospital Nova Project/ ; },
abstract = {The Streptococcus pyogenes CRISPR/Cas system has found widespread applications as a gene-editing and regulatory tool for the simultaneous delivery of the Cas9 protein and guide RNAs into the cell, thus making the recognition of specific DNA sequences possible. The recent study that shows that Cas9 can also bind to and cleave RNA in an RNA-programmable manner is suggestive of potential utility of this system as a universal nucleic-acid recognition tool. To increase the signal intensity of the CRISPR/Cas system, a signal amplification technique has to be exploited appropriately; this requirement is also a challenge for the detection of DNA or RNA. Furthermore, the CRISPR/Cas system may be used to detect point mutations or single-nucleotide variants because of the specificity of the recognition between the target sequence and the CRISPR/Cas system. These lines of evidence make this technique capable of detecting pathogens during infection via analysis of their DNA or RNA. Thus, here we summarize applications of the CRISPR/Cas system to the recognition and detection of DNA and RNA molecules as well as the signal amplification. We also describe its potential ability to detect mutations and single-nucleotide variants. Finally, we sum up its applications to testing for pathogens and potential barriers for its implementation.},
}
@article {pmid30338024,
year = {2018},
author = {Parise, D and Parise, MTD and Viana, MVC and Muñoz-Bucio, AV and Cortés-Pérez, YA and Arellano-Reynoso, B and Díaz-Aparicio, E and Dorella, FA and Pereira, FL and Carvalho, AF and Figueiredo, HCP and Ghosh, P and Barh, D and Gomide, ACP and Azevedo, VAC},
title = {First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico.},
journal = {Standards in genomic sciences},
volume = {13},
number = {},
pages = {21},
pmid = {30338024},
issn = {1944-3277},
abstract = {Corynebacterium pseudotuberculosis is a pathogenic bacterium which has been rapidly spreading all over the world, causing economic losses in the agricultural sector and sporadically infecting humans. Six C. pseudotuberculosis strains were isolated from goats, sheep, and horses with distinct abscess locations. For the first time, Mexican genomes of this bacterium were sequenced and studied in silico. All strains were sequenced using Ion Personal Genome Machine sequencer, assembled using Newbler and SPAdes software. The automatic genome annotation was done using the software RAST and in-house scripts for transference, followed by manual curation using Artemis software and BLAST against NCBI and UniProt databases. The six genomes are publicly available in NCBI database. The analysis of nucleotide sequence similarity and the generated phylogenetic tree led to the observation that the Mexican strains are more similar between strains from the same host, but the genetic structure is probably more influenced by transportation of animals between farms than host preference. Also, a putative drug target was predicted and in silico analysis of 46 strains showed two gene clusters capable of differentiating the biovars equi and ovis: Restriction Modification system and CRISPR-Cas cluster.},
}
@article {pmid30337455,
year = {2018},
author = {Harrington, LB and Burstein, D and Chen, JS and Paez-Espino, D and Ma, E and Witte, IP and Cofsky, JC and Kyrpides, NC and Banfield, JF and Doudna, JA},
title = {Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6416},
pages = {839-842},
doi = {10.1126/science.aav4294},
pmid = {30337455},
issn = {1095-9203},
support = {/HHMI/Howard Hughes Medical Institute/United States ; },
abstract = {CRISPR-Cas systems provide microbes with adaptive immunity to infectious nucleic acids and are widely employed as genome editing tools. These tools use RNA-guided Cas proteins whose large size (950 to 1400 amino acids) has been considered essential to their specific DNA- or RNA-targeting activities. Here we present a set of CRISPR-Cas systems from uncultivated archaea that contain Cas14, a family of exceptionally compact RNA-guided nucleases (400 to 700 amino acids). Despite their small size, Cas14 proteins are capable of targeted single-stranded DNA (ssDNA) cleavage without restrictive sequence requirements. Moreover, target recognition by Cas14 triggers nonspecific cutting of ssDNA molecules, an activity that enables high-fidelity single-nucleotide polymorphism genotyping (Cas14-DETECTR). Metagenomic data show that multiple CRISPR-Cas14 systems evolved independently and suggest a potential evolutionary origin of single-effector CRISPR-based adaptive immunity.},
}
@article {pmid30329221,
year = {2018},
author = {Gong, T and Tang, B and Zhou, X and Zeng, J and Lu, M and Guo, X and Peng, X and Lei, L and Gong, B and Li, Y},
title = {Genome editing in Streptococcus mutans through self-targeting CRISPR arrays.},
journal = {Molecular oral microbiology},
volume = {33},
number = {6},
pages = {440-449},
doi = {10.1111/omi.12247},
pmid = {30329221},
issn = {2041-1014},
abstract = {Streptococcus mutans is the primary etiological agent of human dental caries. Its major virulence factors, glucosyltransferases (Gtfs), utilize sucrose to synthesize extracellular polysaccharides (EPS), leading to the formation of dental plaque biofilm. The current study was designed to develop a novel self-targeting gene editing technology that targeted gtfs to inhibit biofilms formation. The CRISPR-Cas system (ie, clustered regularly interspaced short palindromic repeat, with CRISPR-associated proteins) provides sequence-specific protection against foreign genetic materials in archaea and bacteria, and has been widely developed for genomic engineering. The first aim of this study was to test whether components of the CRISPR-Cas9 system from S mutans UA159 is necessary to defend against foreign DNA. The data showed that a suitable PAM site, tracrRNA, Cas9, and RNase III are indispensable elements to perform normal function of S mutans CRISPR-Cas9 system. Based on these results, we designed self-targeting CRISPR arrays (containing spacer sequences identifying with gtfB) and cloned them onto plasmids. Afterward, we transformed the plasmids and editing templates into UA159 (self-targeting) to acquire desired mutants. Our data showed that this technology performed well and was able to successfully edit gtfB or gtfBgtfC genes. This resulted in high reduction in EPS synthesis and was able to breakdown biofilm formation, which is also a promising tool for dental clinics in order to prevent the formation of S mutans biofilms in the future.},
}
@article {pmid30323295,
year = {2018},
author = {Dong, C and Fontana, J and Patel, A and Carothers, JM and Zalatan, JG},
title = {Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4318},
doi = {10.1038/s41467-018-06909-4},
pmid = {30323295},
issn = {2041-1723},
abstract = {In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.},
}
@article {pmid30319822,
year = {2018},
author = {Lone, BA and Karna, SKL and Ahmad, F and Shahi, N and Pokharel, YR},
title = {CRISPR/Cas9 System: A Bacterial Tailor for Genomic Engineering.},
journal = {Genetics research international},
volume = {2018},
number = {},
pages = {3797214},
pmid = {30319822},
issn = {2090-3154},
abstract = {Microbes use diverse defence strategies that allow them to withstand exposure to a variety of genome invaders such as bacteriophages and plasmids. One such defence strategy is the use of RNA guided endonuclease called CRISPR-associated (Cas) 9 protein. The Cas9 protein, derived from type II CRISPR/Cas system, has been adapted as a versatile tool for genome targeting and engineering due to its simplicity and high efficiency over the earlier tools such as ZFNs and TALENs. With recent advancements, CRISPR/Cas9 technology has emerged as a revolutionary tool for modulating the genome in living cells and inspires innovative translational applications in different fields. In this paper we review the developments and its potential uses in the CRISPR/Cas9 technology as well as recent advancements in genome engineering using CRISPR/Cas9.},
}
@article {pmid30317145,
year = {2018},
author = {Bron, PA and Marcelli, B and Mulder, J and van der Els, S and Morawska, LP and Kuipers, OP and Kok, J and Kleerebezem, M},
title = {Renaissance of traditional DNA transfer strategies for improvement of industrial lactic acid bacteria.},
journal = {Current opinion in biotechnology},
volume = {56},
number = {},
pages = {61-68},
doi = {10.1016/j.copbio.2018.09.004},
pmid = {30317145},
issn = {1879-0429},
abstract = {The ever-expanding genomic insight in natural diversity of lactic acid bacteria (LAB) has revived the industrial interest in traditional and natural genetic mobilization methodologies. Here, we review recent advances in horizontal gene transfer processes in LAB, including natural competence, conjugation, and phage transduction. In addition, we envision the possibilities for industrial strain improvement arising from the recent discoveries of molecular exchanges between bacteria through nanotubes and extracellular vesicles, as well as the constantly expanding genome editing possibilities using the CRISPR-Cas technology.},
}
@article {pmid30309916,
year = {2018},
author = {Eldred, KC and Hadyniak, SE and Hussey, KA and Brenerman, B and Zhang, PW and Chamling, X and Sluch, VM and Welsbie, DS and Hattar, S and Taylor, J and Wahlin, K and Zack, DJ and Johnston, RJ},
title = {Thyroid hormone signaling specifies cone subtypes in human retinal organoids.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6411},
pages = {},
pmid = {30309916},
issn = {1095-9203},
support = {R01 EY025598/EY/NEI NIH HHS/United States ; T32 GM007231/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {CRISPR-Cas Systems ; Cell Line ; Embryonic Stem Cells/metabolism ; *Gene Expression Regulation, Developmental ; Humans ; Mutation ; Organoids/*growth &amp; development/metabolism ; Proteolysis ; Retina/cytology/*growth &amp; development ; Retinal Cone Photoreceptor Cells/*classification ; Thyroid Hormones/*metabolism ; },
abstract = {The mechanisms underlying specification of neuronal subtypes within the human nervous system are largely unknown. The blue (S), green (M), and red (L) cones of the retina enable high-acuity daytime and color vision. To determine the mechanism that controls S versus L/M fates, we studied the differentiation of human retinal organoids. Organoids and retinas have similar distributions, expression profiles, and morphologies of cone subtypes. S cones are specified first, followed by L/M cones, and thyroid hormone signaling controls this temporal switch. Dynamic expression of thyroid hormone-degrading and -activating proteins within the retina ensures low signaling early to specify S cones and high signaling late to produce L/M cones. This work establishes organoids as a model for determining mechanisms of human development with promising utility for therapeutics and vision repair.},
}
@article {pmid30297904,
year = {2018},
author = {Villiger, L and Grisch-Chan, HM and Lindsay, H and Ringnalda, F and Pogliano, CB and Allegri, G and Fingerhut, R and Häberle, J and Matos, J and Robinson, MD and Thöny, B and Schwank, G},
title = {Treatment of a metabolic liver disease by in vivo genome base editing in adult mice.},
journal = {Nature medicine},
volume = {24},
number = {10},
pages = {1519-1525},
doi = {10.1038/s41591-018-0209-1},
pmid = {30297904},
issn = {1546-170X},
abstract = {CRISPR-Cas-based genome editing holds great promise for targeting genetic disorders, including inborn errors of hepatocyte metabolism. Precise correction of disease-causing mutations in adult tissues in vivo, however, is challenging. It requires repair of Cas9-induced double-stranded DNA (dsDNA) breaks by homology-directed mechanisms, which are highly inefficient in nondividing cells. Here we corrected the disease phenotype of adult phenylalanine hydroxylase (Pah)enu2 mice, a model for the human autosomal recessive liver disease phenylketonuria (PKU)1, using recently developed CRISPR-Cas-associated base editors2-4. These systems enable conversion of C∙G to T∙A base pairs and vice versa, independent of dsDNA break formation and homology-directed repair (HDR). We engineered and validated an intein-split base editor, which allows splitting of the fusion protein into two parts, thereby circumventing the limited cargo capacity of adeno-associated virus (AAV) vectors. Intravenous injection of AAV-base editor systems resulted in Pahenu2 gene correction rates that restored physiological blood phenylalanine (L-Phe) levels below 120 µmol/l [5]. We observed mRNA correction rates up to 63%, restoration of phenylalanine hydroxylase (PAH) enzyme activity, and reversion of the light fur phenotype in Pahenu2 mice. Our findings suggest that targeting genetic diseases in vivo using AAV-mediated delivery of base-editing agents is feasible, demonstrating potential for therapeutic application.},
}
@article {pmid30296034,
year = {2018},
author = {Tomlinson, T},
title = {A Crispr Future for Gene-Editing Regulation: a Proposal for an Updated Biotechnology Regulatory System in an Era of Human Genomic Editing.},
journal = {Fordham law review},
volume = {87},
number = {1},
pages = {437-483},
pmid = {30296034},
issn = {0015-704X},
mesh = {Biotechnology/*ethics/legislation &amp; jurisprudence/*standards ; *CRISPR-Cas Systems ; Embryo Research/*ethics/history/legislation &amp; jurisprudence ; Gene Editing/*ethics/legislation &amp; jurisprudence/*standards ; *Government Regulation/history ; History, 20th Century ; Humans ; Stem Cell Research/ethics/history/legislation &amp; jurisprudence ; United States ; },
abstract = {Recent developments in gene-editing technology have enabled scientists to manipulate the human genome in unprecedented ways. One technology in particular, Clustered Regularly Interspaced Short Pallindromic Repeat (CRISPR), has made gene editing more precise and cost-effective than ever before. Indeed, scientists have already shown that CRISPR can eliminate genes linked to life-threatening diseases from an individual's genetic makeup and, when used on human embryos, CRISPR has the potential to permanently eliminate hereditary diseases from the human genome in its entirety. These developments have brought great hope to individuals and their families, who suffer from genetically linked diseases. But there is a dark side: in the wrong hands, CRISPR could negatively impact the course of human evolution or be used to create biological weaponry. Despite these possible consequences, CRISPR remains largely unregulated due to the United States's outdated regulatory scheme for biotechnology. Moreover, human embryo research, which is likely critical to maximizing the therapeutic applications of CRISPR, is not easily undertaken by scientists due to a number of federal and state restrictions aimed at preventing such research. This Note examines the possible benefits and consequences of CRISPR and discusses the current regulations in both the fields of biotechnology and human embryo research that hamper the government's ability to effectively regulate this technology. Ultimately, this Note proposes a new regulatory scheme for biotechnology that focuses on the processes used to create products using CRISPR, rather than the products themselves, with a focus on enabling ethical research using human embryos to maximize the potential benefits of CRISPR.},
}
@article {pmid30295654,
year = {2018},
author = {Du, L and Zhou, A and Sohr, A and Roy, S},
title = {An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {139},
pages = {},
pmid = {30295654},
issn = {1940-087X},
support = {R00 HL114867/HL/NHLBI NIH HHS/United States ; R35 GM124878/GM/NIGMS NIH HHS/United States ; },
abstract = {Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a &quot;Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated&quot; (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.},
}
@article {pmid30295162,
year = {2018},
author = {Ali, Q},
title = {Non-conventional therapeutic technique to replace CRISPR bacteria from biofilm by inducible lysogen.},
journal = {Journal of biological dynamics},
volume = {},
number = {},
pages = {1-28},
doi = {10.1080/17513758.2018.1527958},
pmid = {30295162},
issn = {1751-3766},
abstract = {Bacteriophage can be an effective means of regulating bacterial populations when conditions allow phage invasion of bacterial colonies. Phage can either infect and lyse a host cell, or insert their DNA into the host cell genome; the latter process is called lysogeny. The clustered regularly interspaced short palindromic repeat (CRISPR) system, linked with CRISPR-associated (Cas) genes, is a regulatory system present in a variety of bacteria which confers immunity against bacteriophage. Studies of the group behaviour of bacteria with CRISPR/Cas systems have provided evidence that CRISPR in lysogenized bacteria can cause an inability to form biofilm. This allows CRISPR-immune bacteria in biofilms to effectively resist phage therapy. Our recent work has described a potential therapeutic technique to eradicate CRISPR-immune bacteria from a biofilm by a continuous influx of lysogens carrying an identical phage sequence. However, this model predicted that the CRISPR-immune population could persist for long times before eradication. Our current focus is on the use of diverse lysogens against CRISPR-capable bacterial populations. The goal of this work is to find a suitable strategy which can eradicate bacteria with a CRISPR system through the influx of finite amounts of distinct lysogens over fixed intervals.},
}
@article {pmid30293118,
year = {2018},
author = {Yang, X and Huang, B and Deng, L and Hu, Z},
title = {Progress in gene therapy using oncolytic vaccinia virus as vectors.},
journal = {Journal of cancer research and clinical oncology},
volume = {144},
number = {12},
pages = {2433-2440},
pmid = {30293118},
issn = {1432-1335},
mesh = {Animals ; CRISPR-Cas Systems ; Cancer Vaccines/genetics/immunology ; Gene Targeting ; *Genetic Therapy/methods ; Genetic Vectors/*genetics ; Humans ; Immunotherapy ; Neoplasms/genetics/immunology/therapy ; *Oncolytic Virotherapy/methods ; Oncolytic Viruses/*genetics ; Vaccinia virus/*genetics ; },
abstract = {BACKGROUND: Vaccinia virus was widely used in the World Health Organization's smallpox eradication campaign and is currently a promising vector for gene therapy owing to its unique characteristics. Vaccinia virus can selectively replicate and propagate productively in tumor cells, resulting in oncolysis. In addition, rapid viral particle production, wide host range, large genome size (approximately 200 kb), and safe handling render vaccinia virus a suitable vector for gene therapy.<br><br>MATERIALS AND METHODS: Cancer vaccines and gene therapy are being studied in clinical trials and experiment researches. However, we put forward unique challenges of optimal selection of foreign genes, administration and modification of VACV, personalized medicine, and other existing problems, based on current researches and our own experiments.<br><br>CONCLUSION: This review presents an overview of the vaccinia virus from its mechanisms to medical researches and clinical trials. We believe that the solution to these problems will contribute to understanding mechanisms of VACV and provide a theoretical basis for clinical treatment.},
}
@article {pmid30290202,
year = {2018},
author = {Chen, S and Liu, H and Liang, W and Hong, L and Zhang, B and Huang, L and Guo, X and Duan, G},
title = {Insert sequences of CRISPR/Cas system regulate horizontal antibiotic gene transfer in Shigella.},
journal = {International journal of antimicrobial agents},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.ijantimicag.2018.09.020},
pmid = {30290202},
issn = {1872-7913},
abstract = {Multidrug resistances Shigella is an enormous threat of public health. The resistance genes always located in plasmids, phages and integrons, which get into bacteria cells by horizontal gene transfer (HGT). CRISPR-Cas systems are adaptive immune systems in bacteria that are beneficial to resist phage infection and other mobile genetic elements. But this can come at a cost of inhibiting the acquisition of other beneficial genes through HGT. Here, we investigate how Shigella regulate the activity of the CRISPR/Cas system spontaneously, when it wants acquire exogenous gene that is necessary for its survival. We found that IS elements were identified in cas genes, such as IS600 in cse2, ISSfl2 in cas6e, IS629 in cse1- cas3. The number of spacers in CRISPR/Cas which strain containing IS was fewer compare with none IS. Interestingly, fewer spacers were also found in multi-drug resistance Shigella strains. Furthermore, we have constructed the genetic transferred antibiotic resistant strain by resistance plasmid transfer, to detect the CRISPR/Cas system changes in this two group strains. We found that cse2 gene had a new IS elements (IS600) in the antibiotic-resistant strain. The bioinformatics analyses showed that the IS600 insert hotspots in the cse2 gene were the TGC-GGC gene motifs and the tertiary structure of the Cse2 protein was different with IS600 or not. IS600 could bring a 5-order of magnitude (105) decrease in the relative expression of cse2 gene. This study has significant implication for further revealing the mechanism underlying the CRISPR/Cas-mediated antibiotic resistance gene horizontal transfer in Shigella.},
}
@article {pmid30289378,
year = {2018},
author = {Tashkandi, M and Ali, Z and Aljedaani, F and Shami, A and Mahfouz, MM},
title = {Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato.},
journal = {Plant signaling &amp; behavior},
volume = {13},
number = {10},
pages = {e1525996},
pmid = {30289378},
issn = {1559-2324},
abstract = {CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.},
}
@article {pmid30285624,
year = {2018},
author = {Howells, RM and Craze, M and Bowden, S and Wallington, EJ},
title = {Efficient generation of stable, heritable gene edits in wheat using CRISPR/Cas9.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {215},
pmid = {30285624},
issn = {1471-2229},
support = {BB/J019356/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {Agrobacterium/genetics ; *CRISPR-Cas Systems ; DNA, Bacterial ; Gene Editing/*methods ; Genome, Plant ; Hordeum/genetics ; Plant Breeding/methods ; Plants, Genetically Modified/genetics ; Transformation, Genetic ; Triticum/*genetics ; },
abstract = {BACKGROUND: The use of CRISPR/Cas9 systems could prove to be a valuable tool in crop research, providing the ability to fully knockout gene function in complex genomes or to precisely adjust gene function by knockout of individual alleles.<br><br>RESULTS: We compare gene editing in hexaploid wheat (Triticum aestivum) with diploid barley (Hordeum vulgare), using a combination of single genome and tri-genome targeting. High efficiency gene editing, 11-17% for single genome targeted guides and 5% for tri-genome targeted guides, was achieved in wheat using stable Agrobacterium-mediated transformation. Gene editing in wheat was shown to be predominantly heterozygous, edits were inherited in a Mendelian fashion over multiple generations and no off-target effects were observed. Comparison of editing between the two species demonstrated that more stable, heritable edits were produced in wheat, whilst barley exhibited continued and somatic editing.<br><br>CONCLUSION: Our work shows the potential to obtain stable edited transgene-free wheat lines in 36 weeks through only two generations and that targeted mutagenesis of individual homeologues within the wheat genome is achievable with a modest amount of effort, and without off-target mutations or the need for lengthy crossing strategies.},
}
@article {pmid30285540,
year = {2018},
author = {Smith, CIE and Zain, R},
title = {Therapeutic Oligonucleotides: State of the Art.},
journal = {Annual review of pharmacology and toxicology},
volume = {},
number = {},
pages = {},
doi = {10.1146/annurev-pharmtox-010818-021050},
pmid = {30285540},
issn = {1545-4304},
abstract = {Oligonucleotides (ONs) can interfere with biomolecules representing the entire extended central dogma. Antisense gapmer, steric block, spliceswitching ONs, and short interfering RNA drugs have been successfully developed. Moreover, antagomirs (antimicroRNAs), microRNA mimics, aptamers, DNAdecoys, DNAzymes, synthetic guide strands for CRISPR/Cas, and innate immunity-stimulating ONs are all in clinical trials. DNAtargeting, triplex-forming ONs and strand-invading ONs have made their mark on drug development research, but not yet as medicines. Both design and synthetic nucleic acid chemistry are crucial for achieving biologically active ONs. The dominating modifications are phosphorothioate linkages, base methylation, and numerous 2'-substitutions in the furanose ring, such as 2'-fluoro, O-methyl, or methoxyethyl. Locked nucleic acid and constrained ethyl, a related variant, are bridged forms where the 2'-oxygen connects to the 4'-carbon in the sugar. Phosphorodiamidate morpholino oligomers, carrying a modified heterocyclic backbone ring, have also been commercialized. Delivery remains a major obstacle, but systemic administration and intrathecal infusion are used for treatment of the liver and brain, respectively. Expected final online publication date for the Annual Review of Pharmacology and Toxicology Volume 59 is January 6, 2019. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.},
}
@article {pmid30284045,
year = {2018},
author = {Majumdar, S and Terns, MP},
title = {CRISPR RNA-guided DNA cleavage by reconstituted Type I-A immune effector complexes.},
journal = {Extremophiles : life under extreme conditions},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00792-018-1057-0},
pmid = {30284045},
issn = {1433-4909},
support = {R35 GM118160/GM/NIGMS NIH HHS/United States ; R35GM118160//National Institutes of Health/ ; },
abstract = {Diverse CRISPR-Cas immune systems protect archaea and bacteria from viruses and other mobile genetic elements. All CRISPR-Cas systems ultimately function by sequence-specific destruction of invading complementary nucleic acids. However, each CRISPR system uses compositionally distinct crRNP [CRISPR (cr) RNA/Cas protein] immune effector complexes to recognize and destroy invasive nucleic acids by unique molecular mechanisms. Previously, we found that Type I-A (Csa) effector crRNPs from Pyrococcus furiosus function in vivo to eliminate invader DNA. Here, we reconstituted functional Type I-A effector crRNPs in vitro with recombinant Csa proteins and synthetic crRNA and characterized properties of crRNP assembly, target DNA recognition and cleavage. Six proteins (Csa 4-1, Cas3″, Cas3', Cas5a, Csa2, Csa5) are essential for selective target DNA binding and cleavage. Native gel shift analysis and UV-induced RNA-protein crosslinking demonstrate that Cas5a and Csa2 directly interact with crRNA 5' tag and guide sequences, respectively. Mutational analysis revealed that Cas3″ is the effector nuclease of the complex. Together, our results indicate that DNA cleavage by Type I-A crRNPs requires crRNA-guided and protospacer adjacent motif-dependent target DNA binding to unwind double-stranded DNA and expose single strands for progressive ATP-dependent 3'-5' cleavage catalyzed by integral Cas3' helicase and Cas3″ nuclease crRNP components.},
}
@article {pmid30283411,
year = {2018},
author = {Terceti, MS and Vences, A and Matanza, XM and Dalsgaard, I and Pedersen, K and Osorio, CR},
title = {Molecular Epidemiology of Photobacterium damselae subsp. damselae Outbreaks in Marine Rainbow Trout Farms Reveals Extensive Horizontal Gene Transfer and High Genetic Diversity.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {2155},
pmid = {30283411},
issn = {1664-302X},
abstract = {The marine bacterium Photobacterium damselae subsp. damselae is a pathogen for a variety of marine animals, as well as for humans, and is nowadays considered an emerging pathogen for fish of importance in marine aquaculture. Recent studies have suggested that outbreaks in fish farms are caused by multiclonal populations of this subspecies that exist in the environment. Here, we report the study of a collection of 31 strains isolated during the course of disease outbreaks in marine rainbow trout farms in Denmark in 1994, 1995, and 2006, respectively. A phylogenetic analysis based on the toxR gene sequence, and the screening of virulence-related genes uncovered a high genetic heterogeneity, even among strains isolated from the same fish farm at the same time. Moreover, comparative analysis of the whole genome sequences of four selected strains revealed a large number of differentially occurring genes, which included virulence genes, pPHDD1 plasmid, polysaccharide synthesis gene clusters, CRISPR-Cas systems and putative new mobile genetic elements. This study provides sound evidence that P. damselae subsp. damselae outbreaks in Danish rainbow trout farms were caused by multiclonal populations and that horizontal gene transfer constitutes a strong driving force in the generation of intraspecific diversity in this pathogen.},
}
@article {pmid30282704,
year = {2018},
author = {Hasan, MH and Davis, LE and Bollavarapu, RK and Mitra, D and Parmar, R and Tandon, R},
title = {Dynamin Is Required for Efficient Cytomegalovirus Maturation and Envelopment.},
journal = {Journal of virology},
volume = {92},
number = {24},
pages = {},
pmid = {30282704},
issn = {1098-5514},
abstract = {Cytomegalovirus secondary envelopment occurs in a virus-induced cytoplasmic assembly compartment (vAC) generated via a drastic reorganization of the membranes of the secretory and endocytic systems. Dynamin is a eukaryotic GTPase that is implicated in membrane remodeling and endocytic membrane fission events; however, the role of dynamin in cellular trafficking of viruses beyond virus entry is only partially understood. Mouse embryonic fibroblasts (MEF) engineered to excise all three isoforms of dynamin were infected with mouse cytomegalovirus (MCMV-K181). Immediate-early (IE1; m123) viral protein was detected in these triple dynamin knockout (TKO) cells, as well as in mock-induced parental MEF, at early times postinfection, although levels were reduced in TKO cells, indicating that virus entry was affected but not eliminated. Levels of IE1 protein and another viral early protein (m04) were normalized by 48 h postinfection; however, late protein (m55; gB) expression was reduced in infected TKO cells compared to parental MEF. Ultrastructural analysis revealed intact stages of nuclear virus maturation in both cases with equivalent numbers of nucleocapsids containing packaged viral DNA (C-capsids), indicating successful viral DNA replication, capsid assembly, and genome packaging. Most importantly, severe defects in virus envelopment were visualized in TKO cells but not in parental cells. Dynamin inhibitor (dynasore)-treated MEF showed a phenotype similar to TKO cells upon mouse cytomegalovirus infection, confirming the role of dynamin in late maturation processes. In summary, dynamin-mediated endocytic pathways are critical for the completion of cytoplasmic stages of cytomegalovirus maturation.IMPORTANCE Viruses are known to exploit specific cellular functions at different stages of their life cycle in order to replicate, avoid immune recognition by the host and to establish a successful infection. Cytomegalovirus (CMV)-infected cells are characterized by a prominent cytoplasmic inclusion (virus assembly compartment [vAC]) that is the site of virus maturation and envelopment. While endocytic membranes are known to be the functional components of vAC, knowledge of specific endocytic pathways implicated in CMV maturation and envelopment is lacking. We show here that dynamin, which is an integral part of host endocytic machinery, is largely dispensable for early stages of CMV infection but is required at a late stage of CMV maturation. Studies on dynamin function in CMV infection will help us understand the host-virus interaction pathways amenable to targeting by conventional small molecules, as well as by newer generation nucleotide-based therapeutics (e.g., small interfering RNA, CRISPR/CAS gRNA, etc.).},
}
@article {pmid30279181,
year = {2018},
author = {Jin, JJ and Lv, W and Xia, P and Xu, ZY and Zheng, AD and Wang, XJ and Wang, SS and Zeng, R and Luo, HM and Li, GL and Zuo, B},
title = {Long noncoding RNA SYISL regulates myogenesis by interacting with polycomb repressive complex 2.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {E9802-E9811},
pmid = {30279181},
issn = {1091-6490},
mesh = {Animals ; CRISPR-Cas Systems ; Cell Differentiation ; *Epigenesis, Genetic ; Gene Silencing ; Mice ; Mice, Knockout ; Muscle Development/*physiology ; Polycomb Repressive Complex 2/genetics/*metabolism ; Promoter Regions, Genetic ; RNA, Long Noncoding/genetics/*metabolism ; },
abstract = {Although many long noncoding RNAs (lncRNAs) have been identified in muscle, their physiological function and regulatory mechanisms remain largely unexplored. In this study, we systematically characterized the expression profiles of lncRNAs during C2C12 myoblast differentiation and identified an intronic lncRNA, SYISL (SYNPO2 intron sense-overlapping lncRNA), that is highly expressed in muscle. Functionally, SYISL promotes myoblast proliferation and fusion but inhibits myogenic differentiation. SYISL knockout in mice results in significantly increased muscle fiber density and muscle mass. Mechanistically, SYISL recruits the enhancer of zeste homolog 2 (EZH2) protein, the core component of polycomb repressive complex 2 (PRC2), to the promoters of the cell-cycle inhibitor gene p21 and muscle-specific genes such as myogenin (MyoG), muscle creatine kinase (MCK), and myosin heavy chain 4 (Myh4), leading to H3K27 trimethylation and epigenetic silencing of target genes. Taken together, our results reveal that SYISL is a repressor of muscle development and plays a vital role in PRC2-mediated myogenesis.},
}
@article {pmid30278987,
year = {2018},
author = {Rui, Y and Wilson, DR and Green, JJ},
title = {Non-Viral Delivery To Enable Genome Editing.},
journal = {Trends in biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tibtech.2018.08.010},
pmid = {30278987},
issn = {1879-3096},
support = {R01 EB022148/EB/NIBIB NIH HHS/United States ; },
abstract = {Genome-editing technologies such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENS), and the clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein system have revolutionized biological research. Each biotechnology consists of a DNA-binding protein that can be programmed to recognize and initiate double-strand breaks (DSBs) for site-specific gene modification. These technologies have the potential to be harnessed to cure diseases caused by aberrant gene expression. To be successful therapeutically, their functionality depends on their safe and efficient delivery into the cell nucleus. This review discusses the challenges in the delivery of genome-editing tools, and highlights recent innovations in non-viral delivery that have potential to overcome these limitations and advance the translation of genome editing towards patient care.},
}
@article {pmid30276556,
year = {2018},
author = {Xue, T and Liu, K and Chen, D and Yuan, X and Fang, J and Yan, H and Huang, L and Chen, Y and He, W},
title = {Improved bioethanol production using CRISPR/Cas9 to disrupt the ADH2 gene in Saccharomyces cerevisiae.},
journal = {World journal of microbiology &amp; biotechnology},
volume = {34},
number = {10},
pages = {154},
pmid = {30276556},
issn = {1573-0972},
support = {2017J01622//Natural Science Foundation of Fujian Province/ ; CARS-170501//National Sugar Crop Reserach System/ ; JAT160114//Education Department Project of Fujian Province/ ; },
mesh = {Alcohol Dehydrogenase/*genetics/*metabolism ; Analysis of Variance ; Base Sequence ; *CRISPR-Cas Systems/genetics ; Cloning, Molecular ; DNA, Fungal/analysis ; Escherichia coli/genetics ; Ethanol/*metabolism ; Fermentation ; Gene Deletion ; Gene Editing ; Gene Expression Regulation, Fungal ; Gene Knockout Techniques/methods ; Genetic Engineering/*methods ; Genome, Fungal/genetics ; Metabolic Engineering/*methods ; Metabolic Networks and Pathways/genetics ; Saccharomyces cerevisiae/*genetics/*metabolism ; Saccharomyces cerevisiae Proteins/*genetics/*metabolism ; Sequence Alignment ; Transformation, Genetic ; },
abstract = {Bioethanol, as a form of renewable and clean energy, has become increasingly important to the energy supply. One major obstacle in ethanol production is developing a high-capacity system. Existing approaches for regulating the ethanol production pathway are relatively insufficient, with nonspecific genetic manipulation. Here, we used CRISPR/Cas9 technology to disrupt the alcohol dehydrogenase (ADH) 2 gene via complete deletion of the gene and introduction of a frameshift mutation in the ADH2 locus. Sequencing demonstrated the accurate knockout of the target gene with 91.4% and near 100% targeting efficiency. We also utilized genome resequencing to validate the mutations in the ADH2 mutants targeted by various single-guide RNAs. This extensive analysis indicated the mutations in the CRISPR/Cas9-engineered strains were homozygous. We applied the engineered Saccharomyces cerevisiae strains for bioethanol production. Results showed that the ethanol yield improved by up to 74.7% compared with the yield obtained using the native strain. This work illustrates the applicability of this highly efficient and specific genome engineering approach to promote the improvement of bioethanol production in S. cerevisiae via metabolic engineering. Importantly, this study is the first report of the disruption of a target gene, ADH2, in S. cerevisiae using CRISPR/Cas9 technology to improve bioethanol yield.},
}
@article {pmid30275337,
year = {2018},
author = {Ling, L and Raikhel, AS},
title = {Serotonin signaling regulates insulin-like peptides for growth, reproduction, and metabolism in the disease vector Aedes aegypti.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {E9822-E9831},
pmid = {30275337},
issn = {1091-6490},
support = {R01 AI036959/AI/NIAID NIH HHS/United States ; },
mesh = {Aedes/*physiology ; Animals ; CRISPR-Cas Systems ; Female ; Insect Proteins/*metabolism ; Insulin/*metabolism ; Mosquito Vectors/*physiology ; Peptide Fragments/*metabolism ; Receptors, Serotonin/chemistry/genetics/*metabolism ; *Reproduction ; Serotonin/*metabolism ; Signal Transduction ; },
abstract = {Disease-transmitting female mosquitoes require a vertebrate blood meal to produce their eggs. An obligatory hematophagous lifestyle, rapid reproduction, and existence of a large number of transmittable diseases make mosquitoes the world's deadliest animals. Attaining optimal body size and nutritional status is critical for mosquitoes to become reproductively competent and effective disease vectors. We report that blood feeding boosts serotonin concentration and elevates the serotonin receptor Aa5HT2B (Aedes aegypti 5-hydroxytryptamine receptor, type 2B) transcript level in the fat-body, an insect analog of the vertebrate liver and adipose tissue. Aa5HT2B gene disruption using the CRISPR-Cas9 gene-editing approach led to a decreased body size, postponed development, shortened lifespan, retarded ovarian growth, and dramatically diminished lipid accumulation. Expression of the insulin-like peptide (ILP) genes ilp2 and ilp6 was down-regulated while that of ilp5 and ilp4 was up-regulated in response to Aa5HT2B disruption. CRISPR-Cas9 disruption of ilp2 or ilp6 resulted in adverse phenotypes similar to those of Aa5HT2B disruption, while ilp5 CRISPR-Cas9 disruption had exactly the opposite effect on growth and metabolism, with significantly increased body size and elevated lipid stores. Simultaneous CRISPR-Cas9 disruption of Aa5HT2B and ilp5 rescued these phenotypic manifestations. Aa5HT2B RNAi silencing rendered ilp6 insensitive to serotonin treatment in the cultured fat-body, suggesting a regulatory link between Aa5HT2B and ILP6. Moreover, CRISPR-Cas9 ilp6 disruption affects expression of ilp-2, -5, and -4, pointing out on a possible role of ILP6 as a mediator of the Aa5HT2B action.},
}
@article {pmid30275336,
year = {2018},
author = {Sago, CD and Lokugamage, MP and Paunovska, K and Vanover, DA and Monaco, CM and Shah, NN and Gamboa Castro, M and Anderson, SE and Rudoltz, TG and Lando, GN and Mummilal Tiwari, P and Kirschman, JL and Willett, N and Jang, YC and Santangelo, PJ and Bryksin, AV and Dahlman, JE},
title = {High-throughput in vivo screen of functional mRNA delivery identifies nanoparticles for endothelial cell gene editing.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {E9944-E9952},
pmid = {30275336},
issn = {1091-6490},
support = {T32 EB006343/EB/NIBIB NIH HHS/United States ; T32 EB021962/EB/NIBIB NIH HHS/United States ; T32 GM008433/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Cells, Cultured ; Endothelial Cells/cytology/*metabolism ; *Gene Editing ; *Gene Transfer Techniques ; HEK293 Cells ; Hepatocytes/cytology/metabolism ; High-Throughput Screening Assays ; Humans ; Lipids/*chemistry ; Mice ; Mice, Inbred C57BL ; Nanoparticles/*administration &amp; dosage/chemistry ; RNA, Guide/chemistry/*genetics ; RNA, Messenger/chemistry/*genetics ; },
abstract = {Dysfunctional endothelium causes more disease than any other cell type. Systemically administered RNA delivery to nonliver tissues remains challenging, in large part because there is no high-throughput method to identify nanoparticles that deliver functional mRNA to cells in vivo. Here we report a system capable of simultaneously quantifying how >100 lipid nanoparticles (LNPs) deliver mRNA that is translated into functional protein. Using this system (named FIND), we measured how >250 LNPs delivered mRNA to multiple cell types in vivo and identified 7C2 and 7C3, two LNPs that efficiently deliver siRNA, single-guide RNA (sgRNA), and mRNA to endothelial cells. The 7C3 delivered Cas9 mRNA and sgRNA to splenic endothelial cells as efficiently as hepatocytes, distinguishing it from LNPs that deliver Cas9 mRNA and sgRNA to hepatocytes more than other cell types. These data demonstrate that FIND can identify nanoparticles with novel tropisms in vivo.},
}
@article {pmid30269229,
year = {2018},
author = {Hong, KQ and Liu, DY and Chen, T and Wang, ZW},
title = {Recent advances in CRISPR/Cas9 mediated genome editing in Bacillus subtilis.},
journal = {World journal of microbiology &amp; biotechnology},
volume = {34},
number = {10},
pages = {153},
pmid = {30269229},
issn = {1573-0972},
support = {21576200//National Natural Science Foundation of China/ ; 21776209//National Natural Science Foundation of China/ ; 21621004//National Natural Science Foundation of China/ ; },
mesh = {Bacillus subtilis/*genetics ; Bacterial Proteins/genetics ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Endonucleases ; Gene Editing/*methods ; Genes, Bacterial/genetics ; Molecular Biology/methods ; },
abstract = {Genome editing using engineered nucleases has rapidly transformed from a niche technology to a mainstream method used in various host cells. Its widespread adoption has been largely developed by the emergence of the clustered regularly interspaced short palindromic repeats (CRISPR) system, which uses an easily customizable specificity RNA-guided DNA endonuclease, such as Cas9. Recently, CRISPR/Cas9 mediated genome engineering has been widely applied to model organisms, including Bacillus subtilis, enabling facile, rapid high-fidelity modification of endogenous native genes. Here, we reviewed the recent progress in B. subtilis gene editing using CRISPR/Cas9 based tools, and highlighted state-of-the-art strategies for design of CRISPR/Cas9 system. Finally, future perspectives on the use of CRISPR/Cas9 genome engineering for sequence-specific genome editing in B. subtilis are provided.},
}
@article {pmid30266728,
year = {2018},
author = {Morovic, W and Roos, P and Zabel, B and Hidalgo-Cantabrana, C and Kiefer, A and Barrangou, R},
title = {Transcriptional and Functional Analysis of Bifidobacterium animalis subsp. lactis Exposure to Tetracycline.},
journal = {Applied and environmental microbiology},
volume = {84},
number = {23},
pages = {},
pmid = {30266728},
issn = {1098-5336},
abstract = {Commercial probiotic bacteria must be tested for acquired antibiotic resistance elements to avoid potential transfer to pathogens. The European Food Safety Authority recommends testing resistance using microdilution culture techniques previously used to establish inhibitory thresholds for the Bifidobacterium genus. Many Bifidobacterium animalis subsp. lactis strains exhibit increased resistance to tetracycline, historically attributed to the ribosomal protection gene tet(W). However, some strains that harbor genetically identical tet(W) genes show various inhibition levels, suggesting that other genetic elements also contribute to observed differences. Here, we adapted several molecular assays to confirm the inhibition of B. animalis subsp. lactis strains Bl-04 and HN019 and employed RNA sequencing to assess the transcriptional differences related to genomic polymorphisms. We detected specific stress responses to the antibiotic by correlating ATP concentration to number of viable genome copies from droplet digital PCR and found that the bacteria were still metabolically active in high drug concentrations. Transcriptional analyses revealed that several polymorphic regions, particularly a novel multidrug efflux transporter, were differentially expressed between the strains in each experimental condition, likely having phenotypic effects. We also found that the tet(W) gene was upregulated only during subinhibitory tetracycline concentrations, while two novel tetracycline resistance genes were upregulated at high concentrations. Furthermore, many genes involved in amino acid metabolism and transporter function were upregulated, while genes for complex carbohydrate utilization, protein metabolism, and clustered regularly interspaced short palindromic repeat(s) (CRISPR)-Cas systems were downregulated. These results provide high-throughput means for assessing antibiotic resistances of two highly related probiotic strains and determine the genetic network that contributes to the global tetracycline response.IMPORTANCEBifidobacterium animalis subsp. lactis is widely used in human food and dietary supplements. Although well documented to be safe, B. animalis subsp. lactis strains must not contain transferable antibiotic resistance elements. Many B. animalis subsp. lactis strains have different resistance measurements despite being genetically similar, and the reasons for this are not well understood. In the current study, we sought to examine how genomic differences between two closely related industrial B. animalis subsp. lactis strains contribute to different resistance levels. This will lead to a better understanding of resistance, identify future targets for analysis of transferability, and expand our understanding of tetracycline resistance in bacteria.},
}
@article {pmid30262503,
year = {2018},
author = {He, S and Del Viso, F and Chen, CY and Ikmi, A and Kroesen, AE and Gibson, MC},
title = {An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6409},
pages = {1377-1380},
doi = {10.1126/science.aar8384},
pmid = {30262503},
issn = {1095-9203},
mesh = {Animals ; Bacterial Proteins ; Body Patterning/*genetics ; CRISPR-Associated Protein 9 ; CRISPR-Cas Systems ; Endoderm/cytology/growth &amp; development ; Endonucleases ; *Gene Expression Regulation, Developmental ; Gene Knockdown Techniques/methods ; Genes, Homeobox/genetics/*physiology ; Larva/cytology/genetics/growth &amp; development ; Mutagenesis ; RNA, Small Interfering/genetics ; Sea Anemones/cytology/genetics/*growth &amp; development ; Transcription Factors/genetics/*physiology ; },
abstract = {Hox genes encode conserved developmental transcription factors that govern anterior-posterior (A-P) pattering in diverse bilaterian animals, which display bilateral symmetry. Although Hox genes are also present within Cnidaria, these simple animals lack a definitive A-P axis, leaving it unclear how and when a functionally integrated Hox code arose during evolution. We used short hairpin RNA (shRNA)-mediated knockdown and CRISPR-Cas9 mutagenesis to demonstrate that a Hox-Gbx network controls radial segmentation of the larval endoderm during development of the sea anemone Nematostella vectensis. Loss of Hox-Gbx activity also elicits marked defects in tentacle patterning along the directive (orthogonal) axis of primary polyps. On the basis of our results, we propose that an axial Hox code may have controlled body patterning and tissue segmentation before the evolution of the bilaterian A-P axis.},
}
@article {pmid30261908,
year = {2018},
author = {Dank, A and Smid, EJ and Notebaart, RA},
title = {CRISPR-Cas genome engineering of esterase activity in Saccharomyces cerevisiae steers aroma formation.},
journal = {BMC research notes},
volume = {11},
number = {1},
pages = {682},
pmid = {30261908},
issn = {1756-0500},
mesh = {*CRISPR-Cas Systems ; Carboxylic Ester Hydrolases ; Clustered Regularly Interspaced Short Palindromic Repeats ; Esterases/*genetics/metabolism ; Fermentation ; *Gene Editing ; Mutation ; *Odorants ; Saccharomyces cerevisiae/*enzymology ; Saccharomyces cerevisiae Proteins ; },
abstract = {OBJECTIVE: Saccharomyces cerevisiae is used worldwide for the production of ale-type beers. This yeast is responsible for the production of the characteristic fruity aroma compounds. Esters constitute an important group of aroma active secondary metabolites produced by S. cerevisiae. Previous work suggests that esterase activity, which results in ester degradation, may be the key factor determining the abundance of fruity aroma compounds. Here, we test this hypothesis by deletion of two S. cerevisiae esterases, IAH1 and TIP1, using CRISPR-Cas9 genome editing and by studying the effect of these deletions on esterase activity and extracellular ester pools.<br><br>RESULTS: Saccharomyces cerevisiae mutants were constructed lacking esterase IAH1 and/or TIP1 using CRISPR-Cas9 genome editing. Esterase activity using 5-(6)-carboxyfluorescein diacetate (cFDA) as substrate was found to be significantly lower for ΔIAH1 and ΔIAH1ΔTIP1 mutants compared to wild type (WT) activity (P < 0.05 and P < 0.001, respectively). As expected, we observed an increase in relative abundance of acetate and ethyl esters and an increase in ethyl esters in ΔIAH1 and ΔTIP1, respectively. Interestingly, the double gene disruption mutant ΔIAH1ΔTIP1 showed an aroma profile comparable to WT levels, suggesting the existence and activation of a complex regulatory mechanism to compensate multiple genomic alterations in aroma metabolism.},
}
@article {pmid30261168,
year = {2018},
author = {Hidalgo-Cantabrana, C and Goh, YJ and Barrangou, R},
title = {Characterization and Repurposing of Type I and Type II CRISPR-Cas Systems in Bacteria.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.09.013},
pmid = {30261168},
issn = {1089-8638},
abstract = {CRISPR-Cas systems constitute the adaptive immune system of bacteria and archaea, as a sequence-specific nucleic acid targeting defense mechanism. The sequence-specific recognition and cleavage of Cas effector complexes has been harnessed to developed CRISPR-based technologies and drive the genome editing revolution underway, due to their efficacy, efficiency, and ease of implementation in a broad range of organisms. CRISPR-based technologies offer a wide variety of opportunities in genome remodeling and transcriptional regulation, opening new avenues for therapeutic and biotechnological applications. To repurpose CRISPR-Cas systems for these applications, the various elements of the system need to be first identified and functionally characterized in their native host. Bioinformatic tools are first used to identify putative CRISPR arrays and their associated genes, followed by a comprehensive characterization of the CRISPR-Cas system, encompassing predictions for guide and target sequences. Subsequently, interference assays and transcriptomic analyses should be performed to probe the functionality of the CRISPR-Cas system. Once an endogenous CRISPR-Cas system is characterized as functional, they can be readily repurposed by delivering an engineered synthetic CRISPR array or a small RNA guide for targeted gene manipulation. Alternatively, developing a plasmid-based system for heterologous expression of the necessary CRISPR components can enable exploitation in other organisms. Altogether, there is a wide diversity of native CRISPR-Cas systems in many bacteria and most archaea that await functional characterization and repurposing for genome editing applications in prokaryotes.},
}
@article {pmid30260068,
year = {2018},
author = {Ebrahimi, S and Teimoori, A and Khanbabaei, H and Tabasi, M},
title = {Harnessing CRISPR/Cas 9 System for manipulation of DNA virus genome.},
journal = {Reviews in medical virology},
volume = {},
number = {},
pages = {e2009},
doi = {10.1002/rmv.2009},
pmid = {30260068},
issn = {1099-1654},
abstract = {The recent development of the Clustered Regularly Interspaced Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system, a genome editing system, has many potential applications in virology. The possibility of introducing site specific breaks has provided new possibilities to precisely manipulate viral genomics. Here, we provide diagrams to summarize the steps involved in the process. We also systematically review recent applications of the CRISPR/Cas9 system for manipulation of DNA virus genomics and discuss the therapeutic potential of the system to treat viral diseases.},
}
@article {pmid30259067,
year = {2018},
author = {Xiang, G and Ren, J and Hai, T and Fu, R and Yu, D and Wang, J and Li, W and Wang, H and Zhou, Q},
title = {Editing porcine IGF2 regulatory element improved meat production in Chinese Bama pigs.},
journal = {Cellular and molecular life sciences : CMLS},
volume = {75},
number = {24},
pages = {4619-4628},
pmid = {30259067},
issn = {1420-9071},
support = {31471215//National Natural Science Foundation of China/ ; 31422038//National Natural Science Foundation of China/ ; 31471395//National Natural Science Foundation of China/ ; 31501188//National Natural Science Foundation of China/ ; XDA16010205//Strategic Priority Research Program of Chinese Academy of Sciences/ ; 2015AA020307//National High-Tech Research and Development Program/ ; 2016ZX08010001//National Special Key Project for Transgenic Breeding/ ; },
mesh = {Alleles ; Animal Husbandry/methods ; Animals ; Breeding/methods ; *CRISPR-Cas Systems ; Female ; Gene Editing/*methods ; Genotype ; Insulin-Like Growth Factor II/*genetics ; *Introns ; Male ; Meat/analysis ; Mutation ; Phenotype ; *Regulatory Sequences, Nucleic Acid ; Swine/*genetics ; },
abstract = {Insulin-like growth factor 2 (IGF2) is an important growth factor, which promotes growth and development in mammals during fetal and postnatal stages. Using CRISPR-Cas9 system, we generated multiple founder pigs containing 12 different mutant alleles around a regulatory element within the intron 3 of IGF2 gene. Crossing two male founders passed four mutant alleles onto F1 generation, and these mutations abolished repressor ZBED6 binding and rendered this regulatory element nonfunctional. Both founders and F1 animals showed significantly faster growth, without affecting meat quality. These results indicated that editing IGF2 intron 3-3072 site using CRISPR-Cas9 technology improved meat production in Bama pigs. This is the first demonstration that editing non-coding region can improve economic traits in livestock.},
}
@article {pmid30258941,
year = {2018},
author = {Karlapudi, AP and T C, V and Tammineedi, J and Srirama, K and Kanumuri, L and Prabhakar Kodali, V},
title = {In silico sgRNA tool design for CRISPR control of quorum sensing in Acinetobacter species.},
journal = {Genes &amp; diseases},
volume = {5},
number = {2},
pages = {123-129},
pmid = {30258941},
issn = {2352-3042},
abstract = {CRISPR genome editing utilizes Cas9 nuclease and single guide RNA (sgRNA), which directs the nuclease to a specific site in the genome and makes a double-stranded break (DSB). Design of sgRNA for CRISPR-Cas targeting, and to promote CRISPR adaptation, uses a regulatory mechanism that ensures maximum CRISPR-Cas9 system functions when a bacterial population is at highest risk of phage infection. Acinetobacter baumannii is the most regularly identified gram-negative bacterium infecting patients. Recent reports have demonstrated that the extent of diseases caused by A. baumannii is expanding and, in a few cases, now surpasses the quantity of infections caused by P. aeruginosa. Most Acinetobacter strains possess biofilm-forming ability, which plays a major role in virulence and drug resistance. Biofilm bacteria use quorum sensing, a cell-to-cell communication process, to activate gene expression. Many genes are involved in biofilm formation and the mechanism to disrupt the biofilm network is still not clearly understood. In this study, we performed in silico gene editing to exploit the AbaI gene, responsible for biofilm formation. The study explored different tools available for genome editing to create gene knockouts, selecting the A. baumannii AbaI gene as a target.},
}
@article {pmid30255296,
year = {2018},
author = {Adames, NR and Gallegos, JE and Peccoud, J},
title = {Yeast genetic interaction screens in the age of CRISPR/Cas.},
journal = {Current genetics},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00294-018-0887-8},
pmid = {30255296},
issn = {1432-0983},
support = {R01GM078989//National Institute of General Medical Sciences/ ; 1759900//Directorate for Biological Sciences/ ; 1832320//Directorate for Engineering/ ; },
abstract = {The ease of performing both forward and reverse genetics in Saccharomyces cerevisiae, along with its stable haploid state and short generation times, has made this budding yeast the consummate model eukaryote for genetics. The major advantage of using budding yeast for reverse genetics is this organism's highly efficient homology-directed repair, allowing for precise genome editing simply by introducing DNA with homology to the chromosomal target. Although plasmid- and PCR-based genome editing tools are quite efficient, they depend on rare spontaneous DNA breaks near the target sequence. Consequently, they can generate only one genomic edit at a time, and the edit must be associated with a selectable marker. However, CRISPR/Cas technology is efficient enough to permit markerless and multiplexed edits in a single step. These features have made CRISPR/Cas popular for yeast strain engineering in synthetic biology and metabolic engineering applications, but it has not been widely employed for genetic screens. In this review, we critically examine different methods to generate multi-mutant strains in systematic genetic interaction screens and discuss the potential of CRISPR/Cas to supplement or improve on these methods.},
}
@article {pmid30253789,
year = {2018},
author = {Gaj, T and Perez-Pinera, P},
title = {The continuously evolving CRISPR barcoding toolbox.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {143},
pmid = {30253789},
issn = {1474-760X},
mesh = {Animals ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; },
abstract = {Two articles recently described the development of CRISPR technologies that have the potential to fundamentally transform the barcoding and tracing of mammalian cells.},
}
@article {pmid30251692,
year = {2018},
author = {Luanpitpong, S and Poohadsuan, J and Samart, P and Kiratipaiboon, C and Rojanasakul, Y and Issaragrisil, S},
title = {Reactive oxygen species mediate cancer stem-like cells and determine bortezomib sensitivity via Mcl-1 and Zeb-1 in mantle cell lymphoma.},
journal = {Biochimica et biophysica acta. Molecular basis of disease},
volume = {1864},
number = {11},
pages = {3739-3753},
doi = {10.1016/j.bbadis.2018.09.010},
pmid = {30251692},
issn = {1879-260X},
mesh = {Antineoplastic Agents/*pharmacology/therapeutic use ; Apoptosis/drug effects ; Biopsy ; Bortezomib/*pharmacology/therapeutic use ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Proliferation ; Drug Resistance, Neoplasm ; Female ; Free Radical Scavengers/pharmacology ; Gene Knockdown Techniques ; HEK293 Cells ; Humans ; Lymph Nodes/pathology ; Lymphoma, Mantle-Cell/*drug therapy/pathology ; Middle Aged ; Myeloid Cell Leukemia Sequence 1 Protein/antagonists &amp; inhibitors/genetics/*metabolism ; Neoplasm Recurrence, Local/pathology/prevention &amp; control ; Neoplastic Stem Cells/drug effects/metabolism ; Primary Cell Culture ; Reactive Oxygen Species/*metabolism ; Zinc Finger E-box-Binding Homeobox 1/*metabolism ; },
abstract = {Mantle cell lymphoma (MCL) is an aggressive, incurable non-Hodgkin B-cell lymphoma with good initial response to therapy then subsequently relapse. Cancer stem cells (CSCs) are considered to be an underlying cause of these inevitable drug resistance and tumor regrowth, but how CSCs are regulated is largely unknown. We demonstrate here for the first time the existence of CSC-like subpopulations that are modulated by reactive oxygen species (ROS) in MCL cell lines and patient-derived primary cells in an inverse correlation with bortezomib (BTZ) sensitivity. Using various known donors and inhibitors of cellular superoxide (O2-), hydrogen peroxide (H2O2) and hydroxyl radical (OH), we unveil their distinct roles in the regulation of CSC-like subpopulations and thus MCL response to BTZ. O2- inhibits CSC-like cells and sensitizes BTZ-induced apoptosis, whereas H2O2 conversely enriches CSC-like cells and protects against apoptosis and OH has minimal effects. We further observed that an anti-apoptotic Mcl-1 and a transcription factor Zeb-1 are favorable targets of O2- and H2O2, respectively. Using small molecule inhibition, ectopic expression and CRISPR/Cas9-mediated gene manipulation, we verified the roles of Mcl-1 and Zeb-1 in CSC and apoptosis regulation by O2- and H2O2. Our findings provide a novel mechanistic insight into the significance of redox status of MCL cells in determining their drug response via CSC-like subpopulations, which are imperative to a better understanding of therapeutic resistance and relapse.},
}
@article {pmid30251682,
year = {2018},
author = {Montioli, R and Desbats, MA and Grottelli, S and Doimo, M and Bellezza, I and Borri Voltattorni, C and Salviati, L and Cellini, B},
title = {Molecular and cellular basis of ornithine δ-aminotransferase deficiency caused by the V332M mutation associated with gyrate atrophy of the choroid and retina.},
journal = {Biochimica et biophysica acta. Molecular basis of disease},
volume = {1864},
number = {11},
pages = {3629-3638},
doi = {10.1016/j.bbadis.2018.08.032},
pmid = {30251682},
issn = {1879-260X},
mesh = {CRISPR-Cas Systems/genetics ; Coenzymes/metabolism ; Enzyme Assays ; Gene Knockout Techniques ; Gyrate Atrophy/drug therapy/*genetics/pathology ; HEK293 Cells ; Holoenzymes/genetics/metabolism ; Humans ; Mutagenesis, Site-Directed ; Ornithine-Oxo-Acid Transaminase/*genetics/metabolism ; Point Mutation ; Protein Aggregation, Pathological/drug therapy/*genetics/pathology ; Pyridoxal Phosphate/*metabolism ; Pyridoxine/pharmacology/therapeutic use ; Recombinant Proteins/genetics/metabolism ; Treatment Outcome ; Vitamin B Complex/*pharmacology/therapeutic use ; },
abstract = {Gyrate atrophy (GA) is a rare recessive disorder characterized by progressive blindness, chorioretinal degeneration and systemic hyperornithinemia. GA is caused by point mutations in the gene encoding ornithine δ-aminotransferase (OAT), a tetrameric pyridoxal 5'-phosphate-dependent enzyme catalysing the transamination of l-ornithine and α-ketoglutarate to glutamic-γ-semialdehyde and l-glutamate in mitochondria. More than 50 OAT variants have been identified, but their molecular and cellular properties are mostly unknown. A subset of patients is responsive to pyridoxine administration, although the mechanisms underlying responsiveness have not been clarified. Herein, we studied the effects of the V332M mutation identified in pyridoxine-responsive patients. The Val332-to-Met substitution does not significantly affect the spectroscopic and kinetic properties of OAT, but during catalysis it makes the protein prone to convert into the apo-form, which undergoes unfolding and aggregation under physiological conditions. By using the CRISPR/Cas9 technology we generated a new cellular model of GA based on HEK293 cells knock-out for the OAT gene (HEK-OAT_KO). When overexpressed in HEK-OAT_KO cells, the V332M variant is present in an inactive apodimeric form, but partly shifts to the catalytically-competent holotetrameric form in the presence of exogenous PLP, thus explaining the responsiveness of these patients to pyridoxine administration. Overall, our data represent the first integrated molecular and cellular analysis of the effects of a pathogenic mutation in OAT. In addition, we validated a novel cellular model for the disease that could prove instrumental to define the molecular defect of other GA-causing variants, as well as their responsiveness to pyridoxine and other putative drugs.},
}
@article {pmid30251378,
year = {2018},
author = {da Silva Xavier, A and de Almeida, JCF and de Melo, AG and Rousseau, GM and Tremblay, DM and de Rezende, RR and Moineau, S and Alfenas-Zerbini, P},
title = {Characterization of CRISPR-Cas systems in the Ralstonia solanacearum species complex.},
journal = {Molecular plant pathology},
volume = {},
number = {},
pages = {},
doi = {10.1111/mpp.12750},
pmid = {30251378},
issn = {1364-3703},
support = {APQ-01926-14//Fundação de Amparo à Pesquisa do Estado de Minas Gerais/ ; //Natural Sciences and Engineering Research Council of Canada/ ; },
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPRs) are composed of an array of short DNA repeat sequences separated by unique spacer sequences that are flanked by associated (Cas) genes. CRISPR-Cas systems are found in the genomes of several microbes and can act as an adaptive immune mechanism against invading foreign nucleic acids, such as phage genomes. Here, we studied the CRISPR-Cas systems in plant-pathogenic bacteria of the Ralstonia solanacearum species complex (RSSC). A CRISPR-Cas system was found in 31% of RSSC genomes present in public databases. Specifically, CRISPR-Cas types I-E and II-C were found, with I-E being the most common. The presence of the same CRISPR-Cas types in distinct Ralstonia phylotypes and species suggests the acquisition of the system by a common ancestor before Ralstonia species segregation. In addition, a Cas1 phylogeny (I-E type) showed a perfect geographical segregation of phylotypes, supporting an ancient acquisition. Ralstoniasolanacearum strains CFBP2957 and K60T were challenged with a virulent phage, and the CRISPR arrays of bacteriophage-insensitive mutants (BIMs) were analysed. No new spacer acquisition was detected in the analysed BIMs. The functionality of the CRISPR-Cas interference step was also tested in R. solanacearum CFBP2957 using a spacer-protospacer adjacent motif (PAM) delivery system, and no resistance was observed against phage phiAP1. Our results show that the CRISPR-Cas system in R. solanacearum CFBP2957 is not its primary antiviral strategy.},
}
@article {pmid30251319,
year = {2018},
author = {Martin, RM and Moniruzzaman, M and Mucci, NC and Willis, A and Woodhouse, JN and Xian, Y and Xiao, C and Brussaard, CPD and Wilhelm, SW},
title = {Cylindrospermopsis raciborskii Virus and host: genomic characterization and ecological relevance.},
journal = {Environmental microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1462-2920.14425},
pmid = {30251319},
issn = {1462-2920},
support = {//Kenneth &amp; Blaire Mossman Endowment/ ; //NIOZ/ ; LP130100311//ARC-Linkage/ ; //University of Tennessee/ ; DEB 1240870//National Science Foundation/ ; IOS 141528//National Science Foundation/ ; },
abstract = {Cylindrospermopsis (Raphidiopsis) raciborskii is an invasive, filamentous, nitrogen-fixing cyanobacterium that forms frequent blooms in freshwater habitats. While viruses play key roles in regulating the abundance, production and diversity of their hosts in aquatic ecosystems, the role(s) of viruses in the ecology of C. raciborskii is almost unexplored. Progress in this field has been hindered by the absence of a characterized virus-host system in C. raciborskii. To bridge this gap, we sequenced the genome of CrV-01T, a previously isolated cyanosiphovirus, and its host, C. raciborskii strain Cr2010. Analyses suggest that CrV-01T represents a distinct clade of siphoviruses infecting, and perhaps lysogenizing, filamentous cyanobacteria. Its genome contains unique features that include an intact CRISPR array and a 12 kb inverted duplication. Evidence suggests CrV-01T recently gained the ability to infect Cr2010 and recently lost the ability to form lysogens. The cyanobacterial host contains a CRISPR-Cas system with CRISPR spacers matching protospacers within the inverted duplication of the CrV-01T genome. Examination of metagenomes demonstrates that viruses with high genetic identity to CrV-01T, but lacking the inverted duplication, are present in C. raciborskii blooms in Australia. The unique genomic features of the CrV/Cr2010 system offers opportunities to investigate in more detail virus-host interactions in an ecologically important bloom-forming cyanobacterium.},
}
@article {pmid30248089,
year = {2018},
author = {Chabas, H and Lion, S and Nicot, A and Meaden, S and van Houte, S and Moineau, S and Wahl, LM and Westra, ER and Gandon, S},
title = {Evolutionary emergence of infectious diseases in heterogeneous host populations.},
journal = {PLoS biology},
volume = {16},
number = {9},
pages = {e2006738},
pmid = {30248089},
issn = {1545-7885},
abstract = {The emergence and re-emergence of pathogens remains a major public health concern. Unfortunately, when and where pathogens will (re-)emerge is notoriously difficult to predict, as the erratic nature of those events is reinforced by the stochastic nature of pathogen evolution during the early phase of an epidemic. For instance, mutations allowing pathogens to escape host resistance may boost pathogen spread and promote emergence. Yet, the ecological factors that govern such evolutionary emergence remain elusive because of the lack of ecological realism of current theoretical frameworks and the difficulty of experimentally testing their predictions. Here, we develop a theoretical model to explore the effects of the heterogeneity of the host population on the probability of pathogen emergence, with or without pathogen evolution. We show that evolutionary emergence and the spread of escape mutations in the pathogen population is more likely to occur when the host population contains an intermediate proportion of resistant hosts. We also show that the probability of pathogen emergence rapidly declines with the diversity of resistance in the host population. Experimental tests using lytic bacteriophages infecting their bacterial hosts containing Clustered Regularly Interspaced Short Palindromic Repeat and CRISPR-associated (CRISPR-Cas) immune defenses confirm these theoretical predictions. These results suggest effective strategies for cross-species spillover and for the management of emerging infectious diseases.},
}
@article {pmid30245733,
year = {2018},
author = {Hsu, DS and Kornepati, AV and Glover, W and Kennedy, EM and Cullen, BR},
title = {Targeting HPV16 DNA using CRISPR/Cas inhibits anal cancer growth in vivo.},
journal = {Future virology},
volume = {13},
number = {7},
pages = {475-482},
pmid = {30245733},
issn = {1746-0794},
support = {R21 CA198050/CA/NCI NIH HHS/United States ; },
abstract = {Aim: The goal of this study was to determine if a single AAV vector, encoding Cas9 and guide RNAs specific for the HPV16 E6 and E7 genes, could inhibit the growth of an HPV16-induced tumor in vivo.<br><br>Materials &amp; methods: We grew HPV16+, patient-derived anal cancer explants in immunodeficient mice and then challenged these by injection of AAV-based vectors encoding Cas9 and control or HPV16-specific guide RNAs.<br><br>Results &amp; conclusion: We observed a significant and selective reduction in tumor growth when the HPV16 E6 and E7 genes were targeted using Cas9. These studies provide proof of principle for the hypothesis that CRISPR/Cas has the potential to be used to selectively treat HPV-induced tumors in humans.},
}
@article {pmid30244670,
year = {2018},
author = {Koonin, EV},
title = {Open questions: CRISPR biology.},
journal = {BMC biology},
volume = {16},
number = {1},
pages = {95},
pmid = {30244670},
issn = {1741-7007},
abstract = {CRISPR-Cas systems, the purveyors of adaptive immunity in archaea and bacteria and sources of the new generation of genome engineering tools, have been studied in exquisite molecular detail. However, when it comes to biological functions, ecology, and evolution of CRISPR-Cas, many more intriguing questions remain than there are answers.},
}
@article {pmid30241607,
year = {2018},
author = {Zhang, C and Konermann, S and Brideau, NJ and Lotfy, P and Wu, X and Novick, SJ and Strutzenberg, T and Griffin, PR and Hsu, PD and Lyumkis, D},
title = {Structural Basis for the RNA-Guided Ribonuclease Activity of CRISPR-Cas13d.},
journal = {Cell},
volume = {175},
number = {1},
pages = {212-223.e17},
pmid = {30241607},
issn = {1097-4172},
support = {DP5 OD021369/OD/NIH HHS/United States ; DP5 OD021396/OD/NIH HHS/United States ; U54 GM103368/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas endonucleases directed against foreign nucleic acids mediate prokaryotic adaptive immunity and have been tailored for broad genetic engineering applications. Type VI-D CRISPR systems contain the smallest known family of single effector Cas enzymes, and their signature Cas13d ribonuclease employs guide RNAs to cleave matching target RNAs. To understand the molecular basis for Cas13d function and explain its compact molecular architecture, we resolved cryoelectron microscopy structures of Cas13d-guide RNA binary complex and Cas13d-guide-target RNA ternary complex to 3.4 and 3.3 Å resolution, respectively. Furthermore, a 6.5 Å reconstruction of apo Cas13d combined with hydrogen-deuterium exchange revealed conformational dynamics that have implications for RNA scanning. These structures, together with biochemical and cellular characterization, provide insights into its RNA-guided, RNA-targeting mechanism and delineate a blueprint for the rational design of improved transcriptome engineering technologies.},
}
@article {pmid30241032,
year = {2018},
author = {Han, YQ and Ming, SL and Wu, HT and Zeng, L and Ba, G and Li, J and Lu, WF and Han, J and Du, QJ and Sun, MM and Yang, GY and Wang, J and Chu, BB},
title = {Myostatin knockout induces apoptosis in human cervical cancer cells via elevated reactive oxygen species generation.},
journal = {Redox biology},
volume = {19},
number = {},
pages = {412-428},
pmid = {30241032},
issn = {2213-2317},
mesh = {A549 Cells ; Animals ; Antioxidants/pharmacology ; Apoptosis/*genetics ; CRISPR-Cas Systems/genetics ; Cachexia/*pathology ; Caspases/metabolism ; Cell Line, Tumor ; Cell Proliferation/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Cytochromes c/metabolism ; Epoxy Compounds/pharmacology ; Fatty Acids/metabolism ; Female ; Gene Knockout Techniques ; HEK293 Cells ; HeLa Cells ; Humans ; Lipid Metabolism/physiology ; Membrane Potential, Mitochondrial/genetics ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Mitochondria/genetics/metabolism ; Myostatin/*genetics ; Oxidation-Reduction ; Reactive Oxygen Species/*metabolism ; Uterine Cervical Neoplasms/genetics/*pathology ; Xenograft Model Antitumor Assays ; },
abstract = {Myostatin (Mstn) is postulated to be a key determinant of muscle loss and cachexia in cancer. However, no experimental evidence supports a role for Mstn in cancer, particularly in regulating the survival and growth of cancer cells. In this study, we showed that the expression of Mstn was significantly increased in different tumor tissues and human cancer cells. Mstn knockdown inhibited the proliferation of cancer cells. A knockout (KO) of Mstn created by clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) 9 (CRISPR/Cas9) induced mitochondria-dependent apoptosis in HeLa cells. Furthermore, KO of Mstn reduced the lipid content. Molecular analyses demonstrated that the expression levels of fatty acid oxidation-related genes were upregulated and then increased rate of fatty acid oxidation. Mstn deficiency-induced apoptosis took place along with generation of reactive oxygen species (ROS) and elevated fatty acid oxidation, which may play a role in triggering mitochondrial membrane depolarization, the release of cytochrome c (Cyt-c), and caspase activation. Importantly, apoptosis induced by Mstn KO was partially rescued by antioxidants and etomoxir, thereby suggesting that the increased level of ROS was functionally involved in mediating apoptosis. Overall, our findings demonstrate a novel function of Mstn in regulating mitochondrial metabolism and apoptosis within cancer cells. Hence, inhibiting the production and function of Mstn may be an effective therapeutic intervention during cancer progression and muscle loss in cachexia.},
}
@article {pmid30239876,
year = {2018},
author = {Han, W and Stella, S and Zhang, Y and Guo, T and Sulek, K and Peng-Lundgren, L and Montoya, G and She, Q},
title = {A Type III-B Cmr effector complex catalyzes the synthesis of cyclic oligoadenylate second messengers by cooperative substrate binding.},
journal = {Nucleic acids research},
volume = {46},
number = {19},
pages = {10319-10330},
pmid = {30239876},
issn = {1362-4962},
abstract = {Recently, Type III-A CRISPR-Cas systems were found to catalyze the synthesis of cyclic oligoadenylates (cOAs), a second messenger that specifically activates Csm6, a Cas accessory RNase and confers antiviral defense in bacteria. To test if III-B CRISPR-Cas systems could mediate a similar CRISPR signaling pathway, the Sulfolobus islandicus Cmr-α ribonucleoprotein complex (Cmr-α-RNP) was purified from the native host and tested for cOA synthesis. We found that the system showed a robust production of cyclic tetra-adenylate (c-A4), and that c-A4 functions as a second messenger to activate the III-B-associated RNase Csx1 by binding to its CRISPR-associated Rossmann Fold domain. Investigation of the kinetics of cOA synthesis revealed that Cmr-α-RNP displayed positively cooperative binding to the adenosine triphosphate (ATP) substrate. Furthermore, mutagenesis of conserved domains in Cmr2α confirmed that, while Palm 2 hosts the active site of cOA synthesis, Palm 1 domain serves as the primary site in the enzyme-substrate interaction. Together, our data suggest that the two Palm domains cooperatively interact with ATP molecules to achieve a robust cOA synthesis by the III-B CRISPR-Cas system.},
}
@article {pmid30239713,
year = {2018},
author = {Haverkamp, THA and Geslin, C and Lossouarn, J and Podosokorskaya, OA and Kublanov, I and Nesbø, CL},
title = {Thermosipho spp. Immune System Differences Affect Variation in Genome Size and Geographical Distributions.},
journal = {Genome biology and evolution},
volume = {10},
number = {11},
pages = {2853-2866},
pmid = {30239713},
issn = {1759-6653},
abstract = {Thermosipho species inhabit thermal environments such as marine hydrothermal vents, petroleum reservoirs, and terrestrial hot springs. A 16S rRNA phylogeny of available Thermosipho spp. sequences suggested habitat specialists adapted to living in hydrothermal vents only, and habitat generalists inhabiting oil reservoirs, hydrothermal vents, and hotsprings. Comparative genomics of 15 Thermosipho genomes separated them into three distinct species with different habitat distributions: The widely distributed T. africanus and the more specialized, T. melanesiensis and T. affectus. Moreover, the species can be differentiated on the basis of genome size (GS), genome content, and immune system composition. For instance, the T. africanus genomes are largest and contained the most carbohydrate metabolism genes, which could explain why these isolates were obtained from ecologically more divergent habitats. Nonetheless, all the Thermosipho genomes, like other Thermotogae genomes, show evidence of genome streamlining. GS differences between the species could further be correlated to differences in defense capacities against foreign DNA, which influence recombination via HGT. The smallest genomes are found in T. affectus that contain both CRISPR-cas Type I and III systems, but no RM system genes. We suggest that this has caused these genomes to be almost devoid of mobile elements, contrasting the two other species genomes that contain a higher abundance of mobile elements combined with different immune system configurations. Taken together, the comparative genomic analyses of Thermosipho spp. revealed genetic variation allowing habitat differentiation within the genus as well as differentiation with respect to invading mobile DNA.},
}
@article {pmid30238143,
year = {2018},
author = {Shi, TQ and Huang, H and Kerkhoven, EJ and Ji, XJ},
title = {Advancing metabolic engineering of Yarrowia lipolytica using the CRISPR/Cas system.},
journal = {Applied microbiology and biotechnology},
volume = {102},
number = {22},
pages = {9541-9548},
pmid = {30238143},
issn = {1432-0614},
support = {21776131//National Natural Science Foundation of China/ ; 21476111//National Natural Science Foundation of China/ ; XTD1814//the Jiangsu Synergetic Innovation Center for Advanced Bio-Manufacture/ ; },
mesh = {Bacterial Proteins/genetics/metabolism ; CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Metabolic Engineering/*methods/trends ; Yarrowia/*genetics/*metabolism ; },
abstract = {The oleaginous yeast Yarrowia lipolytica is widely used for the production of both bulk and fine chemicals, including organic acids, fatty acid-derived biofuels and chemicals, polyunsaturated fatty acids, single-cell proteins, terpenoids, and other valuable products. Consequently, it is becoming increasingly popular for metabolic engineering applications. Multiple gene manipulation tools including URA blast, Cre/LoxP, and transcription activator-like effector nucleases (TALENs) have been developed for metabolic engineering in Y. lipolytica. However, the low efficiency and time-consuming procedures involved in these methods hamper further research. The emergence of the CRISPR/Cas system offers a potential solution for these problems due to its high efficiency, ease of operation, and time savings, which can significantly accelerate the genomic engineering of Y. lipolytica. In this review, we summarize the research progress on the development of CRISPR/Cas systems for Y. lipolytica, including Cas9 proteins and sgRNA expression strategies, as well as gene knock-out/knock-in and repression/activation applications. Finally, the most promising and tantalizing future prospects in this area are highlighted.},
}
@article {pmid30228869,
year = {2018},
author = {Reimer, KA and Neugebauer, KM},
title = {Blood Relatives: Splicing Mechanisms underlying Erythropoiesis in Health and Disease.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
pmid = {30228869},
issn = {2046-1402},
abstract = {During erythropoiesis, hematopoietic stem and progenitor cells transition to erythroblasts en route to terminal differentiation into enucleated red blood cells. Transcriptome-wide changes underlie distinct morphological and functional characteristics at each cell division during this process. Many studies of gene expression have historically been carried out in erythroblasts, and the biogenesis of β-globin mRNA-the most highly expressed transcript in erythroblasts-was the focus of many seminal studies on the mechanisms of pre-mRNA splicing. We now understand that pre-mRNA splicing plays an important role in shaping the transcriptome of developing erythroblasts. Recent advances have provided insight into the role of alternative splicing and intron retention as important regulatory mechanisms of erythropoiesis. However, dysregulation of splicing during erythropoiesis is also a cause of several hematological diseases, including β-thalassemia and myelodysplastic syndromes. With a growing understanding of the role that splicing plays in these diseases, we are well poised to develop gene-editing treatments. In this review, we focus on changes in the developing erythroblast transcriptome caused by alternative splicing, the molecular basis of splicing-related blood diseases, and therapeutic advances in disease treatment using CRISPR/Cas9 gene editing.},
}
@article {pmid30226584,
year = {2018},
author = {Liu, Q and Fan, D and Adah, D and Wu, Z and Liu, R and Yan, QT and Zhang, Y and Du, ZY and Wang, D and Li, Y and Bao, SY and Liu, LP},
title = {CRISPR/Cas9‑mediated hypoxia inducible factor‑1α knockout enhances the antitumor effect of transarterial embolization in hepatocellular carcinoma.},
journal = {Oncology reports},
volume = {40},
number = {5},
pages = {2547-2557},
pmid = {30226584},
issn = {1791-2431},
abstract = {Transarterial embolization (TAE) is a palliative option commonly used for the treatment of advanced, unresectable hepatocellular carcinoma (HCC). However, patient prognosis in regards to overall survival has not improved with this method, mainly due to hypoxia‑inducible factor‑1α (HIF‑1α)‑induced angiogenesis and invasiveness. Thus, it is hypothesized that HIF‑1α may be an ideal knockout target for the treatment of HCC in combination with TAE. Thus, in the present study, HIF‑1α knockout was conducted in human liver cancer SMMC‑7721 cells and a xenograft HCC model was established using a lentivirus‑mediated CRISPR/Cas system (LV‑Cas) with small guide RNA‑721 (LV‑H721). Furthermore, hepatic artery ligation (HAL) was used to mimic human transarterial chemoembolization in mice. The results revealed that HIF‑1α was highly expressed in both HCC patient tissues and SMMC‑7721‑induced tumor tissues. The HIF‑1α knockout in SMMC‑7721 cells significantly suppressed cell invasiveness and migration, and induced cell apoptosis under CoCl2‑mimicking hypoxic conditions. Compared with the control groups, HAL + LV‑H721 inhibited SMMC‑7721 tumor growth in orthotopic HCC and markedly prolonged the survival of HCC‑bearing mice, which was accompanied by a lower CD31 expression (tumor angiogenesis) and increased apoptosis in the tumor cells. These findings demonstrated a valuable antitumor synergism in combining CRISPR/Cas9‑mediated HIF‑1α knockout with TAE in mice and highlighted the possibility that HIF‑1α may be an effective therapeutic knockout target in combination with TAE for HCC treatment.},
}
@article {pmid30224454,
year = {2018},
author = {Oberhofer, G and Ivy, T and Hay, BA},
title = {Behavior of homing endonuclease gene drives targeting genes required for viability or female fertility with multiplexed guide RNAs.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {40},
pages = {E9343-E9352},
pmid = {30224454},
issn = {1091-6490},
support = {T32 GM007616/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Drosophila melanogaster ; Female ; Fertility/genetics ; *Gene Targeting ; },
abstract = {A gene drive method of particular interest for population suppression utilizes homing endonuclease genes (HEGs), wherein a site-specific, nuclease-encoding cassette is copied, in the germline, into a target gene whose loss of function results in loss of viability or fertility in homozygous, but not heterozygous, progeny. Earlier work in Drosophila and mosquitoes utilized HEGs consisting of Cas9 and a single guide RNA (gRNA) that together target a specific gene for cleavage. Homing was observed, but resistant alleles immune to cleavage, while retaining wild-type gene function, were also created through nonhomologous end joining. Such alleles prevent drive and population suppression. Targeting a gene for cleavage at multiple positions has been suggested as a strategy to prevent the appearance of resistant alleles. To test this hypothesis, we generated two suppression HEGs in Drosophila melanogaster targeting genes required for embryonic viability or fertility, using a HEG consisting of CRISPR/Cas9 and gRNAs designed to cleave each gene at four positions. Rates of target locus cleavage were very high, and multiplexing of gRNAs prevented resistant allele formation. However, germline homing rates were modest, and the HEG cassette was unstable during homing events, resulting in frequent partial copying of HEGs that lacked gRNAs, a dominant marker gene, or Cas9. Finally, in drive experiments, the HEGs failed to spread due to the high fitness load induced in offspring as a result of maternal carryover of Cas9/gRNA complex activity. Alternative design principles are proposed that may mitigate these problems in future gene drive engineering.},
}
@article {pmid30224156,
year = {2018},
author = {Marzec, M and Hensel, G},
title = {Targeted Base Editing Systems Are Available for Plants.},
journal = {Trends in plant science},
volume = {23},
number = {11},
pages = {955-957},
doi = {10.1016/j.tplants.2018.08.011},
pmid = {30224156},
issn = {1878-4372},
abstract = {Use of RNA-guided endonucleases for targeted genome editing is one of the most important breakthrough discoveries of the 21st century. Recent studies have described modifications of this precise base editing technique that open up a new dimension to plant genome editing.},
}
@article {pmid30222730,
year = {2018},
author = {Dorn, A and Röhrig, S and Papp, K and Schröpfer, S and Hartung, F and Knoll, A and Puchta, H},
title = {The topoisomerase 3α zinc-finger domain T1 of Arabidopsis thaliana is required for targeting the enzyme activity to Holliday junction-like DNA repair intermediates.},
journal = {PLoS genetics},
volume = {14},
number = {9},
pages = {e1007674},
pmid = {30222730},
issn = {1553-7404},
abstract = {Topoisomerase 3α, a class I topoisomerase, consists of a TOPRIM domain, an active centre and a variable number of zinc-finger domains (ZFDs) at the C-terminus, in multicellular organisms. Whereas the functions of the TOPRIM domain and the active centre are known, the specific role of the ZFDs is still obscure. In contrast to mammals where a knockout of TOP3α leads to lethality, we found that CRISPR/Cas induced mutants in Arabidopsis are viable but show growth retardation and meiotic defects, which can be reversed by the expression of the complete protein. However, complementation with AtTOP3α missing either the TOPRIM-domain or carrying a mutation of the catalytic tyrosine of the active centre leads to embryo lethality. Surprisingly, this phenotype can be overcome by the simultaneous removal of the ZFDs from the protein. In combination with a mutation of the nuclease AtMUS81, the TOP3α knockout proved to be also embryo lethal. Here, expression of TOP3α without ZFDs, and in particular without the conserved ZFD T1, leads to only a partly complementation in root growth-in contrast to the complete protein, that restores root length to mus81-1 mutant level. Expressing the E. coli resolvase RusA in this background, which is able to process Holliday junction (HJ)-like recombination intermediates, we could rescue this root growth defect. Considering all these results, we conclude that the ZFD T1 is specifically required for targeting the topoisomerase activity to HJ like recombination intermediates to enable their processing. In the case of an inactivated enzyme, this leads to cell death due to the masking of these intermediates, hindering their resolution by MUS81.},
}
@article {pmid30222157,
year = {2018},
author = {Sorlien, EL and Witucki, MA and Ogas, J},
title = {Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {138},
pages = {},
pmid = {30222157},
issn = {1940-087X},
support = {P30 CA023168/CA/NCI NIH HHS/United States ; R21 CA182197/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Knockout Techniques/*methods ; Zebrafish/*genetics ; },
abstract = {Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.},
}
@article {pmid30220031,
year = {2018},
author = {Kim, MS and Kim, KH},
title = {CRISPR/Cas9-mediated knockout of HIF-1α gene in epithelioma papulosum cyprini (EPC) cells inhibited apoptosis and viral hemorrhagic septicemia virus (VHSV) growth.},
journal = {Archives of virology},
volume = {163},
number = {12},
pages = {3395-3402},
doi = {10.1007/s00705-018-4018-0},
pmid = {30220031},
issn = {1432-8798},
mesh = {Animals ; *Apoptosis ; CRISPR-Cas Systems ; Cell Line ; Cyprinidae/virology ; Fish Diseases/*genetics/metabolism/physiopathology/virology ; Gene Knockout Techniques ; Hemorrhagic Septicemia, Viral/*genetics/metabolism/physiopathology/virology ; Hypoxia-Inducible Factor 1, alpha Subunit/*genetics/metabolism ; Novirhabdovirus/genetics/*growth &amp; development/physiology ; },
abstract = {Hypoxia-inducible factor-1 (HIF-1) is a heterodimer of HIF-1α and HIF-1β, and its key role in the regulation of cellular responses to hypoxia has been well-demonstrated. The participation of HIF-1α in apoptosis has been reported in mammals, however, a little information is available on the role of HIF-1α in the progression of apoptosis in fish. In this study, to know the role of HIF-1α in the apoptosis of fish cells, we produced HIF-1α knockout Epithelioma papulosum cyprini (EPC) cells using a CRISPR/Cas9 vector, and a single cell clone showing a heterozygous insertion/deletion (indel) mutation (one nucleotide insertion and one nucleotide deletion in HIF-1α gene) was chosen for further experiments. To confirm the knockout of HIF-1α, cells were transfected with a hypoxia reporting vector containing hypoxic response elements (HREs). EPC cells transfected with the reporting plasmids showed significantly increased luminescence by exposure to cobalt chloride, a prolyl hydroxylases inhibitor. On the other hand, HIF-1α knockout EPC cells showed a non-responsiveness to a cobalt chloride exposure, suggesting that functional HIF-1α protein was not produced in the HIF-1α knockout EPC cells. Apoptosis progression induced by camptothecin and viral hemorrhagic septicemia virus (VHSV) infection was severely inhibited by HIF-1α knockout, and the replication of VHSV was significantly retarded in HIF-1α knockout EPC cells. These results suggest that HIF-1α in EPC cells acts as a pro-apoptotic factor in the progression of apoptosis triggered by a DNA damaging agent and rhabdoviral infection.},
}
@article {pmid30219987,
year = {2018},
author = {Hu, L and Zhang, H and Yang, Q and Meng, Q and Han, S and Nwafor, CC and Khan, MHU and Fan, C and Zhou, Y},
title = {Promoter variations in a homeobox gene, BnA10.LMI1, determine lobed leaves in rapeseed (Brassica napus L.).},
journal = {TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik},
volume = {131},
number = {12},
pages = {2699-2708},
pmid = {30219987},
issn = {1432-2242},
support = {2015CB150202//National Key Basic Research Program of China/ ; 2662015PY172//Fundamental Research Funds for the Central Universities/ ; },
mesh = {Alleles ; Amino Acid Sequence ; Brassica napus/anatomy &amp; histology/*genetics ; CRISPR-Cas Systems ; Chromosome Mapping ; *Genes, Homeobox ; *Genes, Plant ; Genetic Linkage ; Plant Leaves/*anatomy &amp; histology ; Plant Proteins/genetics ; Plants, Genetically Modified/genetics ; *Promoter Regions, Genetic ; Transcription Factors/genetics ; },
abstract = {KEY MESSAGE: BnA10.LMI1 positively regulates the development of leaf lobes in Brassica napus, and cis-regulatory divergences cause the different allele effects. Leaf shape is an important agronomic trait, and large variations in this trait exist within the Brassica germplasm. The lobed leaf is a unique morphological characteristic for Brassica improvement. Nevertheless, the molecular basis of leaf lobing in Brassica is poorly understood. Here, we show that an incompletely dominant locus, BnLLA10, is responsible for the lobed-leaf shape in rapeseed. A LATE MERISTEM IDENTITY1 (LMI1)-like gene (BnA10.LMI1) encoding an HD-Zip I transcription factor is the causal gene underlying the BnLLA10 locus. Sequence analysis of parental alleles revealed no sequence variations in the coding sequences, whereas abundant variations were identified in the regulatory region. Consistent with this finding, the expression levels of BnLMI1 were substantially elevated in the lobed-leaf parent compared with its near-isogenic line. The knockout mutations of BnA10.LMI1 gene were induced using the CRISPR/Cas9 system in both HY (the lobed-leaf parent) and J9707 (serrated leaf) genetic backgrounds. BnA10.LMI1 null mutations in the HY background were sufficient to produce unlobed leaves, whereas null mutations in the J9707 background showed no obvious changes in leaf shape compared with the control. Collectively, our results indicate that BnA10.LMI1 positively regulates the development of leaf lobes in B. napus, with cis-regulatory divergences causing the different allelic effects, providing new insights into the molecular mechanism of leaf lobe formation in Brassica crops.},
}
@article {pmid30217040,
year = {2018},
author = {Pan, Q and Wang, J and Gao, Y and Cui, H and Liu, C and Qi, X and Zhang, Y and Wang, Y and Wang, X},
title = {The Natural Large Genomic Deletion Is Unrelated to the Increased Virulence of the Novel Genotype Fowl Adenovirus 4 Recently Emerged in China.},
journal = {Viruses},
volume = {10},
number = {9},
pages = {},
pmid = {30217040},
issn = {1999-4915},
mesh = {Adenoviridae/classification/*genetics ; Adenoviridae Infections/*veterinary ; Animals ; CRISPR-Cas Systems ; Chickens ; China/epidemiology ; Ducks ; Gene Editing ; *Genome, Viral ; Genotype ; Phylogeny ; Poultry Diseases/diagnosis/epidemiology/*virology ; *Sequence Deletion ; Virulence/genetics ; },
abstract = {Since 2015, severe hydropericardium-hepatitis syndrome (HHS), caused by a highly pathogenic fowl adenovirus 4 (FAdV-4), emerged in China. In our previous study, the FAdV-4 has been identified as a novel genotype with a unique 1966-bp nucleotide deletion (1966Del) between open reading frame 42 and 43. In this study, the natural 1966Del was frequently identified among 17 clinical isolates and other reported Chinese clinical strains. To investigate the relationship between 1966Del and the increased virulence of the novel FAdV-4, a CRISPR/Cas9 operating platform for FAdV-4 was developed for the first time in this study. Based on this platform, a Re1966 strain was rescued, inserted the relative 1966Del sequence of a nonpathogenic strain KR5. In the pathogenicity study, the Re1966 strain retained high virulence for specific-pathogen-free chickens, similar to the parental wild-type HLJFAd15, although the survival time of chickens infected with Re1966 was much longer. Therefore, the natural 1966Del was identified as a non-essential site for the increased virulence of the emerged novel FAdV-4. Although further research on the virulence-determining region or point within the genome of the novel FAdV-4 is needed, the CRISPR/Cas9 operating platform for the novel FAdV-4 was developed and successfully applied to edit the genomic DNA for the first time, and it provides a novel powerful tool for both basic virology studies and vaccine vector development of FAdVs.},
}
@article {pmid30210230,
year = {2018},
author = {Zelinka, CP and Sotolongo-Lopez, M and Fadool, JM},
title = {Targeted disruption of the endogenous zebrafish rhodopsin locus as models of rapid rod photoreceptor degeneration.},
journal = {Molecular vision},
volume = {24},
number = {},
pages = {587-602},
pmid = {30210230},
issn = {1090-0535},
support = {R21 EY025410/EY/NEI NIH HHS/United States ; },
mesh = {Animals ; Animals, Genetically Modified ; CRISPR-Cas Systems ; Codon, Terminator/genetics ; *Disease Models, Animal ; Frameshift Mutation/genetics ; Gene Targeting ; Immunoblotting ; Polymorphism, Restriction Fragment Length ; RNA, Messenger/genetics ; Retinal Degeneration/*genetics/pathology ; Retinal Rod Photoreceptor Cells/*pathology ; Rhodopsin/*genetics ; Zebrafish/*genetics ; Zebrafish Proteins/*genetics ; },
abstract = {Purpose: Retinitis pigmentosa (RP) is a collection of genetic disorders that results in the degeneration of light-sensitive photoreceptor cells, leading to blindness. RP is associated with more than 70 loci that may display dominant or recessive modes of inheritance, but mutations in the gene encoding the visual pigment rhodopsin (RHO) are the most frequent cause. In an effort to develop precise mutations in zebrafish as novel models of photoreceptor degeneration, we describe the generation and germline transmission of a series of novel clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-induced insertion and deletion (indel) mutations in the major zebrafish rho locus, rh1-1.<br><br>Methods: One- or two-cell staged zebrafish embryos were microinjected with in vitro transcribed mRNA encoding Cas9 and a single guide RNA (gRNA). Mutations were detected by restriction fragment length polymorphism (RFLP) and DNA sequence analyses in injected embryos and offspring. Immunolabeling with rod- and cone-specific antibodies was used to test for histological and cellular changes.<br><br>Results: Using gRNAs that targeted highly conserved regions of rh1-1, a series of dominant and recessive alleles were recovered that resulted in the rapid degeneration of rod photoreceptors. No effect on cones was observed. Targeting the 5'-coding sequence of rh1-1 led to the recovery of several indels similar to disease-associated alleles. A frame shift mutation leading to a premature stop codon (T17*) resulted in rod degeneration when brought to homozygosity. Immunoblot and fluorescence labeling with a Rho-specific antibody suggest that this is indeed a null allele, illustrating that the Rho expression is essential for rod survival. Two in-frame mutations were recovered that disrupted the highly conserved N-linked glycosylation consensus sequence at N15. Larvae heterozygous for either of the alleles demonstrated rapid rod degeneration. Targeting of the 3'-coding region of rh1-1 resulted in the recovery of an allele encoding a premature stop codon (S347*) upstream of the conserved VSPA sorting sequence and a second in-frame allele that disrupted the putative phosphorylation site at S339. Both alleles resulted in rod death in a dominant inheritance pattern. Following the loss of the targeting sequence, immunolabeling for Rho was no longer restricted to the rod outer segment, but it was also localized to the plasma membrane.<br><br>Conclusions: The efficiency of CRISPR/Cas9 for gene targeting, coupled with the large number of mutations associated with RP, provided a backdrop for the rapid isolation of novel alleles in zebrafish that phenocopy disease. These novel lines will provide much needed in-vivo models for high throughput screens of compounds or genes that protect from photoreceptor degeneration.},
}
@article {pmid30209390,
year = {2018},
author = {Akcakaya, P and Bobbin, ML and Guo, JA and Malagon-Lopez, J and Clement, K and Garcia, SP and Fellows, MD and Porritt, MJ and Firth, MA and Carreras, A and Baccega, T and Seeliger, F and Bjursell, M and Tsai, SQ and Nguyen, NT and Nitsch, R and Mayr, LM and Pinello, L and Bohlooly-Y, M and Aryee, MJ and Maresca, M and Joung, JK},
title = {In vivo CRISPR editing with no detectable genome-wide off-target mutations.},
journal = {Nature},
volume = {561},
number = {7723},
pages = {416-419},
pmid = {30209390},
issn = {1476-4687},
support = {P30 DK043351/DK/NIDDK NIH HHS/United States ; R00 HG008399/HG/NHGRI NIH HHS/United States ; R35 GM118158/GM/NIGMS NIH HHS/United States ; },
abstract = {CRISPR-Cas genome-editing nucleases hold substantial promise for developing human therapeutic applications1-6 but identifying unwanted off-target mutations is important for clinical translation7. A well-validated method that can reliably identify off-targets in vivo has not been described to date, which means it is currently unclear whether and how frequently these mutations occur. Here we describe 'verification of in vivo off-targets' (VIVO), a highly sensitive strategy that can robustly identify the genome-wide off-target effects of CRISPR-Cas nucleases in vivo. We use VIVO and a guide RNA deliberately designed to be promiscuous to show that CRISPR-Cas nucleases can induce substantial off-target mutations in mouse livers in vivo. More importantly, we also use VIVO to show that appropriately designed guide RNAs can direct efficient in vivo editing in mouse livers with no detectable off-target mutations. VIVO provides a general strategy for defining and quantifying the off-target effects of gene-editing nucleases in whole organisms, thereby providing a blueprint to foster the development of therapeutic strategies that use in vivo gene editing.},
}
@article {pmid30209206,
year = {2018},
author = {Cubbon, A and Ivancic-Bace, I and Bolt, EL},
title = {CRISPR-Cas immunity, DNA repair and genome stability.},
journal = {Bioscience reports},
volume = {38},
number = {5},
pages = {},
pmid = {30209206},
issn = {1573-4935},
abstract = {Co-opting of CRISPR-Cas 'Interference' reactions for editing the genomes of eukaryotic and prokaryotic cells has highlighted crucial support roles for DNA repair systems that strive to maintain genome stability. As front-runners in genome editing that targets DNA, the class 2 CRISPR-Cas enzymes Cas9 and Cas12a rely on repair of DNA double-strand breaks (DDSBs) by host DNA repair enzymes, using mechanisms that vary in how well they are understood. Data are emerging about the identities of DNA repair enzymes that support genome editing in human cells. At the same time, it is becoming apparent that CRISPR-Cas systems functioning in their native environment, bacteria or archaea, also need DNA repair enzymes. In this short review, we survey how DNA repair and CRISPR-Cas systems are intertwined. We consider how understanding DNA repair and CRISPR-Cas interference reactions in nature might help improve the efficacy of genome editing procedures that utilise homologous or analogous systems in human and other cells.},
}
@article {pmid30208287,
year = {2018},
author = {Stanley, SY and Maxwell, KL},
title = {Phage-Encoded Anti-CRISPR Defenses.},
journal = {Annual review of genetics},
volume = {52},
number = {},
pages = {445-464},
doi = {10.1146/annurev-genet-120417-031321},
pmid = {30208287},
issn = {1545-2948},
abstract = {The battle for survival between bacteria and bacteriophages (phages) is an arms race where bacteria develop defenses to protect themselves from phages and phages evolve counterstrategies to bypass these defenses. CRISPR-Cas adaptive immune systems represent a widespread mechanism by which bacteria protect themselves from phage infection. In response to CRISPR-Cas, phages have evolved protein inhibitors known as anti-CRISPRs. Here, we describe the discovery and mechanisms of action of anti-CRISPR proteins. We discuss the potential impact of anti-CRISPRs on bacterial evolution, speculate on their evolutionary origins, and contemplate the possible next steps in the CRISPR-Cas evolutionary arms race. We also touch on the impact of anti-CRISPRs on the development of CRISPR-Cas-based biotechnological tools.},
}
@article {pmid30206235,
year = {2018},
author = {Wang, H and Guo, W and Mitra, J and Hegde, PM and Vandoorne, T and Eckelmann, BJ and Mitra, S and Tomkinson, AE and Van Den Bosch, L and Hegde, ML},
title = {Mutant FUS causes DNA ligation defects to inhibit oxidative damage repair in Amyotrophic Lateral Sclerosis.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3683},
pmid = {30206235},
issn = {2041-1723},
mesh = {Amyotrophic Lateral Sclerosis/*genetics/pathology ; CRISPR-Cas Systems/genetics ; Cell Line ; DNA/*metabolism ; DNA Damage/*genetics ; DNA Ligases/metabolism ; DNA Repair/*genetics ; Gene Knockout Techniques ; Genes, Dominant ; Humans ; Induced Pluripotent Stem Cells/metabolism ; Models, Biological ; Mutation/*genetics ; *Oxidative Stress ; Poly(ADP-ribose) Polymerases/metabolism ; RNA-Binding Protein FUS/*genetics ; Reactive Oxygen Species/metabolism ; X-ray Repair Cross Complementing Protein 1/metabolism ; },
abstract = {Genome damage and defective repair are etiologically linked to neurodegeneration. However, the specific mechanisms involved remain enigmatic. Here, we identify defects in DNA nick ligation and oxidative damage repair in a subset of amyotrophic lateral sclerosis (ALS) patients. These defects are caused by mutations in the RNA/DNA-binding protein FUS. In healthy neurons, FUS protects the genome by facilitating PARP1-dependent recruitment of XRCC1/DNA Ligase IIIα (LigIII) to oxidized genome sites and activating LigIII via direct interaction. We discover that loss of nuclear FUS caused DNA nick ligation defects in motor neurons due to reduced recruitment of XRCC1/LigIII to DNA strand breaks. Moreover, DNA ligation defects in ALS patient-derived iPSC lines carrying FUS mutations and in motor neurons generated therefrom are rescued by CRISPR/Cas9-mediated correction of mutation. Our findings uncovered a pathway of defective DNA ligation in FUS-linked ALS and suggest that LigIII-targeted therapies may prevent or slow down disease progression.},
}
@article {pmid30205462,
year = {2018},
author = {Hidalgo-Cantabrana, C and Sanozky-Dawes, R and Barrangou, R},
title = {Insights into the Human Virome Using CRISPR Spacers from Microbiomes.},
journal = {Viruses},
volume = {10},
number = {9},
pages = {},
pmid = {30205462},
issn = {1999-4915},
support = {support//North Carolina Agricultural Foundation/International ; internal support//North Carolina State University/International ; },
mesh = {*Biodiversity ; Clustered Regularly Interspaced Short Palindromic Repeats ; Humans ; Metagenomics ; *Microbiota ; Viruses/*classification/genetics/*isolation &amp; purification ; },
abstract = {Due to recent advances in next-generation sequencing over the past decade, our understanding of the human microbiome and its relationship to health and disease has increased dramatically. Yet, our insights into the human virome, and its interplay with important microbes that impact human health, is relatively limited. Prokaryotic and eukaryotic viruses are present throughout the human body, comprising a large and diverse population which influences several niches and impacts our health at various body sites. The presence of prokaryotic viruses like phages, has been documented at many different body sites, with the human gut being the richest ecological niche. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and associated proteins constitute the adaptive immune system of bacteria, which prevents attack by invasive nucleic acid. CRISPR-Cas systems function by uptake and integration of foreign genetic element sequences into the CRISPR array, which constitutes a genomic archive of iterative vaccination events. Consequently, CRISPR spacers can be investigated to reconstruct interplay between viruses and bacteria, and metagenomic sequencing data can be exploited to provide insights into host-phage interactions within a niche. Here, we show how the CRISPR spacer content of commensal and pathogenic bacteria can be used to determine the evidence of their phage exposure. This framework opens new opportunities for investigating host-virus dynamics in metagenomic data, and highlights the need to dedicate more efforts for virome sampling and sequencing.},
}
@article {pmid30203114,
year = {2018},
author = {Cai, B and Sun, S and Li, Z and Zhang, X and Ke, Y and Yang, J and Li, X},
title = {Application of CRISPR/Cas9 technologies combined with iPSCs in the study and treatment of retinal degenerative diseases.},
journal = {Human genetics},
volume = {137},
number = {9},
pages = {679-688},
pmid = {30203114},
issn = {1432-1203},
support = {81670875//National Natural Science Foundation of China/ ; 81500745//National Natural Science Foundation of China/ ; 18JCQNJC10700//Natural Science Foundation of Tianjin City/ ; 17JCYBJC27200//Natural Science Foundation of Tianjin City/ ; BJ-LM2015008L//the Dr. Henry Norman Bethune: LangMu Young Scientist scholarship/ ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Combined Modality Therapy ; Gene Editing ; *Genetic Therapy ; Humans ; Induced Pluripotent Stem Cells/*cytology ; Retinal Degeneration/genetics/*therapy ; Stem Cell Transplantation/*methods ; },
abstract = {Retinal degeneration diseases, such as age-related macular degeneration and retinitis pigmentosa, affect millions of people worldwide and are major causes of irreversible blindness. Effective treatments for retinal degeneration, including drug therapy, gene augmentation or transplantation approaches, have been widely investigated. Nevertheless, more research should be dedicated to therapeutic methods to improve future clinical treatments. Recently, with the rapid development of genome-editing technology, gene therapy has become a potentially effective treatment for retinal degeneration diseases. A clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system has been developed as a powerful genome-editing tool in ophthalmic studies. The CRISPR/Cas9 system has been widely applied in basic research to develop animal models and gene therapies in vivo. With the ability to self-renew and the potential to differentiate into different types of cells, induced pluripotent stem cells (iPSCs) have already been used as a promising tool for understanding disease pathophysiology and evaluating the effect of drug and gene therapeutics. iPSCs are also a cell source for autologous transplantation. In this review, we compared genome-editing strategies and highlighted the advantages and concerns of the CRISPR/Cas9 system. Moreover, the latest progress and applications of the CRISPR/Cas9 system and its combination with iPSCs for the treatment of retinal degenerative diseases are summarized.},
}
@article {pmid30201719,
year = {2018},
author = {Viegas, J},
title = {Profile of Dana Carroll.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {38},
pages = {9331-9333},
pmid = {30201719},
issn = {1091-6490},
mesh = {CRISPR-Cas Systems ; Gene Editing/*history/*methods ; History, 20th Century ; History, 21st Century ; Homologous Recombination ; Transcription Activator-Like Effector Nucleases/metabolism ; United States ; Zinc Finger Nucleases/metabolism ; },
}
@article {pmid30201710,
year = {2018},
author = {Benej, M and Hong, X and Vibhute, S and Scott, S and Wu, J and Graves, E and Le, QT and Koong, AC and Giaccia, AJ and Yu, B and Chen, SC and Papandreou, I and Denko, NC},
title = {Papaverine and its derivatives radiosensitize solid tumors by inhibiting mitochondrial metabolism.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {42},
pages = {10756-10761},
pmid = {30201710},
issn = {1091-6490},
support = {S10 OD020006/OD/NIH HHS/United States ; P01 CA067166/CA/NCI NIH HHS/United States ; R01 CA163581/CA/NCI NIH HHS/United States ; R15 CA202605/CA/NCI NIH HHS/United States ; P30 CA016058/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems ; Cell Hypoxia/*drug effects/radiation effects ; Cell Proliferation/drug effects/radiation effects ; Female ; Humans ; Lung Neoplasms/drug therapy/pathology/*radiotherapy ; Male ; Mice ; Mice, Inbred C57BL ; Mitochondria/*drug effects/metabolism/radiation effects ; NADH Dehydrogenase/*antagonists &amp; inhibitors/genetics ; Oxygen/*metabolism ; Papaverine/*pharmacology ; Phosphodiesterase Inhibitors/pharmacology ; Radiation Tolerance ; Radiation-Sensitizing Agents/*pharmacology ; Tumor Cells, Cultured ; Xenograft Model Antitumor Assays ; },
abstract = {Tumor hypoxia reduces the effectiveness of radiation therapy by limiting the biologically effective dose. An acute increase in tumor oxygenation before radiation treatment should therefore significantly improve the tumor cell kill after radiation. Efforts to increase oxygen delivery to the tumor have not shown positive clinical results. Here we show that targeting mitochondrial respiration results in a significant reduction of the tumor cells' demand for oxygen, leading to increased tumor oxygenation and radiation response. We identified an activity of the FDA-approved drug papaverine as an inhibitor of mitochondrial complex I. We also provide genetic evidence that papaverine's complex I inhibition is directly responsible for increased oxygenation and enhanced radiation response. Furthermore, we describe derivatives of papaverine that have the potential to become clinical radiosensitizers with potentially fewer side effects. Importantly, this radiosensitizing strategy will not sensitize well-oxygenated normal tissue, thereby increasing the therapeutic index of radiotherapy.},
}
@article {pmid30201707,
year = {2018},
author = {Yarrington, RM and Verma, S and Schwartz, S and Trautman, JK and Carroll, D},
title = {Nucleosomes inhibit target cleavage by CRISPR-Cas9 in vivo.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {38},
pages = {9351-9358},
pmid = {30201707},
issn = {1091-6490},
support = {R01 GM078571/GM/NIGMS NIH HHS/United States ; },
mesh = {Bacterial Proteins/metabolism ; Base Sequence ; Binding Sites/genetics ; CRISPR-Associated Protein 9 ; *CRISPR-Cas Systems ; Chromatin/genetics/metabolism ; DNA, Fungal/genetics/metabolism ; Deoxyribonucleases, Type II Site-Specific/genetics ; Endonucleases/metabolism ; Gene Editing/*methods ; Genomics/*methods ; Nucleosomes/*genetics/metabolism ; Promoter Regions, Genetic/genetics ; Saccharomyces cerevisiae Proteins/genetics ; Zinc Finger Nucleases/metabolism ; },
abstract = {Genome editing with CRISPR-Cas nucleases has been applied successfully to a wide range of cells and organisms. There is, however, considerable variation in the efficiency of cleavage and outcomes at different genomic targets, even within the same cell type. Some of this variability is likely due to the inherent quality of the interaction between the guide RNA and the target sequence, but some may also reflect the relative accessibility of the target. We investigated the influence of chromatin structure, particularly the presence or absence of nucleosomes, on cleavage by the Streptococcus pyogenes Cas9 protein. At multiple target sequences in two promoters in the yeast genome, we find that Cas9 cleavage is strongly inhibited when the DNA target is within a nucleosome. This inhibition is relieved when nucleosomes are depleted. Remarkably, the same is not true of zinc-finger nucleases (ZFNs), which cleave equally well at nucleosome-occupied and nucleosome-depleted sites. These results have implications for the choice of specific targets for genome editing, both in research and in clinical and other practical applications.},
}
@article {pmid30199041,
year = {2018},
author = {Haupt, A and Grancharova, T and Arakaki, J and Fuqua, MA and Roberts, B and Gunawardane, RN},
title = {Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {138},
pages = {},
pmid = {30199041},
issn = {1940-087X},
mesh = {CRISPR-Cas Systems/*immunology ; Cells, Cultured ; Humans ; Induced Pluripotent Stem Cells/*metabolism ; },
abstract = {A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame N- or C-terminal fluorescent tags. The prokaryotic CRISPR/Cas9 system (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) may be used to introduce large exogenous sequences into genomic loci via homology directed repair (HDR). To achieve the desired knock-in, this protocol employs the ribonucleoprotein (RNP)-based approach where wild type Streptococcus pyogenes Cas9 protein, synthetic 2-part guide RNA (gRNA), and a donor template plasmid are delivered to the cells via electroporation. Putatively edited cells expressing the fluorescently tagged proteins are enriched by fluorescence activated cell sorting (FACS). Clonal lines are then generated and can be analyzed for precise editing outcomes. By introducing the fluorescent tag at the genomic locus of the gene of interest, the resulting subcellular localization and dynamics of the fusion protein can be studied under endogenous regulatory control, a key improvement over conventional overexpression systems. The use of hiPSCs as a model system for gene tagging provides the opportunity to study the tagged proteins in diploid, nontransformed cells. Since hiPSCs can be differentiated into multiple cell types, this approach provides the opportunity to create and study tagged proteins in a variety of isogenic cellular contexts.},
}
@article {pmid30198342,
year = {2018},
author = {Dangi, AK and Sharma, B and Hill, RT and Shukla, P},
title = {Bioremediation through microbes: systems biology and metabolic engineering approach.},
journal = {Critical reviews in biotechnology},
volume = {},
number = {},
pages = {1-20},
doi = {10.1080/07388551.2018.1500997},
pmid = {30198342},
issn = {1549-7801},
abstract = {Today, environmental pollution is a serious problem, and bioremediation can play an important role in cleaning contaminated sites. Remediation strategies, such as chemical and physical approaches, are not enough to mitigate pollution problems because of the continuous generation of novel recalcitrant pollutants due to anthropogenic activities. Bioremediation using microbes is an eco-friendly and socially acceptable alternative to conventional remediation approaches. Many microbes with a bioremediation potential have been isolated and characterized but, in many cases, cannot completely degrade the targeted pollutant or are ineffective in situations with mixed wastes. This review envisages advances in systems biology (SB), which enables the analysis of microbial behavior at a community level under different environmental stresses. By applying a SB approach, crucial preliminary information can be obtained for metabolic engineering (ME) of microbes for their enhanced bioremediation capabilities. This review also highlights the integrated SB and ME tools and techniques for bioremediation purposes.},
}
@article {pmid30195930,
year = {2018},
author = {St John, E and Liu, Y and Podar, M and Stott, MB and Meneghin, J and Chen, Z and Lagutin, K and Mitchell, K and Reysenbach, AL},
title = {A new symbiotic nanoarchaeote (Candidatus Nanoclepta minutus) and its host (Zestosphaera tikiterensis gen. nov., sp. nov.) from a New Zealand hot spring.},
journal = {Systematic and applied microbiology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.syapm.2018.08.005},
pmid = {30195930},
issn = {1618-0984},
abstract = {Three thermophilic Nanoarchaeota-Crenarchaeota symbiotic systems have been described. We obtained another stable anaerobic enrichment culture at 80°C, pH 6.0 from a New Zealand hot spring. The nanoarchaeote (Ncl-1) and its host (NZ3T) were isolated in co-culture and their genomes assembled. The small (∼200nm) flagellated cocci were often attached to larger cocci. Based on 16S rRNA gene similarity (88.4%) and average amino acid identity (52%), Ncl-1 is closely related to Candidatus Nanopusillus acidilobi. Their genomes both encode for archaeal flagella and partial glycolysis and gluconeogenesis pathways, but lack ATP synthase genes. Like Nanoarchaeum equitans, Ncl-1 has a CRISPR-Cas system. Ncl-1 also relies on its crenarchaeotal host for most of its biosynthetic needs. The host NZ3T was isolated and grows on proteinaceous substrates but not on sugars, alcohols, or fatty acids. NZ3T requires thiosulfate and grows best at 82°C, pH 6.0. NZ3T is most closely related to the Desulfurococcaceae, Ignisphaera aggregans (∼92% 16S rRNA gene sequence similarity, 45% AAI). Based on phylogenetic, physiological and genomic data, Ncl-1 and NZ3T represent novel genera in the Nanoarchaeota and the Desulfurococcaceae, respectively, with the proposed names Candidatus Nanoclepta minutus and Zestosphaera tikiterensis gen. nov., sp. nov., type strain NZ3T (=DSMZ 107634T=OCM 1213T).},
}
@article {pmid30195753,
year = {2018},
author = {Gao, Z and Herrera-Carrillo, E and Berkhout, B},
title = {RNA Polymerase II Activity of Type 3 Pol III Promoters.},
journal = {Molecular therapy. Nucleic acids},
volume = {12},
number = {},
pages = {135-145},
pmid = {30195753},
issn = {2162-2531},
abstract = {In eukaryotes, three RNA polymerases (Pol I, II, and III) are responsible for the transcription of distinct subsets of genes. Gene-external type 3 Pol III promoters use defined transcription start and termination sites, and they are, therefore, widely used for small RNA expression, including short hairpin RNAs in RNAi applications and guide RNAs in CRISPR-Cas systems. We report that all three commonly used human Pol III promoters (7SK, U6, and H1) mediate luciferase reporter gene expression, which indicates Pol II activity, but to a different extent (H1 ≫ U6 > 7SK). We demonstrate that these promoters can recruit Pol II for transcribing extended messenger transcripts. Intriguingly, selective inhibition of Pol II stimulates the Pol III activity and vice versa, suggesting that two polymerase complexes compete for promoter usage. Pol II initiates transcription at the regular Pol III start site on the 7SK and U6 promoters, but Pol II transcription on the most active H1 promoter starts 8 nt upstream of the Pol III start site. This study provides functional evidence for the close relationship of Pol II and Pol III transcription. These mechanistic insights are important for optimal use of Pol III promoters, and they offer additional flexibility for biotechnology applications of these genetic elements.},
}
@article {pmid30195321,
year = {2018},
author = {Karagyaur, MN and Rubtsov, YP and Vasiliev, PA and Tkachuk, VA},
title = {Practical Recommendations for Improving Efficiency and Accuracy of the CRISPR/Cas9 Genome Editing System.},
journal = {Biochemistry. Biokhimiia},
volume = {83},
number = {6},
pages = {629-642},
doi = {10.1134/S0006297918060020},
pmid = {30195321},
issn = {1608-3040},
mesh = {CRISPR-Cas Systems/*genetics ; DNA Breaks ; DNA Repair ; Gene Editing/*methods ; Genetic Vectors/genetics/metabolism ; Humans ; RNA, Guide/chemistry/metabolism ; },
abstract = {CRISPR/Cas9 genome-editing system is a powerful, fairly accurate, and efficient tool for modifying genomic DNA. Despite obvious advantages, it is not devoid of certain drawbacks, such as propensity for introduction of additional nonspecific DNA breaks, insufficient activity against aneuploid genomes, and relative difficulty in delivering its components to cells. In this review, we focus on the difficulties that can limit the use of CRISPR/Cas9 and suggest a number of practical recommendations and information sources that will make it easier for the beginners to work with this outstanding technological achievement of the XXI century.},
}
@article {pmid30194297,
year = {2018},
author = {Bin Moon, S and Lee, JM and Kang, JG and Lee, NE and Ha, DI and Kim, DY and Kim, SH and Yoo, K and Kim, D and Ko, JH and Kim, YS},
title = {Highly efficient genome editing by CRISPR-Cpf1 using CRISPR RNA with a uridinylate-rich 3'-overhang.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3651},
pmid = {30194297},
issn = {2041-1723},
support = {NRF-2016M3A9B6903343//National Research Foundation of Korea (NRF)/International ; },
mesh = {*CRISPR-Cas Systems ; Francisella ; Gene Editing/*methods ; HEK293 Cells ; Humans ; Prevotella ; },
abstract = {Genome editing has been harnessed through the development of CRISPR system, and the CRISPR from Prevotella and Francisella 1 (Cpf1) system has emerged as a promising alternative to CRISPR-Cas9 for use in various circumstances. Despite the inherent multiple advantages of Cpf1 over Cas9, the adoption of Cpf1 has been unsatisfactory because of target-dependent insufficient indel efficiencies. Here, we report an engineered CRISPR RNA (crRNA) for highly efficient genome editing by Cpf1, which includes a 20-base target-complementary sequence and a uridinylate-rich 3'-overhang. When the crRNA is transcriptionally produced, crRNA with a 20-base target-complementary sequence plus a U4AU4 3'-overhang is the optimal configuration. U-rich crRNA also maximizes the utility of the AsCpf1 mutants and multiplexing genome editing using mRNA as the source of multiple crRNAs. Furthermore, U-rich crRNA enables a highly safe and specific genome editing using Cpf1 in human cells, contributing to the enhancement of a genome-editing toolbox.},
}
@article {pmid30193985,
year = {2018},
author = {Faure, G and Makarova, KS and Koonin, EV},
title = {CRISPR-Cas: Complex Functional Networks and Multiple Roles beyond Adaptive Immunity.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.08.030},
pmid = {30193985},
issn = {1089-8638},
abstract = {CRISPR-Cas is a prokaryotic adaptive immune system that functions by incorporating fragments of foreign DNA into CRISPR arrays. The arrays containing spacers derived from foreign DNA are transcribed, and the transcripts are processed to generate spacer-containing mature CRISPR-RNAs that are employed as guides to specifically recognize and cleave the DNA or RNA of the cognate parasitic genetic elements. The CRISPR-Cas systems show remarkable complexity and diversity of molecular organization and appear to be involved in various cellular functions that are distinct from, even if connected to, adaptive immunity. In this review, we discuss some of such functional links of CRISPR-Cas systems including their effect on horizontal gene transfer that can be either inhibitory or stimulatory, connections between CRISPR-Cas and DNA repair systems as well as programmed cell death and signal transduction mechanisms, and potential role of CRISPR-Cas in transposon integration and plasmid maintenance. The interplay between the primary function of CRISPR-Cas as an adaptive immunity mechanism and these other roles defines the richness of the biological effects of these systems and affects their spread among bacteria and archaea.},
}
@article {pmid30193161,
year = {2018},
author = {Vogel, P and Stafforst, T},
title = {Critical review on engineering deaminases for site-directed RNA editing.},
journal = {Current opinion in biotechnology},
volume = {55},
number = {},
pages = {74-80},
doi = {10.1016/j.copbio.2018.08.006},
pmid = {30193161},
issn = {1879-0429},
abstract = {The game-changing role of CRISPR/Cas for genome editing draw interest to programmable RNA-guided tools in general. Currently, we see a wave of papers pioneering the CRISPR/Cas system for RNA targeting, and applying them for site-directed RNA editing. Here, we exemplarily compare three recent RNA editing strategies that rely on three distinct RNA targeting mechanisms. We conclude that the CRISPR/Cas system seems not generally superior to other RNA targeting strategies in solving the most pressing problem in the RNA editing field, which is to obtain high efficiency in combination with high specificity. However, once achieved, RNA editing promises to complement or even outcompete DNA editing approaches in therapy, and also in some fields of basic research.},
}
@article {pmid30190322,
year = {2018},
author = {Shen, Y and Cohen, JL and Nicoloro, SM and Kelly, M and Yenilmez, B and Henriques, F and Tsagkaraki, E and Edwards, YJK and Hu, X and Friedline, RH and Kim, JK and Czech, MP},
title = {CRISPR-delivery particles targeting nuclear receptor-interacting protein 1 (Nrip1) in adipose cells to enhance energy expenditure.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {44},
pages = {17291-17305},
pmid = {30190322},
issn = {1083-351X},
support = {R01 DK030898/DK/NIDDK NIH HHS/United States ; R01 DK103047/DK/NIDDK NIH HHS/United States ; R37 DK030898/DK/NIDDK NIH HHS/United States ; U2C DK093000/DK/NIDDK NIH HHS/United States ; },
abstract = {RNA-guided, engineered nucleases derived from the prokaryotic adaptive immune system CRISPR-Cas represent a powerful platform for gene deletion and editing. When used as a therapeutic approach, direct delivery of Cas9 protein and single-guide RNA (sgRNA) could circumvent the safety issues associated with plasmid delivery and therefore represents an attractive tool for precision genome engineering. Gene deletion or editing in adipose tissue to enhance its energy expenditure, fatty acid oxidation, and secretion of bioactive factors through a &quot;browning&quot; process presents a potential therapeutic strategy to alleviate metabolic disease. Here, we developed &quot;CRISPR-delivery particles,&quot; denoted CriPs, composed of nano-size complexes of Cas9 protein and sgRNA that are coated with an amphipathic peptide called Endo-Porter that mediates entry into cells. Efficient CRISPR-Cas9-mediated gene deletion of ectopically expressed GFP by CriPs was achieved in multiple cell types, including a macrophage cell line, primary macrophages, and primary pre-adipocytes. Significant GFP loss was also observed in peritoneal exudate cells with minimum systemic toxicity in GFP-expressing mice following intraperitoneal injection of CriPs containing Gfp-targeting sgRNA. Furthermore, disruption of a nuclear co-repressor of catabolism, the Nrip1 gene, in white adipocytes by CriPs enhanced adipocyte browning with a marked increase of uncoupling protein 1 (UCP1) expression. Of note, the CriP-mediated Nrip1 deletion did not produce detectable off-target effects. We conclude that CriPs offer an effective Cas9 and sgRNA delivery system for ablating targeted gene products in cultured cells and in vivo, providing a potential therapeutic strategy for metabolic disease.},
}
@article {pmid30190308,
year = {2018},
author = {Marino, ND and Zhang, JY and Borges, AL and Sousa, AA and Leon, LM and Rauch, BJ and Walton, RT and Berry, JD and Joung, JK and Kleinstiver, BP and Bondy-Denomy, J},
title = {Discovery of widespread type I and type V CRISPR-Cas inhibitors.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6411},
pages = {240-242},
doi = {10.1126/science.aau5174},
pmid = {30190308},
issn = {1095-9203},
support = {DP5 OD021344/OD/NIH HHS/United States ; R01 GM127489/GM/NIGMS NIH HHS/United States ; K99 CA218870/CA/NCI NIH HHS/United States ; R35 GM118158/GM/NIGMS NIH HHS/United States ; },
mesh = {Bacterial Proteins/*antagonists &amp; inhibitors/chemistry/genetics/metabolism ; *CRISPR-Cas Systems ; Cell Line ; Computational Biology/methods ; Endonucleases/*antagonists &amp; inhibitors ; *Gene Editing ; Humans ; Moraxella/*genetics ; Pseudomonas/*genetics ; },
abstract = {Bacterial CRISPR-Cas systems protect their host from bacteriophages and other mobile genetic elements. Mobile elements, in turn, encode various anti-CRISPR (Acr) proteins to inhibit the immune function of CRISPR-Cas. To date, Acr proteins have been discovered for type I (subtypes I-D, I-E, and I-F) and type II (II-A and II-C) but not other CRISPR systems. Here, we report the discovery of 12 acr genes, including inhibitors of type V-A and I-C CRISPR systems. AcrVA1 inhibits a broad spectrum of Cas12a (Cpf1) orthologs-including MbCas12a, Mb3Cas12a, AsCas12a, and LbCas12a-when assayed in human cells. The acr genes reported here provide useful biotechnological tools and mark the discovery of acr loci in many bacteria and phages.},
}
@article {pmid30190307,
year = {2018},
author = {Watters, KE and Fellmann, C and Bai, HB and Ren, SM and Doudna, JA},
title = {Systematic discovery of natural CRISPR-Cas12a inhibitors.},
journal = {Science (New York, N.Y.)},
volume = {362},
number = {6411},
pages = {236-239},
pmid = {30190307},
issn = {1095-9203},
support = {K99 GM118909/GM/NIGMS NIH HHS/United States ; R00 GM118909/GM/NIGMS NIH HHS/United States ; },
mesh = {Bacterial Proteins/*antagonists &amp; inhibitors/chemistry/genetics/metabolism ; *CRISPR-Cas Systems ; Cell Line ; Computational Biology/methods ; DNA Cleavage ; Endonucleases/*antagonists &amp; inhibitors ; *Gene Editing ; Genome, Bacterial ; Humans ; Moraxella/*genetics ; },
abstract = {Cas12a (Cpf1) is a CRISPR-associated nuclease with broad utility for synthetic genome engineering, agricultural genomics, and biomedical applications. Although bacteria harboring CRISPR-Cas9 or CRISPR-Cas3 adaptive immune systems sometimes acquire mobile genetic elements encoding anti-CRISPR proteins that inhibit Cas9, Cas3, or the DNA-binding Cascade complex, no such inhibitors have been found for CRISPR-Cas12a. Here we use a comprehensive bioinformatic and experimental screening approach to identify three different inhibitors that block or diminish CRISPR-Cas12a-mediated genome editing in human cells. We also find a widespread connection between CRISPR self-targeting and inhibitor prevalence in prokaryotic genomes, suggesting a straightforward path to the discovery of many more anti-CRISPRs from the microbial world.},
}
@article {pmid30189348,
year = {2018},
author = {Verkuijl, SA and Rots, MG},
title = {The influence of eukaryotic chromatin state on CRISPR-Cas9 editing efficiencies.},
journal = {Current opinion in biotechnology},
volume = {55},
number = {},
pages = {68-73},
doi = {10.1016/j.copbio.2018.07.005},
pmid = {30189348},
issn = {1879-0429},
abstract = {CRISPR/Cas technologies have rapidly become in routine use for site-directed genetic or transcriptional manipulation. Despite this, the efficiency of CRISPR/Cas9 functioning cannot entirely be predicted, and it is not fully understood which factors contribute to this variability. Recent studies indicate that heterochromatin can negatively affect Cas9 binding and functioning. Investigating chromatin factors indicates that DNA cytosine-5 methylation does not directly block Cas9 binding. Nucleosomes, however, can completely block Cas9 access to DNA in cell-free assays and present a substantial hurdle in vivo. In addition to being associated with an open chromatin state, active transcription can directly stimulate DNA cleavage by influencing Cas9 release rates in a strand-specific manner. With these insights and a better understanding of genome-wide chromatin and transcription states, CRISPR/Cas9 effectiveness and reliability can be improved.},
}
@article {pmid30189098,
year = {2018},
author = {Radovcic, M and Killelea, T and Savitskaya, E and Wettstein, L and Bolt, EL and Ivancic-Bace, I},
title = {CRISPR-Cas adaptation in Escherichia coli requires RecBCD helicase but not nuclease activity, is independent of homologous recombination, and is antagonized by 5' ssDNA exonucleases.},
journal = {Nucleic acids research},
volume = {46},
number = {19},
pages = {10173-10183},
pmid = {30189098},
issn = {1362-4962},
abstract = {Prokaryotic adaptive immunity is established against mobile genetic elements (MGEs) by 'naïve adaptation' when DNA fragments from a newly encountered MGE are integrated into CRISPR-Cas systems. In Escherichia coli, DNA integration catalyzed by Cas1-Cas2 integrase is well understood in mechanistic and structural detail but much less is known about events prior to integration that generate DNA for capture by Cas1-Cas2. Naïve adaptation in E. coli is thought to depend on the DNA helicase-nuclease RecBCD for generating DNA fragments for capture by Cas1-Cas2. The genetics presented here show that naïve adaptation does not require RecBCD nuclease activity but that helicase activity may be important. RecA loading by RecBCD inhibits adaptation explaining previously observed adaptation phenotypes that implicated RecBCD nuclease activity. Genetic analysis of other E. coli nucleases and naïve adaptation revealed that 5' ssDNA tailed DNA molecules promote new spacer acquisition. We show that purified E. coli Cas1-Cas2 complex binds to and nicks 5' ssDNA tailed duplexes and propose that E. coli Cas1-Cas2 nuclease activity on such DNA structures supports naïve adaptation.},
}
@article {pmid30187755,
year = {2018},
author = {Yang, W and Restrepo-Pérez, L and Bengtson, M and Heerema, SJ and Birnie, A and van der Torre, J and Dekker, C},
title = {Detection of CRISPR-dCas9 on DNA with Solid-State Nanopores.},
journal = {Nano letters},
volume = {18},
number = {10},
pages = {6469-6474},
pmid = {30187755},
issn = {1530-6992},
mesh = {Binding Sites ; Biosensing Techniques/*methods ; CRISPR-Cas Systems/*genetics ; DNA/chemistry/genetics/*isolation &amp; purification ; Humans ; *Nanopores ; RNA, Guide/chemistry/genetics ; },
abstract = {Solid-state nanopores have emerged as promising platforms for biosensing including diagnostics for disease detection. Here we show nanopore experiments that detect CRISPR-dCas9, a sequence-specific RNA-guided protein system that specifically binds to a target DNA sequence. While CRISPR-Cas9 is acclaimed for its gene editing potential, the CRISPR-dCas9 variant employed here does not cut DNA but instead remains tightly bound at a user-defined binding site, thus providing an excellent target for biosensing. In our nanopore experiments, we observe the CRISPR-dCas9 proteins as local spikes that appear on top of the ionic current blockade signal of DNA molecules that translocate through the nanopore. The proteins exhibit a pronounced blockade signal that allows for facile identification of the targeted sequence. Even at the high salt conditions (1 M LiCl) required for nanopore experiments, dCas9 proteins are found to remain stably bound. The binding position of the target sequence can be read from the spike position along the DNA signal. We anticipate applications of this nanopore-based CRISPR-dCas9 biosensing approach in DNA-typing based diagnostics such as quick disease-strain identification, antibiotic-resistance detection, and genome typing.},
}
@article {pmid30185555,
year = {2018},
author = {Wall, RJ and Rico, E and Lukac, I and Zuccotto, F and Elg, S and Gilbert, IH and Freund, Y and Alley, MRK and Field, MC and Wyllie, S and Horn, D},
title = {Clinical and veterinary trypanocidal benzoxaboroles target CPSF3.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {38},
pages = {9616-9621},
pmid = {30185555},
issn = {1091-6490},
support = {105021/Z/14/Z//Wellcome Trust/United Kingdom ; MR/K008749/1//Medical Research Council/United Kingdom ; //Wellcome Trust/United Kingdom ; 100320/Z/12/Z//Wellcome Trust/United Kingdom ; 203134/Z/16/Z//Wellcome Trust/United Kingdom ; },
mesh = {Animals ; Benzamides/pharmacology/therapeutic use ; Boron Compounds/pharmacology/therapeutic use ; CRISPR-Cas Systems ; Cell Nucleus/genetics/metabolism ; Cleavage And Polyadenylation Specificity Factor/*antagonists &amp; inhibitors/genetics/metabolism ; Drug Resistance/drug effects/genetics ; Gene Knockdown Techniques ; Gene Library ; High-Throughput Screening Assays/methods ; Humans ; Molecular Docking Simulation ; Protozoan Proteins/*antagonists &amp; inhibitors/genetics/metabolism ; RNA Processing, Post-Transcriptional/drug effects ; RNA, Messenger/metabolism ; RNA, Protozoan/metabolism ; Trypanocidal Agents/*pharmacology/therapeutic use ; Trypanosoma brucei brucei/drug effects/*physiology ; Trypanosomiasis, African/*prevention &amp; control/transmission/veterinary ; Valine/analogs &amp; derivatives/pharmacology/therapeutic use ; },
abstract = {African trypanosomes cause lethal and neglected tropical diseases, known as sleeping sickness in humans and nagana in animals. Current therapies are limited, but fortunately, promising therapies are in advanced clinical and veterinary development, including acoziborole (AN5568 or SCYX-7158) and AN11736, respectively. These benzoxaboroles will likely be key to the World Health Organization's target of disease control by 2030. Their mode of action was previously unknown. We have developed a high-coverage overexpression library and use it here to explore drug mode of action in Trypanosoma brucei Initially, an inhibitor with a known target was used to select for drug resistance and to test massive parallel library screening and genome-wide mapping; this effectively identified the known target and validated the approach. Subsequently, the overexpression screening approach was used to identify the target of the benzoxaboroles, Cleavage and Polyadenylation Specificity Factor 3 (CPSF3, Tb927.4.1340). We validated the CPSF3 endonuclease as the target, using independent overexpression strains. Knockdown provided genetic validation of CPSF3 as essential, and GFP tagging confirmed the expected nuclear localization. Molecular docking and CRISPR-Cas9-based editing demonstrated how acoziborole can specifically block the active site and mRNA processing by parasite, but not host CPSF3. Thus, our findings provide both genetic and chemical validation for CPSF3 as an important drug target in trypanosomes and reveal inhibition of mRNA maturation as the mode of action of the trypanocidal benzoxaboroles. Understanding the mechanism of action of benzoxaborole-based therapies can assist development of improved therapies, as well as the prediction and monitoring of resistance, if or when it arises.},
}
@article {pmid30183125,
year = {2018},
author = {Ortigosa, A and Gimenez-Ibanez, S and Leonhardt, N and Solano, R},
title = {Design of a bacterial speck resistant tomato by CRISPR/Cas9-mediated editing of SlJAZ2.},
journal = {Plant biotechnology journal},
volume = {},
number = {},
pages = {},
doi = {10.1111/pbi.13006},
pmid = {30183125},
issn = {1467-7652},
support = {//Severo Ochoa/ ; BIO2014-55884-JIN//Spanish Ministry for Science and Innovation/ ; BIO2016-77216-R (AEI/FEDER, UE)//Spanish Ministry for Science and Innovation/ ; 2015007//ANR program/ ; },
abstract = {Due to their different lifestyles, effective defence against biotrophic pathogens normally leads to increased susceptibility to necrotrophs, and vice versa. Solving this trade-off is a major challenge for obtaining broad-spectrum resistance in crops and requires uncoupling the antagonism between the jasmonate (JA) and salicylate (SA) defence pathways. Pseudomonas syringae pv. tomato (Pto) DC3000, the causal agent of tomato bacterial speck disease, produces coronatine (COR) that stimulates stomata opening and facilitates bacterial leaf colonization. In Arabidopsis, stomata response to COR requires the COR co-receptor AtJAZ2, and dominant AtJAZ2Δjas repressors resistant to proteasomal degradation prevent stomatal opening by COR. Here, we report the generation of a tomato variety resistant to the bacterial speck disease caused by PtoDC3000 without compromising resistance to necrotrophs. We identified the functional ortholog of AtJAZ2 in tomato, found that preferentially accumulates in stomata and proved that SlJAZ2 is a major co-receptor of COR in stomatal guard cells. SlJAZ2 was edited using CRISPR/Cas9 to generate dominant JAZ2 repressors lacking the C-terminal Jas domain (SlJAZ2Δjas). SlJAZ2Δjas prevented stomatal reopening by COR and provided resistance to PtoDC3000. Water transpiration rate and resistance to the necrotrophic fungal pathogen Botrytis cinerea, causal agent of the tomato gray mold, remained unaltered in Sljaz2Δjas plants. Our results solve the defence trade-off in a crop, by spatially uncoupling the SA-JA hormonal antagonism at the stomata, entry gates of specific microbes such as PtoDC3000. Moreover, our results also constitute a novel CRISPR/Cas-based strategy for crop protection that could be readily implemented in the field.},
}
@article {pmid30180552,
year = {2018},
author = {Tian, H and Luo, J and Zhang, Z and Wu, J and Zhang, T and Busato, S and Huang, L and Song, N and Bionaz, M},
title = {CRISPR/Cas9-mediated Stearoyl-CoA Desaturase 1 (SCD1) Deficiency Affects Fatty Acid Metabolism in Goat Mammary Epithelial Cells.},
journal = {Journal of agricultural and food chemistry},
volume = {66},
number = {38},
pages = {10041-10052},
doi = {10.1021/acs.jafc.8b03545},
pmid = {30180552},
issn = {1520-5118},
mesh = {Animals ; Animals, Genetically Modified/*genetics/metabolism ; CRISPR-Cas Systems ; Epithelial Cells/*enzymology/metabolism ; Fatty Acids/*metabolism ; Female ; Gene Deletion ; Gene Knockout Techniques/*methods ; Goats/*genetics/metabolism ; Lipogenesis ; Mammary Glands, Animal/cytology/*enzymology/metabolism ; Milk/chemistry/metabolism ; Stearoyl-CoA Desaturase/*deficiency/genetics ; Sterol Regulatory Element Binding Protein 1/genetics/metabolism ; Triglycerides/metabolism ; },
abstract = {Stearoyl-CoA desaturase 1 (SCD1) is a fatty acid desaturase catalyzing cis-double-bond formation in the Δ9 position to produce monounsaturated fatty acids essential for the synthesis of milk fat. Previous studies using RNAi methods have provided support for a role of SCD1 in goat mammary epithelial cells (GMEC); however, RNAi presents several limitations that might preclude a truthful understanding of the biological function of SCD1. To explore the function of SCD1 on fatty acid metabolism in GMEC, we used CRISPR-Cas9-mediated SCD1 knockout through non-homologous end-joining (NHEJ) and homology-directed repair (HDR) pathways in GMEC. We successfully introduced nucleotide deletions and mutations in the SCD1 gene locus through the NHEJ pathway and disrupted its second exon via insertion of an EGFP-PuroR segment using the HDR pathway. In clones derived from the latter, gene- and protein-expression data indicated that we obtained a monoallelic SCD1 knockout. A T7EN1-mediated assay revealed no off-targets in the surveyed sites. The contents of triacylglycerol and cholesterol and the desaturase index were significantly decreased as a consequence of SCD1 knockout. The deletion of SCD1 decreased the expression of other genes involved in de novo fatty acid synthesis, including SREBF1 and FASN, as well the fatty acid transporters FABP3 and FABP4. The downregulation of these genes partly explains the decrease of intracellular triacylglycerols. Our results indicate a successful SCD1 knockout in goat mammary cells using CRISPR-Cas9. The demonstration of the successful use of CRISPR-Cas9 in GMEC is an important step to producing transgenic goats to study mammary biology in vivo.},
}
@article {pmid30176818,
year = {2018},
author = {Sanders, SM and Ma, Z and Hughes, JM and Riscoe, BM and Gibson, GA and Watson, AM and Flici, H and Frank, U and Schnitzler, CE and Baxevanis, AD and Nicotra, ML},
title = {CRISPR/Cas9-mediated gene knockin in the hydroid Hydractinia symbiolongicarpus.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {649},
pmid = {30176818},
issn = {1471-2164},
support = {ZIA-HG000140//National Human Genome Research Institute/ ; T32 AI074490/AI/NIAID NIH HHS/United States ; ZIA HG000140/HG/NHGRI NIH HHS/United States ; 11/PI/1020//Science Foundation Ireland/Ireland ; IOS1557339//Division of Integrative Organismal Systems/ ; T32AI074490//National Institutes of Health/ ; },
mesh = {Animals ; *CRISPR-Cas Systems ; *Gene Editing ; *Gene Knock-In Techniques ; Genetic Vectors ; Homologous Recombination ; Hydrozoa/*genetics/growth &amp; development ; Peptide Elongation Factor 1/*genetics ; Transgenes ; },
abstract = {BACKGROUND: Hydractinia symbiolongicarpus, a colonial cnidarian, is a tractable model system for many cnidarian-specific and general biological questions. Until recently, tests of gene function in Hydractinia have relied on laborious forward genetic approaches, randomly integrated transgenes, or transient knockdown of mRNAs.<br><br>RESULTS: Here, we report the use of CRISPR/Cas9 genome editing to generate targeted genomic insertions in H. symbiolonigcarpus. We used CRISPR/Cas9 to promote homologous recombination of two fluorescent reporters, eGFP and tdTomato, into the Eukaryotic elongation factor 1 alpha (Eef1a) locus. We demonstrate that the transgenes are expressed ubiquitously and are stable over two generations of breeding. We further demonstrate that CRISPR/Cas9 genome editing can be used to mark endogenous proteins with FLAG or StrepII-FLAG affinity tags to enable in vivo and ex vivo protein studies.<br><br>CONCLUSIONS: This is the first account of CRISPR/Cas9 mediated knockins in Hydractinia and the first example of the germline transmission of a CRISPR/Cas9 inserted transgene in a cnidarian. The ability to precisely insert exogenous DNA into the Hydractinia genome will enable sophisticated genetic studies and further development of functional genomics tools in this understudied cnidarian model.},
}
@article {pmid30174653,
year = {2018},
author = {Tagini, F and Pillonel, T and Croxatto, A and Bertelli, C and Koutsokera, A and Lovis, A and Greub, G},
title = {Distinct Genomic Features Characterize Two Clades of Corynebacterium diphtheriae: Proposal of Corynebacterium diphtheriae Subsp. diphtheriae Subsp. nov. and Corynebacterium diphtheriae Subsp. lausannense Subsp. nov.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1743},
pmid = {30174653},
issn = {1664-302X},
abstract = {Corynebacterium diphtheriae is the etiological agent of diphtheria, a disease caused by the presence of the diphtheria toxin. However, an increasing number of records report non-toxigenic C. diphtheriae infections. Here, a C. diphtheriae strain was recovered from a patient with a past history of bronchiectasis who developed a severe tracheo-bronchitis with multiple whitish lesions of the distal trachea and the mainstem bronchi. Whole-genome sequencing (WGS), performed in parallel with PCR targeting the toxin gene and the Elek test, provided clinically relevant results in a short turnaround time, showing that the isolate was non-toxigenic. A comparative genomic analysis of the new strain (CHUV2995) with 56 other publicly available genomes of C. diphtheriae revealed that the strains CHUV2995, CCUG 5865 and CMCNS703 share a lower average nucleotide identity (ANI) (95.24 to 95.39%) with the C. diphtheriae NCTC 11397T reference genome than all other C. diphtheriae genomes (>98.15%). Core genome phylogeny confirmed the presence of two monophyletic clades. Based on these findings, we propose here two new C. diphtheriae subspecies to replace the lineage denomination used in previous multilocus sequence typing studies: C. diphtheriae subsp. lausannense subsp. nov. (instead of lineage-2), regrouping strains CHUV2995, CCUG 5865, and CMCNS703, and C. diphtheriae subsp. diphtheriae subsp. nov, regrouping all other C. diphtheriae in the dataset (instead of lineage-1). Interestingly, members of subspecies lausannense displayed a larger genome size than subspecies diphtheriae and were enriched in COG categories related to transport and metabolism of lipids (I) and inorganic ion (P). Conversely, they lacked all genes involved in the synthesis of pili (SpaA-type, SpaD-type and SpaH-type), molybdenum cofactor and of the nitrate reductase. Finally, the CHUV2995 genome is particularly enriched in mobility genes and harbors several prophages. The genome encodes a type II-C CRISPR-Cas locus with 2 spacers that lacks csn2 or cas4, which could hamper the acquisition of new spacers and render strain CHUV2995 more susceptible to bacteriophage infections and gene acquisition through various mechanisms of horizontal gene transfer.},
}
@article {pmid30173772,
year = {2018},
author = {Liu, Q and Yu, T and Campbell, K and Nielsen, J and Chen, Y},
title = {Modular Pathway Rewiring of Yeast for Amino Acid Production.},
journal = {Methods in enzymology},
volume = {608},
number = {},
pages = {417-439},
doi = {10.1016/bs.mie.2018.06.009},
pmid = {30173772},
issn = {1557-7988},
abstract = {Amino acids find various applications in biotechnology in view of their importance in the food, feed, pharmaceutical, and personal care industries as nutrients, additives, and drugs, respectively. For the large-scale production of amino acids, microbial cell factories are widely used and the development of amino acid-producing strains has mainly focused on prokaryotes Corynebacterium glutamicum and Escherichia coli. However, the eukaryote Saccharomyces cerevisiae is becoming an even more appealing microbial host for production of amino acids and derivatives because of its superior molecular and physiological features, such as amenable to genetic engineering and high tolerance to harsh conditions. To transform S. cerevisiae into an industrial amino acid production platform, the highly coordinated and multiple layers regulation in its amino acid metabolism should be relieved and reconstituted to optimize the metabolic flux toward synthesis of target products. This chapter describes principles, strategies, and applications of modular pathway rewiring in yeast using the engineering of l-ornithine metabolism as a paradigm. Additionally, detailed protocols for in vitro module construction and CRISPR/Cas-mediated pathway assembly are provided.},
}
@article {pmid30173764,
year = {2018},
author = {Schultz, C and Lian, J and Zhao, H},
title = {Metabolic Engineering of Saccharomyces cerevisiae Using a Trifunctional CRISPR/Cas System for Simultaneous Gene Activation, Interference, and Deletion.},
journal = {Methods in enzymology},
volume = {608},
number = {},
pages = {265-276},
doi = {10.1016/bs.mie.2018.04.010},
pmid = {30173764},
issn = {1557-7988},
abstract = {Design and construction of an optimal microbial cell factory typically requires overexpression, knockdown, and knockout of multiple gene targets. In this chapter, we describe a combinatorial metabolic engineering strategy utilizing an orthogonal trifunctional CRISPR system that combines transcriptional activation, transcriptional interference, and gene deletion (CRISPR-AID) in the yeast Saccharomyces cerevisiae. This strategy enables multiplexed perturbation of the metabolic and regulatory networks in a modular, parallel, and high-throughput manner. To implement this system, three orthogonal Cas proteins were utilized: dLbCpf1 fused to a transcriptional activator, dSpCas9 fused to a transcriptional repressor, and SaCas9 for gene deletion. Deletion was accomplished by the introduction of a 28bp frame-shift mutation using a homology donor on the guide RNA expression vector. This approach enables the application of metabolic engineering to systematically optimize phenotypes of interest through a combination of gain-, reduction-, and loss-of-function mutations. Finally, we describe the construction of the CRISPR-AID system and its application toward engineering an example phenotype, surface display of recombinant Trichoderma reesei endoglucanase II.},
}
@article {pmid30171202,
year = {2019},
author = {McGinn, J and Marraffini, LA},
title = {Molecular mechanisms of CRISPR-Cas spacer acquisition.},
journal = {Nature reviews. Microbiology},
volume = {17},
number = {1},
pages = {7-12},
doi = {10.1038/s41579-018-0071-7},
pmid = {30171202},
issn = {1740-1534},
abstract = {Many bacteria and archaea have the unique ability to heritably alter their genomes by incorporating small fragments of foreign DNA, called spacers, into CRISPR loci. Once transcribed and processed into individual CRISPR RNAs, spacer sequences guide Cas effector nucleases to destroy complementary, invading nucleic acids. Collectively, these two processes are known as the CRISPR-Cas immune response. In this Progress article, we review recent studies that have advanced our understanding of the molecular mechanisms underlying spacer acquisition and that have revealed a fundamental link between the two phases of CRISPR immunity that ensures optimal immunity from newly acquired spacers. Finally, we highlight important open questions and discuss the potential basic and applied impact of spacer acquisition research.},
}
@article {pmid30170104,
year = {2018},
author = {Lee, JH and Wang, JH and Chen, J and Li, F and Edwards, TL and Hewitt, AW and Liu, GS},
title = {Gene therapy for visual loss: Opportunities and concerns.},
journal = {Progress in retinal and eye research},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.preteyeres.2018.08.003},
pmid = {30170104},
issn = {1873-1635},
abstract = {Many clinical trials using gene therapy have shown significant therapeutic benefits and exceptional safety records. Increasing evidence is verifying the long sought-after promise that gene therapy will genetically 'cure' some severely disabling diseases. In particular, the first gene therapy bioproduct for RPE65-associated Leber's congenital amaurosis, which was approved by the US Food and Drug Administration in 2017, has provided tremendous encouragement to the field of gene therapy. Recent developments in genome editing technologies have significantly advanced our capability to precisely engineer genomes in eukaryotic cells. Programmable nucleases, particularly the CRISPR/Cas system, have been widely adopted in studies applying genome engineering therapy to ocular diseases with the hope of managing these diseases. In this review article, we summarize the current approaches that have been developed in the area of gene therapy for ocular disease. We also discuss the challenges and opportunities facing gene therapy for ocular diseases, as well as its prospects.},
}
@article {pmid30170069,
year = {2018},
author = {Schuh, RS and Poletto, É and Pasqualim, G and Tavares, AMV and Meyer, FS and Gonzalez, EA and Giugliani, R and Matte, U and Teixeira, HF and Baldo, G},
title = {In vivo genome editing of mucopolysaccharidosis I mice using the CRISPR/Cas9 system.},
journal = {Journal of controlled release : official journal of the Controlled Release Society},
volume = {288},
number = {},
pages = {23-33},
doi = {10.1016/j.jconrel.2018.08.031},
pmid = {30170069},
issn = {1873-4995},
abstract = {Mucopolysaccharidosis type I (MPS I) is a multisystemic disorder caused by the deficiency of alpha-L-iduronidase (IDUA) that leads to intracellular accumulation of glycosaminoglycans (GAG). In the present study we aimed to use cationic liposomes carrying the CRISPR/Cas9 plasmid and a donor vector for in vitro and in vivo MPS I gene editing, and compare to treatment with naked plasmids. The liposomal formulation was prepared by microfluidization. Complexes were obtained by the addition of DNA at +4/-1 charge ratio. The overall results showed complexes of about 110 nm, with positive zeta potential of +30 mV. The incubation of the complexes with fibroblasts from MPS I patients led to a significant increase in IDUA activity and reduction of lysosomal abnormalities. Hydrodynamic injection of the liposomal complex in newborn MPS I mice led to a significant increase in serum IDUA levels for up to six months. The biodistribution of complexes after hydrodynamic injection was markedly detected in the lungs and heart, corroborating the results of increased IDUA activity and decreased GAG storage especially in these tissues, while the group that received the naked plasmids presented increased enzyme activity especially in the liver. Furthermore, animals treated with the liposomal formulation presented improvement in cardiovascular parameters, one of the main causes of death observed in MPS I patients. We conclude that the IDUA production in multiple organs had a significant beneficial effect on the characteristics of MPS I disease, which may bring hope to gene therapy of Hurler patients.},
}
@article {pmid30167805,
year = {2018},
author = {Kroth, PG and Bones, AM and Daboussi, F and Ferrante, MI and Jaubert, M and Kolot, M and Nymark, M and Río Bártulos, C and Ritter, A and Russo, MT and Serif, M and Winge, P and Falciatore, A},
title = {Genome editing in diatoms: achievements and goals.},
journal = {Plant cell reports},
volume = {37},
number = {10},
pages = {1401-1408},
pmid = {30167805},
issn = {1432-203X},
support = {GBMF4966//Gordon and Betty Moore Foundation/ ; },
mesh = {CRISPR-Cas Systems ; Diatoms/*genetics ; Gene Editing/*methods ; Genome ; Transcription Activator-Like Effector Nucleases/genetics/metabolism ; },
abstract = {Diatoms are major components of phytoplankton and play a key role in the ecology of aquatic ecosystems. These algae are of great scientific importance for a wide variety of research areas, ranging from marine ecology and oceanography to biotechnology. During the last 20 years, the availability of genomic information on selected diatom species and a substantial progress in genetic manipulation, strongly contributed to establishing diatoms as molecular model organisms for marine biology research. Recently, tailored TALEN endonucleases and the CRISPR/Cas9 system were utilized in diatoms, allowing targeted genetic modifications and the generation of knockout strains. These approaches are extremely valuable for diatom research because breeding, forward genetic screens by random insertion, and chemical mutagenesis are not applicable to the available model species Phaeodactylum tricornutum and Thalassiosira pseudonana, which do not cross sexually in the lab. Here, we provide an overview of the genetic toolbox that is currently available for performing stable genetic modifications in diatoms. We also discuss novel challenges that need to be addressed to fully exploit the potential of these technologies for the characterization of diatom biology and for metabolic engineering.},
}
@article {pmid30166549,
year = {2018},
author = {Laustsen, A and Bak, RO and Krapp, C and Kjær, L and Egedahl, JH and Petersen, CC and Pillai, S and Tang, HQ and Uldbjerg, N and Porteus, M and Roan, NR and Nyegaard, M and Denton, PW and Jakobsen, MR},
title = {Interferon priming is essential for human CD34+ cell-derived plasmacytoid dendritic cell maturation and function.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3525},
pmid = {30166549},
issn = {2041-1723},
support = {R01 AI127219/AI/NIAID NIH HHS/United States ; R194-2015-1388//Lundbeckfonden (Lundbeck Foundation)/International ; 4004-00237//Sundhed og Sygdom, Det Frie Forskningsråd (Medical Sciences, Danish Council for Independent Research)/International ; },
mesh = {Antigens, CD34/*metabolism ; CRISPR-Cas Systems/genetics ; Cell Differentiation/genetics/physiology ; Cells, Cultured ; DEAD Box Protein 58/metabolism ; Dendritic Cells/*metabolism ; Enzyme-Linked Immunosorbent Assay ; Gene Editing ; Humans ; Interferon Type I/metabolism ; Interleukin-6/metabolism ; Nucleotidyltransferases/metabolism ; Polymerase Chain Reaction ; Receptor, Interferon alpha-beta/genetics/metabolism ; Toll-Like Receptor 7/agonists ; Toll-Like Receptor 9/agonists ; },
abstract = {Plasmacytoid dendritic cells (pDC) are essential for immune competence. Here we show that pDC precursor differentiated from human CD34+ hematopoietic stem and progenitor cells (HSPC) has low surface expression of pDC markers, and has limited induction of type I interferon (IFN) and IL-6 upon TLR7 and TLR9 agonists treatment; by contrast, cGAS or RIG-I agonists-mediated activation is not altered. Importantly, after priming with type I and II IFN, these precursor pDCs attain a phenotype and functional activity similar to that of peripheral blood-derived pDCs. Data from CRISPR/Cas9-mediated genome editing of HSPCs further show that HSPC-pDCs with genetic modifications can be obtained, and that expression of the IFN-α receptor is essential for the optimal function, but dispensable for the differentiation, of HSPC-pDC percursor. Our results thus demonstrate the biological effects of IFNs for regulating pDC function, and provide the means of generating of gene-modified human pDCs.},
}
@article {pmid30166482,
year = {2018},
author = {Knott, GJ and Doudna, JA},
title = {CRISPR-Cas guides the future of genetic engineering.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6405},
pages = {866-869},
doi = {10.1126/science.aat5011},
pmid = {30166482},
issn = {1095-9203},
mesh = {Animals ; Bacterial Proteins/genetics/metabolism ; CRISPR-Associated Protein 9 ; *CRISPR-Cas Systems ; DNA/analysis/chemistry/genetics ; Endonucleases/genetics/metabolism ; Gene Editing/*methods ; Genetic Engineering/*methods/*trends ; Humans ; Molecular Imaging ; Plants/genetics ; RNA/analysis/chemistry ; RNA, Guide/genetics ; Transcription, Genetic ; },
abstract = {The diversity, modularity, and efficacy of CRISPR-Cas systems are driving a biotechnological revolution. RNA-guided Cas enzymes have been adopted as tools to manipulate the genomes of cultured cells, animals, and plants, accelerating the pace of fundamental research and enabling clinical and agricultural breakthroughs. We describe the basic mechanisms that set the CRISPR-Cas toolkit apart from other programmable gene-editing technologies, highlighting the diverse and naturally evolved systems now functionalized as biotechnologies. We discuss the rapidly evolving landscape of CRISPR-Cas applications, from gene editing to transcriptional regulation, imaging, and diagnostics. Continuing functional dissection and an expanding landscape of applications position CRISPR-Cas tools at the cutting edge of nucleic acid manipulation that is rewriting biology.},
}
@article {pmid30166441,
year = {2018},
author = {Nishimasu, H and Shi, X and Ishiguro, S and Gao, L and Hirano, S and Okazaki, S and Noda, T and Abudayyeh, OO and Gootenberg, JS and Mori, H and Oura, S and Holmes, B and Tanaka, M and Seki, M and Hirano, H and Aburatani, H and Ishitani, R and Ikawa, M and Yachie, N and Zhang, F and Nureki, O},
title = {Engineered CRISPR-Cas9 nuclease with expanded targeting space.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6408},
pages = {1259-1262},
doi = {10.1126/science.aas9129},
pmid = {30166441},
issn = {1095-9203},
support = {P01 HD087157/HD/NICHD NIH HHS/United States ; R01 HD088412/HD/NICHD NIH HHS/United States ; DP1 MH100706/MH/NIMH NIH HHS/United States ; R01 MH110049/MH/NIMH NIH HHS/United States ; R01 DK097768/DK/NIDDK NIH HHS/United States ; },
mesh = {Bacterial Proteins/*chemistry/*genetics ; CRISPR-Associated Protein 9 ; *CRISPR-Cas Systems ; Crystallography, X-Ray ; Endonucleases/*chemistry/*genetics ; *Gene Editing ; HEK293 Cells ; Humans ; Protein Engineering ; },
abstract = {The RNA-guided endonuclease Cas9 cleaves its target DNA and is a powerful genome-editing tool. However, the widely used Streptococcus pyogenes Cas9 enzyme (SpCas9) requires an NGG protospacer adjacent motif (PAM) for target recognition, thereby restricting the targetable genomic loci. Here, we report a rationally engineered SpCas9 variant (SpCas9-NG) that can recognize relaxed NG PAMs. The crystal structure revealed that the loss of the base-specific interaction with the third nucleobase is compensated by newly introduced non-base-specific interactions, thereby enabling the NG PAM recognition. We showed that SpCas9-NG induces indels at endogenous target sites bearing NG PAMs in human cells. Furthermore, we found that the fusion of SpCas9-NG and the activation-induced cytidine deaminase (AID) mediates the C-to-T conversion at target sites with NG PAMs in human cells.},
}
@article {pmid30158648,
year = {2018},
author = {Crudele, JM and Chamberlain, JS},
title = {Cas9 immunity creates challenges for CRISPR gene editing therapies.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3497},
pmid = {30158648},
issn = {2041-1723},
support = {R01 AR044533/AR/NIAMS NIH HHS/United States ; AR44533//U.S. Department of Health &amp; Human Services | National Institutes of Health (NIH)/International ; 409968//Muscular Dystrophy Association (Muscular Dystrophy Association Inc.)/International ; },
mesh = {CRISPR-Cas Systems/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Editing/*methods ; Genetic Therapy ; RNA/*genetics ; Staphylococcus aureus/genetics/immunology ; Streptococcus pyogenes/genetics/immunology ; },
}
@article {pmid30158531,
year = {2018},
author = {Xu, X and Tan, X and Tampe, B and Wilhelmi, T and Hulshoff, MS and Saito, S and Moser, T and Kalluri, R and Hasenfuss, G and Zeisberg, EM and Zeisberg, M},
title = {High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3509},
pmid = {30158531},
issn = {2041-1723},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Cell Line ; Chromatin Immunoprecipitation ; DNA Methylation/genetics/*physiology ; Fibrosis/*genetics/*therapy ; GTPase-Activating Proteins/genetics ; Glucuronidase/genetics ; High-Throughput Nucleotide Sequencing ; Humans ; Kidney Diseases/genetics/*therapy ; Lentivirus/genetics ; Mice ; Promoter Regions, Genetic/genetics ; },
abstract = {While suppression of specific genes through aberrant promoter methylation contributes to different diseases including organ fibrosis, gene-specific reactivation technology is not yet available for therapy. TET enzymes catalyze hydroxymethylation of methylated DNA, reactivating gene expression. We here report generation of a high-fidelity CRISPR/Cas9-based gene-specific dioxygenase by fusing an endonuclease deactivated high-fidelity Cas9 (dHFCas9) to TET3 catalytic domain (TET3CD), targeted to specific genes by guiding RNAs (sgRNA). We demonstrate use of this technology in four different anti-fibrotic genes in different cell types in vitro, among them RASAL1 and Klotho, both hypermethylated in kidney fibrosis. Furthermore, in vivo lentiviral delivery of the Rasal1-targeted fusion protein to interstitial cells and of the Klotho-targeted fusion protein to tubular epithelial cells each results in specific gene reactivation and attenuation of fibrosis, providing gene-specific demethylating technology in a disease model.},
}
@article {pmid30158244,
year = {2018},
author = {Ždralević, M and Brand, A and Di Ianni, L and Dettmer, K and Reinders, J and Singer, K and Peter, K and Schnell, A and Bruss, C and Decking, SM and Koehl, G and Felipe-Abrio, B and Durivault, J and Bayer, P and Evangelista, M and O'Brien, T and Oefner, PJ and Renner, K and Pouysségur, J and Kreutz, M},
title = {Double genetic disruption of lactate dehydrogenases A and B is required to ablate the &quot;Warburg effect&quot; restricting tumor growth to oxidative metabolism.},
journal = {The Journal of biological chemistry},
volume = {293},
number = {41},
pages = {15947-15961},
pmid = {30158244},
issn = {1083-351X},
abstract = {Increased glucose consumption distinguishes cancer cells from normal cells and is known as the &quot;Warburg effect&quot; because of increased glycolysis. Lactate dehydrogenase A (LDHA) is a key glycolytic enzyme, a hallmark of aggressive cancers, and believed to be the major enzyme responsible for pyruvate-to-lactate conversion. To elucidate its role in tumor growth, we disrupted both the LDHA and LDHB genes in two cancer cell lines (human colon adenocarcinoma and murine melanoma cells). Surprisingly, neither LDHA nor LDHB knockout strongly reduced lactate secretion. In contrast, double knockout (LDHA/B-DKO) fully suppressed LDH activity and lactate secretion. Furthermore, under normoxia, LDHA/B-DKO cells survived the genetic block by shifting their metabolism to oxidative phosphorylation (OXPHOS), entailing a 2-fold reduction in proliferation rates in vitro and in vivo compared with their WT counterparts. Under hypoxia (1% oxygen), however, LDHA/B suppression completely abolished in vitro growth, consistent with the reliance on OXPHOS. Interestingly, activation of the respiratory capacity operated by the LDHA/B-DKO genetic block as well as the resilient growth were not consequences of long-term adaptation. They could be reproduced pharmacologically by treating WT cells with an LDHA/B-specific inhibitor (GNE-140). These findings demonstrate that the Warburg effect is not only based on high LDHA expression, as both LDHA and LDHB need to be deleted to suppress fermentative glycolysis. Finally, we demonstrate that the Warburg effect is dispensable even in aggressive tumors and that the metabolic shift to OXPHOS caused by LDHA/B genetic disruptions is responsible for the tumors' escape and growth.},
}
@article {pmid30157762,
year = {2018},
author = {Butt, H and Jamil, M and Wang, JY and Al-Babili, S and Mahfouz, M},
title = {Engineering plant architecture via CRISPR/Cas9-mediated alteration of strigolactone biosynthesis.},
journal = {BMC plant biology},
volume = {18},
number = {1},
pages = {174},
pmid = {30157762},
issn = {1471-2229},
support = {CRG4//King Abdullah University of Science and Technology/ ; },
mesh = {*CRISPR-Cas Systems ; Dioxygenases/*genetics/metabolism ; *Gene Expression Regulation, Plant ; Heterocyclic Compounds, 3-Ring/*metabolism ; Lactones/*metabolism ; Oryza/*genetics/metabolism ; Plant Growth Regulators/*metabolism ; Plant Proteins/*genetics/metabolism ; },
abstract = {BACKGROUND: Precision plant genome engineering holds much promise for targeted improvement of crop traits via unprecedented single-base level control over the genetic material. Strigolactones (SLs) are a key determinant of plant architecture, known for their role in inhibiting shoot branching (tillering).<br><br>RESULTS: We used CRISPR/Cas9 in rice (Oryza sativa) for targeted disruption of CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7), which controls a key step in SL biosynthesis. The ccd7 mutants exhibited a striking increase in tillering, combined with a reduced height, which could be rescued by application of the synthetic SL analog GR24. Striga germination assays and liquid chromatography-mass spectrometry analysis showed that root exudates of ccd7 mutants were also SL deficient.<br><br>CONCLUSIONS: Taken together, our results show the potential and feasibility of the use of the CRISPR/Cas9 system for targeted engineering of plant architecture and for elucidating the molecular underpinnings of architecture-related traits.},
}
@article {pmid30157725,
year = {2018},
author = {Nicholson, TJ and Jackson, SA and Croft, BI and Staals, RHJ and Fineran, PC and Brown, CM},
title = {Bioinformatic evidence of widespread priming in type I and II CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-11},
doi = {10.1080/15476286.2018.1509662},
pmid = {30157725},
issn = {1555-8584},
abstract = {CRISPR-Cas systems provide bacteria and archaea with adaptive immunity against invading genetic elements, such as plasmids, bacteriophages and archaeal viruses. They consist of cas genes and CRISPR loci, which store genetic memories of previously encountered invaders as short sequences termed spacers. Spacers determine the specificity of CRISPR-Cas defence and immunity can be gained or updated by the addition of new spacers into CRISPR loci. There are two main routes to spacer acquisition, which are known as naïve and primed CRISPR adaptation. Naïve CRISPR adaptation involves the de novo formation of immunity, independent of pre-existing spacers. In contrast, primed CRISPR adaptation (priming) uses existing spacers to enhance the acquisition of new spacers. Priming typically results in spacer acquisition from locations near the site of target recognition by the existing (priming) spacer. Primed CRISPR adaptation has been observed in several type I CRISPR-Cas systems and it is potentially widespread. However, experimental evidence is unavailable for some subtypes, and for most systems, priming has only been shown in a small number of hosts. There is also no current evidence of priming by other CRISPR-Cas types. Here, we used a bioinformatic approach to search for evidence of priming in diverse CRISPR-Cas systems. By analysing the clustering of spacers acquired from phages, prophages and archaeal viruses, including strand and directional biases between subsequently acquired spacers, we demonstrate that two patterns of primed CRISPR adaptation dominate in type I systems. In addition, we find evidence of a priming-like pathway in type II CRISPR-Cas systems.},
}
@article {pmid30157456,
year = {2018},
author = {Aumann, RA and Schetelig, MF and Häcker, I},
title = {Highly efficient genome editing by homology-directed repair using Cas9 protein in Ceratitis capitata.},
journal = {Insect biochemistry and molecular biology},
volume = {101},
number = {},
pages = {85-93},
doi = {10.1016/j.ibmb.2018.08.004},
pmid = {30157456},
issn = {1879-0240},
abstract = {The Mediterranean fruit fly Ceratitis capitata is a highly polyphagous and invasive insect pest, causing enormous economic damage in horticultural systems. A successful and environment-friendly control strategy is the sterile insect technique (SIT) that reduces pest populations through infertile matings with mass-released, sterilized insects. However, the SIT is not readily applicable to each pest species. While transgenic approaches hold great promise to improve critical aspects of the SIT to transfer it to new species, they are suspect to strict or even prohibitive legislation regarding the release of genetically modified (GM) organisms. In contrast, specific mutations created via CRISPR-Cas genome editing are not regulated as GM in the US, and might thus allow creating optimal strains for SIT. Here, we describe highly efficient homology-directed repair genome editing in C. capitata by injecting pre-assembled CRISPR-Cas9 ribonucleoprotein complexes using different guide RNAs and a short single-stranded oligodeoxynucleotide donor to convert an enhanced green fluorescent protein in C. capitata into a blue fluorescent protein. Six out of seven fertile and individually backcrossed G0 individuals generated 57-90% knock-in rate within their total offspring and 70-96% knock-in rate within their phenotypically mutant offspring. Based on the achieved efficiency, this approach could also be used to introduce mutations which do not produce a screenable phenotype and identify positive mutants with a reasonable workload. Furthermore, CRISPR-Cas HDR would allow to recreate mutations formerly identified in classical mutagenesis screens and to transfer them to related species to establish new (SIT-like) pest control systems. Considering the potential that CRISPR-induced alterations in organisms could be classified as non-GM in additional countries, such new strains could potentially be used for pest control applications without the need to struggle with GMO directives.},
}
@article {pmid30155813,
year = {2018},
author = {Maier, JAH and Jeltsch, A},
title = {Design and Application of 6mA-Specific Zinc-Finger Proteins for the Readout of DNA Methylation.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1867},
number = {},
pages = {29-41},
doi = {10.1007/978-1-4939-8799-3_3},
pmid = {30155813},
issn = {1940-6029},
abstract = {Designed zinc-finger (ZnF) proteins can recognize AT base pairs by H-bonds in the major groove, which are disrupted, if the adenine base is methylated at the N6 position. Based on this principle, we have recently designed a ZnF protein, which does not bind to DNA, if its recognition site is methylated. In this review, we summarize the principles of the recognition of methylated DNA by proteins and describe the design steps starting with the initial bacterial two-hybrid screening of three-domain ZnF proteins that do not bind to CcrM methylated target sites, followed by their di- and tetramerization to improve binding affinity and specificity. One of the 6mA-specific ZnF proteins was used as repressor to generate a methylation-sensitive promoter/repressor system. This artificial promoter/repressor system was employed to regulate the expression of a CcrM DNA methyltransferase gene, thereby generating an epigenetic system with positive feedback, which can exist in two stable states, an off-state with unmethylated promoter, bound ZnF and repressed gene expression, and an on-state with methylated promoter and active gene expression. This system can memorize transient signals approaching bacterial cells and store the input in the form of DNA methylation patterns. More generally, the ability to bind to DNA in a methylation-dependent manner gives ZnF and TAL proteins an advantage over CRISPR/Cas as DNA-targeting device by allowing methylation-dependent genome or epigenome editing.},
}
@article {pmid30153081,
year = {2018},
author = {Nickel, L and Ulbricht, A and Alkhnbashi, OS and Förstner, KU and Cassidy, L and Weidenbach, K and Backofen, R and Schmitz, RA},
title = {Cross-cleavage activity of Cas6b in crRNA processing of two different CRISPR-Cas systems in Methanosarcina mazei Gö1.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1514234},
pmid = {30153081},
issn = {1555-8584},
abstract = {The clustered regularly interspaced short palindromic repeat (CRISPR) system is a prokaryotic adaptive defense system against foreign nucleic acids. In the methanoarchaeon Methanosarcina mazei Gö1, two types of CRISPR-Cas systems are present (type I-B and type III-C). Both loci encode a Cas6 endonuclease, Cas6b-IB and Cas6b-IIIC, typically responsible for maturation of functional short CRISPR RNAs (crRNAs). To evaluate potential cross cleavage activity, we biochemically characterized both Cas6b proteins regarding their crRNA binding behavior and their ability to process pre-crRNA from the respective CRISPR array in vivo. Maturation of crRNA was studied in the respective single deletion mutants by northern blot and RNA-Seq analysis demonstrating that in vivo primarily Cas6b-IB is responsible for crRNA processing of both CRISPR arrays. Tentative protein level evidence for the translation of both Cas6b proteins under standard growth conditions was detected, arguing for different activities or a potential non-redundant role of Cas6b-IIIC within the cell. Conservation of both Cas6 endonucleases was observed in several other M. mazei isolates, though a wide variety was displayed. In general, repeat and leader sequence conservation revealed a close correlation in the M. mazei strains. The repeat sequences from both CRISPR arrays from M. mazei Gö1 contain the same sequence motif with differences only in two nucleotides. These data stand in contrast to all other analyzed M. mazei isolates, which have at least one additional CRISPR array with repeats belonging to another sequence motif. This conforms to the finding that Cas6b-IB is the crucial and functional endonuclease in M. mazei Gö1.<br><br>ABBREVIATIONS: sRNA: small RNA; crRNA: CRISPR RNA; pre-crRNAs: Precursor CRISPR RNA; CRISPR: clustered regularly interspaced short palindromic repeats; Cas: CRISPR associated; nt: nucleotide; RNP: ribonucleoprotein; RBS: ribosome binding site.},
}
@article {pmid30151606,
year = {2018},
author = {Dong, Z and Huang, L and Dong, F and Hu, Z and Qin, Q and Long, J and Cao, M and Chen, P and Lu, C and Pan, MH},
title = {Establishment of a baculovirus-inducible CRISPR/Cas9 system for antiviral research in transgenic silkworms.},
journal = {Applied microbiology and biotechnology},
volume = {102},
number = {21},
pages = {9255-9265},
doi = {10.1007/s00253-018-9295-8},
pmid = {30151606},
issn = {1432-0614},
support = {31472153//National Natural Science Foundation of China/ ; 31572466//National Natural Science Foundation of China/ ; CARS-18//China Agriculture Research System/ ; },
mesh = {Animals ; Animals, Genetically Modified/*genetics ; Baculoviridae/*genetics ; Bombyx/*genetics/virology ; CRISPR-Cas Systems/*genetics ; Gene Targeting/methods ; Genetic Vectors/genetics ; Nucleopolyhedrovirus/genetics ; Pest Control/methods ; Promoter Regions, Genetic/genetics ; Transcription, Genetic/genetics ; },
abstract = {The CRISPR/Cas9 system is a powerful genetic engineering technique that has been widely used in gene therapy, as well as in the development of novel antimicrobials and transgenic insects. However, several challenges, including the lack of effective host target genes and the off-target effects, limit the application of CRISPR/Cas9 in insects. To mitigate these difficulties, we established a highly efficient virus-inducible CRISPR/Cas9 system in transgenic silkworms. This system includes the baculovirus-inducible promoter 39K, which directs transcription of the gene encoding, the Cas9 protein, and the U6 promoter which targets the sgATAD3A site of the ATPase family AAA domain-containing protein 3 (ATAD3A) gene. The double-positive transgenic line sgATAD3A×39K-Cas9 (ATAD3A-KO) was obtained by hybridization; antiviral activity in this hybrid transgenic line is induced only after Bombyx mori nucleopolyhedrovirus (BmNPV) infection. The BmNPV-inducible system significantly reduced off-target effects and did not affect the economically important characteristics of the transgenic silkworms. Most importantly, this novel system efficiently and consistently edited target genes, inhibiting BmNPV replication after the transgenic silkworms were inoculated with occlusion bodies (OBs). The suppression of BmNPV by the virus-inducible system was comparable to that of the stably expressed CRISPR/Cas9 system. Therefore, we successfully established a highly efficient BmNPV-inducible ATAD3A-KO transgenic silkworm line, with improved gene targeting specificity and antiviral efficiency. Our study thereby provides insights into the treatment of infectious diseases and into the control of insect pests.},
}
@article {pmid30150735,
year = {2019},
author = {Shaw, WR and Catteruccia, F},
title = {Vector biology meets disease control: using basic research to fight vector-borne diseases.},
journal = {Nature microbiology},
volume = {4},
number = {1},
pages = {20-34},
doi = {10.1038/s41564-018-0214-7},
pmid = {30150735},
issn = {2058-5276},
abstract = {Human pathogens that are transmitted by insects are a global problem, particularly those vectored by mosquitoes; for example, malaria parasites transmitted by Anopheles species, and viruses such as dengue, Zika and chikungunya that are carried by Aedes mosquitoes. Over the past 15 years, the prevalence of malaria has been substantially reduced and virus outbreaks have been contained by controlling mosquito vectors using insecticide-based approaches. However, disease control is now threatened by alarming rates of insecticide resistance in insect populations, prompting the need to develop a new generation of specific strategies that can reduce vector-mediated transmission. Here, we review how increased knowledge in insect biology and insect-pathogen interactions is stimulating new concepts and tools for vector control. We focus on strategies that either interfere with the development of pathogens within their vectors or directly impact insect survival, including enhancement of vector-mediated immune control, manipulation of the insect microbiome, or use of powerful new genetic tools such as CRISPR-Cas systems to edit vector genomes. Finally, we offer a perspective on the implementation hurdles as well as the knowledge gaps that must be filled in the coming years to safely realize the potential of these novel strategies to eliminate the scourge of vector-borne disease.},
}
@article {pmid30150396,
year = {2018},
author = {Zhu, F and Feng, M and Sinha, R and Seita, J and Mori, Y and Weissman, IL},
title = {Screening for genes that regulate the differentiation of human megakaryocytic lineage cells.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {40},
pages = {E9308-E9316},
pmid = {30150396},
issn = {1091-6490},
support = {R00 CA201075/CA/NCI NIH HHS/United States ; R01 CA086065/CA/NCI NIH HHS/United States ; U01 HL099999/HL/NHLBI NIH HHS/United States ; },
mesh = {Blood Platelets/cytology/*metabolism ; CRISPR-Cas Systems ; Cell Differentiation/*physiology ; Cell Line ; Humans ; Megakaryocyte Progenitor Cells/cytology ; },
abstract = {Different combinations of transcription factors (TFs) function at each stage of hematopoiesis, leading to distinct expression patterns of lineage-specific genes. The identification of such regulators and their functions in hematopoiesis remain largely unresolved. In this study, we utilized screening approaches to study the transcriptional regulators of megakaryocyte progenitor (MkP) generation, a key step before platelet production. Promising candidate genes were generated from a microarray platform gene expression commons and individually manipulated in human hematopoietic stem and progenitor cells (HSPCs). Deletion of some of the candidate genes (the hit genes) by CRISPR/Cas9 led to decreased MkP generation during HSPC differentiation, while more MkPs were produced when some hit genes were overexpressed in HSPCs. We then demonstrated that overexpression of these genes can increase the frequency of mature megakaryocytic colonies by functional colony forming unit-megakaryocyte (CFU-Mk) assay and the release of platelets after in vitro maturation. Finally, we showed that the histone deacetylase inhibitors could also increase MkP differentiation, possibly by regulating some of the newly identified TFs. Therefore, identification of such regulators will advance the understanding of basic mechanisms of HSPC differentiation and conceivably enable the generation and maturation of megakaryocytes and platelets in vitro.},
}
@article {pmid30150254,
year = {2018},
author = {Wang, Z and Hardcastle, TJ and Canto Pastor, A and Yip, WH and Tang, S and Baulcombe, DC},
title = {A novel DCL2-dependent miRNA pathway in tomato affects susceptibility to RNA viruses.},
journal = {Genes &amp; development},
volume = {32},
number = {17-18},
pages = {1155-1160},
pmid = {30150254},
issn = {1549-5477},
mesh = {CRISPR-Cas Systems ; Disease Susceptibility ; Lycopersicon esculentum/enzymology/*genetics/*virology ; MicroRNAs/*metabolism ; Mutation ; Plant Diseases/virology ; RNA Viruses/*physiology ; RNA, Small Untranslated/metabolism ; Ribonuclease III/genetics/*metabolism ; },
abstract = {Tomato Dicer-like2 (slDCL2) is a key component of resistance pathways against potato virus X (PVX) and tobacco mosaic virus (TMV). It is also required for production of endogenous small RNAs, including miR6026 and other noncanonical microRNAs (miRNAs). The slDCL2 mRNAs are targets of these slDCL2-dependent RNAs in a feedback loop that was disrupted by target mimic RNAs of miR6026. In lines expressing these RNAs, there was correspondingly enhanced resistance against PVX and TMV. These findings illustrate a novel miRNA pathway in plants and a crop protection strategy in which miRNA target mimicry elevates expression of defense-related mRNAs.},
}
@article {pmid30146918,
year = {2018},
author = {Auster, O and Globus, R and Yosef, I and Qimron, U},
title = {Optimizing DNA transduction by selection of mutations that evade bacterial defense systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-5},
doi = {10.1080/15476286.2018.1514235},
pmid = {30146918},
issn = {1555-8584},
abstract = {We recently developed a platform where phage-transducing particles optimize DNA delivery to a wide range of hosts. Here, we use this platform to optimize DNA transduction into hosts that naturally restrict specific DNA sequences. We first show that a specific plasmid is restricted for transduction into a particular Salmonella strain. Using the platform, we select for a mutated plasmid that overcomes the restriction barrier. Insertion of the non-mutated sequence into a permissive plasmid restricts transduction. We further show that epigenetic modification enables the DNA to evade restriction by the putative defense system. Our results validate this straightforward genetic approach for optimization of DNA transduction into new hosts.},
}
@article {pmid30146914,
year = {2018},
author = {Papathanasiou, P and Erdmann, S and Leon-Sobrino, C and Sharma, K and Urlaub, H and Garrett, RA and Peng, X},
title = {Stable maintenance of the rudivirus SIRV3 in a carrier state in Sulfolobus islandicus despite activation of the CRISPR-Cas immune response by a second virus SMV1.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-9},
doi = {10.1080/15476286.2018.1511674},
pmid = {30146914},
issn = {1555-8584},
abstract = {Carrier state viral infection constitutes an equilibrium state in which a limited fraction of a cellular population is infected while the remaining cells are transiently resistant to infection. This type of infection has been characterized for several bacteriophages but not, to date, for archaeal viruses. Here we demonstrate that the rudivirus SIRV3 can produce a host-dependent carrier state infection in the model crenarchaeon Sulfolobus. SIRV3 only infected a fraction of a Sulfolobus islandicus REY15A culture over several days during which host growth was unimpaired and no chromosomal DNA degradation was observed. CRISPR spacer acquisition from SIRV3 DNA was induced by coinfecting with the monocaudavirus SMV1 and it was coincident with increased transcript levels from subtype I-A adaptation and interference cas genes. However, this response did not significantly affect the carrier state infection of SIRV3 and both viruses were maintained in the culture over 12 days during which SIRV3 anti-CRISPR genes were shown to be expressed. Transcriptome and proteome analyses demonstrated that most SIRV3 genes were expressed at varying levels over time whereas SMV1 gene expression was generally low. The study yields insights into the basis for the stable infection of SIRV3 and the resistance to the different host CRISPR-Cas interference mechanisms. It also provides a rationale for the commonly observed coinfection of archaeal cells by different viruses in natural environments.},
}
@article {pmid30146478,
year = {2018},
author = {Mochizuki, Y and Chiba, T and Kataoka, K and Yamashita, S and Sato, T and Kato, T and Takahashi, K and Miyamoto, T and Kitazawa, M and Hatta, T and Natsume, T and Takai, S and Asahara, H},
title = {Combinatorial CRISPR/Cas9 Approach to Elucidate a Far-Upstream Enhancer Complex for Tissue-Specific Sox9 Expression.},
journal = {Developmental cell},
volume = {46},
number = {6},
pages = {794-806.e6},
doi = {10.1016/j.devcel.2018.07.024},
pmid = {30146478},
issn = {1878-1551},
support = {R01 AR050631/AR/NIAMS NIH HHS/United States ; R01 AR065379/AR/NIAMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Cartilage/cytology/*metabolism ; Cells, Cultured ; Chondrocytes/cytology/*metabolism ; Chromatin/metabolism ; *Enhancer Elements, Genetic ; Female ; *Gene Expression Regulation ; Mice ; Mice, Inbred C57BL ; Organ Specificity ; SOX9 Transcription Factor/genetics/*metabolism ; STAT3 Transcription Factor/metabolism ; Sequence Deletion ; },
abstract = {SRY-box 9 (SOX9) is a master transcription factor that regulates cartilage development. SOX9 haploinsufficiency resulting from breakpoints in a ∼1-Mb region upstream of SOX9 was reported in acampomelic campomelic dysplasia (ACD) patients, suggesting that essential enhancer regions of SOX9 for cartilage development are located in this long non-coding sequence. However, the cis-acting enhancer region regulating cartilage-specific SOX9 expression remains to be identified. To identify distant cartilage Sox9 enhancers, we utilized the combination of multiple CRISPR/Cas9 technologies including enrichment of the promoter-enhancer complex followed by next-generation sequencing and mass spectrometry (MS), SIN3A-dCas9-mediated epigenetic silencing, and generation of enhancer deletion mice. As a result, we could identify a critical far-upstream cis-element and Stat3 as a trans-acting factor, regulating cartilage-specific Sox9 expression and subsequent skeletal development. Our strategy could facilitate definitive ACD diagnosis and should be useful to reveal the detailed chromatin conformation and regulation.},
}
@article {pmid30146193,
year = {2018},
author = {Perkons, NR and Sheth, R and Ackerman, D and Chen, J and Saleh, K and Hunt, SJ and Nadolski, GJ and Shi, J and Gade, TP},
title = {The Implications of CRISPR-Cas9 Genome Editing for IR.},
journal = {Journal of vascular and interventional radiology : JVIR},
volume = {29},
number = {9},
pages = {1264-1267.e1},
doi = {10.1016/j.jvir.2018.02.027},
pmid = {30146193},
issn = {1535-7732},
mesh = {Animals ; CRISPR-Associated Proteins/*genetics/metabolism ; *CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; DNA Damage ; Diffusion of Innovation ; Forecasting ; Gene Editing/*methods/trends ; Gene Expression Regulation ; Humans ; Radiography, Interventional/*methods/trends ; Translational Medical Research/*methods/trends ; },
}
@article {pmid30142414,
year = {2018},
author = {Kimberland, ML and Hou, W and Alfonso-Pecchio, A and Wilson, S and Rao, Y and Zhang, S and Lu, Q},
title = {Strategies for controlling CRISPR/Cas9 off-target effects and biological variations in mammalian genome editing experiments.},
journal = {Journal of biotechnology},
volume = {284},
number = {},
pages = {91-101},
doi = {10.1016/j.jbiotec.2018.08.007},
pmid = {30142414},
issn = {1873-4863},
mesh = {Animals ; CRISPR-Associated Proteins/genetics ; *CRISPR-Cas Systems ; *Gene Editing ; Humans ; },
abstract = {The CRISPR/Cas9 system has enabled efficient modification of genes in a variety of cellular systems for studying phenotypic effects of genetic perturbations. However, with this technology comes the inherent risk of generating off-target effects (OTEs) in addition to the desired modifications. As such, it can be difficult to conclusively determine that the observed phenotypic changes are in fact due to the intended modification of the target gene and not from random mutations elsewhere in the genome. In addition, biological variations observed within cultured cells or laboratory animals can also confound results and need to be addressed. In this article, we review potential sources of experimental and biological variation as well as propose experimental options to minimize and control OTEs and other variations in CRISPR genome editing experiments for exploratory research applications. Confirmation of on-target KO effect by orthogonal approaches is also discussed.},
}
@article {pmid30139026,
year = {2018},
author = {Zuo, CX and Bian, XC and Yang, ZL and Feng, HL and Zhou, FY and Liu, YQ},
title = {[Establishment of Cas9 stably expressed human hepatocellular carcinoma and cholangiocarcinoma cell lines].},
journal = {Zhonghua zhong liu za zhi [Chinese journal of oncology]},
volume = {40},
number = {8},
pages = {572-579},
doi = {10.3760/cma.j.issn.0253-3766.2018.08.003},
pmid = {30139026},
issn = {0253-3766},
support = {NSTI-CR17//National Science and Technology Infrastructure Program/ ; 2016-12M-3-005//CAMS Innovative Fund for Medical Science/ ; },
mesh = {Bile Duct Neoplasms/*genetics/pathology/virology ; CRISPR-Associated Proteins/metabolism ; CRISPR-Cas Systems/*genetics ; Carcinoma, Hepatocellular/*genetics/pathology/virology ; *Cell Line, Tumor/pathology/virology ; Cholangiocarcinoma/*genetics/pathology/virology ; Gallbladder Neoplasms/*genetics/pathology/virology ; Genetic Vectors ; Genome ; Humans ; Lentivirus ; Liver Neoplasms/*genetics/pathology/virology ; RNA, Guide ; },
abstract = {Objective: To facilitate using the CRISPR/Cas9 gene editing system in human liver and gallbladder cancer cells, we established Cas9 stably expressed human liver and gallbladder cancer cell lines, and validated the gene editing activity of Cas9. Methods: Human liver cancer cell lines (Huh7, PLC/PRF/5, HepG2, Hep3b, SK-HEP-1 and Li-7), human cholangiocarcinoma cells (RBE) and human gallbladder cancer cells (GBC-SD) were infected with 3 Cas9-expressing lentivirus vectors (pLv-EF1α-Cas9-Flag-Neo, pLv-EF1α-Cas9-Flag-Puro, Cas9m1.1), respectively, and Cas9 stably expressed colonies were screened and selected. We extracted the genomic DNA and protein, validated the stable expression of Cas9 by using genomic polymerase chain reaction (PCR) and western blot. Three of cell lines were further infected with Lv-EF1α-mCherry. Then mCherry positive cells were sorted by flow cytometry and infected with designed guide RNA (gRNA) vectors which targeted mCherry gene. Subsequently the gene editing activity of Cas9 was detected by genomic PCR, fluorescence microscopic observation and flow cytometry analysis. Results: One hundred Cas9-expressing human liver and gallbladder cancer cell lines were selected. Among them, 35 cell lines expressed Cas9-Neo, 25 expressed Cas9-puro, and 40 expressed mutant Cas9 (mCas9). We also established 3 cell lines with stable expression of mCherry (Huh7-mCas9-M, PLC/PRF/5-Cas9-M and SK-HEP-1-Cas9-M). The results of genomic PCR and sequencing showed that by lentiviral infection with 2 types of designed gRNA, the long fragment deletion of mCherry gene was found in these 3 cell lines. Moreover, mCherry(-)EGFP(+) cells infected with 2 types of gRNA were observed by fluorescence microscope. The results of flow cytometry showed that mCherry(-)EGFP(+) cells accounted from 0.3% to 93.6%. Conclusion: We successfully establish 100 human liver and gallbladder cancer cell lines with stable expression of Cas9 protein and validate their activities of gene editing.},
}
@article {pmid30136108,
year = {2018},
author = {Wang, W and Simmonds, J and Pan, Q and Davidson, D and He, F and Battal, A and Akhunova, A and Trick, HN and Uauy, C and Akhunov, E},
title = {Gene editing and mutagenesis reveal inter-cultivar differences and additivity in the contribution of TaGW2 homoeologues to grain size and weight in wheat.},
journal = {TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik},
volume = {131},
number = {11},
pages = {2463-2475},
pmid = {30136108},
issn = {1432-2242},
support = {2017-67007-25932//USDA National Institute of Food and Agriculture/ ; IWYP76//International Wheat Yield Partnership grant/ ; 01511000146//Bill and Melinda Gates Foundation grant/ ; BB/P016855/1//UK Biotechnology and Biological Sciences Research Council/ ; BB/P013511/1//UK Biotechnology and Biological Sciences Research Council/ ; },
mesh = {CRISPR-Cas Systems ; Edible Grain/genetics/growth &amp; development ; *Gene Editing ; Gene Knockout Techniques ; *Mutagenesis ; Seeds/genetics/*growth &amp; development ; Triticum/*genetics/growth &amp; development ; },
abstract = {KEY MESSAGE: CRISPR-Cas9-based genome editing and EMS mutagenesis revealed inter-cultivar differences and additivity in the contribution of TaGW2 homoeologues to grain size and weight in wheat. The TaGW2 gene homoeologues have been reported to be negative regulators of grain size (GS) and thousand grain weight (TGW) in wheat. However, the contribution of each homoeologue to trait variation among different wheat cultivars is not well documented. We used the CRISPR-Cas9 system and TILLING to mutagenize each homoeologous gene copy in cultivars Bobwhite and Paragon, respectively. Plants carrying single-copy nonsense mutations in different genomes showed different levels of GS/TGW increase, with TGW increasing by an average of 5.5% (edited lines) and 5.3% (TILLING mutants). In any combination, the double homoeologue mutants showed higher phenotypic effects than the respective single-genome mutants. The double mutants had on average 12.1% (edited) and 10.5% (TILLING) higher TGW with respect to wild-type lines. The highest increase in GS and TGW was shown for triple mutants of both cultivars, with increases in 16.3% (edited) and 20.7% (TILLING) in TGW. The additive effects of the TaGW2 homoeologues were also demonstrated by the negative correlation between the functional gene copy number and GS/TGW in Bobwhite mutants and an F2 population. The highest single-genome increases in GS and TGW in Paragon and Bobwhite were obtained by mutations in the B and D genomes, respectively. These inter-cultivar differences in the phenotypic effects between the TaGW2 gene homoeologues coincide with inter-cultivar differences in the homoeologue expression levels. These results indicate that GS/TGW variation in wheat can be modulated by the dosage of homoeologous genes with inter-cultivar differences in the magnitude of the individual homoeologue effects.},
}
@article {pmid30135027,
year = {2018},
author = {Ren, C and Xu, K and Segal, DJ and Zhang, Z},
title = {Strategies for the Enrichment and Selection of Genetically Modified Cells.},
journal = {Trends in biotechnology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tibtech.2018.07.017},
pmid = {30135027},
issn = {1879-3096},
abstract = {Programmable artificial nucleases have transitioned over the past decade from ZFNs and TALENs to CRISPR/Cas systems, which have been ubiquitously used with great success to modify genomes. The efficiencies of knockout and knockin vary widely among distinct cell types and genomic loci and depend on the nuclease delivery and cleavage efficiencies. Moreover, genetically modified cells are almost phenotypically indistinguishable from normal counterparts, making screening and isolating positive cells rather challenging and time-consuming. To address this issue, we review several strategies for the enrichment and selection of genetically modified cells, including transfection-positive selection, nuclease-positive selection, genome-targeted positive selection, and knockin-positive selection, to provide a reference for future genome research and gene therapy studies.},
}
@article {pmid30130453,
year = {2018},
author = {Nethery, MA and Barrangou, R},
title = {CRISPR Visualizer: rapid identification and visualization of CRISPR loci via an automated high-throughput processing pipeline.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-8},
doi = {10.1080/15476286.2018.1493332},
pmid = {30130453},
issn = {1555-8584},
abstract = {A CRISPR locus, defined by an array of repeat and spacer elements, constitutes a genetic record of the ceaseless battle between bacteria and viruses, showcasing the genomic integration of spacers acquired from invasive DNA. In particular, iterative spacer acquisitions represent unique evolutionary histories and are often useful for high-resolution bacterial genotyping, including comparative analysis of closely related organisms, clonal lineages, and clinical isolates. Current spacer visualization methods are typically tedious and can require manual data manipulation and curation, including spacer extraction at each CRISPR locus from genomes of interest. Here, we constructed a high-throughput extraction pipeline coupled with a local web-based visualization tool which enables CRISPR spacer and repeat extraction, rapid visualization, graphical comparison, and progressive multiple sequence alignment. We present the bioinformatic pipeline and investigate the loci of reference CRISPR-Cas systems and model organisms in 4 well-characterized subtypes. We illustrate how this analysis uncovers the evolutionary tracks and homology shared between various organisms through visual comparison of CRISPR spacers and repeats, driven through progressive alignments. Due to the ability to process unannotated genome files with minimal preparation and curation, this pipeline can be implemented promptly. Overall, this efficient high-throughput solution supports accelerated analysis of genomic data sets and enables and expedites genotyping efforts based on CRISPR loci.},
}
@article {pmid30126372,
year = {2018},
author = {Bachas, C and Hodzic, J and van der Mijn, JC and Stoepker, C and Verheul, HMW and Wolthuis, RMF and Felley-Bosco, E and van Wieringen, WN and van Beusechem, VW and Brakenhoff, RH and de Menezes, RX},
title = {Rscreenorm: normalization of CRISPR and siRNA screen data for more reproducible hit selection.},
journal = {BMC bioinformatics},
volume = {19},
number = {1},
pages = {301},
pmid = {30126372},
issn = {1471-2105},
support = {CCA2014-5-19//Stichting VUmc Cancer Center Amsterdam/ ; 10701//KWF Kankerbestrijding/ ; },
mesh = {Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Genetic Testing/*methods ; Genomics/*methods ; Humans ; RNA, Small Interfering/*genetics ; Reproducibility of Results ; },
abstract = {BACKGROUND: Reproducibility of hits from independent CRISPR or siRNA screens is poor. This is partly due to data normalization primarily addressing technical variability within independent screens, and not the technical differences between them.<br><br>RESULTS: We present &quot;rscreenorm&quot;, a method that standardizes the functional data ranges between screens using assay controls, and subsequently performs a piecewise-linear normalization to make data distributions across all screens comparable. In simulation studies, rscreenorm reduces false positives. Using two multiple-cell lines siRNA screens, rscreenorm increased reproducibility between 27 and 62% for hits, and up to 5-fold for non-hits. Using publicly available CRISPR-Cas screen data, application of commonly used median centering yields merely 34% of overlapping hits, in contrast with rscreenorm yielding 84% of overlapping hits. Furthermore, rscreenorm yielded at most 8% discordant results, whilst median-centering yielded as much as 55%.<br><br>CONCLUSIONS: Rscreenorm yields more consistent results and keeps false positive rates under control, improving reproducibility of genetic screens data analysis from multiple cell lines.},
}
@article {pmid30126366,
year = {2018},
author = {Argemi, X and Matelska, D and Ginalski, K and Riegel, P and Hansmann, Y and Bloom, J and Pestel-Caron, M and Dahyot, S and Lebeurre, J and Prévost, G},
title = {Comparative genomic analysis of Staphylococcus lugdunensis shows a closed pan-genome and multiple barriers to horizontal gene transfer.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {621},
pmid = {30126366},
issn = {1471-2164},
support = {2014/15/B/NZ1/03357//Polish National Science Centre/ ; },
mesh = {CRISPR-Cas Systems/genetics ; Gene Transfer, Horizontal/*genetics ; *Genome, Bacterial ; Humans ; Phylogeny ; Sequence Analysis, DNA ; Staphylococcal Infections/microbiology ; Staphylococcus lugdunensis/*genetics ; Virulence ; Virulence Factors/genetics ; },
abstract = {BACKGROUND: Coagulase negative staphylococci (CoNS) are commensal bacteria on human skin. Staphylococcus lugdunensis is a unique CoNS which produces various virulence factors and may, like S. aureus, cause severe infections, particularly in hospital settings. Unlike other staphylococci, it remains highly susceptible to antimicrobials, and genome-based phylogenetic studies have evidenced a highly conserved genome that distinguishes it from all other staphylococci.<br><br>RESULTS: We demonstrate that S. lugdunensis possesses a closed pan-genome with a very limited number of new genes, in contrast to other staphylococci that have an open pan-genome. Whole-genome nucleotide and amino acid identity levels are also higher than in other staphylococci. We identified numerous genetic barriers to horizontal gene transfer that might explain this result. The S. lugdunensis genome has multiple operons encoding for restriction-modification, CRISPR/Cas and toxin/antitoxin systems. We also identified a new PIN-like domain-associated protein that might belong to a larger operon, comprising a metalloprotease, that could function as a new toxin/antitoxin or detoxification system.<br><br>CONCLUSION: We show that S. lugdunensis has a unique genome profile within staphylococci, with a closed pan-genome and several systems to prevent horizontal gene transfer. Its virulence in clinical settings does not rely on its ability to acquire and exchange antibiotic resistance genes or other virulence factors as shown for other staphylococci.},
}
@article {pmid30124643,
year = {2018},
author = {Xu, L and Gao, Y and Lau, YS and Han, R},
title = {Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {138},
pages = {},
pmid = {30124643},
issn = {1940-087X},
support = {R01 HL116546/HL/NHLBI NIH HHS/United States ; R01 AR064241/AR/NIAMS NIH HHS/United States ; },
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Dystrophin/*metabolism ; Gene Editing/*methods ; Humans ; Mice ; Muscular Dystrophy, Duchenne/*genetics/*metabolism ; },
abstract = {The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.},
}
@article {pmid30123320,
year = {2018},
author = {Li, J and Xu, Z and Chupalov, A and Marchisio, MA},
title = {Anti-CRISPR-based biosensors in the yeast S. cerevisiae.},
journal = {Journal of biological engineering},
volume = {12},
number = {},
pages = {11},
pmid = {30123320},
issn = {1754-1611},
abstract = {Background: Anti-CRISPR proteins are expressed by phages as a reaction to the bacterial CRISPR-Cas defense system. Recently, the structures of anti-CRISPR proteins have been determined, and their diverse functions have been clarified. Anti-CRISPR proteins such as LmAcrIIA2 and LmAcrIIA4 interact with the SpCas9:gRNA system and occlude the protospacer adjacent motif (PAM) recognition site, thereby preventing SpCas9:gRNA from binding to the DNA. Hence, anti-CRISPR proteins represent a powerful means to control and modulate the activity of SpCas9 and its nuclease-deficient version dSpCas9. LmAcrIIA2 and LmAcrIIA4 have been shown to be efficient inhibitors of SpCas9 in Escherichia coli, Saccharomyces cerevisiae, and mammalian cells. To date, there have been no reports of anti-CRISPR-based synthetic gene circuits engineered into yeast cells.<br><br>Results: We constructed in the yeast S. cerevisiae synthetic biosensors based on the anti-CRISPR-dSpCas9:gRNA interaction. Upon induction with galactose or β-estradiol, anti-CRISPR proteins (LmAcrIIA4, LmAcrIIA2, and StAcrIIA5) produced an enhancement in fluorescence expression by preventing the dSpCas9-Mxi1:gRNA complex from binding to the DNA. We found that LmAcrIIA2 performed as well as LmAcrIIA4 in S. cerevisiae, whereas StAcrIIA5, which had previously been tested in bacteria only, had non-negligible negative effects on yeast cell growth. The efficiency of anti-CRISPR-based biosensors was strongly dependent on the means by which the guide RNAs were produced. The best performance, as measured by the increase in fluorescence, was achieved using a &quot;ribozyme-gRNA-ribozyme&quot; expression cassette under the control of the yeast constitutive ADH1 promoter.<br><br>Conclusions: This work demonstrates that anti-CRISPR proteins are effective dSpCas9 suppressors in yeast cells. In particular, LmAcrIIA2 and LmAcrIIA4 could be employed as new components of yeast synthetic gene circuits.},
}
@article {pmid30122537,
year = {2018},
author = {Meeske, AJ and Marraffini, LA},
title = {RNA Guide Complementarity Prevents Self-Targeting in Type VI CRISPR Systems.},
journal = {Molecular cell},
volume = {71},
number = {5},
pages = {791-801.e3},
doi = {10.1016/j.molcel.2018.07.013},
pmid = {30122537},
issn = {1097-4164},
abstract = {All immune systems use precise target recognition to interrogate foreign invaders. During CRISPR-Cas immunity, prokaryotes capture short spacer sequences from infecting viruses and insert them into the CRISPR array. Transcription and processing of the CRISPR locus generate small RNAs containing the spacer and repeat sequences that guide Cas nucleases to cleave a complementary protospacer in the invading nucleic acids. In most CRISPR systems, sequences flanking the protospacer drastically affect cleavage. Here, we investigated the target requirements of the recently discovered RNA-targeting type VI-A CRISPR-Cas system in its natural host, Listeria seeligeri. We discovered that target RNAs with extended complementarity between the protospacer flanking sequence and the repeat sequence of the guide RNA are not cleaved by the type VI-A nuclease Cas13, neither in vivo nor in vitro. These findings establish fundamental rules for the design of Cas13-based technologies and provide a mechanism for preventing self-targeting in type VI-A systems.},
}
@article {pmid30120945,
year = {2018},
author = {Qi, X and Zhu, L and Yang, B and Luo, H and Xu, W and He, X and Huang, K},
title = {Mitigation of cell apoptosis induced by ochratoxin A (OTA) is possibly through organic cation transport 2 (OCT2) knockout.},
journal = {Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association},
volume = {121},
number = {},
pages = {15-23},
doi = {10.1016/j.fct.2018.08.026},
pmid = {30120945},
issn = {1873-6351},
abstract = {Ochratoxin A (OTA) is a secondary metabolite of fungi such as Aspergillus ochraceus, A. niger and A. carbonarius, Penicillium verrucosum, and various other Penicillium, Petromyces, and Neopetromyces species. Various foods can be contaminated with OTA, potentially causing several toxic effects such as nephrotoxicity, hepatotoxicity and neurotoxicity. Typically, OTA is excreted by organic anion transporters (OATs). There is no research indicating organic cation transporters (OCTs) are involved in OTA nephrotoxicity. In our study, NRK-52E cells and rats were treated with OTA. OTA changed the expression of OCT1, OCT2 and OCT3 in NRK-52E cells and rat kidneys. TEA alleviated OTA-induced cell death, apoptosis, and DNA damage, and increased ROS. The OCT2 knockout cell line was constructed by the CRISPR/Cas 9 system. OCT2 knockout did not change the gene expression of OCT1, OAT1 and OAT3. OCT2 knockout alleviated the increase of Caspase 3 and CDK1 induced by OTA, leading to a reduction of apoptosis. In addition, OCT2 overexpression increased cell toxicity and expression of Caspase 3. In short, our findings indicate that OCT2 knockout possibly mitigate OTA-induced apoptosis by preventing the increase of Caspase 3 and CDK1.},
}
@article {pmid30120228,
year = {2018},
author = {Park, HM and Liu, H and Wu, J and Chong, A and Mackley, V and Fellmann, C and Rao, A and Jiang, F and Chu, H and Murthy, N and Lee, K},
title = {Extension of the crRNA enhances Cpf1 gene editing in vitro and in vivo.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3313},
pmid = {30120228},
issn = {2041-1723},
support = {K99 GM118909/GM/NIGMS NIH HHS/United States ; K99GM118909//U.S. Department of Health &amp; Human Services | NIH | National Institute of General Medical Sciences (NIGMS)/International ; },
mesh = {Animals ; Bacterial Proteins/*metabolism ; Base Sequence ; CRISPR-Cas Systems/*genetics ; Cations ; DNA End-Joining Repair/genetics ; *Gene Editing ; HEK293 Cells ; Hep G2 Cells ; Humans ; Lipids/chemistry ; Mice ; Nanoparticles/chemistry ; Polymers/chemistry ; RNA, Bacterial/*genetics ; Ribonucleoproteins/metabolism ; },
abstract = {Engineering of the Cpf1 crRNA has the potential to enhance its gene editing efficiency and non-viral delivery to cells. Here, we demonstrate that extending the length of its crRNA at the 5' end can enhance the gene editing efficiency of Cpf1 both in cells and in vivo. Extending the 5' end of the crRNA enhances the gene editing efficiency of the Cpf1 RNP to induce non-homologous end-joining and homology-directed repair using electroporation in cells. Additionally, chemical modifications on the extended 5' end of the crRNA result in enhanced serum stability. Also, extending the 5' end of the crRNA by 59 nucleotides increases the delivery efficiency of Cpf1 RNP in cells and in vivo cationic delivery vehicles including polymer nanoparticle. Thus, 5' extension and chemical modification of the Cpf1 crRNA is an effective method for enhancing the gene editing efficiency of Cpf1 and its delivery in vivo.},
}
@article {pmid30119695,
year = {2018},
author = {Conti, A and Di Micco, R},
title = {p53 activation: a checkpoint for precision genome editing?.},
journal = {Genome medicine},
volume = {10},
number = {1},
pages = {66},
pmid = {30119695},
issn = {1756-994X},
support = {Telethon (TIGET grant E5 2016)//Fondazione Telethon/International ; Pilot and See Grant 2015//Ospedale San Raffaele/International ; FIRC postdoctoral fellowship//Associazione Italiana per la Ricerca sul Cancro/International ; },
mesh = {Animals ; CRISPR-Cas Systems ; Gene Editing/*methods ; Humans ; Precision Medicine/*methods ; Tumor Suppressor Protein p53/*genetics/metabolism ; },
}
@article {pmid30119690,
year = {2018},
author = {Han, R and Li, L and Ugalde, AP and Tal, A and Manber, Z and Barbera, EP and Chiara, VD and Elkon, R and Agami, R},
title = {Functional CRISPR screen identifies AP1-associated enhancer regulating FOXF1 to modulate oncogene-induced senescence.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {118},
pmid = {30119690},
issn = {1474-760X},
mesh = {CRISPR-Cas Systems/*genetics ; Cellular Senescence/*genetics ; *Enhancer Elements, Genetic ; Forkhead Transcription Factors/*genetics ; Gene Expression Profiling ; *Genetic Testing ; HEK293 Cells ; Humans ; Models, Biological ; *Oncogenes ; Transcription Factor AP-1/*metabolism ; },
abstract = {BACKGROUND: Functional characterization of non-coding elements in the human genome is a major genomic challenge and the maturation of genome-editing technologies is revolutionizing our ability to achieve this task. Oncogene-induced senescence, a cellular state of irreversible proliferation arrest that is enforced following excessive oncogenic activity, is a major barrier against cancer transformation; therefore, bypassing oncogene-induced senescence is a critical step in tumorigenesis. Here, we aim at further identification of enhancer elements that are required for the establishment of this state.<br><br>RESULTS: We first apply genome-wide profiling of enhancer-RNAs (eRNAs) to systematically identify enhancers that are activated upon oncogenic stress. DNA motif analysis of these enhancers indicates AP-1 as a major regulator of the transcriptional program induced by oncogene-induced senescence. We thus constructed a CRISPR-Cas9 sgRNA library designed to target senescence-induced enhancers that are putatively regulated by AP-1 and used it in a functional screen. We identify a critical enhancer that we name EnhAP1-OIS1 and validate that mutating the AP-1 binding site within this element results in oncogene-induced senescence bypass. Furthermore, we identify FOXF1 as the gene regulated by this enhancer and demonstrate that FOXF1 mediates EnhAP1-OIS1 effect on the senescence phenotype.<br><br>CONCLUSIONS: Our study elucidates a novel cascade mediated by AP-1 and FOXF1 that regulates oncogene-induced senescence and further demonstrates the power of CRISPR-based functional genomic screens in deciphering the function of non-coding regulatory elements in the genome.},
}
@article {pmid30118998,
year = {2018},
author = {Liu, H and Xie, Y and Zhang, Z and Mao, P and Liu, J and Ma, W and Zhao, Y},
title = {Telomeric Recombination Induced by DNA Damage Results in Telomere Extension and Length Heterogeneity.},
journal = {Neoplasia (New York, N.Y.)},
volume = {20},
number = {9},
pages = {905-916},
pmid = {30118998},
issn = {1476-5586},
mesh = {CRISPR-Cas Systems ; Cell Cycle/genetics ; Cell Line ; DNA Breaks, Double-Stranded ; *DNA Damage ; DNA Repair ; Gene Editing ; Gene Targeting ; Humans ; *Recombination, Genetic ; Sister Chromatid Exchange ; Telomerase/metabolism ; Telomere/*genetics/metabolism ; *Telomere Homeostasis ; },
abstract = {About 15% of human cancers counteract telomere loss by alternative lengthening of telomeres (ALT), which is attributed to homologous recombination (HR)-mediated events. But how telomeric HR leads to length elongation is poorly understood. Here, we explore telomere clustering and telomeric HR induced by double-stranded breaks (DSBs). We show that telomere clustering could occur at G1 and S phase of cell cycle and that three types of telomeric HR occur based on the manner of telomeric DNA exchange: equivalent telomeric sister chromatin exchange (T-SCE), inequivalent T-SCE, and No-SCE. While inequivalent T-SCE increases telomere length heterogeneity with no net gain of telomere length, No-SCE, which is presumably induced by interchromatid HR and/or break-induced replication, results in telomere elongation. Accordingly, cells subjected to long-term telomeric DSBs display increased heterogeneity of length and longer telomeres. We also demonstrate that DSBs-induced telomere elongation is telomerase independent. Moreover, telomeric recombination induced by DSBs is associated with formation of ALT-associated PML body and C-circle. Thus, DNA damage triggers recombination mediated elongation, leading to the induction of multiple ALT phenotypes.},
}
@article {pmid30117419,
year = {2018},
author = {Huang, YQ and Li, GL and Yang, HQ and Wu, ZF},
title = {[Progress and application of genome-edited pigs in biomedical research].},
journal = {Yi chuan = Hereditas},
volume = {40},
number = {8},
pages = {632-646},
doi = {10.16288/j.yczz.18-026},
pmid = {30117419},
issn = {0253-9772},
mesh = {Animals ; Biomedical Research/*trends ; CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; *Gene Editing ; *Genome ; Humans ; Swine/*genetics/metabolism ; },
abstract = {Genome editing technologies (GETs) can precisely alter the genomic sequences and modify the genetic information at the target site of an organism. Since the beginning of the 21st century, the GETs, including zinc finger nucleases (ZFN), transcription-activating-like receptor factor (TALEN), and clustered regularly interspaced short palindromic repeats/Cas endonucleases (CRISPR/Cas), have been successively developed. The GETs can easily engineer the targeted genomic site of animals to exhibit a desired phenotype(s), thereby providing valuable tools in biomedical research. The pigs are closely related to human, in terms of similarities in physiological properties and pathogenic characters. Thus, pigs have been used as important animal models in studies of human disease, xenotransplantation, and humanized organs regeneration. In this review, we summarize the development of the three GETs, research progress of genome-edited pigs as disease models and organ donors for xenotransplantation, and the prospects of their applications in future biomedical research.},
}
@article {pmid30117250,
year = {2018},
author = {Cabello-Yeves, PJ and Picazo, A and Camacho, A and Callieri, C and Rosselli, R and Roda-Garcia, JJ and Coutinho, FH and Rodriguez-Valera, F},
title = {Ecological and genomic features of two widespread freshwater picocyanobacteria.},
journal = {Environmental microbiology},
volume = {20},
number = {10},
pages = {3757-3771},
doi = {10.1111/1462-2920.14377},
pmid = {30117250},
issn = {1462-2920},
support = {//FEDER funds/ ; //Generalitat Valenciana/ ; CGL2015-69557-R'//CLIMAWET/ ; //Spanish Ministry of Economy and Competitiveness/ ; //European Fund for Regional Development/ ; },
abstract = {We present two genomes of widespread freshwater picocyanobacteria isolated by extinction dilution from a Spanish oligotrophic reservoir. Based on microscopy and genomic properties, both picocyanobacteria were tentatively designated Synechococcus lacustris Tous, formerly described as a metagenome assembled genome (MAG) from the same habitat, and Cyanobium usitatum Tous, described here for the first time. Both strains were purified in unicyanobacterial cultures, and their genomes were sequenced. They are broadly distributed in freshwater systems; the first seems to be a specialist on temperate reservoirs (Tous, Amadorio, Dexter, Lake Lanier, Sparkling), and the second appears to also be abundant in cold environments including ice-covered lakes such as Lake Baikal, Lake Erie or the brackish Baltic Sea. Having complete genomes provided access to the flexible genome that does not assemble in MAGs. We found several genomic islands in both genomes, within which there were genes for nitrogen acquisition, transporters for a wide set of compounds and biosynthesis of phycobilisomes in both strains. Some of these regions of low coverage in metagenomes also included antimicrobial compounds, transposases and phage defence systems, including a novel type III CRISPR-Cas phage defence system that was only detected in Synechococcus lacustris Tous.},
}
@article {pmid30114543,
year = {2018},
author = {Mattei, TA},
title = {The CRISPR-Cas9 Genome Editing System: Not as Precise as Previously Believed.},
journal = {World neurosurgery},
volume = {118},
number = {},
pages = {377-378},
doi = {10.1016/j.wneu.2018.08.042},
pmid = {30114543},
issn = {1878-8769},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Gene Editing/*methods/*standards ; Humans ; Reproducibility of Results ; },
}
@article {pmid30112967,
year = {2018},
author = {Gordon-Lipkin, E and Fatemi, A},
title = {Current Therapeutic Approaches in Leukodystrophies: A Review.},
journal = {Journal of child neurology},
volume = {33},
number = {13},
pages = {861-868},
doi = {10.1177/0883073818792313},
pmid = {30112967},
issn = {1708-8283},
abstract = {Leukodystrophies are a heterogeneous class of genetic diseases affecting the white matter in the central nervous system with a broad range of clinical manifestations and a frequently progressive course. An interest in precision medicine has emerged over the last several decades, and biomedical research in leukodystrophies has made exciting advances along this front through therapeutic target discovery and novel disease model systems. In this review, we discuss current and emerging therapeutic approaches in leukodystrophies, including gene therapy, antisense oligonucleotide therapy, CRISPR/CAS-based gene editing, and cell and stem cell based therapies.},
}
@article {pmid30110720,
year = {2018},
author = {Jung, IY and Lee, J},
title = {Unleashing the Therapeutic Potential of CAR-T Cell Therapy Using Gene-Editing Technologies.},
journal = {Molecules and cells},
volume = {41},
number = {8},
pages = {717-723},
pmid = {30110720},
issn = {0219-1032},
support = {//Ministry of Science and ICT/ ; 2018M3A9H3020844//National Research Foundation of Korea/ ; 2017M3A9B4061406//National Research Foundation of Korea/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Gene Editing/*methods ; Genetic Therapy/*methods ; Humans ; Receptors, Antigen, T-Cell/*genetics ; },
abstract = {Chimeric antigen receptor (CAR) T-cell therapy, an emerging immunotherapy, has demonstrated promising clinical results in hematological malignancies including B-cell malignancies. However, accessibility to this transformative medicine is highly limited due to the complex process of manufacturing, limited options for target antigens, and insufficient anti-tumor responses against solid tumors. Advances in gene-editing technologies, such as the development of Zinc Finger Nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR/Cas9), have provided novel engineering strategies to address these limitations. Development of next-generation CAR-T cells using gene-editing technologies would enhance the therapeutic potential of CAR-T cell treatment for both hematologic and solid tumors. Here we summarize the unmet medical needs of current CAR-T cell therapies and gene-editing strategies to resolve these challenges as well as safety concerns of gene-edited CAR-T therapies.},
}
@article {pmid30109815,
year = {2018},
author = {Gleditzsch, D and Pausch, P and Müller-Esparza, H and Özcan, A and Guo, X and Bange, G and Randau, L},
title = {PAM identification by CRISPR-Cas effector complexes: diversified mechanisms and structures.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-14},
doi = {10.1080/15476286.2018.1504546},
pmid = {30109815},
issn = {1555-8584},
abstract = {Adaptive immunity of prokaryotes is mediated by CRISPR-Cas systems that employ a large variety of Cas protein effectors to identify and destroy foreign genetic material. The different targeting mechanisms of Cas proteins rely on the proper protection of the host genome sequence while allowing for efficient detection of target sequences, termed protospacers. A short DNA sequence, the protospacer-adjacent motif (PAM), is frequently used to mark proper target sites. Cas proteins have evolved a multitude of PAM-interacting domains, which enables them to cope with viral anti-CRISPR measures that alter the sequence or accessibility of PAM elements. In this review, we summarize known PAM recognition strategies for all CRISPR-Cas types. Available structures of target bound Cas protein effector complexes highlight the diversity of mechanisms and domain architectures that are employed to guarantee target specificity.},
}
@article {pmid30108577,
year = {2018},
author = {Maikova, A and Severinov, K and Soutourina, O},
title = {New Insights Into Functions and Possible Applications of Clostridium difficile CRISPR-Cas System.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1740},
pmid = {30108577},
issn = {1664-302X},
abstract = {Over the last decades the enteric bacterium Clostridium difficile (novel name Clostridioides difficile) - has emerged as an important human nosocomial pathogen. It is a leading cause of hospital-acquired diarrhea and represents a major challenge for healthcare providers. Many aspects of C. difficile pathogenesis and its evolution remain poorly understood. Efficient defense systems against phages and other genetic elements could have contributed to the success of this enteropathogen in the phage-rich gut communities. Recent studies demonstrated the presence of an active CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) subtype I-B system in C. difficile. In this mini-review, we will discuss the recent advances in characterization of original features of the C. difficile CRISPR-Cas system in laboratory and clinical strains, as well as interesting perspectives for our understanding of this defense system function and regulation in this important enteropathogen. This knowledge will pave the way for the development of promising biotechnological and therapeutic tools in the future. Possible applications for the C. difficile strain monitoring and genotyping, as well as for CRISPR-based genome editing and antimicrobials are also discussed.},
}
@article {pmid30107450,
year = {2018},
author = {Künne, T and Zhu, Y and da Silva, F and Konstantinides, N and McKenzie, RE and Jackson, RN and Brouns, SJ},
title = {Role of nucleotide identity in effective CRISPR target escape mutations.},
journal = {Nucleic acids research},
volume = {46},
number = {19},
pages = {10395-10404},
pmid = {30107450},
issn = {1362-4962},
support = {639707//European Research Council/International ; },
abstract = {Prokaryotes use primed CRISPR adaptation to update their memory bank of spacers against invading genetic elements that have escaped CRISPR interference through mutations in their protospacer target site. We previously observed a trend that nucleotide-dependent mismatches between crRNA and the protospacer strongly influence the efficiency of primed CRISPR adaptation. Here we show that guanine-substitutions in the target strand of the protospacer are highly detrimental to CRISPR interference and interference-dependent priming, while cytosine-substitutions are more readily tolerated. Furthermore, we show that this effect is based on strongly decreased binding affinity of the effector complex Cascade for guanine-mismatched targets, while cytosine-mismatched targets only minimally affect target DNA binding. Structural modeling of Cascade-bound targets with mismatches shows that steric clashes of mismatched guanines lead to unfavorable conformations of the RNA-DNA duplex. This effect has strong implications for the natural selection of target site mutations that lead to effective escape from type I CRISPR-Cas systems.},
}
@article {pmid30104577,
year = {2019},
author = {Molenda, O and Tang, S and Lomheim, L and Gautam, VK and Lemak, S and Yakunin, AF and Maxwell, KL and Edwards, EA},
title = {Extrachromosomal circular elements targeted by CRISPR-Cas in Dehalococcoides mccartyi are linked to mobilization of reductive dehalogenase genes.},
journal = {The ISME journal},
volume = {13},
number = {1},
pages = {24-38},
doi = {10.1038/s41396-018-0254-2},
pmid = {30104577},
issn = {1751-7370},
support = {2009-OGI-ABC-1405//Ontario Genomics Institute (OGI)/ ; },
abstract = {Dehalococcoides mccartyi are obligate organohalide-respiring bacteria that play an important detoxifying role in the environment. They have small genomes (~1.4 Mb) with a core region interrupted by two high plasticity regions (HPRs) containing dozens of genes encoding reductive dehalogenases involved in organohalide respiration. The genomes of eight new strains of D. mccartyi were closed from metagenomic data from a related set of enrichment cultures, bringing the total number of genomes to 24. Two of the newly sequenced strains and three previously sequenced strains contain CRISPR-Cas systems. These D. mccartyi CRISPR-Cas systems were found to primarily target prophages and genomic islands. The genomic islands were identified either as integrated into D. mccartyi genomes or as circular extrachromosomal elements. We observed active circularization of the integrated genomic island containing vcrABC operon encoding the dehalogenase (VcrA) responsible for the transformation of vinyl chloride to non-toxic ethene. We interrogated archived DNA from established enrichment cultures and found that the CRISPR array acquired three new spacers in 11 years. These data provide a glimpse into dynamic processes operating on the genomes distinct to D. mccartyi strains found in enrichment cultures and provide the first insights into possible mechanisms of lateral DNA exchange in D. mccartyi.},
}
@article {pmid30104361,
year = {2018},
author = {Zhang, Z and Niu, B and Ji, D and Li, M and Li, K and James, AA and Tan, A and Huang, Y},
title = {Silkworm genetic sexing through W chromosome-linked, targeted gene integration.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {35},
pages = {8752-8756},
pmid = {30104361},
issn = {1091-6490},
mesh = {Animals ; Bombyx/*genetics ; *CRISPR-Cas Systems ; Chromosomes, Insect/*genetics ; Female ; Gene Editing/*methods ; Male ; Sex Chromosomes/*genetics ; *Sex Determination Processes ; },
abstract = {Sex separation methods are critical for genetic sexing systems in commercial insect production and sterile insect techniques. Integration of selectable marker genes into a sex chromosome is particularly useful in insects with a heterogametic sex determination system. Here, we describe targeted gene integration of fluorescent marker expression cassettes into a randomly amplified polymorphic DNA (RAPD) marker region in the W chromosome of the lepidopteran model insect Bombyx mori using transcriptional activator-like effector nuclease (TALEN)-mediated genome editing. This silkworm strain shows ubiquitous female-specific red or green fluorescence from the embryonic to adult stages. Furthermore, we developed a binary, female-specific, embryonic lethality system combining the TALEN and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology. This system includes one strain with TALEN-mediated, W-specific Cas9 expression driven by the silkworm germ cell-specific nanos (nos) promoter and another strain with U6-derived single-guide RNA (sgRNA) expression targeting transformer 2 (tra2), an essential gene for silkworm embryonic development. Filial 1 (F1) hybrids exhibit complete female-specific lethality during embryonic stages. Our study provides a promising approach for B. mori genetic sexing and sheds light on developing sterile insect techniques in other insect species, especially in lepidopteran pests with WZ/ZZ sex chromosome systems.},
}
@article {pmid30103848,
year = {2018},
author = {Devkota, S},
title = {The road less traveled: strategies to enhance the frequency of homology-directed repair (HDR) for increased efficiency of CRISPR/Cas-mediated transgenesis.},
journal = {BMB reports},
volume = {51},
number = {9},
pages = {437-443},
pmid = {30103848},
issn = {1976-670X},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; *Gene Transfer Techniques ; Humans ; Recombinational DNA Repair/*genetics ; },
abstract = {Non-homologous end joining (NHEJ), and to a lesser extent, the error-free pathway known as homology-directed repair (HDR) are cellular mechanisms for recovery from double-strand DNA breaks (DSB) induced by RNA-guided programmable nuclease CRISPR/Cas. Since NHEJ is equivalent to using a duck tape to stick two pieces of metals together, the outcome of this repair mechanism is prone to error. Any out-of-frame mutations or premature stop codons resulting from NHEJ repair mechanism are extremely handy for loss-of-function studies. Substitution of a mutation on the genome with the correct exogenous repair DNA requires coordination via an error-free HDR, for targeted transgenesis. However, several practical limitations exist in harnessing the potential of HDR to replace a faulty mutation for therapeutic purposes in all cell types and more so in somatic cells. In germ cells after the DSB, copying occurs from the homologous chromosome, which increases the chances of incorporation of exogenous DNA with some degree of homology into the genome compared with somatic cells where copying from the identical sister chromatid is always preferred. This review summarizes several strategies that have been implemented to increase the frequency of HDR with a focus on somatic cells. It also highlights the limitations of this technology in gene therapy and suggests specific solutions to circumvent those barriers. [BMB Reports 2018; 51(9): 437-443].},
}
@article {pmid30103702,
year = {2018},
author = {Iorio, F and Behan, FM and Gonçalves, E and Bhosle, SG and Chen, E and Shepherd, R and Beaver, C and Ansari, R and Pooley, R and Wilkinson, P and Harper, S and Butler, AP and Stronach, EA and Saez-Rodriguez, J and Yusa, K and Garnett, MJ},
title = {Unsupervised correction of gene-independent cell responses to CRISPR-Cas9 targeting.},
journal = {BMC genomics},
volume = {19},
number = {1},
pages = {604},
pmid = {30103702},
issn = {1471-2164},
support = {015//Open Targets/ ; C44943/A22536//Cancer Research UK/United Kingdom ; SU2C-AACR-DT1213//Cancer Research UK/United Kingdom ; 102696//Wellcome Trust (GB)/ ; },
mesh = {*CRISPR-Cas Systems ; Cell Line, Tumor ; DNA Copy Number Variations ; Gene Amplification ; Gene Knockout Techniques/methods ; Gene Targeting/*methods ; Genes, Essential ; *Genome, Human ; High-Throughput Screening Assays ; Humans ; Neoplasms/*genetics ; Sequence Analysis, DNA ; Software ; },
abstract = {BACKGROUND: Genome editing by CRISPR-Cas9 technology allows large-scale screening of gene essentiality in cancer. A confounding factor when interpreting CRISPR-Cas9 screens is the high false-positive rate in detecting essential genes within copy number amplified regions of the genome. We have developed the computational tool CRISPRcleanR which is capable of identifying and correcting gene-independent responses to CRISPR-Cas9 targeting. CRISPRcleanR uses an unsupervised approach based on the segmentation of single-guide RNA fold change values across the genome, without making any assumption about the copy number status of the targeted genes.<br><br>RESULTS: Applying our method to existing and newly generated genome-wide essentiality profiles from 15 cancer cell lines, we demonstrate that CRISPRcleanR reduces false positives when calling essential genes, correcting biases within and outside of amplified regions, while maintaining true positive rates. Established cancer dependencies and essentiality signals of amplified cancer driver genes are detectable post-correction. CRISPRcleanR reports sgRNA fold changes and normalised read counts, is therefore compatible with downstream analysis tools, and works with multiple sgRNA libraries.<br><br>CONCLUSIONS: CRISPRcleanR is a versatile open-source tool for the analysis of CRISPR-Cas9 knockout screens to identify essential genes.},
}
@article {pmid30103650,
year = {2018},
author = {Faure, G and Shmakov, SA and Makarova, KS and Wolf, YI and Crawley, AB and Barrangou, R and Koonin, EV},
title = {Comparative genomics and evolution of trans-activating RNAs in Class 2 CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-14},
doi = {10.1080/15476286.2018.1493331},
pmid = {30103650},
issn = {1555-8584},
abstract = {Trans-activating CRISPR (tracr) RNA is a distinct RNA species that interacts with the CRISPR (cr) RNA to form the dual guide (g) RNA in type II and subtype V-B CRISPR-Cas systems. The tracrRNA-crRNA interaction is essential for pre-crRNA processing as well as target recognition and cleavage. The tracrRNA consists of an antirepeat, which forms an imperfect hybrid with the repeat in the crRNA, and a distal region containing a Rho-independent terminator. Exhaustive comparative analysis of the sequences and predicted structures of the Class 2 CRISPR guide RNAs shows that all these guide RNAs share distinct structural features, in particular, the nexus stem-loop that separates the repeat-antirepeat hybrid from the distal portion of the tracrRNA and the conserved GU pair at that end of the hybrid. These structural constraints might ensure full exposure of the spacer for target recognition. Reconstruction of tracrRNA evolution for 4 tight bacterial groups demonstrates random drift of repeat-antirepeat complementarity within a window of hybrid stability that is, apparently, maintained by selection. An evolutionary scenario is proposed whereby tracrRNAs evolved on multiple occasions, via rearrangement of a CRISPR array to form the antirepeat in different locations with respect to the array. A functional tracrRNA would form if, in the new location, the antirepeat is flanked by sequences that meet the minimal requirements for a promoter and a Rho-independent terminator. Alternatively, or additionally, the antirepeat sequence could be occasionally 'reset' by recombination with a repeat, restoring the functionality of tracrRNAs that drift beyond the required minimal hybrid stability.},
}
@article {pmid30102386,
year = {2018},
author = {Ka, D and Jang, DM and Han, BW and Bae, E},
title = {Molecular organization of the type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2.},
journal = {Nucleic acids research},
volume = {46},
number = {18},
pages = {9805-9815},
pmid = {30102386},
issn = {1362-4962},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) proteins provide microbial adaptive immunity against invading foreign nucleic acids. In type II-A CRISPR-Cas systems, the Cas1-Cas2 integrase complex and the subtype-specific Csn2 comprise the CRISPR adaptation module, which cooperates with the Cas9 nuclease effector for spacer selection. Here, we report the molecular organization of the Streptococcus pyogenes type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2. We determined the crystal structure of S. pyogenes type II-A Cas2. Chromatographic and calorimetric analyses revealed the stoichiometry and topology of the type II-A adaptation module composed of Cas1, Cas2 and Csn2. We also demonstrated that Cas9 interacts with Csn2 in a direct and stoichiometric manner. Our results reveal a network of molecular interactions among type II-A Cas proteins and highlight the role of Csn2 in coordinating Cas components involved in the adaptation and interference stages of CRISPR-mediated immunity.},
}
@article {pmid30097071,
year = {2018},
author = {Su, J and Huang, YH and Cui, X and Wang, X and Zhang, X and Lei, Y and Xu, J and Lin, X and Chen, K and Lv, J and Goodell, MA and Li, W},
title = {Homeobox oncogene activation by pan-cancer DNA hypermethylation.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {108},
pmid = {30097071},
issn = {1474-760X},
support = {R01 CA193466/CA/NCI NIH HHS/United States ; F99 CA222736/CA/NCI NIH HHS/United States ; R01HG007538/NH/NIH HHS/United States ; R56 DK092883/DK/NIDDK NIH HHS/United States ; U54CA217297/NH/NIH HHS/United States ; CA228140/CA/NCI NIH HHS/United States ; DK092883/NH/NIH HHS/United States ; R01CA193466/NH/NIH HHS/United States ; P50 CA126752/CA/NCI NIH HHS/United States ; P30 CA125123/CA/NCI NIH HHS/United States ; CA183252/NH/NIH HHS/United States ; R01 CA183252/CA/NCI NIH HHS/United States ; R01 HG007538/HG/NHGRI NIH HHS/United States ; R01 DK092883/DK/NIDDK NIH HHS/United States ; U54 CA217297/CA/NCI NIH HHS/United States ; },
mesh = {CRISPR-Cas Systems/genetics ; DNA (Cytosine-5-)-Methyltransferases/metabolism ; DNA Methylation/*genetics ; *Gene Expression Regulation, Neoplastic ; *Genes, Homeobox ; Humans ; Neoplasms/*genetics ; *Oncogenes ; Promoter Regions, Genetic ; Reference Standards ; },
abstract = {BACKGROUND: Cancers have long been recognized to be not only genetically but also epigenetically distinct from their tissues of origin. Although genetic alterations underlying oncogene upregulation have been well studied, to what extent epigenetic mechanisms, such as DNA methylation, can also induce oncogene expression remains unknown.<br><br>RESULTS: Here, through pan-cancer analysis of 4174 genome-wide profiles, including whole-genome bisulfite sequencing data from 30 normal tissues and 35 solid tumors, we discover a strong correlation between gene-body hypermethylation of DNA methylation canyons, defined as broad under-methylated regions, and overexpression of approximately 43% of homeobox genes, many of which are also oncogenes. To gain insights into the cause-and-effect relationship, we use a newly developed dCas9-SunTag-DNMT3A system to methylate genomic sites of interest. The locus-specific hypermethylation of gene-body canyon, but not promoter, of homeobox oncogene DLX1, can directly increase its gene expression.<br><br>CONCLUSIONS: Our pan-cancer analysis followed by functional validation reveals DNA hypermethylation as a novel epigenetic mechanism for homeobox oncogene upregulation.},
}
@article {pmid30096986,
year = {2018},
author = {Killelea, T and Hawkins, M and Howard, JL and McGlynn, P and Bolt, EL},
title = {DNA replication roadblocks caused by Cascade interference complexes are alleviated by RecG DNA repair helicase.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-6},
doi = {10.1080/15476286.2018.1496773},
pmid = {30096986},
issn = {1555-8584},
abstract = {Cascade complexes underpin E. coli CRISPR-Cas immunity systems by stimulating 'adaptation' reactions that update immunity and by initiating 'interference' reactions that destroy invader DNA. Recognition of invader DNA in Cascade catalysed R-loops provokes DNA capture and its subsequent integration into CRISPR loci by Cas1 and Cas2. DNA capture processes are unclear but may involve RecG helicase, which stimulates adaptation during its role responding to genome instability. We show that Cascade is a potential source of genome instability because it blocks DNA replication and that RecG helicase alleviates this by dissociating Cascade. This highlights how integrating in vitro CRISPR-Cas interference and adaptation reactions with DNA replication and repair reactions will help to determine precise mechanisms underpinning prokaryotic adaptive immunity.},
}
@article {pmid30096237,
year = {2018},
author = {Li, R and Zhang, L and Wang, L and Chen, L and Zhao, R and Sheng, J and Shen, L},
title = {Reduction of Tomato-Plant Chilling Tolerance by CRISPR-Cas9-Mediated SlCBF1 Mutagenesis.},
journal = {Journal of agricultural and food chemistry},
volume = {66},
number = {34},
pages = {9042-9051},
doi = {10.1021/acs.jafc.8b02177},
pmid = {30096237},
issn = {1520-5118},
mesh = {CRISPR-Cas Systems ; Cold Temperature ; Gene Knockout Techniques ; Lycopersicon esculentum/genetics/*physiology ; Mutagenesis ; Plant Proteins/*genetics/metabolism ; *Stress, Physiological ; },
abstract = {Chilling stress is the main constraint in tomato (Solanum lycopersicum) production, as this is a chilling-sensitive horticultural crop. The highly conserved C-repeat binding factors (CBFs) are cold-response-system components found in many species. In this study, we generated slcbf1 mutants using the CRISPR-Cas9 system and investigated the role of SlCBF1 in tomato-plant chilling tolerances. The slcbf1 mutants exhibited more severe chilling-injury symptoms with higher electrolyte leakage and malondialdehyde levels than wild-type (WT) plants. Additionally, slcbf1 mutants showed lower proline and protein contents and higher hydrogen peroxide contents and activities of antioxidant enzymes than WT plants. Knockout of SlCBF1 significantly increased indole acetic acid contents but decreased methyl jasmonate, abscisic acid, and zeatin riboside contents. The reduced chilling tolerance of the slcbf1 mutants was further reflected by the down-regulation of CBF-related genes. These results contribute to a better understanding of the molecular basis underlying SlCBF1 mediation of tomato chilling sensitivity.},
}
@article {pmid30094064,
year = {2018},
author = {Goodman, DA and Stedman, KM},
title = {Comparative genetic and genomic analysis of the novel fusellovirus Sulfolobus spindle-shaped virus 10.},
journal = {Virus evolution},
volume = {4},
number = {2},
pages = {vey022},
pmid = {30094064},
issn = {2057-1577},
support = {R41 AI126940/AI/NIAID NIH HHS/United States ; },
abstract = {Viruses that infect thermophilic Archaea are unique in both their structure and genetic makeup. The lemon-shaped fuselloviruses-which infect members of the order Sulfolobales, growing optimally at 80 °C and pH 3-are some of the most ubiquitous and best studied viruses of the thermoacidophilic Archaea. Nonetheless, much remains to be learned about these viruses. In order to investigate fusellovirus evolution, we have isolated and characterized a novel fusellovirus, Sulfolobus spindle-shaped virus 10 (formerly SSV-L1). Comparative genomic analyses highlight significant similarity with both SSV8 and SSV9, as well as conservation of promoter elements within the Fuselloviridae. SSV10 encodes five ORFs with no homology within or outside of the Fuselloviridae, as well as a putatively functional Cas4-like ORF, which may play a role in evading CRISPR-mediated host defenses. Moreover, we demonstrate the ability of SSV10 to withstand mutation in a fashion consistent with mutagenesis in SSV1.},
}
@article {pmid30093604,
year = {2018},
author = {Kalhor, R and Kalhor, K and Mejia, L and Leeper, K and Graveline, A and Mali, P and Church, GM},
title = {Developmental barcoding of whole mouse via homing CRISPR.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6405},
pages = {},
pmid = {30093604},
issn = {1095-9203},
support = {P50 HG005550/HG/NHGRI NIH HHS/United States ; R01 GM123313/GM/NIGMS NIH HHS/United States ; R01 MH103910/MH/NIMH NIH HHS/United States ; R01 CA222826/CA/NCI NIH HHS/United States ; R01 HG009285/HG/NHGRI NIH HHS/United States ; },
mesh = {Alleles ; Animals ; *CRISPR-Cas Systems ; Cell Lineage ; Embryonic Development/*genetics ; Embryonic Stem Cells ; Gene Expression Profiling/*methods ; Mice ; Mutation ; RNA, Guide/genetics ; },
abstract = {In vivo barcoding using nuclease-induced mutations is a powerful approach for recording biological information, including developmental lineages; however, its application in mammalian systems has been limited. We present in vivo barcoding in the mouse with multiple homing guide RNAs that each generate hundreds of mutant alleles and combine to produce an exponential diversity of barcodes. Activation upon conception and continued mutagenesis through gestation resulted in developmentally barcoded mice wherein information is recorded in lineage-specific mutations. We used these recordings for reliable post hoc reconstruction of the earliest lineages and investigation of axis development in the brain. Our results provide an enabling and versatile platform for in vivo barcoding and lineage tracing in a mammalian model system.},
}
@article {pmid30091101,
year = {2018},
author = {Immethun, CM and Moon, TS},
title = {Synthetic Gene Regulation in Cyanobacteria.},
journal = {Advances in experimental medicine and biology},
volume = {1080},
number = {},
pages = {317-355},
doi = {10.1007/978-981-13-0854-3_13},
pmid = {30091101},
issn = {0065-2598},
abstract = {Cyanobacteria are appealing hosts for green chemical synthesis due to their use of light and carbon dioxide. To optimize product yields and titers, specific and tunable regulation of the metabolic pathways is needed. Synthetic biology has increased and diversified the genetic tools available for biological process control. While early tool development focused on commonly used heterotrophs, there has been a recent expansion of tools for cyanobacteria. CRISPR-Cas9 has been used to edit the genome of cyanobacterial strains, while transcriptional regulation has been accomplished with CRISPR interference and RNA riboswitches. Promoter development has produced a significant number of transcriptional regulators, including those that respond to chemicals, environmental signals, and metabolic states. Trans-acting RNAs have been utilized for posttranscriptional and translational control. The regulation of translation initiation is beginning to be explored with ribosome binding sites and riboswitches, while protein degradation tags have been used to control expression levels. Devices built from multiple parts have also been developed to create more complex behaviors. These advances in development of synthetic cyanobacterial regulatory parts provide the groundwork for creation of new, even more sophisticated bioprocess control devices, bolstering the viability of cyanobacteria as sustainable biotechnology platforms.},
}
@article {pmid30090055,
year = {2018},
author = {Robbins, JP and Perfect, L and Ribe, EM and Maresca, M and Dangla-Valls, A and Foster, EM and Killick, R and Nowosiad, P and Reid, MJ and Polit, LD and Nevado, AJ and Ebner, D and Bohlooly-Y, M and Buckley, N and Pangalos, MN and Price, J and Lovestone, S},
title = {Clusterin Is Required for β-Amyloid Toxicity in Human iPSC-Derived Neurons.},
journal = {Frontiers in neuroscience},
volume = {12},
number = {},
pages = {504},
pmid = {30090055},
issn = {1662-4548},
abstract = {Our understanding of the molecular processes underlying Alzheimer's disease (AD) is still limited, hindering the development of effective treatments, and highlighting the need for human-specific models. Advances in identifying components of the amyloid cascade are progressing, including the role of the protein clusterin in mediating β-amyloid (Aβ) toxicity. Mutations in the clusterin gene (CLU), a major genetic AD risk factor, are known to have important roles in Aβ processing. Here we investigate how CLU mediates Aβ-driven neurodegeneration in human induced pluripotent stem cell (iPSC)-derived neurons. We generated a novel CLU-knockout iPSC line by CRISPR/Cas9-mediated gene editing to investigate Aβ-mediated neurodegeneration in cortical neurons differentiated from wild type and CLU knockout iPSCs. We measured response to Aβ using an imaging assay and measured changes in gene expression using qPCR and RNA sequencing. In wild type neurons imaging indicated that neuronal processes degenerate following treatment with Aβ25-35 peptides and Aβ1-42 oligomers, in a dose dependent manner, and that intracellular levels of clusterin are increased following Aβ treatment. However, in CLU knockout neurons Aβ exposure did not affect neurite length, suggesting that clusterin is an important component of the amyloid cascade. Transcriptomic data were analyzed to elucidate the pathways responsible for the altered response to Aβ in neurons with the CLU deletion. Four of the five genes previously identified as downstream to Aβ and Dickkopf-1 (DKK1) proteins in an Aβ-driven neurotoxic pathway in rodent cells were also dysregulated in human neurons with the CLU deletion. AD and lysosome pathways were the most significantly dysregulated pathways in the CLU knockout neurons, and pathways relating to cytoskeletal processes were most dysregulated in Aβ treated neurons. The absence of neurodegeneration in the CLU knockout neurons in response to Aβ compared to the wild type neurons supports the role of clusterin in Aβ-mediated AD pathogenesis.},
}
@article {pmid30086262,
year = {2018},
author = {Chugh, S and Barkeer, S and Rachagani, S and Nimmakayala, RK and Perumal, N and Pothuraju, R and Atri, P and Mahapatra, S and Thapa, I and Talmon, GA and Smith, LM and Yu, X and Neelamegham, S and Fu, J and Xia, L and Ponnusamy, MP and Batra, SK},
title = {Disruption of C1galt1 Gene Promotes Development and Metastasis of Pancreatic Adenocarcinomas in Mice.},
journal = {Gastroenterology},
volume = {155},
number = {5},
pages = {1608-1624},
pmid = {30086262},
issn = {1528-0012},
support = {U01 CA200466/CA/NCI NIH HHS/United States ; R01 HL103411/HL/NHLBI NIH HHS/United States ; R01 CA195586/CA/NCI NIH HHS/United States ; P50 CA127297/CA/NCI NIH HHS/United States ; R01 DK085691/DK/NIDDK NIH HHS/United States ; P30 GM114731/GM/NIGMS NIH HHS/United States ; U01 CA210240/CA/NCI NIH HHS/United States ; R01 CA183459/CA/NCI NIH HHS/United States ; R01 CA210637/CA/NCI NIH HHS/United States ; P01 CA217798/CA/NCI NIH HHS/United States ; },
mesh = {Adenocarcinoma/*etiology/secondary ; Animals ; CRISPR-Cas Systems ; Carcinoma, Pancreatic Ductal ; Cell Proliferation ; Galactosyltransferases/genetics/*physiology ; Glycosylation ; Humans ; Mice ; Mice, Inbred C57BL ; Pancreatic Neoplasms/*etiology/pathology ; },
abstract = {BACKGROUND &amp; AIMS: Pancreatic ductal adenocarcinomas (PDACs) produce higher levels of truncated O-glycan structures (such as Tn and sTn) than normal pancreata. Dysregulated activity of core 1 synthase glycoprotein-N-acetylgalactosamine 3-β-galactosyltransferase 1 (C1GALT1) leads to increased expression of these truncated O-glycans. We investigated whether and how truncated O-glycans contributes to the development and progression of PDAC using mice with disruption of C1galt1.<br><br>METHODS: We crossed C1galt1 floxed mice (C1galt1loxP/loxP) with KrasG12D/+; Trp53R172H/+; Pdx1-Cre (KPC) mice to create KPCC mice. Growth and progression of pancreatic tumors were compared between KPC and KPCC mice; pancreatic tissues were collected and analyzed by immunohistochemistry; immunofluorescence; and Sirius red, alcian blue, and lectin staining. We used the CRISPR/Cas9 system to disrupt C1GALT1 in human PDAC cells (T3M4 and CD18/HPAF) and levels of O-glycans were analyzed by lectin blotting, mass spectrometry, and lectin pulldown assay. Orthotopic studies and RNA sequencing analyses were performed with control and C1GALT1 knockout PDAC cells. C1GALT1 expression was analyzed in well-differentiated (n = 36) and poorly differentiated (n = 23) PDAC samples by immunohistochemistry.<br><br>RESULTS: KPCC mice had significantly shorter survival times (median 102 days) than KPC mice (median 200 days) and developed early pancreatic intraepithelial neoplasias at 3 weeks, PDAC at 5 weeks, and metastasis at 10 weeks compared with KPC mice. Pancreatic tumors that developed in KPCC mice were more aggressive (more invasive and metastases) than those in KPC mice, had a decreased amount of stroma, and had increased production of Tn. Poorly differentiated PDAC specimens had significantly lower levels of C1GALT1 than well-differentiated PDACs. Human PDAC cells with knockout of C1GALT1 had aberrant glycosylation of MUC16 compared with control cells and increased expression of genes that regulate tumorigenesis and metastasis.<br><br>CONCLUSIONS: In studies of KPC mice with disruption of C1galt1, we found that loss of C1galt1 promotes development of aggressive PDACs and increased metastasis. Knockout of C1galt1 leads to increased tumorigenicity and truncation of O-glycosylation on MUC16, which could contribute to increased aggressiveness.},
}
@article {pmid30085063,
year = {2018},
author = {Buckner, MMC and Ciusa, ML and Piddock, LJV},
title = {Strategies to combat antimicrobial resistance: anti-plasmid and plasmid curing.},
journal = {FEMS microbiology reviews},
volume = {42},
number = {6},
pages = {781-804},
pmid = {30085063},
issn = {1574-6976},
support = {//Wellcome Trust/United Kingdom ; },
abstract = {Antimicrobial resistance (AMR) is a global problem hindering treatment of bacterial infections, rendering many aspects of modern medicine less effective. AMR genes (ARGs) are frequently located on plasmids, which are self-replicating elements of DNA. They are often transmissible between bacteria, and some have spread globally. Novel strategies to combat AMR are needed, and plasmid curing and anti-plasmid approaches could reduce ARG prevalence, and sensitise bacteria to antibiotics. We discuss the use of curing agents as laboratory tools including chemicals (e.g. detergents and intercalating agents), drugs used in medicine including ascorbic acid, psychotropic drugs (e.g. chlorpromazine), antibiotics (e.g. aminocoumarins, quinolones and rifampicin) and plant-derived compounds. Novel strategies are examined; these include conjugation inhibitors (e.g. TraE inhibitors, linoleic, oleic, 2-hexadecynoic and tanzawaic acids), systems designed around plasmid incompatibility, phages and CRISPR/Cas-based approaches. Currently, there is a general lack of in vivo curing options. This review highlights this important shortfall, which if filled could provide a promising mechanism to reduce ARG prevalence in humans and animals. Plasmid curing mechanisms which are not suitable for in vivo use could still prove important for reducing the global burden of AMR, as high levels of ARGs exist in the environment.},
}
@article {pmid30082270,
year = {2018},
author = {Jardin, N and Giudicelli, F and Ten Martín, D and Vitrac, A and De Gois, S and Allison, R and Houart, C and Reid, E and Hazan, J and Fassier, C},
title = {BMP- and neuropilin 1-mediated motor axon navigation relies on spastin alternative translation.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {17},
pages = {},
pmid = {30082270},
issn = {1477-9129},
support = {MR/M00046X/1//Medical Research Council/United Kingdom ; },
mesh = {Animals ; Axons/metabolism ; Bone Morphogenetic Proteins/*metabolism ; COS Cells ; CRISPR-Cas Systems/genetics ; Cell Line ; Cell Movement/genetics ; Cercopithecus aethiops ; GTP-Binding Proteins/metabolism ; Gene Knockout Techniques ; Humans ; Membrane Proteins/metabolism ; Motor Neurons/*cytology ; Neuropilin-1/*metabolism ; Protein Isoforms/genetics ; Spastic Paraplegia, Hereditary/genetics ; Spastin/biosynthesis/*genetics ; Zebrafish/*embryology ; Zebrafish Proteins/biosynthesis/*genetics ; },
abstract = {Functional analyses of genes responsible for neurodegenerative disorders have unveiled crucial links between neurodegenerative processes and key developmental signalling pathways. Mutations in SPG4-encoding spastin cause hereditary spastic paraplegia (HSP). Spastin is involved in diverse cellular processes that couple microtubule severing to membrane remodelling. Two main spastin isoforms are synthesised from alternative translational start sites (M1 and M87). However, their specific roles in neuronal development and homeostasis remain largely unknown. To selectively unravel their neuronal function, we blocked spastin synthesis from each initiation codon during zebrafish development and performed rescue analyses. The knockdown of each isoform led to different motor neuron and locomotion defects, which were not rescued by the selective expression of the other isoform. Notably, both morphant neuronal phenotypes were observed in a CRISPR/Cas9 spastin mutant. We next showed that M1 spastin, together with HSP proteins atlastin 1 and NIPA1, drives motor axon targeting by repressing BMP signalling, whereas M87 spastin acts downstream of neuropilin 1 to control motor neuron migration. Our data therefore suggest that defective BMP and neuropilin 1 signalling may contribute to the motor phenotype in a vertebrate model of spastin depletion.},
}
@article {pmid30081743,
year = {2018},
author = {Millen, AM and Samson, JE and Tremblay, DM and Magadán, AH and Rousseau, GM and Moineau, S and Romero, DA},
title = {Lactococcus lactis type III-A CRISPR-Cas system cleaves bacteriophage RNA.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-8},
doi = {10.1080/15476286.2018.1502589},
pmid = {30081743},
issn = {1555-8584},
abstract = {CRISPR-Cas defends microbial cells against invading nucleic acids including viral genomes. Recent studies have shown that type III-A CRISPR-Cas systems target both RNA and DNA in a transcription-dependent manner. We previously found a type III-A system on a conjugative plasmid in Lactococcus lactis which provided resistance against virulent phages of the Siphoviridae family. Its naturally occurring spacers are oriented to generate crRNAs complementary to target phage mRNA, suggesting transcription-dependent targeting. Here, we show that only constructs whose spacers produce crRNAs complementary to the phage mRNA confer phage resistance in L. lactis. In vivo nucleic acid cleavage assays showed that cleavage of phage dsDNA genome was not detected within phage-infected L. lactis cells. On the other hand, Northern blots indicated that the lactococcal CRISPR-Cas cleaves phage mRNA in vivo. These results cannot exclude that single-stranded phage DNA is not being targeted, but phage DNA replication has been shown to be impaired.},
}
@article {pmid30081189,
year = {2018},
author = {de Carvalho, TG and Schuh, R and Pasqualim, G and Pellenz, FM and Filippi-Chiela, EC and Giugliani, R and Baldo, G and Matte, U},
title = {CRISPR-Cas9-mediated gene editing in human MPS I fibroblasts.},
journal = {Gene},
volume = {678},
number = {},
pages = {33-37},
doi = {10.1016/j.gene.2018.08.004},
pmid = {30081189},
issn = {1879-0038},
mesh = {CRISPR-Cas Systems ; Cells, Cultured ; Fibroblasts/*cytology/metabolism ; Gene Editing/*methods ; Genetic Therapy ; High-Throughput Nucleotide Sequencing ; Humans ; Iduronidase/*genetics ; Mucopolysaccharidosis I/*genetics/therapy ; Mutation ; Sequence Analysis, DNA ; },
abstract = {Mucopolysaccharidosis type I (MPS I) is a lysosomal storage disorder (LSD). It is caused by mutations in the IDUA gene, which lead to the accumulation of the glycosaminoglycans dermatan and heparan sulfate. The CRISPR-Cas9 system is a new and powerful tool that allows gene editing at precise points of the genome, resulting in gene correction through the introduction and genomic integration of a wildtype sequence. In this study, we used the CRISPR-Cas9 genome editing technology to correct in vitro the most common mutation causing MPS I. Human fibroblasts homozygous for p.Trp402* (legacy name W402X) were transfected and analyzed for up to one month after treatment. IDUA activity was significantly increased, lysosomal mass was decreased, and next generation sequencing confirmed that a percentage of cells carried the wildtype sequence. As a proof of concept, this study demonstrates that CRISPR-Cas9 genome editing may be used to correct causative mutations in MPS I. LIST OF ABBREVIATIONS.},
}
@article {pmid30078724,
year = {2018},
author = {Strohkendl, I and Saifuddin, FA and Rybarski, JR and Finkelstein, IJ and Russell, R},
title = {Kinetic Basis for DNA Target Specificity of CRISPR-Cas12a.},
journal = {Molecular cell},
volume = {71},
number = {5},
pages = {816-824.e3},
doi = {10.1016/j.molcel.2018.06.043},
pmid = {30078724},
issn = {1097-4164},
abstract = {Class 2 CRISPR-Cas nucleases are programmable genome editing tools with promising applications in human health and disease. However, DNA cleavage at off-target sites that resemble the target sequence is a pervasive problem that remains poorly understood mechanistically. Here, we use quantitative kinetics to dissect the reaction steps of DNA targeting by Acidaminococcus sp Cas12a (also known as Cpf1). We show that Cas12a binds DNA tightly in two kinetically separable steps. Protospacer-adjacent motif (PAM) recognition is followed by rate-limiting R-loop propagation, leading to inevitable DNA cleavage of both strands. Despite functionally irreversible binding, Cas12a discriminates strongly against mismatches along most of the DNA target sequence. This result implies substantial reversibility during R-loop formation-a late transition state-and defies common descriptions of a &quot;seed&quot; region. Our results provide a quantitative basis for the DNA cleavage patterns measured in vivo and observations of greater reported target specificity for Cas12a than for the Cas9 nuclease.},
}
@article {pmid30078067,
year = {2018},
author = {Javed, MR and Sadaf, M and Ahmed, T and Jamil, A and Nawaz, M and Abbas, H and Ijaz, A},
title = {CRISPR-Cas System: History and Prospects as a Genome Editing Tool in Microorganisms.},
journal = {Current microbiology},
volume = {75},
number = {12},
pages = {1675-1683},
pmid = {30078067},
issn = {1432-0991},
support = {NRPU Project # 5590//Higher Education Commission of Pakistan/ ; },
mesh = {Animals ; Bacteria/*genetics ; CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; Gene Editing/methods ; Genetic Engineering/methods ; Genome/*genetics ; Humans ; },
abstract = {Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR or more precisely CRISPR-Cas) system has proven to be a highly efficient and simple tool for achieving site-specific genome modifications in comparison to Zinc Finger Nucleases (ZFNs) and Transcription Activator-Like Effector Nucleases (TALENs). The discovery of bacterial defense system that uses RNA-guided DNA cleaving enzymes for producing double-strand breaks along CRISPR has provided an exciting alternative to ZFNs and TALENs for gene editing &amp; regulation, as the CRISPR-associated (Cas) proteins remain the same for different gene targets and only the short sequence of the guide RNA needs to be changed to redirect the site-specific cleavage. Therefore, in recent years the CRISPR-Cas system has emerged as a revolutionary engineering tool for carrying out precise and controlled genetic modifications in many microbes such as Escherichia coli, Staphylococcus aureus, Lactobacillus reuteri, Clostridium beijerinckii, Streptococcus pneumonia, and Saccharomyces cerevisiae. Though, concerns about CRISPR-Cas effectiveness in interlinked gene modifications and off-target effects need to be addressed. Nevertheless, it holds a great potential to speed up the pace of gene function discovery by interacting with previously intractable organisms and by raising the extent of genetic screens. Therefore, the potential applications of this system in microbial adaptive immune system, genome editing, gene regulations, functional genomics &amp; biosynthesis along ethical issues, and possible harmful effects have been reviewed.},
}
@article {pmid30076877,
year = {2018},
author = {Nishiyama, J},
title = {Genome editing in the mammalian brain using the CRISPR-Cas system.},
journal = {Neuroscience research},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.neures.2018.07.003},
pmid = {30076877},
issn = {1872-8111},
abstract = {Recent advances in genome editing technologies such as the clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease Cas9 have enabled the rapid and efficient modification of endogenous genomes in a variety of cell types, accelerating biomedical research. In particular, precise genome editing in somatic cells in vivo allows for the rapid generation of genetically modified cells in living animals and holds great promise for the possibility of directly correcting genetic defects associated with human diseases. However, because of the limited efficiency and suitability of these technologies in the brain, especially in postmitotic neurons, the practical application of genome editing technologies has been largely limited in the field of neuroscience. Recent technological advances overcome significant challenges facing genome editing in the brain and have enabled us to precisely edit the genome in both mitotic cells and mature postmitotic neurons in vitro and in vivo, providing powerful means for studying gene function and dysfunction in the brain. This review highlights the development of genome editing technologies for the brain and discusses their applications, limitations, and future challenges.},
}
@article {pmid30076736,
year = {2018},
author = {Mendoza, BJ and Trinh, CT},
title = {In Silico Processing of the Complete CRISPR-Cas Spacer Space for Identification of PAM Sequences.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700595},
doi = {10.1002/biot.201700595},
pmid = {30076736},
issn = {1860-7314},
support = {D17AP00023//Defense Advanced Research Projects Agency/ ; },
mesh = {Algorithms ; CRISPR-Cas Systems/*genetics ; *Computer Simulation ; DNA, Intergenic/*genetics ; Databases, Genetic ; Genome, Archaeal/genetics ; Genome, Bacterial/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {Despite extensive exploration of the diversity of CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR associated) systems, biological applications have been mostly confined to Class 2 systems, specifically the Cas9 and Cas12 (formerly Cpf1) single effector proteins. A key limitation of exploring and utilizing other CRISPR-Cas systems with unique functionalities, particularly Class I types and their multi-protein effector complex, is the knowledge of the system's protospacer adjacent motif (PAM) sequence identity. In this work, the authors developed a systematic pipeline, named CASPERpam, that enables a comprehensive assessment of the PAM sequences of all the available CRISPR-Cas systems in the NCBI database of bacterial genomes. The CASPERpam analysis reveals that within the 30 389 assemblies previously screened for CRISPR arrays, there exists 26 364 spacers that match somewhere in the viral, bacterial, and plasmid databases of NCBI, using the constraints of 95% sequence identity and 95% sequence coverage for blast hits. When grouping these results by species, the authors identified putative PAM sequences for 1049 among 1493 unique species. The remaining species either have insufficient data or an undetermined result from the analysis. Finally, the authors assigned a confidence score to each species' PAM prediction and generate categories that largely cover the revealed diversity of PAM motifs, providing a baseline for further experimental studies including PAM assays. The authors envision CASPERpam is a useful bioinformatic tool for understanding and harnessing the diversity of CRISPR-Cas systems.},
}
@article {pmid30076486,
year = {2018},
author = {Kuruvilla, J and Sasmita, AO and Ling, APK},
title = {Therapeutic potential of combined viral transduction and CRISPR/Cas9 gene editing in treating neurodegenerative diseases.},
journal = {Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology},
volume = {39},
number = {11},
pages = {1827-1835},
pmid = {30076486},
issn = {1590-3478},
mesh = {Animals ; CRISPR-Cas Systems/*physiology ; Gene Editing/*methods ; Genetic Therapy/*methods ; Genetic Vectors ; Humans ; Neurodegenerative Diseases/*genetics/*therapy ; },
abstract = {BACKGROUND AND PURPOSE: The central nervous system (CNS) faces unique difficulties in attaining permanent therapy for neurodegenerative disorder (ND). Genomic level forms of therapy have garnered interest in the recent decade, with the novel CRISPR/Cas9 gene editing tool continuing to be explored due to its efficiency, safety, and adaptability to varying conditions. With the aid of viral vectors as transport vectors, the gene editing tool has produced promising in vitro and in vivo findings in study models. Thus, this review focuses on the recent advancements and update of CRISPR/Cas9 to combat neurodegenerative diseases.<br><br>METHODS: Articles detailing potential applications of CRISPR/Cas9 in neurodegenerative settings were retrieved from PubMed and Google Scholar with the keywords &quot;CRISPR,&quot; &quot;gene editing,&quot; and &quot;neurodegenerative diseases.&quot; Relevant information was collected and critically reviewed.<br><br>RESULTS: The utility of CRISPR/Cas9 coupled with viral transduction ranges from the disruption of amyloid precursor protein (APP) production at a genomic level in Alzheimer's disease (AD) to the deletion of varying exon portions of the Dmd gene in Duchenne muscular dystrophy (DMD) which would increase dystrophin expression. This usage of CRISPR/Cas9 also extends to experimentally ameliorate the neurodegenerative effects caused by viral infections.<br><br>CONCLUSION: The CRISPR/Cas9 gene editing tool is a powerful arsenal in the field of gene therapy and molecular medicine; hence, more research should be called to focus on the ample potential this tool has to offer in the field of neurodegenerative diseases.},
}
@article {pmid30075414,
year = {2018},
author = {Su, X and Wang, S and Su, G and Zheng, Z and Zhang, J and Ma, Y and Liu, Z and Zhou, H and Zhang, Y and Zhang, L},
title = {Production of microhomologous-mediated site-specific integrated LacS gene cow using TALENs.},
journal = {Theriogenology},
volume = {119},
number = {},
pages = {282-288},
doi = {10.1016/j.theriogenology.2018.07.011},
pmid = {30075414},
issn = {1879-3231},
mesh = {Animals ; Animals, Genetically Modified ; Animals, Newborn ; CRISPR-Cas Systems ; Cattle/*genetics ; DNA ; Female ; Gene Editing/methods/*veterinary ; Genetic Engineering/methods ; Genotype ; Transcription Activator-Like Effector Nucleases ; },
abstract = {Gene editing tools (Zinc-Finger Nucleases, ZFN; Transcription Activator-Like Effector Nucleases, TALEN; and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas)9, CRISPR-Cas9) provide us with a powerful means of performing genetic engineering procedures. A combinational approach that utilizes both somatic cell nuclear transfer (SCNT) and somatic cell gene editing facilitates the generation of genetically engineered animals. However, the associated research has utilized markers and/or selected genes, which constitute a potential threat to biosafety. Microhomologous-mediated end-joining (MMEJ) has showed the utilization of micro-homologous arms (5-25 bp) can mediate exogenous gene insertion. Dairy milk is a major source of nutrition worldwide. However, most people are not capable of optimally utilizing the nutrition in milk because of lactose intolerance. Sulfolobus solfataricus β-glycosidase (LacS) is a lactase derived from the extreme thermophilic archaeon Sulfolobus solfataricus. Our finally aim was to site-specific integrated LacS gene into cow's genome through TALEN-mediated MMEJ and produce low-lactose cow. Firstly, we constructed TALENs vectors which target to the cow's β-casein locus and LacS gene expression vector which contain TALEN reorganization sequence and micro-homologous arms. Then we co-transfected these vectors into fetal derived skin fibroblasts and cultured as monoclone. Positive cell clones were screened using 3' junction PCR amplification and sequencing analysis. The positive cells were used as donors for SCNT and embryo transfer (ET). Lastly, we detected the genotype through PCR of blood genomic DNA. This resulted in a LacS knock-in rate of 0.8% in TALEN-treated cattle fetal fibroblasts. The blastocyst rate of SCNT embryo was 27%. The 3 months pregnancy rate was 20%. Finally, we obtained 1 newborn cow (5%) and verified its genotype. We obtained 1 site-specific marker-free LacS transgenic cow. It provides a basis to solve lactose intolerance by gene engineering breeding. This study also provides us with a new strategy to facilitate gene knock-ins in livestock using techniques that exhibit improved biosafety and intuitive methodologies.},
}
@article {pmid30075125,
year = {2018},
author = {Plaza Reyes, A and Lanner, F},
title = {Time Matters: Gene Editing at the Mouse 2-Cell Embryo Stage Boosts Knockin Efficiency.},
journal = {Cell stem cell},
volume = {23},
number = {2},
pages = {155-157},
doi = {10.1016/j.stem.2018.07.008},
pmid = {30075125},
issn = {1875-9777},
abstract = {Although endonuclease-mediated genome editing techniques offer significant improvement over traditional methods, they are still ineffective for introduction of large DNA sequences. Recently in Nature Biotechnology, Gu et al. (2018) developed a CRISPR-Cas strategy termed 2C-HR-CRISPR that generates fluorescent reporter tagging of genes with up to 95% knockin efficiency in mouse embryos.},
}
@article {pmid30074178,
year = {2018},
author = {Cheng, YX and Chen, GT and Yang, X and Wang, YQ and Hong, L},
title = {Effects of HPV Pseudotype Virus in Cutting E6 Gene Selectively in SiHa Cells.},
journal = {Current medical science},
volume = {38},
number = {2},
pages = {212-221},
pmid = {30074178},
issn = {2523-899X},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; Carcinogenesis/pathology ; Cell Line, Tumor ; Cell Proliferation ; Human papillomavirus 16/*metabolism ; Humans ; Mice, Inbred BALB C ; Mice, Nude ; Neoplasm Invasiveness ; Oncogene Proteins, Viral/*genetics/metabolism ; Plasmids/metabolism ; RNA, Guide/metabolism ; RNA, Messenger/genetics/metabolism ; Repressor Proteins/*genetics/metabolism ; },
abstract = {The objectives of this study were to investigate the effects of the CRISPR/Cas9 system mediated by the HPV pseudotype virus on SiHa cytobiology behavior by cutting the HPV16 E6 gene selectively and to explore the role of this system in the treatment of cervical cancer. After designing specific gRNA sequences targeting HPV16 E6, generating hCas9-EGFP and E6-gRNA-RFP plasmids, and preparing the pseudovirus of HPV16 carrying E6-gRNA and Cas9 plasmids, we determined the titer of the pseudotype virus using the TCID50 method. We obtained the pseudotype virus of HPV16 carrying E6-gRNA and Cas9 plasmids to transfect cervical cancer SiHa cells. Experimental subjects were divided into control group, empty virus group, E6-gRNA transfected group, Cas9 transfected group and Cas9+E6-gRNA transfected group. The molecular size of the cutting sequence was detected using the T7E1 enzyme digestion method and agarose gel electrophoresis, and the cleavage function of CRISPR/Cas9 on the E6 gene was determined at the same time. RT-PCR and Western blotting were performed to detect the mRNA and protein expression levels of E6 in all the groups; the Transwell cell migration assay was performed to detect the cell migration ability and metastasis in all groups. Heterotopic transplantation tumors were incorporated into mice and were used to investigate the effects of the CRISPR/Cas9 system mediated by the HPV pseudovirus on the tumorigenic ability of SiHa cells by selectively cutting HPV16 E6. The HPV16 pseudotype virus carrying E6-gRNA and Cas9 plasmids could successfully infect SiHa cells, and there were two cutting zones in the Cas9+E6-gRNA transfected group. However, the empty virus group, E6-gRNA transfected group and Cas9 transfected group had no corresponding zone. Compared with those in the control group, the empty virus group, E6-gRNA transfected group and Cas9 transfected group, the mRNA and protein expression levels of E6 in SiHa cells were downregulated in the Cas9+E6-gRNA transfected group (P<0.01). In addition, the proliferation and migration abilities of SiHa cells were significantly inhibited (P<0.01). There were no significant differences among the other groups. In contrast to the control group, the HPV pseudotype virus carrying E6-gRNA and Cas9 plasmids could significantly delay the growth of tumor cells of the ectopic tumor transplantation model (P<0.01). The CRISPR/Cas9 system mediated by the HPV pseudotype virus to knockout E6 gene expression exhibited a clear inhibitory effect on the biological function of SiHa cells, which indicated that knocking out the E6 gene using the CRISPR/Cas9 system mediated by the HPV pseudotype virus had a potential effect of eliminating HPV infection and inhibiting the growth of HPV-related tumors. Taken together, these findings provide insight into a new treatment strategy for the prevention and treatment of hr-HPV infected disease, particularly in HPV-related tumors.},
}
@article {pmid30073181,
year = {2018},
author = {Simhadri, VL and McGill, J and McMahon, S and Wang, J and Jiang, H and Sauna, ZE},
title = {Prevalence of Pre-existing Antibodies to CRISPR-Associated Nuclease Cas9 in the USA Population.},
journal = {Molecular therapy. Methods &amp; clinical development},
volume = {10},
number = {},
pages = {105-112},
pmid = {30073181},
issn = {2329-0501},
abstract = {The repurposing of the CRISPR/Cas microbial adaptive immune system for gene editing has resulted in an exponential rise in new technologies and promising approaches for treating numerous human diseases. While some of the approaches being currently developed involve ex vivo editing by CRISPR/Cas9, many more potential applications will require in vivo editing. The in vivo use of this technology comes with challenges, one of which is the immune response to Cas9, a protein of microbial origin. Thus, the prevalence of pre-existing antibodies to Cas9 could also be a relevant parameter. There are many avenues for how CRISPR/Cas9 technologies will be applied in vivo, including the mode of delivery. These may be expected to invoke different immunological pathways. Nonetheless, as with all protein therapeutics, it may be desirable to monitor for anti-Cas9 antibodies during clinical development. This will require the development of robust and reliable assays. Here, we describe ELISA-based assays that are capable of detecting antibodies to Cas9 from Staphylococcus aureus (SaCas9) and Streptococcs pyogenes (SpCas9) in human sera. Furthermore, using these assays to screen for pre-existing antibodies in 200 human serum samples, we found the prevalence of anti-SaCas9 and anti-SpCas9 antibodies to be 10% and 2.5%, respectively.},
}
@article {pmid30073121,
year = {2018},
author = {Aglawe, SB and Barbadikar, KM and Mangrauthia, SK and Madhav, MS},
title = {New breeding technique &quot;genome editing&quot; for crop improvement: applications, potentials and challenges.},
journal = {3 Biotech},
volume = {8},
number = {8},
pages = {336},
pmid = {30073121},
issn = {2190-572X},
abstract = {Crop improvement is a continuous process in agriculture which ensures ample supply of food, fodder and fiber to burgeoning world population. Despite tremendous success in plant breeding and transgenesis to improve the yield-related traits, there have been several limitations primarily with the specificity in genetic modifications and incompatibility of host species. Because of this, new breeding techniques (NBTs) are gaining worldwide attention for crop improvement programs. Among the NBTs, genome editing (GE) using site-directed nucleases (SDNs) is an important and potential technique that overcomes limitations associated with classical breeding and transgenesis. These SDNs specifically target a compatible region in the gene/genome. The meganucleases (MgN), zinc finger nucleases (ZFN), transcription activator-like effectors nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated endonuclease (Cas) are being successfully employed for GE. These can be used for desired or targeted modifications of the native endogenous gene(s) or targeted insertion of cis/trans elements in the genomes of recipient organisms. Applications of these techniques appear to be endless ever since their discovery and several modifications in original technologies have further brought precision and accuracy in these methods. In this review, we present an overview of GE using SDNs with an emphasis on CRISPR/Cas system, their advantages, limitations and also practical considerations while designing experiments have been discussed. The review also emphasizes on the possible applications of CRISPR for improving economic traits in crop plants.},
}
@article {pmid30072959,
year = {2018},
author = {González-Torres, P and Gabaldón, T},
title = {Genome Variation in the Model Halophilic Bacterium Salinibacter ruber.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1499},
pmid = {30072959},
issn = {1664-302X},
abstract = {The halophilic bacterium Salinibacter ruber is an abundant and ecologically important member of halophilic communities worldwide. Given its broad distribution and high intraspecific genetic diversity, S. ruber is considered one of the main models for ecological and evolutionary studies of bacterial adaptation to hypersaline environments. However, current insights on the genomic diversity of this species is limited to the comparison of the genomes of two co-isolated strains. Here, we present a comparative genomic analysis of eight S. ruber strains isolated at two different time points in each of two different Mediterranean solar salterns. Our results show an open pangenome with contrasting evolutionary patterns in the core and accessory genomes. We found that the core genome is shaped by extensive homologous recombination (HR), which results in limited sequence variation within population clusters. In contrast, the accessory genome is modulated by horizontal gene transfer (HGT), with genomic islands and plasmids acting as gateways to the rest of the genome. In addition, both types of genetic exchange are modulated by restriction and modification (RM) or CRISPR-Cas systems. Finally, genes differentially impacted by such processes reveal functional processes potentially relevant for environmental interactions and adaptation to extremophilic conditions. Altogether, our results support scenarios that conciliate &quot;Neutral&quot; and &quot;Constant Diversity&quot; models of bacterial evolution.},
}
@article {pmid30072518,
year = {2018},
author = {Kupferschmidt, K},
title = {EU verdict on CRISPR crops dismays scientists.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6401},
pages = {435-436},
doi = {10.1126/science.361.6401.435},
pmid = {30072518},
issn = {1095-9203},
mesh = {*CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats ; Crops, Agricultural/*genetics ; European Union ; Gene Editing/*legislation &amp; jurisprudence ; Plants, Genetically Modified/*genetics ; },
}
@article {pmid30068963,
year = {2018},
author = {Crawley, AB and Henriksen, ED and Stout, E and Brandt, K and Barrangou, R},
title = {Characterizing the activity of abundant, diverse and active CRISPR-Cas systems in lactobacilli.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {11544},
pmid = {30068963},
issn = {2045-2322},
abstract = {CRISPR-Cas systems provide immunity against phages and plasmids in bacteria and archaea. Despite the popularity of CRISPR-Cas9 based genome editing, few endogenous systems have been characterized to date. Here, we sampled 1,262 publically available lactobacilli genomes found them to be enriched with CRISPR-Cas adaptive immunity. While CRISPR-Cas is ubiquitous in some Lactobacillus species, CRISPR-Cas content varies at the strain level in most Lactobacillus species. We identified that Type II is the most abundant type across the genus, with II-A being the most dominant sub-type. We found that many Type II-A systems are actively transcribed, and encode spacers that efficiently provide resistance against plasmid uptake. Analysis of various CRISPR transcripts revealed that guide sequences are highly diverse in terms of crRNA and tracrRNA length and structure. Interference assays revealed highly diverse target PAM sequences. Lastly, we show that these systems can be readily repurposed for self-targeting by expressing an engineered single guide RNA. Our results reveal that Type II-A systems in lactobacilli are naturally active in their native host in terms of expression and efficiently targeting invasive and genomic DNA. Together, these systems increase the possible Cas9 targeting space and provide multiplexing potential in native hosts and heterologous genome editing purpose.},
}
@article {pmid30068905,
year = {2018},
author = {Chaverra-Rodriguez, D and Macias, VM and Hughes, GL and Pujhari, S and Suzuki, Y and Peterson, DR and Kim, D and McKeand, S and Rasgon, JL},
title = {Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable germline gene editing.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {3008},
pmid = {30068905},
issn = {2041-1723},
support = {R21 AI111175/AI/NIAID NIH HHS/United States ; U01CK000512//ACL HHS/United States ; R01 AI116636/AI/NIAID NIH HHS/United States ; R21 AI124452/AI/NIAID NIH HHS/United States ; R01 AI128201/AI/NIAID NIH HHS/United States ; R21 AI129507/AI/NIAID NIH HHS/United States ; U19 AI089672/AI/NIAID NIH HHS/United States ; },
mesh = {Alleles ; Animals ; Base Sequence ; CRISPR-Associated Protein 9/*metabolism ; CRISPR-Cas Systems/*genetics ; Crosses, Genetic ; Culicidae/embryology/*genetics ; Drosophila melanogaster/genetics ; Embryo, Nonmammalian/metabolism ; Female ; *Gene Editing ; Germ Cells/*metabolism ; Green Fluorescent Proteins/metabolism ; Inheritance Patterns/genetics ; Injections ; Male ; Mutation/genetics ; Oocytes/metabolism ; Ovary/*metabolism ; Ribonucleoproteins/*metabolism ; Sequence Deletion ; },
abstract = {Cas9-mediated gene editing is a powerful tool for addressing research questions in arthropods. Current approaches rely upon delivering Cas9 ribonucleoprotein (RNP) complex by embryonic microinjection, which is challenging, is limited to a small number of species, and is inefficient even in optimized taxa. Here we develop a technology termed Receptor-Mediated Ovary Transduction of Cargo (ReMOT Control) to deliver Cas9 RNP to the arthropod germline by injection into adult female mosquitoes. We identify a peptide (P2C) that mediates transduction of Cas9 RNP from the female hemolymph to the developing mosquito oocytes, resulting in heritable gene editing of the offspring with efficiency as high as 0.3 mutants per injected mosquito. We demonstrate that P2C functions in six mosquito species. Identification of taxa-specific ovary-specific ligand-receptor pairs may further extend the use of ReMOT Control for gene editing in novel species.},
}
@article {pmid30065322,
year = {2018},
author = {Callaway, E},
title = {CRISPR plants now subject to tough GM laws in European Union.},
journal = {Nature},
volume = {560},
number = {7716},
pages = {16},
doi = {10.1038/d41586-018-05814-6},
pmid = {30065322},
issn = {1476-4687},
mesh = {Agriculture/economics/legislation &amp; jurisprudence/methods ; CRISPR-Cas Systems/*genetics ; *European Union ; *Food, Genetically Modified/economics/standards ; Gene Editing/*legislation &amp; jurisprudence/standards/trends ; Humans ; Mutagenesis ; Plant Breeding/economics/legislation &amp; jurisprudence/methods ; Research/*legislation &amp; jurisprudence/trends ; },
}
@article {pmid30063480,
year = {2018},
author = {Sicard, A and Boardman, DA and Levings, MK},
title = {Taking regulatory T-cell therapy one step further.},
journal = {Current opinion in organ transplantation},
volume = {23},
number = {5},
pages = {509-515},
doi = {10.1097/MOT.0000000000000566},
pmid = {30063480},
issn = {1531-7013},
abstract = {PURPOSE OF REVIEW: Adoptive cell therapy using CD4FOXP3 regulatory T cells (Treg) has emerged as a promising therapeutic strategy to treat autoimmunity and alloimmunity. Preclinical studies suggest that the efficacy of Treg therapy can be improved by modifying the antigen specificity, stability and function of therapeutic Tregs. We review recent innovations that considerably enhance the possibilities of controlling these parameters.<br><br>RECENT FINDINGS: Antigen-specific Tregs can be generated by genetically modifying polyclonal Tregs to express designated T-cell receptors or single-chain chimeric antigen receptors. The benefits of this approach can be further extended by using novel strategies to fine-tune the antigen-specificity and affinity of Treg in vivo. CRISPR/Cas 9 technology now enables the modification of therapeutic Tregs so they are safer, more stable and long lived. The differentiation and homing properties of Tregs can also be modulated by gene editing or modifying ex-vivo stimulation conditions.<br><br>SUMMARY: A new wave of innovation has considerably increased the number of strategies that could be used to increase the therapeutic potential of Treg therapy. However, the increased complexity of these approaches may limit their wide accessibility. Third-party therapy with off-the-shelf Treg products could be a solution.},
}
@article {pmid30061876,
year = {2018},
author = {Li, HY and Kao, CY and Lin, WH and Zheng, PX and Yan, JJ and Wang, MC and Teng, CH and Tseng, CC and Wu, JJ},
title = {Characterization of CRISPR-Cas Systems in Clinical Klebsiella pneumoniae Isolates Uncovers Its Potential Association With Antibiotic Susceptibility.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1595},
pmid = {30061876},
issn = {1664-302X},
abstract = {Prokaryotic CRISPR-Cas systems limit the acquisition of genetic elements and provide immunity against invasive bacteriophage. The characteristics of CRISPR-Cas systems in clinical Klebsiella pneumoniae isolates are still unknown. Here, 97 K. pneumoniae genomes retrieved from the Integrated Microbial Genomes &amp; Microbiomes genome database and 176 clinical isolates obtained from patients with bloodstream (BSI, n = 87) or urinary tract infections (UTI, n = 89) in Taiwan, were used for analysis. Forty out of ninety-seven genomes (41.2%) had CRISPR-Cas systems identified by the combination of CRISPRFinder and cas1 gene sequence alignment. The phylogenetic trees revealed that CRISPR-Cas systems in K. pneumoniae were divided into two types (type I-E, 23; subtype I-E∗, 17) based on the sequences of Cas1 and Cas3 proteins and their location in the chromosome. The distribution of type I-E and I-E∗ CRISPR-Cas systems was associated with the multilocus sequence typing and the pulsed-field gel electrophoresis results. Importantly, no CRISPR-Cas system was identified in published genomes of clonal complex 258 isolates (ST11 and ST258), which comprise the largest multi-drug resistant K. pneumoniae clonal group worldwide. PCR with cas-specific primers showed that 30.7% (54/176) of the clinical isolates had a CRISPR-Cas system. Among clinical isolates, more type I-E CRISPR-Cas systems were found in UTI isolates (BSI, 5.7%; UTI, 11.2%), and subtype I-E∗ CRISPR-Cas systems were dominant in BSI isolates (BSI, 28.7%; UTI, 15.7%) (p = 0.042). Isolates which had subtype I-E∗ CRISPR-Cas system were more susceptible to ampicillin-sulbactam (p = 0.009), cefazolin (p = 0.016), cefuroxime (p = 0.039), and gentamicin (p = 0.012), compared to the CRISPR-negative isolates. The strains containing subtype I-E∗ CRISPR-Cas systems had decreased numbers of plasmids, prophage regions, and acquired antibiotic resistance genes in their published genomes. Here, we first revealed subtype I-E∗ CRISPR-Cas system in K. pneumoniae potentially interfering with the acquisition of phages and plasmids harboring antibiotic resistance determinants, and thus maintained these isolates susceptible to antibiotics.},
}
@article {pmid30061218,
year = {2018},
author = {Lee, J and Yun, HH and Kim, S and Ji, SH and Kuh, HJ and Lee, JH},
title = {Implication of BIS in the Migration and Invasion of A549 Non-small Cell Lung Cancer Cells.},
journal = {Anticancer research},
volume = {38},
number = {8},
pages = {4525-4533},
doi = {10.21873/anticanres.12756},
pmid = {30061218},
issn = {1791-7530},
mesh = {A549 Cells ; Bcl-2-Like Protein 11/*metabolism ; CRISPR-Cas Systems/physiology ; Cadherins/metabolism ; Carcinoma, Non-Small-Cell Lung/metabolism/*pathology ; Cell Communication/physiology ; Cell Line, Tumor ; Cell Movement/*physiology ; Epithelial-Mesenchymal Transition/physiology ; Humans ; Lung Neoplasms/metabolism/*pathology ; Matrix Metalloproteinase 2/metabolism ; NF-kappa B/metabolism ; Neoplasm Invasiveness/*pathology ; RNA, Messenger/metabolism ; Signal Transduction/physiology ; Snail Family Transcription Factors/metabolism ; Wound Healing/physiology ; Zinc Finger E-box-Binding Homeobox 1/metabolism ; },
abstract = {BACKGROUND/AIM: High expression of the Bcl-2-interacting cell death suppressor (BIS), an anti-apoptotic protein, in various human cancers is linked to a poor outcome. The purpose of this study was to clarify whether BIS is associated with the migration and invasive characteristics of A549 cells.<br><br>MATERIALS AND METHODS: BIS-knockout (KO) cells were prepared by the CRISPR/Cas9 method. The aggressive behaviors of A549 cells were analyzed by wound healing and a transwell invasion assay as well as 3D spheroid culture.<br><br>RESULTS: BIS depletion resulted in significant inhibition of the migration and invasive potential of A549 cells which was accompanied by an increased ratio of E-cadherin/N-cadherin and a decrease in the mRNA levels of Zeb1, Snail, Slug and MMP-2. NF-κB activity was suppressed in BIS-KO A549 cells due to the decrease in p65 protein levels, but not in mRNA levels.<br><br>CONCLUSION: BIS regulates cell invasion and the induction of the epithelial-mesenchymal transition (EMT) phenotype in A549 cells probably via the NF-κB signaling pathway.},
}
@article {pmid30060765,
year = {2018},
author = {Seal, BS and Drider, D and Oakley, BB and Brüssow, H and Bikard, D and Rich, JO and Miller, S and Devillard, E and Kwan, J and Bertin, G and Reeves, S and Swift, SM and Raicek, M and Gay, CG},
title = {Microbial-derived products as potential new antimicrobials.},
journal = {Veterinary research},
volume = {49},
number = {1},
pages = {66},
pmid = {30060765},
issn = {1297-9716},
mesh = {Animal Diseases/prevention &amp; control ; *Animal Husbandry ; Animals ; Anti-Infective Agents/*analysis ; Bacteriocins ; Bacteriophages ; CRISPR-Cas Systems ; *Drug Discovery ; France ; Livestock ; },
abstract = {Due to the continuing global concerns involving antibiotic resistance, there is a need for scientific forums to assess advancements in the development of antimicrobials and their alternatives that might reduce development and spread of antibiotic resistance among bacterial pathogens. The objectives of the 2nd International Symposium on Alternatives to Antibiotics were to highlight promising research results and novel technologies that can provide alternatives to antibiotics for use in animal health and production, assess challenges associated with their authorization and commercialization for use, and provide actionable strategies to support their development. The session on microbial-derived products was directed at presenting novel technologies that included exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials, probiotics development via fecal microbiome transplants among monogastric production animals such as chickens and mining microbial sources such as bacteria or yeast to identify new antimicrobial compounds. Other research has included continuing development of antimicrobial peptides such as newly discovered bacteriocins as alternatives to antibiotics, use of bacteriophages accompanied by development of unique lytic proteins with specific cell-wall binding domains and novel approaches such as microbial-ecology guided discovery of anti-biofilm compounds discovered in marine environments. The symposium was held at the Headquarters of the World Organisation for Animal Health (OIE) in Paris, France during 12-15 December 2016.},
}
@article {pmid30059276,
year = {2018},
author = {Heidrich, N and Hagmann, A and Bauriedl, S and Vogel, J and Schoen, C},
title = {The CRISPR/Cas system in Neisseria meningitidis affects bacterial adhesion to human nasopharyngeal epithelial cells.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-7},
doi = {10.1080/15476286.2018.1486660},
pmid = {30059276},
issn = {1555-8584},
abstract = {Neisseria meningitidis, a commensal β-proteobacterium of the human nasopharynx, constitutes a worldwide leading cause of sepsis and epidemic meningitis. A recent genome-wide association study suggested an association of its type II-C CRISPR/Cas system with carriage and thus less invasive lineages. Here, we show that knock-out strains lacking the Cas9 protein are impaired in the adhesion to human nasopharyngeal cells which constitutes a central step in the pathogenesis of invasive meningococcal disease. Transcriptome sequencing data further suggest that meningococcal Cas9 does not affect the expression of surface adhesins but rather exerts its effect on cell adhesion in an indirect manner. Consequently, we speculate that the meningococcal CRISPR/Cas system exerts novel functions beyond its established role in defence against foreign DNA.},
}
@article {pmid30054595,
year = {2018},
author = {Richardson, CD and Kazane, KR and Feng, SJ and Zelin, E and Bray, NL and Schäfer, AJ and Floor, SN and Corn, JE},
title = {CRISPR-Cas9 genome editing in human cells occurs via the Fanconi anemia pathway.},
journal = {Nature genetics},
volume = {50},
number = {8},
pages = {1132-1139},
doi = {10.1038/s41588-018-0174-0},
pmid = {30054595},
issn = {1546-1718},
abstract = {CRISPR-Cas genome editing creates targeted DNA double-strand breaks (DSBs) that are processed by cellular repair pathways, including the incorporation of exogenous DNA via single-strand template repair (SSTR). To determine the genetic basis of SSTR in human cells, we developed a coupled inhibition-cutting system capable of interrogating multiple editing outcomes in the context of thousands of individual gene knockdowns. We found that human Cas9-induced SSTR requires the Fanconi anemia (FA) pathway, which is normally implicated in interstrand cross-link repair. The FA pathway does not directly impact error-prone, non-homologous end joining, but instead diverts repair toward SSTR. Furthermore, FANCD2 protein localizes to Cas9-induced DSBs, indicating a direct role in regulating genome editing. Since FA is itself a genetic disease, these data imply that patient genotype and/or transcriptome may impact the effectiveness of gene editing treatments and that treatments biased toward FA repair pathways could have therapeutic value.},
}
@article {pmid30054474,
year = {2018},
author = {Tycko, J and Barrera, LA and Huston, NC and Friedland, AE and Wu, X and Gootenberg, JS and Abudayyeh, OO and Myer, VE and Wilson, CJ and Hsu, PD},
title = {Pairwise library screen systematically interrogates Staphylococcus aureus Cas9 specificity in human cells.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2962},
pmid = {30054474},
issn = {2041-1723},
mesh = {Bacterial Proteins/genetics ; Base Sequence ; CRISPR-Associated Protein 9/*genetics ; CRISPR-Cas Systems ; Cloning, Molecular ; Clustered Regularly Interspaced Short Palindromic Repeats ; Gene Editing/*methods ; *Gene Library ; Genes, Bacterial/genetics ; HEK293 Cells ; Humans ; RNA, Guide/genetics ; Staphylococcus aureus/*genetics ; },
abstract = {Therapeutic genome editing with Staphylococcus aureus Cas9 (SaCas9) requires a rigorous understanding of its potential off-target activity in the human genome. Here we report a high-throughput screening approach to measure SaCas9 genome editing variation in human cells across a large repertoire of 88,692 single guide RNAs (sgRNAs) paired with matched or mismatched target sites in a synthetic cassette. We incorporate randomized barcodes that enable whitelisting of correctly synthesized molecules for further downstream analysis, in order to circumvent the limitation of oligonucleotide synthesis errors. We find SaCas9 sgRNAs with 21-mer or 22-mer spacer sequences are generally more active, although high efficiency 20-mer spacers are markedly less tolerant of mismatches. Using this dataset, we developed an SaCas9 specificity model that performs robustly in ranking off-target sites. The barcoded pairwise library screen enabled high-fidelity recovery of guide-target relationships, providing a scalable framework for the investigation of CRISPR enzyme properties and general nucleic acid interactions.},
}
@article {pmid30053228,
year = {2018},
author = {Hupfeld, M and Trasanidou, D and Ramazzini, L and Klumpp, J and Loessner, MJ and Kilcher, S},
title = {A functional type II-A CRISPR-Cas system from Listeria enables efficient genome editing of large non-integrating bacteriophage.},
journal = {Nucleic acids research},
volume = {46},
number = {13},
pages = {6920-6933},
pmid = {30053228},
issn = {1362-4962},
abstract = {CRISPR-Cas systems provide bacteria with adaptive immunity against invading DNA elements including bacteriophages and plasmids. While CRISPR technology has revolutionized eukaryotic genome engineering, its application to prokaryotes and their viruses remains less well established. Here we report the first functional CRISPR-Cas system from the genus Listeria and demonstrate its native role in phage defense. LivCRISPR-1 is a type II-A system from the genome of L. ivanovii subspecies londoniensis that uses a small, 1078 amino acid Cas9 variant and a unique NNACAC protospacer adjacent motif. We transferred LivCRISPR-1 cas9 and trans-activating crRNA into Listeria monocytogenes. Along with crRNA encoding plasmids, this programmable interference system enables efficient cleavage of bacterial DNA and incoming phage genomes. We used LivCRISPR-1 to develop an effective engineering platform for large, non-integrating Listeria phages based on allelic replacement and CRISPR-Cas-mediated counterselection. The broad host-range Listeria phage A511 was engineered to encode and express lysostaphin, a cell wall hydrolase that specifically targets Staphylococcus peptidoglycan. In bacterial co-culture, the armed phages not only killed Listeria hosts but also lysed Staphylococcus cells by enzymatic collateral damage. Simultaneous killing of unrelated bacteria by a single phage demonstrates the potential of CRISPR-Cas-assisted phage engineering, beyond single pathogen control.},
}
@article {pmid30052174,
year = {2018},
author = {Nguyen, SV and Harhay, DM and Bono, JL and Smith, TPL and Fields, PI and Dinsmore, BA and Santovenia, M and Wang, R and Bosilevac, JM and Harhay, GP},
title = {Comparative genomics of Salmonella enterica serovar Montevideo reveals lineage-specific gene differences that may influence ecological niche association.},
journal = {Microbial genomics},
volume = {4},
number = {8},
pages = {},
pmid = {30052174},
issn = {2057-5858},
abstract = {Salmonella enterica serovar Montevideo has been linked to recent foodborne illness outbreaks resulting from contamination of products such as fruits, vegetables, seeds and spices. Studies have shown that Montevideo also is frequently associated with healthy cattle and can be isolated from ground beef, yet human salmonellosis outbreaks of Montevideo associated with ground beef contamination are rare. This disparity fuelled our interest in characterizing the genomic differences between Montevideo strains isolated from healthy cattle and beef products, and those isolated from human patients and outbreak sources. To that end, we sequenced 13 Montevideo strains to completion, producing high-quality genome assemblies of isolates from human patients (n=8) or from healthy cattle at slaughter (n=5). Comparative analysis of sequence data from this study and publicly available sequences (n=72) shows that Montevideo falls into four previously established clades, differentially occupied by cattle and human strains. The results of these analyses reveal differences in metabolic islands, environmental adhesion determinants and virulence factors within each clade, and suggest explanations for the infrequent association between bovine isolates and human illnesses.},
}
@article {pmid30051818,
year = {2018},
author = {Viswanatha, R and Li, Z and Hu, Y and Perrimon, N},
title = {Pooled genome-wide CRISPR screening for basal and context-specific fitness gene essentiality in Drosophila cells.},
journal = {eLife},
volume = {7},
number = {},
pages = {},
pmid = {30051818},
issn = {2050-084X},
support = {5T32GM007748-39/GM/NIGMS NIH HHS/United States ; W81XWH-16-1-0127//U.S. Department of Defense/International ; R01 GM067761/GM/NIGMS NIH HHS/United States ; R01GM067761/GM/NIGMS NIH HHS/United States ; LAM0122P01-17//LAM Foundation/International ; T32 GM007748/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Animals ; CRISPR-Cas Systems ; Computational Biology ; Drosophila/*genetics ; *Drug Interactions ; Gene Expression Regulation/drug effects ; Gene Knockout Techniques ; Gene Library ; *Genes, Essential ; *Genetic Fitness ; *Genome-Wide Association Study ; Pharmacogenetics ; Phenotype ; Protein Kinase Inhibitors/*pharmacology ; Pyridones/pharmacology ; Pyrimidinones/pharmacology ; Sirolimus/pharmacology ; },
abstract = {Genome-wide screens in Drosophila cells have offered numerous insights into gene function, yet a major limitation has been the inability to stably deliver large multiplexed DNA libraries to cultured cells allowing barcoded pooled screens. Here, we developed a site-specific integration strategy for library delivery and performed a genome-wide CRISPR knockout screen in Drosophila S2R+ cells. Under basal growth conditions, 1235 genes were essential for cell fitness at a false-discovery rate of 5%, representing the highest-resolution fitness gene set yet assembled for Drosophila, including 407 genes which likely duplicated along the vertebrate lineage and whose orthologs were underrepresented in human CRISPR screens. We additionally performed context-specific fitness screens for resistance to or synergy with trametinib, a Ras/ERK/ETS inhibitor, or rapamycin, an mTOR inhibitor, and identified key regulators of each pathway. The results present a novel, scalable, and versatile platform for functional genomic screens in invertebrate cells.},
}
@article {pmid30048323,
year = {2018},
author = {Adams, AB and Kim, SC and Martens, GR and Ladowski, JM and Estrada, JL and Reyes, LM and Breeden, C and Stephenson, A and Eckhoff, DE and Tector, M and Tector, AJ},
title = {Xenoantigen Deletion and Chemical Immunosuppression Can Prolong Renal Xenograft Survival.},
journal = {Annals of surgery},
volume = {268},
number = {4},
pages = {564-573},
doi = {10.1097/SLA.0000000000002977},
pmid = {30048323},
issn = {1528-1140},
support = {R01 AI126322/AI/NIAID NIH HHS/United States ; },
abstract = {OBJECTIVE: Xenotransplantation using pig organs could end the donor organ shortage for transplantation, but humans have xenoreactive antibodies that cause early graft rejection. Genome editing can eliminate xenoantigens in donor pigs to minimize the impact of these xenoantibodies. Here we determine whether an improved cross-match and chemical immunosuppression could result in prolonged kidney xenograft survival in a pig-to-rhesus preclinical model.<br><br>METHODS: Double xenoantigen (Gal and Sda) knockout (DKO) pigs were created using CRISPR/Cas. Serum from rhesus monkeys (n = 43) was cross-matched with cells from the DKO pigs. Kidneys from the DKO pigs were transplanted into rhesus monkeys (n = 6) that had the least reactive cross-matches. The rhesus recipients were immunosuppressed with anti-CD4 and anti-CD8 T-cell depletion, anti-CD154, mycophenolic acid, and steroids.<br><br>RESULTS: Rhesus antibody binding to DKO cells is reduced, but all still have positive CDC and flow cross-match. Three grafts were rejected early at 5, 6, and 6 days. Longer survival was achieved in recipients with survival to 35, 100, and 435 days. Each of the 3 early graft losses was secondary to IgM antibody-mediated rejection. The 435-day graft loss occurred secondary to IgG antibody-mediated rejection.<br><br>CONCLUSIONS: Reducing xenoantigens in donor pigs and chemical immunosuppression can be used to achieve prolonged renal xenograft survival in a preclinical model, suggesting that if a negative cross-match can be obtained for humans then prolonged survival could be achieved.},
}
@article {pmid30046996,
year = {2018},
author = {Nozawa, K and Hayashi, A and Motohashi, J and Takeo, YH and Matsuda, K and Yuzaki, M},
title = {Cellular and Subcellular Localization of Endogenous Neuroligin-1 in the Cerebellum.},
journal = {Cerebellum (London, England)},
volume = {17},
number = {6},
pages = {709-721},
pmid = {30046996},
issn = {1473-4230},
support = {JP16H06461//Japan Society for the Promotion of Science/ ; JPMJCR13L6//Japan Science and Technology Agency/ ; JP15H05772//Ministry of Education, Culture, Sports, Science and Technology (JP)/ ; },
mesh = {Animals ; Astrocytes/cytology/metabolism ; CRISPR-Cas Systems ; Cell Adhesion Molecules, Neuronal/genetics/*metabolism ; Cerebellum/*cytology/*metabolism ; Epitopes ; Gene Knockdown Techniques ; Genetic Engineering ; HEK293 Cells ; Hemagglutinins/genetics/immunology ; Hippocampus/cytology/metabolism ; Humans ; Mice, Inbred C57BL ; Mice, Inbred DBA ; Mice, Inbred ICR ; Mice, Transgenic ; Neurons/cytology/metabolism ; Synapses/metabolism ; },
abstract = {Synapses are precisely established, maintained, and modified throughout life by molecules called synaptic organizers, which include neurexins and neuroligins (Nlgn). Despite the importance of synaptic organizers in defining functions of neuronal circuits, the cellular and subcellular localization of many synaptic organizers has remained largely elusive because of the paucity of specific antibodies for immunohistochemical studies. In the present study, rather than raising specific antibodies, we generated knock-in mice in which a hemagglutinin (HA) epitope was inserted in the Nlgn1 gene. We have achieved high-throughput and precise gene editing by delivering the CRISPR/Cas9 system into zygotes. Using HA-Nlgn1 mice, we found that HA-Nlgn1 was enriched at synapses between parallel fibers and molecular layer interneurons (MLIs) and the glomeruli, in which mossy fiber terminals synapse onto granule cell dendrites. HA immunoreactivity was colocalized with postsynaptic density 95 at these synapses, indicating that endogenous Nlgn1 is localized at excitatory postsynaptic sites. In contrast, HA-Nlgn1 signals were very weak in dendrites and somata of Purkinje cells. Interestingly, HA-immunoreactivities were also observed in the pinceau, a specialized structure formed by MLI axons and astrocytes. HA-immunoreactivities in the pinceau were significantly reduced by knockdown of Nlgn1 in MLIs, indicating that in addition to postsynaptic sites, Nlgn1 is also localized at MLI axons. Our results indicate that epitope-tagging by electroporation-based gene editing with CRISPR/Cas9 is a viable and powerful method for mapping endogenous synaptic organizers with subcellular resolution, without the need for specific antibodies for each protein.},
}
@article {pmid30046034,
year = {2018},
author = {Hynes, AP and Rousseau, GM and Agudelo, D and Goulet, A and Amigues, B and Loehr, J and Romero, DA and Fremaux, C and Horvath, P and Doyon, Y and Cambillau, C and Moineau, S},
title = {Widespread anti-CRISPR proteins in virulent bacteriophages inhibit a range of Cas9 proteins.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2919},
pmid = {30046034},
issn = {2041-1723},
mesh = {Bacteriophages/genetics ; CRISPR-Associated Protein 9/genetics/*physiology ; CRISPR-Cas Systems/genetics/physiology ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Gene Editing ; Humans ; Virulence/genetics/physiology ; },
abstract = {CRISPR-Cas systems are bacterial anti-viral systems, and bacterial viruses (bacteriophages, phages) can carry anti-CRISPR (Acr) proteins to evade that immunity. Acrs can also fine-tune the activity of CRISPR-based genome-editing tools. While Acrs are prevalent in phages capable of lying dormant in a CRISPR-carrying host, their orthologs have been observed only infrequently in virulent phages. Here we identify AcrIIA6, an Acr encoded in 33% of virulent Streptococcus thermophilus phage genomes. The X-ray structure of AcrIIA6 displays some features unique to this Acr family. We compare the activity of AcrIIA6 to those of other Acrs, including AcrIIA5 (also from S. thermophilus phages), and characterize their effectiveness against a range of CRISPR-Cas systems. Finally, we demonstrate that both Acr families from S. thermophilus phages inhibit Cas9-mediated genome editing of human cells.},
}
@article {pmid30045985,
year = {2018},
author = {Pautasso, S and Galitska, G and Dell'Oste, V and Biolatti, M and Cagliani, R and Forni, D and De Andrea, M and Gariglio, M and Sironi, M and Landolfo, S},
title = {Strategy of Human Cytomegalovirus To Escape Interferon Beta-Induced APOBEC3G Editing Activity.},
journal = {Journal of virology},
volume = {92},
number = {19},
pages = {},
pmid = {30045985},
issn = {1098-5514},
mesh = {APOBEC-3G Deaminase/*genetics/immunology ; CRISPR-Cas Systems ; Cell Line ; Computational Biology ; Cytomegalovirus/*genetics/immunology ; Epithelial Cells/immunology/virology ; Fibroblasts/immunology/virology ; Foreskin/cytology ; Gene Expression Regulation ; Gene Knockout Techniques ; *Genome, Viral ; HEK293 Cells ; Human Umbilical Vein Endothelial Cells/immunology/virology ; Humans ; *Immune Evasion ; Immunity, Innate ; Interferon-beta/*genetics/immunology ; Male ; Mutagenesis ; Open Reading Frames ; Primary Cell Culture ; Signal Transduction ; THP-1 Cells ; Virus Replication ; },
abstract = {The apolipoprotein B editing enzyme catalytic subunit 3 (APOBEC3) is a family of DNA cytosine deaminases that mutate and inactivate viral genomes by single-strand DNA editing, thus providing an innate immune response against a wide range of DNA and RNA viruses. In particular, APOBEC3A (A3A), a member of the APOBEC3 family, is induced by human cytomegalovirus (HCMV) in decidual tissues where it efficiently restricts HCMV replication, thereby acting as an intrinsic innate immune effector at the maternal-fetal interface. However, the widespread incidence of congenital HCMV infection implies that HCMV has evolved to counteract APOBEC3-induced mutagenesis through mechanisms that still remain to be fully established. Here, we have assessed gene expression and deaminase activity of various APOBEC3 gene family members in HCMV-infected primary human foreskin fibroblasts (HFFs). Specifically, we show that APOBEC3G (A3G) gene products and, to a lesser degree, those of A3F but not of A3A, are upregulated in HCMV-infected HFFs. We also show that HCMV-mediated induction of A3G expression is mediated by interferon beta (IFN-β), which is produced early during HCMV infection. However, knockout or overexpression of A3G does not affect HCMV replication, indicating that A3G is not a restriction factor for HCMV. Finally, through a bioinformatics approach, we show that HCMV has evolved mutational robustness against IFN-β by limiting the presence of A3G hot spots in essential open reading frames (ORFs) of its genome. Overall, our findings uncover a novel immune evasion strategy by HCMV with profound implications for HCMV infections.IMPORTANCE APOBEC3 family of proteins plays a pivotal role in intrinsic immunity defense mechanisms against multiple viral infections, including retroviruses, through the deamination activity. However, the currently available data on APOBEC3 editing mechanisms upon HCMV infection remain unclear. In the present study, we show that particularly the APOBEC3G (A3G) member of the deaminase family is strongly induced upon infection with HCMV in fibroblasts and that its upregulation is mediated by IFN-β. Furthermore, we were able to demonstrate that neither A3G knockout nor A3G overexpression appears to modulate HCMV replication, indicating that A3G does not inhibit HCMV replication. This may be explained by HCMV escape strategy from A3G activity through depletion of the preferred nucleotide motifs (hot spots) from its genome. The results may shed light on antiviral potential of APOBEC3 activity during HCMV infection, as well as the viral counteracting mechanisms under A3G-mediated selective pressure.},
}
@article {pmid30045910,
year = {2018},
author = {Rossant, J},
title = {Gene editing in human development: ethical concerns and practical applications.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {16},
pages = {},
doi = {10.1242/dev.150888},
pmid = {30045910},
issn = {1477-9129},
mesh = {CRISPR-Cas Systems/physiology ; Embryo Research/*ethics ; Embryo, Mammalian ; Embryonic Development/*genetics ; Gene Editing/*ethics/*methods/statistics &amp; numerical data ; Genome, Human ; Humans ; Pluripotent Stem Cells/physiology ; },
abstract = {The amazing power of CRISPR-Cas9 gene editing tools and other related technologies has impacted all areas of biology today. It has also raised ethical concerns, particularly with regard to the possibility of generating heritable changes in the human genome - so-called germline gene editing. Although technical and safety issues suggest that this approach is far from clinical application, gene editing as a research tool is moving forward in human embryos, non-human primates and in stem cell-derived embryoids. These studies are already providing new information relevant to our understanding of normal human development, infertility, early pregnancy loss and pluripotent stem cell origins.},
}
@article {pmid30044970,
year = {2018},
author = {Tambe, A and East-Seletsky, A and Knott, GJ and Doudna, JA and O'Connell, MR},
title = {RNA Binding and HEPN-Nuclease Activation Are Decoupled in CRISPR-Cas13a.},
journal = {Cell reports},
volume = {24},
number = {4},
pages = {1025-1036},
pmid = {30044970},
issn = {2211-1247},
support = {T32 GM007232/GM/NIGMS NIH HHS/United States ; P50 GM102706/GM/NIGMS NIH HHS/United States ; S10 OD018174/OD/NIH HHS/United States ; P50 GM082250/GM/NIGMS NIH HHS/United States ; S10 OD021489/OD/NIH HHS/United States ; },
abstract = {CRISPR-Cas13a enzymes are RNA-guided, RNA-activated RNases. Their properties have been exploited as powerful tools for RNA detection, RNA imaging, and RNA regulation. However, the relationship between target RNA binding and HEPN (higher eukaryotes and prokaryotes nucleotide binding) domain nuclease activation is poorly understood. Using sequencing experiments coupled with in vitro biochemistry, we find that Cas13a target RNA binding affinity and HEPN-nuclease activity are differentially affected by the number and the position of mismatches between the guide and the target. We identify a central binding seed for which perfect base pairing is required for target binding and a separate nuclease switch for which imperfect base pairing results in tight binding, but not HEPN-nuclease activation. These results demonstrate that the binding and cleavage activities of Cas13a are decoupled, highlighting a complex specificity landscape. Our findings underscore a need to consider the range of effects off-target recognition has on Cas13a RNA binding and cleavage behavior for RNA-targeting tool development.},
}
@article {pmid30043362,
year = {2018},
author = {Wolter, F and Puchta, H},
title = {Application of CRISPR/Cas to Understand Cis- and Trans-Regulatory Elements in Plants.},
journal = {Methods in molecular biology (Clifton, N.J.)},
volume = {1830},
number = {},
pages = {23-40},
doi = {10.1007/978-1-4939-8657-6_2},
pmid = {30043362},
issn = {1940-6029},
abstract = {The recent emergence of the CRISPR/Cas system as a genome editing tool enables simple, fast, and efficient induction of DNA double-strand breaks at precise positions in the genome. This has proven extremely useful for analysis and modification of protein-coding sequences. Regulatory sequences have received much less attention, but can now be quickly and easily disrupted as well. Editing of cis-regulatory elements (CRE) offers considerable potential for crop improvement via fine-tuning of gene expression that cannot be achieved by simple KO mutations, but its widespread application is still hampered by a lack of precise knowledge about functional motifs in CRE. As demonstrated for mammalian cells, CRISPR/Cas is also extremely useful for the identification and analysis of CRE in their native environment on a large scale using tiling screens. Transcriptional complexes are another promising target for crop genome editing, as demonstrated for pathogen resistance and regulation of flowering. The development of more diverse and sophisticated CRISPR/Cas tools for genome editing will allow even more efficient and powerful approaches for editing of regulatory sequences in the future.},
}
@article {pmid30043343,
year = {2018},
author = {Sardesai, N and Subramanyam, S},
title = {Agrobacterium: A Genome-Editing Tool-Delivery System.},
journal = {Current topics in microbiology and immunology},
volume = {418},
number = {},
pages = {463-488},
doi = {10.1007/82_2018_101},
pmid = {30043343},
issn = {0070-217X},
abstract = {With the rapidly increasing global population, it will be extremely challenging to provide food to the world without increasing food production by at least 70% over the next 30 years. As we reach the limits of expanding arable land, the responsibility of meeting this production goal will rely on increasing yields. Traditional plant breeding practices will not be able to realistically meet these expectations, thrusting plant biotechnology into the limelight to fulfill these needs. Better varieties will need to be developed faster and with the least amount of regulatory hurdles. With the need to add, delete, and substitute genes into existing genomes, the field of genome editing and gene targeting is now rapidly developing with numerous new technologies coming to the forefront. Agrobacterium-mediated crop transformation has been the most utilized method to generate transgenic varieties that are better yielding, have new traits, and are disease and pathogen resistant. Genome-editing technologies rely on the creation of double-strand breaks (DSBs) in the genomic DNA of target species to facilitate gene disruption, addition, or replacement through either non-homologous end joining or homology-dependent repair mechanisms. DSBs can be introduced through the use of zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspersed short palindromic repeats (CRISPR)/Cas nucleases, among others. Agrobacterium strains have been employed to deliver the reagents for genome editing to the specific target cells. Understanding the biology of transformation from the perspective not only of Agrobacterium, but also of the host, from processing of T-DNA to its integration in the host genome, has resulted in a wealth of information that has been used to engineer Agrobacterium strains having increased virulence. As more technologies are being developed, that will help overcome issues of Agrobacterium host range and random integration of DNA, combined with highly sequence-specific nucleases, a robust crop genome-editing toolkit finally seems attainable.},
}
@article {pmid30042352,
year = {2018},
author = {Wang, H and Zhang, Y and Sun, L and Xu, P and Tu, R and Meng, S and Wu, W and Anis, GB and Hussain, K and Riaz, A and Chen, D and Cao, L and Cheng, S and Shen, X},
title = {WB1, a Regulator of Endosperm Development in Rice, Is Identified by a Modified MutMap Method.},
journal = {International journal of molecular sciences},
volume = {19},
number = {8},
pages = {},
pmid = {30042352},
issn = {1422-0067},
mesh = {Amylopectin/analysis ; Amylose/analysis ; CRISPR-Cas Systems ; Endosperm/genetics/*growth &amp; development ; Food Quality ; *Gene Expression Regulation, Plant ; Gene Library ; Mutation ; Oryza/genetics/*growth &amp; development ; Plant Proteins/*genetics/metabolism ; Polymorphism, Single Nucleotide ; Sequence Analysis, DNA ; Starch/metabolism ; Whole Grains/metabolism ; beta-Fructofuranosidase/*genetics/metabolism ; },
abstract = {Abnormally developed endosperm strongly affects rice (Oryza sativa) appearance quality and grain weight. Endosperm formation is a complex process, and although many enzymes and related regulators have been identified, many other related factors remain largely unknown. Here, we report the isolation and characterization of a recessive mutation of White Belly 1 (WB1), which regulates rice endosperm development, using a modified MutMap method in the rice mutant wb1. The wb1 mutant develops a white-belly endosperm and abnormal starch granules in the inner portion of white grains. Representative of the white-belly phenotype, grains of wb1 showed a higher grain chalkiness rate and degree and a lower 1000-grain weight (decreased by ~34%), in comparison with that of Wild Type (WT). The contents of amylose and amylopectin in wb1 significantly decreased, and its physical properties were also altered. We adopted the modified MutMap method to identify 2.52 Mb candidate regions with a high specificity, where we detected 275 SNPs in chromosome 4. Finally, we identified 19 SNPs at 12 candidate genes. Transcript levels analysis of all candidate genes showed that WB1 (Os04t0413500), encoding a cell-wall invertase, was the most probable cause of white-belly endosperm phenotype. Switching off WB1 with the CRISPR/cas9 system in Japonica cv. Nipponbare demonstrates that WB1 regulates endosperm development and that different mutations of WB1 disrupt its biological function. All of these results taken together suggest that the wb1 mutant is controlled by the mutation of WB1, and that the modified MutMap method is feasible to identify mutant genes, and could promote genetic improvement in rice.},
}
@article {pmid30040285,
year = {2018},
author = {van de Vrugt, HJ and Cornel, MC and Wolthuis, RMF},
title = {[CRISPR/Cas: technique to repair DNA errors: is a clinical breakthrough near?].},
journal = {Nederlands tijdschrift voor geneeskunde},
volume = {162},
number = {},
pages = {},
pmid = {30040285},
issn = {1876-8784},
mesh = {*CRISPR-Cas Systems ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Embryo, Mammalian ; *Gene Editing/ethics ; Genetic Therapy/*methods ; Humans ; },
abstract = {CRISPR/Cas gene editing makes it much easier to make targeted changes in the DNA of human cells than other forms of gene therapy. This revolutionary technology offers spectacular opportunities to study gene functions; the clinical consequences of gene variations in patients can be determined much faster. The efficacy and accuracy of CRISPR/Cas is so impressive that a breakthrough to therapeutic applications is approaching fast. CRISPR/Cas is already being used in immunotherapy against cancer, and trials for monogenetic blood disorders, such as beta-thalassemia, have been scheduled. However, broad clinical implementation of CRISPR/Cas is not feasible yet, due to off-target DNA changes that may occur as a by-product. Particularly in case of in-vivo applications there are therapeutic challenges. For gene editing in human embryos, technical shortcomings and open ethical issues need to be addressed. Gene-editing therapy for serious disorders with transplantable cell types, and therefore the option of verification of &quot;CRISPRed&quot; cells, is seen as a possible first application within the regular healthcare system.},
}
@article {pmid30040228,
year = {2018},
author = {Gertsenstein, M and Nutter, LMJ},
title = {Engineering Point Mutant and Epitope-Tagged Alleles in Mice Using Cas9 RNA-Guided Nuclease.},
journal = {Current protocols in mouse biology},
volume = {8},
number = {1},
pages = {28-53},
doi = {10.1002/cpmo.40},
pmid = {30040228},
issn = {2161-2617},
mesh = {Alleles ; Animals ; CRISPR-Cas Systems/*genetics ; Electroporation ; Endonucleases/genetics/*metabolism ; Gene Editing/methods ; Humans ; Mice ; RNA, Guide/genetics/*metabolism ; Zygote/metabolism ; },
abstract = {Mice carrying patient-associated point mutations are powerful tools to define the causality of single-nucleotide variants to disease states. Epitope tags enable immuno-based studies of genes for which no antibodies are available. These alleles enable detailed and precise developmental, mechanistic, and translational research. The first step in generating these alleles is to identify within the target sequence-the orthologous sequence for point mutations or the N or C terminus for epitope tags-appropriate Cas9 protospacer sequences. Subsequent steps include design and acquisition of a single-stranded oligonucleotide repair template, synthesis of a single guide RNA (sgRNA), collection of zygotes, and microinjection or electroporation of zygotes with Cas9 mRNA or protein, sgRNA, and repair template followed by screening of born mice for the presence of the desired sequence change. Quality control of mouse lines includes screening for random or multicopy insertions of the repair template and, depending on sgRNA sequence, off-target mutations introduced by Cas9. © 2018 by John Wiley &amp; Sons, Inc.},
}
@article {pmid30039929,
year = {2018},
author = {Sun, B and Yang, J and Yang, S and Ye, RD and Chen, D and Jiang, Y},
title = {A CRISPR-Cpf1-Assisted Non-Homologous End Joining Genome Editing System of Mycobacterium smegmatis.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700588},
doi = {10.1002/biot.201700588},
pmid = {30039929},
issn = {1860-7314},
support = {2014CB745101//National Basic Research Program of China/ ; 2014CB745102//National Basic Research Program of China/ ; 31470209//National Natural Science Foundation of China/ ; 31500068//National Natural Science Foundation of China/ ; 31470685//National Natural Science Foundation of China/ ; 18ZR1446500//Natural Science Foundation of Shanghai/ ; 18ZR1446800//Natural Science Foundation of Shanghai/ ; },
abstract = {Mycobacterium smegmatis is an important model strain of Mycobacterium for scientific study because it is non-pathogenic and grows rapidly. However, research is limited by the low efficiency and time-consuming nature of existing genome editing tools. Although the Streptococcus pyogenes CRISPR-Cas9 system is widely used in bacterial genome editing, it cannot be introduced into M. smegmatis because of its toxicity. The authors test 14 different Cas effector proteins in M. smegmatis. Cas9 (TdCas9_m) from Treponema denticola, Cas9 (NmCas9) from Neisseria meningitidis, and Corynebacterium glutamicum codon-optimized Cpf1 (FnCpf1_cg) from Francisella tularensis do not affect cell growth. The numbers of transformant plasmids expressing TdCas9_m, NmCas9, or FnCpf1_cg, and guide RNAs (gRNA) targeting ku(MSMEG_5580), ligD(MSMEG_6301), pta(MSMEG_0783), or ackA(MSMEG_0784) decreases by about 10-, 10-, or 100-fold, respectively, compared with plasmids expressing only the Cas effector proteins. Non-homologous end joining (NHEJ) is detected only in the CRISPR-FnCpf1_cg system. The one-plasmid-based, CRISPR-FnCpf1-assisted NHEJ system enables N iterative rounds of genome editing in 7N + 2 days, with an editing efficiency up to 70%; thus, this system should greatly reduce the necessary genome manipulation time for M. smegmatis.},
}
@article {pmid30039577,
year = {2018},
author = {Espitia Jaimes, C and Fish, RJ and Neerman-Arbez, M},
title = {Local chromatin interactions contribute to expression of the fibrinogen gene cluster.},
journal = {Journal of thrombosis and haemostasis : JTH},
volume = {16},
number = {10},
pages = {2070-2082},
doi = {10.1111/jth.14248},
pmid = {30039577},
issn = {1538-7836},
support = {31003A_172864//Swiss National Science Foundation/ ; },
abstract = {Essentials The fibrinogen gene cluster is flanked by CCCTC-binding factor (CTCF) interaction sites. Chromatin looping of the fibrinogen cluster was demonstrated by chromosome conformation capture. Deleting a CTCF interaction site alters chromatin looping and halves fibrinogen expression. Looping of the human fibrinogen locus is functionally linked to fibrinogen gene expression.<br><br>SUMMARY: Background The coordinately regulated genes encoding human fibrinogen are clustered. This evolutionarily conserved configuration provides a possible mechanism for co-regulation whereby regulatory elements influence gene expression locally. The cluster is flanked by CCCTC-binding factor (CTCF) interaction sites that are candidate insulator regions mediating chromatin looping. Objectives To further our understanding of fibrinogen gene regulation, we aimed to investigate whether interactions exist between parts of the fibrinogen locus and how these contacts contribute to fibrinogen expression. Methods We used chromosome conformation capture in cultured cell lines to detect chromatin interactions at the fibrinogen gene cluster. We generated clonal cell lines where two CTCF interaction sites at one end of the locus were deleted using CRISPR-Cas9-mediated genome editing. Fibrinogen expression and protein production were measured using qRT-PCR and ELISA, respectively. Results We detected proximity between the ends of the fibrinogen locus, regardless of whether cells express fibrinogen. An interaction between the FGA promoter and the edge of the locus was more frequent in fibrinogen-expressing cells. Deletion of a CTCF site at one edge of the cluster altered chromatin interactions, reduced steady-state expression of FGB and FGG mRNA, and led to a halving of secreted fibrinogen. These phenotypes were completely restored by reintroduction of the CTCF interaction motif in previously motif-deleted clones. Conclusions Chromatin interactions are important for the coordinated regulation of the human fibrinogen genes. This finding furthers our comprehension of how fibrinogen is produced and identifies a possible source of variability in plasma fibrinogen levels seen in populations.},
}
@article {pmid30038015,
year = {2018},
author = {Bonsma-Fisher, M and Soutière, D and Goyal, S},
title = {How adaptive immunity constrains the composition and fate of large bacterial populations.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {32},
pages = {E7462-E7468},
pmid = {30038015},
issn = {1091-6490},
mesh = {Adaptive Immunity/*physiology ; Bacteria/genetics/*immunology/virology ; Bacteriophages/genetics/*immunology ; CRISPR-Cas Systems/*immunology ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics/immunology ; DNA, Viral/genetics/immunology ; Evolution, Molecular ; Quorum Sensing/*immunology ; },
abstract = {Features of the CRISPR-Cas system, in which bacteria integrate small segments of phage genome (spacers) into their DNA to neutralize future attacks, suggest that its effect is not limited to individual bacteria but may control the fate and structure of whole populations. Emphasizing the population-level impact of the CRISPR-Cas system, recent experiments show that some bacteria regulate CRISPR-associated genes via the quorum sensing (QS) pathway. Here we present a model that shows that from the highly stochastic dynamics of individual spacers under QS control emerges a rank-abundance distribution of spacers that is time invariant, a surprising prediction that we test with dynamic spacer-tracking data from literature. This distribution depends on the state of the competing phage-bacteria population, which due to QS-based regulation may coexist in multiple stable states that vary significantly in their phage-to-bacterium ratio, a widely used ecological measure to characterize microbial systems.},
}
@article {pmid30037991,
year = {2018},
author = {Huang, J and Li, J and Zhou, J and Wang, L and Yang, S and Hurst, LD and Li, WH and Tian, D},
title = {Identifying a large number of high-yield genes in rice by pedigree analysis, whole-genome sequencing, and CRISPR-Cas9 gene knockout.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {32},
pages = {E7559-E7567},
pmid = {30037991},
issn = {1091-6490},
mesh = {Agriculture/*methods ; CRISPR-Cas Systems/genetics ; Gene Knockout Techniques/methods ; Genome, Plant/*physiology ; Oryza/genetics/*physiology ; Pedigree ; Phenotype ; Plants, Genetically Modified/genetics/physiology ; *Quantitative Trait Loci ; *Quantitative Trait, Heritable ; Selection, Genetic/genetics ; Sequence Analysis, DNA/methods ; },
abstract = {Repeated artificial selection of a complex trait facilitates the identification of genes underlying the trait, especially if multiple selected descendant lines are available. Here we developed a pedigree-based approach to identify genes underlying the Green Revolution (GR) phenotype. From a pedigree analysis, we selected 30 cultivars including the &quot;miracle rice&quot; IR8, a GR landmark, its ancestors and descendants, and also other related cultivars for identifying high-yield genes. Through sequencing of these genomes, we identified 28 ancestral chromosomal blocks that were maintained in all the high-yield cultivars under study. In these blocks, we identified six genes of known function, including the GR gene sd1, and 123 loci with genes of unknown function. We randomly selected 57 genes from the 123 loci for knockout or knockdown studies and found that a high proportion of these genes are essential or have phenotypic effects related to rice production. Notably, knockout lines have significant changes in plant height (P < 0.003), a key GR trait, compared with wild-type lines. Some gene knockouts or knockdowns were especially interesting. For example, knockout of Os10g0555100, a putative glucosyltransferase gene, showed both reduced growth and altered panicle architecture. In addition, we found that in some retained chromosome blocks several GR-related genes were clustered, although they have unrelated sequences, suggesting clustering of genes with similar functions. In conclusion, we have identified many high-yield genes in rice. Our method provides a powerful means to identify genes associated with a specific trait.},
}
@article {pmid30036575,
year = {2018},
author = {Azam, MW and Khan, AU},
title = {Updates on the pathogenicity status of Pseudomonas aeruginosa.},
journal = {Drug discovery today},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.drudis.2018.07.003},
pmid = {30036575},
issn = {1878-5832},
abstract = {Pseudomonas aeruginosa is a pathogenic bacterial species that causes infections and diseases in both plants and animals, including several human diseases, especially in immune-compromised patients, and many hospital-acquired infections. Given that P. aeruginosa is an opportunistic pathogen, the occurrence of antimicrobial resistance makes it difficult to treat and eradicate. Antimicrobial resistance in P. aeruginosa is categorized as intrinsic, acquired, or adaptive. Here, we different aspects of resistance and pathogenicity in P. aeruginosa, such as the role of outer membrane proteins, transcriptional regulators, efflux pumps, enzymes, and biofilms in antimicrobial resistance. We also highlight quorum-sensing (QS) genes, their protein secretion, and role in pathogenicity; different QS inhibitors; and the influence of QS on the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system and virulence factor production.},
}
@article {pmid30036493,
year = {2018},
author = {García-León, JA and Cabrera-Socorro, A and Eggermont, K and Swijsen, A and Terryn, J and Fazal, R and Nami, F and Ordovás, L and Quiles, A and Lluis, F and Serneels, L and Wierda, K and Sierksma, A and Kreir, M and Pestana, F and Van Damme, P and De Strooper, B and Thorrez, L and Ebneth, A and Verfaillie, CM},
title = {Generation of a human induced pluripotent stem cell-based model for tauopathies combining three microtubule-associated protein TAU mutations which displays several phenotypes linked to neurodegeneration.},
journal = {Alzheimer's &amp; dementia : the journal of the Alzheimer's Association},
volume = {14},
number = {10},
pages = {1261-1280},
doi = {10.1016/j.jalz.2018.05.007},
pmid = {30036493},
issn = {1552-5279},
abstract = {INTRODUCTION: Tauopathies are neurodegenerative diseases characterized by TAU protein-related pathology, including frontotemporal dementia and Alzheimer's disease among others. Mutant TAU animal models are available, but none of them faithfully recapitulates human pathology and are not suitable for drug screening.<br><br>METHODS: To create a new in vitro tauopathy model, we generated a footprint-free triple MAPT-mutant human induced pluripotent stem cell line (N279K, P301L, and E10+16 mutations) using clustered regularly interspaced short palindromic repeats-FokI and piggyBac transposase technology.<br><br>RESULTS: Mutant neurons expressed pathogenic 4R and phosphorylated TAU, endogenously triggered TAU aggregation, and had increased electrophysiological activity. TAU-mutant cells presented deficiencies in neurite outgrowth, aberrant sequence of differentiation to cortical neurons, and a significant activation of stress response pathways. RNA sequencing confirmed stress activation, demonstrated a shift toward GABAergic identity, and an upregulation of neurodegenerative pathways.<br><br>DISCUSSION: In summary, we generated a novel in vitro human induced pluripotent stem cell TAU-mutant model displaying neurodegenerative disease phenotypes that could be used for disease modeling and drug screening.},
}
@article {pmid30033365,
year = {2018},
author = {Landsberger, M and Gandon, S and Meaden, S and Rollie, C and Chevallereau, A and Chabas, H and Buckling, A and Westra, ER and van Houte, S},
title = {Anti-CRISPR Phages Cooperate to Overcome CRISPR-Cas Immunity.},
journal = {Cell},
volume = {174},
number = {4},
pages = {908-916.e12},
pmid = {30033365},
issn = {1097-4172},
support = {//Wellcome Trust/United Kingdom ; },
abstract = {Some phages encode anti-CRISPR (acr) genes, which antagonize bacterial CRISPR-Cas immune systems by binding components of its machinery, but it is less clear how deployment of these acr genes impacts phage replication and epidemiology. Here, we demonstrate that bacteria with CRISPR-Cas resistance are still partially immune to Acr-encoding phage. As a consequence, Acr-phages often need to cooperate in order to overcome CRISPR resistance, with a first phage blocking the host CRISPR-Cas immune system to allow a second Acr-phage to successfully replicate. This cooperation leads to epidemiological tipping points in which the initial density of Acr-phage tips the balance from phage extinction to a phage epidemic. Furthermore, both higher levels of CRISPR-Cas immunity and weaker Acr activities shift the tipping points toward higher initial phage densities. Collectively, these data help elucidate how interactions between phage-encoded immune suppressors and the CRISPR systems they target shape bacteria-phage population dynamics.},
}
@article {pmid30033364,
year = {2018},
author = {Borges, AL and Zhang, JY and Rollins, MF and Osuna, BA and Wiedenheft, B and Bondy-Denomy, J},
title = {Bacteriophage Cooperation Suppresses CRISPR-Cas3 and Cas9 Immunity.},
journal = {Cell},
volume = {174},
number = {4},
pages = {917-925.e10},
pmid = {30033364},
issn = {1097-4172},
support = {T32 GM007810/GM/NIGMS NIH HHS/United States ; R21 AI130670/AI/NIAID NIH HHS/United States ; DP5 OD021344/OD/NIH HHS/United States ; P30 GM110732/GM/NIGMS NIH HHS/United States ; R01 GM110270/GM/NIGMS NIH HHS/United States ; P20 GM103500/GM/NIGMS NIH HHS/United States ; R01 GM108888/GM/NIGMS NIH HHS/United States ; },
abstract = {Bacteria utilize CRISPR-Cas adaptive immune systems for protection from bacteriophages (phages), and some phages produce anti-CRISPR (Acr) proteins that inhibit immune function. Despite thorough mechanistic and structural information for some Acr proteins, how they are deployed and utilized by a phage during infection is unknown. Here, we show that Acr production does not guarantee phage replication when faced with CRISPR-Cas immunity, but instead, infections fail when phage population numbers fall below a critical threshold. Infections succeed only if a sufficient Acr dose is contributed to a single cell by multiple phage genomes. The production of Acr proteins by phage genomes that fail to replicate leave the cell immunosuppressed, which predisposes the cell for successful infection by other phages in the population. This altruistic mechanism for CRISPR-Cas inhibition demonstrates inter-virus cooperation that may also manifest in other host-parasite interactions.},
}
@article {pmid30031987,
year = {2018},
author = {Eisenbach, L and Janßen, D and Ehrmann, MA and Vogel, RF},
title = {Comparative genomics of Lactobacillus curvatus enables prediction of traits relating to adaptation and strategies of assertiveness in sausage fermentation.},
journal = {International journal of food microbiology},
volume = {286},
number = {},
pages = {37-47},
doi = {10.1016/j.ijfoodmicro.2018.06.025},
pmid = {30031987},
issn = {1879-3460},
mesh = {Adaptation, Physiological/*genetics ; Bacteriocins/genetics ; Base Composition/genetics ; Bread/*microbiology ; Fermentation ; Genome, Bacterial/genetics ; Genomics ; Lactobacillus/*enzymology/*genetics/metabolism ; Meat/*microbiology ; Meat Products/*microbiology ; Plasmids/genetics ; Proteome/genetics ; },
abstract = {Lactobacillus (L.) curvatus reaches high numbers in a variety of habitats, which suggests a high (genomic) diversity within this species. Empirically selected strains are used as starter cultures in sausage fermentation. Determinants for the assertiveness of a strain in this environment are assumed to be multifactorial. We used comparative genomics and in silico proteomics of 10 L. curvatus strains, which were representative of its genetic and physiological biodiversity, to possibly derive genetic determinants for strain or group specific assertiveness in sausage fermentation. Their genome sizes ranged from 1.7 Mb up to 2.0 Mb. The estimated pan- and core genomes were 3.0 Mb and 1.4 Mb, respectively. The accessory genome, GC-content and coding density revealed a significant genomic diversity within this species. Plasmids were found, which were either closely related or unique in several strains. Putative assertiveness determinants including CRISPR/Cas systems, prophages, bacteriocin production, or specific metabolic settings were detected. Such traits of the accessory genome could not be correlated with the source of isolation. Pathways, which previously have been predicted for a relation with adaptation to meat of L. sakei, are part of the core genome of L curvatus. Intraspecies differences in the accessory genome of L. curvatus comprise ribose metabolism, enzymes involved in nucleotide metabolism (nucleoside phosphorylases, phosphopentomutase, adenosine deaminase, ribose transporters), and tyrosine decarboxylases, ornithine decarboxylases. One group of the strains encoded a phosphotransferase system (PTS) as ribose transporter, whereas the second group encoded an ATP binding cassette (ABC) transporter. Analysis of the ribose uptake by HPLC analysis revealed different efficiencies of both transporter systems. Except for bacteriocin formation, no strain specific traits were identified predicting assertiveness of single strains. This fits our previous observation that single strains of L. curvatus could not override others in a competitive setting. Rather, pairs or sets of strains, comprising metabolically synergistic or non-assertive partner strains were able to dominate the fermentation. Indeed, this work suggests that assertive partnerships can be predicted along their complementary accessory genomes.},
}
@article {pmid30029875,
year = {2018},
author = {Zhang, B and Lu, HY and Xia, YH and Jiang, AG and Lv, YX},
title = {Long non-coding RNA EPIC1 promotes human lung cancer cell growth.},
journal = {Biochemical and biophysical research communications},
volume = {503},
number = {3},
pages = {1342-1348},
doi = {10.1016/j.bbrc.2018.07.046},
pmid = {30029875},
issn = {1090-2104},
abstract = {Long non-coding RNA (LncRNA) EPIC1 (Lnc-EPIC1) is a MYC-interacting LncRNA. In the present study, the expression and potential function of Lnc-EPIC1 in human lung cancer cells are tested. We show that Lnc-EPIC1 expression is significantly higher in established/primary human lung cancer cells than that in human lung epithelial cells. Lnc-EPIC1 is also elevated in human lung cancer tissues. Silencing of Lnc-EPIC1 by targeted siRNA significantly inhibited human lung cancer cell growth, survival and proliferation, whiling inducing G1-S cell cycle arrest and cell apoptosis. MYC targets, including Cyclin A1, CDC20 and CDC45, were downregulated by Lnc-EPIC1 siRNA. MYC knockout by CRISPR/Cas-9 gene-editing method mimicked actions by Lnc-EPIC1 siRNA in A549 cells. Conversely, forced overexpression of Lnc-EPIC1 by a lentiviral construct increased expression of MYC targets to promote A549 cell growth. Lnc-EPIC1 directly associated with MYC protein in the nuclei of A549 cells. Significantly MYC knockout abolished Lnc-EPIC1 silencing- or overexpression-induced actions in human lung cancer cells. Together, our results show that Lnc-EPIC1 promotes human lung cancer cell growth possibly by targeting MYC.},
}
@article {pmid30029480,
year = {2018},
author = {Bothwell, PJ and Kron, CD and Wittke, EF and Czerniak, BN and Bode, BP},
title = {Targeted Suppression and Knockout of ASCT2 or LAT1 in Epithelial and Mesenchymal Human Liver Cancer Cells Fail to Inhibit Growth.},
journal = {International journal of molecular sciences},
volume = {19},
number = {7},
pages = {},
pmid = {30029480},
issn = {1422-0067},
mesh = {Amino Acid Transport System ASC/*metabolism ; Amino Acids/metabolism ; Biological Transport/drug effects ; CRISPR-Cas Systems/genetics ; Cell Death/drug effects ; Cell Proliferation/drug effects ; Epithelium/*pathology ; *Gene Knockout Techniques ; Humans ; Large Neutral Amino Acid-Transporter 1/*metabolism ; Liver Neoplasms/*metabolism/*pathology ; Mechanistic Target of Rapamycin Complex 1/metabolism ; Mesoderm/*pathology ; Mifepristone/pharmacology ; Minor Histocompatibility Antigens/*metabolism ; RNA, Antisense/metabolism ; RNA, Small Interfering/metabolism ; Signal Transduction/drug effects ; Sodium/metabolism ; },
abstract = {Amino acid transporters alanine-serine-cysteine transporter 2 (ASCT2) and L-Type Amino Acid Transporter 1 (LAT1) are coordinately enhanced in human cancers where among other roles, they are thought to drive mechanistic target-of-rapamycin (mTOR) growth signaling. To assess ASCT2 and LAT1 as therapeutic targets, nine unique short hairpin RNA (shRNA) vectors were used to stably suppress transporter expression in human epithelial (Hep3B) and mesenchymal (SK-Hep1) hepatocellular carcinoma (HCC) cell lines. In addition, six unique CRISPR-Cas9 vectors were used to edit the ASCT2 (SLC1A5) and LAT1 (SLC7A5) genes in epithelial (HUH7) and mesenchymal (SK-Hep1) HCC cells. Both approaches successfully diminished glutamine (ASCT2) and leucine (LAT1) initial-rate transport proportional to transporter protein suppression. In spite of profoundly reduced glutamine or leucine transport (up to 90%), transporter suppression or knockout failed to substantially affect cellular proliferation or basal and amino acid-stimulated mTORC1 growth signaling in either HCC cell type. Only LAT1 knockout in HUH7 slightly reduced growth rate. However, intracellular accumulation of radiolabeled glutamine and leucine over longer time periods largely recovered to control levels in ASCT2 and LAT1 knockout cells, respectively, which partially explains the lack of an impaired growth phenotype. These data collectively establish that in an in vitro context, human epithelial and mesenchymal HCC cell lines adapt to ASCT2 or LAT1 knockout. These results comport with an emerging model of amino acid exchangers like ASCT2 and LAT1 as &quot;harmonizers&quot;, not drivers, of amino acid accumulation and signaling, despite their long-established dominant role in initial-rate amino acid transport.},
}
@article {pmid30029055,
year = {2018},
author = {Trillhaase, A and Haferkamp, U and Rangnau, A and Märtens, M and Schmidt, B and Trilck, M and Seibler, P and Aherrahrou, R and Erdmann, J and Aherrahrou, Z},
title = {Differentiation of human iPSCs into VSMCs and generation of VSMC-derived calcifying vascular cells.},
journal = {Stem cell research},
volume = {31},
number = {},
pages = {62-70},
doi = {10.1016/j.scr.2018.07.008},
pmid = {30029055},
issn = {1876-7753},
abstract = {Vascular calcification displays a major cause of death worldwide, which involve mainly vascular smooth muscle cells (VSMCs). Since 2007, there are increasing numbers of protocols to obtain different cell types from human induced-pluripotent stem cells (iPSCs), however a protocol for calcification is missing. Few protocols exist today for the differentiation of iPSCs towards VSMCs and none are known for their calcification. Here we present a protocol for the calcification of iPSC-derived VSMCs. We successfully differentiated iPSCs into VSMCs based on a modified protocol. Calcification in VSMCs is induced by a commercial StemXVivo™ osteogenic medium. Calcification was verified using Calcein and Alizarin Red S staining or Calcium assays, and molecular analyses showed enhanced expression of calcification-associated genes. The presented method could help to study genetic risk variants, using the CRISPR/Cas technology through the introduction of Knockouts or Knockins of risk variants. Finally, this method can be applied for drug screening.},
}
@article {pmid30026550,
year = {2018},
author = {Feng, X and Hsu, SJ and Bhattacharjee, A and Wang, Y and Diao, J and Price, CM},
title = {CTC1-STN1 terminates telomerase while STN1-TEN1 enables C-strand synthesis during telomere replication in colon cancer cells.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2827},
pmid = {30026550},
issn = {2041-1723},
support = {R01 GM041803/GM/NIGMS NIH HHS/United States ; T32 CA117846/CA/NCI NIH HHS/United States ; T32 CA117846//U.S. Department of Health &amp; Human Services | National Institutes of Health (NIH)/International ; RO1 GM041803//U.S. Department of Health &amp; Human Services | NIH | National Institute of General Medical Sciences (NIGMS)/International ; },
mesh = {CRISPR-Cas Systems ; DNA/*biosynthesis ; DNA Damage ; DNA Polymerase I/genetics/metabolism ; Gene Editing ; *Gene Expression Regulation, Neoplastic ; HCT116 Cells ; HEK293 Cells ; Humans ; Plasmids/chemistry/metabolism ; Protein Binding ; Signal Transduction ; Telomerase/*genetics/metabolism ; Telomere/chemistry/ultrastructure ; *Telomere Homeostasis ; Telomere Shortening ; Telomere-Binding Proteins/*genetics/metabolism ; Transfection ; },
abstract = {Telomerase elongates the telomeric G-strand to prevent telomere shortening through conventional DNA replication. However, synthesis of the complementary C-strand by DNA polymerase α is also required to maintain telomere length. Polymerase α cannot perform this role without the ssDNA binding complex CST (CTC1-STN1-TEN1). Here we describe the roles of individual CST subunits in telomerase regulation and G-overhang maturation in human colon cancer cells. We show that CTC1-STN1 limits telomerase action to prevent G-overhang overextension. CTC1-/- cells exhibit telomeric DNA damage and growth arrest due to overhang elongation whereas TEN1-/- cells do not. However, TEN1 is essential for C-strand synthesis and TEN1-/- cells exhibit progressive telomere shortening. DNA binding analysis indicates that CTC1-STN1 retains affinity for ssDNA but TEN1 stabilizes binding. We propose CTC1-STN1 binding is sufficient to terminate telomerase action but altered DNA binding dynamics renders CTC1-STN1 unable to properly engage polymerase α on the overhang for C-strand synthesis.},
}
@article {pmid30026278,
year = {2018},
author = {Jarrett, KE and Lee, C and De Giorgi, M and Hurley, A and Gillard, BK and Doerfler, AM and Li, A and Pownall, HJ and Bao, G and Lagor, WR},
title = {Somatic Editing of Ldlr With Adeno-Associated Viral-CRISPR Is an Efficient Tool for Atherosclerosis Research.},
journal = {Arteriosclerosis, thrombosis, and vascular biology},
volume = {38},
number = {9},
pages = {1997-2006},
pmid = {30026278},
issn = {1524-4636},
support = {T32 HL007676/HL/NHLBI NIH HHS/United States ; R01 HL129767/HL/NHLBI NIH HHS/United States ; R01 HL132840/HL/NHLBI NIH HHS/United States ; P30 DK056338/DK/NIDDK NIH HHS/United States ; T32 GM008231/GM/NIGMS NIH HHS/United States ; },
abstract = {Objective- Atherosclerosis studies in Ldlr knockout mice require breeding to homozygosity and congenic status on C57BL6/J background, a process that is both time and resource intensive. We aimed to develop a new method for generating atherosclerosis through somatic deletion of Ldlr in livers of adult mice. Approach and Results- Overexpression of PCSK9 (proprotein convertase subtilisin/kexin type 9) is currently used to study atherosclerosis, which promotes degradation of LDLR (low-density lipoprotein receptor) in the liver. We sought to determine whether CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) could also be used to generate atherosclerosis through genetic disruption of Ldlr in adult mice. We engineered adeno-associated viral (AAV) vectors expressing Staphylococcus aureus Cas9 and a guide RNA targeting the Ldlr gene (AAV-CRISPR). Both male and female mice received either (1) saline, (2) AAV-CRISPR, or (3) AAV-hPCSK9 (human PCSK9)-D374Y. A fourth group of germline Ldlr-KO mice was included for comparison. Mice were placed on a Western diet and followed for 20 weeks to assess plasma lipids, PCSK9 protein levels, atherosclerosis, and editing efficiency. Disruption of Ldlr with AAV-CRISPR was robust, resulting in severe hypercholesterolemia and atherosclerotic lesions in the aorta. AAV-hPCSK9 also produced hypercholesterolemia and atherosclerosis as expected. Notable sexual dimorphism was observed, wherein AAV-CRISPR was superior for Ldlr removal in male mice, while AAV-hPCSK9 was more effective in female mice. Conclusions- This all-in-one AAV-CRISPR vector targeting Ldlr is an effective and versatile tool to model atherosclerosis with a single injection and provides a useful alternative to the use of germline Ldlr-KO mice.},
}
@article {pmid30026227,
year = {2018},
author = {Grevet, JD and Lan, X and Hamagami, N and Edwards, CR and Sankaranarayanan, L and Ji, X and Bhardwaj, SK and Face, CJ and Posocco, DF and Abdulmalik, O and Keller, CA and Giardine, B and Sidoli, S and Garcia, BA and Chou, ST and Liebhaber, SA and Hardison, RC and Shi, J and Blobel, GA},
title = {Domain-focused CRISPR screen identifies HRI as a fetal hemoglobin regulator in human erythroid cells.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6399},
pages = {285-290},
pmid = {30026227},
issn = {1095-9203},
support = {F30 DK107055/DK/NIDDK NIH HHS/United States ; R01 HL065449/HL/NHLBI NIH HHS/United States ; R56 DK065806/DK/NIDDK NIH HHS/United States ; R01 HL119479/HL/NHLBI NIH HHS/United States ; T32 GM008216/GM/NIGMS NIH HHS/United States ; R37 DK058044/DK/NIDDK NIH HHS/United States ; R01 AI118891/AI/NIAID NIH HHS/United States ; R01 DK054937/DK/NIDDK NIH HHS/United States ; R01 GM110174/GM/NIGMS NIH HHS/United States ; R24 DK106766/DK/NIDDK NIH HHS/United States ; R01 MD009124/MD/NIMHD NIH HHS/United States ; U54 HG006998/HG/NHGRI NIH HHS/United States ; },
mesh = {Anemia, Sickle Cell/drug therapy/*genetics ; CRISPR-Cas Systems ; Carrier Proteins/*genetics/metabolism ; Cell Line ; Erythroid Cells/*metabolism ; Fetal Hemoglobin/*genetics ; *Gene Expression Regulation ; Genetic Testing ; Humans ; Molecular Targeted Therapy ; Nuclear Proteins/*genetics/metabolism ; RNA, Guide ; eIF-2 Kinase/*genetics/metabolism ; },
abstract = {Increasing fetal hemoglobin (HbF) levels in adult red blood cells provides clinical benefit to patients with sickle cell disease and some forms of β-thalassemia. To identify potentially druggable HbF regulators in adult human erythroid cells, we employed a protein kinase domain-focused CRISPR-Cas9-based genetic screen with a newly optimized single-guide RNA scaffold. The screen uncovered the heme-regulated inhibitor HRI (also known as EIF2AK1), an erythroid-specific kinase that controls protein translation, as an HbF repressor. HRI depletion markedly increased HbF production in a specific manner and reduced sickling in cultured erythroid cells. Diminished expression of the HbF repressor BCL11A accounted in large part for the effects of HRI depletion. Taken together, these results suggest HRI as a potential therapeutic target for hemoglobinopathies.},
}
@article {pmid30024364,
year = {2018},
author = {Stout, EA and Sanozky-Dawes, R and Goh, YJ and Crawley, AB and Klaenhammer, TR and Barrangou, R},
title = {Deletion-based escape of CRISPR-Cas9 targeting in Lactobacillus gasseri.},
journal = {Microbiology (Reading, England)},
volume = {164},
number = {9},
pages = {1098-1111},
doi = {10.1099/mic.0.000689},
pmid = {30024364},
issn = {1465-2080},
abstract = {Lactobacillus gasseri is a human commensal which carries CRISPR-Cas, an adaptive immune system that protects the cell from invasive mobile genetic elements (MGEs). However, MGEs occasionally escape CRISPR targeting due to DNA mutations that occur in sequences involved in CRISPR interference. To better understand CRISPR escape processes, a plasmid interference assay was used to screen for mutants that escape CRISPR-Cas targeting. Plasmids containing a target sequence and a protospacer adjacent motif (PAM) were transformed for targeting by the native CRISPR-Cas system. Although the primary outcome of the assay was efficient interference, a small proportion of the transformed population overcame targeting. Mutants containing plasmids that had escaped were recovered to investigate the genetic routes of escape and their relative frequencies. Deletion of the targeting spacer in the native CRISPR array was the dominant pattern of escape, accounting for 52-70 % of the mutants from two L. gasseri strains. We repeatedly observed internal deletions in the chromosomal CRISPR array, characterized by polarized excisions from the leader end that spanned 1-15 spacers, and systematically included the leader-proximal targeting spacer. This study shows that deletions of spacers within CRISPR arrays constitute a key escape mechanism to evade CRISPR targeting, while preserving the functionality of the CRISPR-Cas system. This mechanism enables cells to maintain an active immune system, but allows the uptake of potentially beneficial plasmids. Our study revealed the co-occurrence of other genomic mutations associated with various phenotypes, showing how this selection process uncovers population diversification.},
}
@article {pmid30024073,
year = {2018},
author = {Deng, Q and Chen, Z and Shi, L and Lin, H},
title = {Developmental progress of CRISPR/Cas9 and its therapeutic applications for HIV-1 infection.},
journal = {Reviews in medical virology},
volume = {28},
number = {5},
pages = {e1998},
doi = {10.1002/rmv.1998},
pmid = {30024073},
issn = {1099-1654},
support = {//Jinan University/International ; //Guangzhou Medical University/International ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Gene Editing ; Genetic Engineering ; *Genetic Therapy/methods ; HIV Infections/*genetics/therapy/*virology ; HIV-1/*genetics ; Humans ; },
abstract = {The CRISPR/Cas9 system has been developed as a powerful tool for targeted gene editing. As a result of technical enhancements in recent years, this technology has become the method of choice for efficiently modifying targeted HIV-1 genome efficiently as part of HIV therapy. CRISPR can be modified to target specific sequences that Cas9 then cuts. In this article, we outline the development of the CRISPR/Cas9 system. We also show how this technology can be used for the prevention and treatment of HIV-1 infection. Optimistically, this technology promises to make a significant impact on the fight against HIV-1 in the future.},
}
@article {pmid30022698,
year = {2018},
author = {Jain, I and Minakhin, L and Mekler, V and Sitnik, V and Rubanova, N and Severinov, K and Semenova, E},
title = {Defining the seed sequence of the Cas12b CRISPR-Cas effector complex.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-10},
doi = {10.1080/15476286.2018.1495492},
pmid = {30022698},
issn = {1555-8584},
abstract = {Target binding by CRISPR-Cas ribonucleoprotein effectors is initiated by the recognition of double-stranded PAM motifs by the Cas protein moiety followed by destabilization, localized melting, and interrogation of the target by the guide part of CRISPR RNA moiety. The latter process depends on seed sequences, parts of the target that must be strictly complementary to CRISPR RNA guide. Mismatches between the target and CRISPR RNA guide outside the seed have minor effects on target binding, thus contributing to off-target activity of CRISPR-Cas effectors. Here, we define the seed sequence of the Type V Cas12b effector from Bacillus thermoamylovorans. While the Cas12b seed is just five bases long, in contrast to all other effectors characterized to date, the nucleotide base at the site of target cleavage makes a very strong contribution to target binding. The generality of this additional requirement was confirmed during analysis of target recognition by Cas12b effector from Alicyclobacillus acidoterrestris. Thus, while the short seed may contribute to Cas12b promiscuity, the additional specificity determinant at the site of cleavage may have a compensatory effect making Cas12b suitable for specialized genome editing applications.},
}
@article {pmid30021719,
year = {2018},
author = {Liu, HL and Shen, Y and Gao, Y and Zhou, L and Han, XS and Zhao, CZ and Yang, GJ and Chen, YL and Yang, H and Xie, SS},
title = {[Assessing abundance and specificity of different types of sgRNA targeting miRNA precursors].},
journal = {Yi chuan = Hereditas},
volume = {40},
number = {7},
pages = {561-571},
doi = {10.16288/j.yczz.17-417},
pmid = {30021719},
issn = {0253-9772},
abstract = {CRISPR/Cas technology enables efficient and specific editing the genome. Since different bacterial sources or artificially modified Cas9, as well as Cpf1 and other nucleases, recognize different PAMs (protospacer adjacent motifs), different gene editing nucleases may use different types of sgRNAs (small guide RNA). MicroRNAs (miRNAs) are a class of regulatory small non-coding RNAs. To determine whether specific targets for sgRNAs in miRNA precursor exit, the abundance and specificity of 11 different types of sgRNA targeting 28 645 miRNA precursors were analyzed in the present study using the CRISPR-offinder, a bioinformatics software developed in our own laboratory. The CRISPR/Cas9 lentivirus technology was used to target the miR-302/367 cluster in a porcine cell line, and its knockout efficiency for the miRNA target was evaluated. The results show that there are about 8 different types of sgRNAs that can target individual miRNA precursors. By assessing the off-target effect, only 18.2% of the sgRNAs showed high specificity for targeting the porcine miRNA precursors. Lastly, using the miR-302/367 cluster target as an example, we showed that the CRISPR/Cas9 lentivirus technology was 40% efficient in successfully establishing correct knockout of the target miRNA in the porcine cell line. This present study provides an important resource for the use of CRISPR/Cas technology to target miRNAs for knockout studies.},
}
@article {pmid30021624,
year = {2018},
author = {Sevim, H and Kocaefe, YÇ and Onur, MA and Uçkan-Çetinkaya, D and Gürpınar, ÖA},
title = {Bone marrow derived mesenchymal stem cells ameliorate inflammatory response in an in vitro model of familial hemophagocytic lymphohistiocytosis 2.},
journal = {Stem cell research &amp; therapy},
volume = {9},
number = {1},
pages = {198},
pmid = {30021624},
issn = {1757-6512},
support = {SBAG-114S057//Türkiye Bilimsel ve Teknolojik Araştirma Kurumu (TR)/ ; 013D12601001//Hacettepe Üniversitesi/ ; },
abstract = {BACKGROUND: Familial hemophagocytic lymphohistiocytosis 2 (FHL2) is the most common familial type of hemophagocytic lymphohistiocytosis with immune dysregulation. FHL2 patients have mutations in the perforin gene which cause overactivation and proliferation of cytotoxic T lymphocytes and natural killer cells. Perforin is the key component of the cytolytic granule response function of cytotoxic T lymphocytes and natural killer cells. Perforin dysfunction causes a cytotoxic immune deficiency with a clinical outcome of uncontrolled and continuous immune stimulation response. This excessive stimulation leads to continuous systemic inflammation and, ultimately, multiorgan failure. Radical therapy is hematopoietic stem cell transplantation which is limited by the availability of a donor. Exacerbations of inflammatory attacks require a palliative immunosuppressive regimen. There is a need for an alternative or adjuvant therapy to maintain these patients when immunosuppression is ineffective or a donor is not available. Beneficial actions of mesenchymal stem cells (MSCs) have been shown in autoimmune diseases in clinical trials and are attributed to their immune-modulatory properties. This study aimed to assess the immune-modulatory effect of MSCs in an in-vitro model of FHL2.<br><br>METHODS: We generated a targeted mutation in the perforin gene of NK92 cells to create an in-vitro FLH2 model using Crispr/Cas technology. A coculture setup was employed to assess the immunomodulatory efficacy of MSCs.<br><br>RESULTS: Engineered NK92 clones did not show PRF1 mRNA expression and failed to secrete perforin upon phorbol myristate acetate-ionomycin stimulation, providing evidence for a valid FHL2 model. Coculture media of the engineered cells were investigated for the abundance of several cytokines. Coculture with MSCs revealed a reduction in major proinflammatory cytokines and an induction in anti-inflammatory and immunomodulatory cytokines compared to the parental NK92 cells.<br><br>CONCLUSIONS: This study shows the ameliorating effect of MSCs as an adjuvant immune modulator toward the therapy of FHL2 patients. MSCs are supportive therapy candidates for FHL2 patients under circumstances where prolonged immunosuppression is required to gain time before allogeneic hematopoietic stem cell transplantation.},
}
@article {pmid30018371,
year = {2018},
author = {Jeon, Y and Choi, YH and Jang, Y and Yu, J and Goo, J and Lee, G and Jeong, YK and Lee, SH and Kim, IS and Kim, JS and Jeong, C and Lee, S and Bae, S},
title = {Direct observation of DNA target searching and cleavage by CRISPR-Cas12a.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2777},
pmid = {30018371},
issn = {2041-1723},
mesh = {Acidaminococcus/enzymology/*genetics ; Base Pairing ; Base Sequence ; CRISPR-Associated Protein 9/*genetics/metabolism ; *CRISPR-Cas Systems ; Cloning, Molecular ; DNA/*genetics/metabolism ; DNA Cleavage ; Escherichia coli/enzymology/genetics ; Gene Editing ; Gene Expression ; Genetic Vectors/chemistry/metabolism ; Isoenzymes/genetics/metabolism ; Models, Molecular ; Nucleic Acid Conformation ; Nucleic Acid Heteroduplexes ; RNA, Guide/*genetics/metabolism ; Recombinant Proteins/genetics/metabolism ; },
abstract = {Cas12a (also called Cpf1) is a representative type V-A CRISPR effector RNA-guided DNA endonuclease, which provides an alternative to type II CRISPR-Cas9 for genome editing. Previous studies have revealed that Cas12a has unique features distinct from Cas9, but the detailed mechanisms of target searching and DNA cleavage by Cas12a are still unclear. Here, we directly observe this entire process by using single-molecule fluorescence assays to study Cas12a from Acidaminococcus sp. (AsCas12a). We determine that AsCas12a ribonucleoproteins search for their on-target site by a one-dimensional diffusion along elongated DNA molecules and induce cleavage in the two DNA strands in a well-defined order, beginning with the non-target strand. Furthermore, the protospacer-adjacent motif (PAM) for AsCas12a makes only a limited contribution of DNA unwinding during R-loop formation and shows a negligible role in the process of DNA cleavage, in contrast to the Cas9 PAM.},
}
@article {pmid30015871,
year = {2018},
author = {Wu, CL and Zhang, SM and Lin, L and Gao, SS and Fu, KF and Liu, XD and Liu, Y and Zhou, LJ and Zhou, PK},
title = {BECN1-knockout impairs tumor growth, migration and invasion by suppressing the cell cycle and partially suppressing the epithelial-mesenchymal transition of human triple-negative breast cancer cells.},
journal = {International journal of oncology},
volume = {53},
number = {3},
pages = {1301-1312},
doi = {10.3892/ijo.2018.4472},
pmid = {30015871},
issn = {1791-2423},
mesh = {Apoptosis/genetics ; Autophagy/genetics ; Beclin-1/*genetics/metabolism ; CRISPR-Cas Systems ; Cell Division/genetics ; Cell Line, Tumor ; Cell Proliferation/genetics ; Datasets as Topic ; Epithelial-Mesenchymal Transition/*genetics ; Female ; G1 Phase Cell Cycle Checkpoints/*genetics ; Gene Expression Profiling ; *Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; Humans ; Oncogenes/genetics ; Triple Negative Breast Neoplasms/*genetics/pathology ; },
abstract = {Beclin1 (BECN1), which directly interacts with B‑cell lymphoma 2, serves an important role in autophagy and is involved in the tumorigenesis of various types of cancer. However, the definite role of BECN1 in breast cancer remains controversial. Bi-allelic knockout of Becn1 in a mouse model leads to an embryonic lethal phenotype, which hampers further investigation. To generate cell lines with knockout of BECN1, the CRISPR/Cas9 technique was used to disrupt BECN1 in human triple-negative breast cancer (TNBC) MDA‑MB‑231 cells. To the best of our knowledge, the present study was the first to successfully disrupt BECN1 in MDA‑MB‑231 cells and to screen three stable monoclonal BECN1‑knockout cell lines, suggesting that BECN1‑knockout is not lethal in TNBC cells. Functional analysis revealed that complete loss of BECN1 suppressed MDA‑MB‑231 proliferation and colony formation via inducing G0/G1 cell cycle arrest, not apoptosis, in vitro. On the other hand, BECN1‑knockout inhibited the migratory and invasive ability of MDA‑MB‑231 cells by partially reversing signals of epithelial-mesenchymal transition. Finally, analysis of publicly available gene expression datasets revealed increased expression of BECN1 in TNBC samples. Taken together, the results of the present study identified BECN1 as an oncogene, providing a novel potential target for the treatment of TNBC.},
}
@article {pmid30014471,
year = {2018},
author = {Razzouk, S},
title = {CRISPR-Cas9: A cornerstone for the evolution of precision medicine.},
journal = {Annals of human genetics},
volume = {82},
number = {6},
pages = {331-357},
doi = {10.1111/ahg.12271},
pmid = {30014471},
issn = {1469-1809},
abstract = {Modern genetic therapy incorporates genomic testing and genome editing. It is the finest approach for precision medicine. Genome editing is a state-of-the-art technology to manipulate gene expression thus generating a particular genotype. It encompasses multiple programmable nuclease-based approaches leading to genetic changes. Not surprisingly, this method triggered internationally a wide array of controversies in the scientific community and in the public since it transforms the human genome. Given its importance, the pace of this technology is exceptionally fast. In this report, we introduce one aspect of genome editing, the CRISPR/Cas9 system, highlight its potential to correct genetic mutations and explore its utility in clinical setting. Our goal is to enlighten health care providers about genome editing and incite them to take part of this vital debate.},
}
@article {pmid30013417,
year = {2018},
author = {Vesikansa, A},
title = {Unraveling of Central Nervous System Disease Mechanisms Using CRISPR Genome Manipulation.},
journal = {Journal of central nervous system disease},
volume = {10},
number = {},
pages = {1179573518787469},
pmid = {30013417},
issn = {1179-5735},
abstract = {The complex structure and highly variable gene expression profile of the brain makes it among the most challenging fields to study in both basic and translational biological research. Most of the brain diseases are multifactorial and despite the rapidly increasing genomic data, molecular pathways and causal links between genes and central nervous system (CNS) diseases are largely unknown. The advent of an easy and flexible CRISPR-Cas genome editing technology has rapidly revolutionized the field of functional genomics and opened unprecedented possibilities to dissect the mechanisms of CNS disease. CRISPR-Cas allows a plenitude of applications for both gene-focused and genome-wide approaches, ranging from original &quot;gene scissors&quot; making permanent modifications in the genome to the regulation of gene expression and epigenetics. CRISPR technology provides a unique opportunity to establish new cellular and animal models of CNS diseases and holds potential for breakthroughs in the CNS research and drug development.},
}
@article {pmid30013160,
year = {2018},
author = {Asada, S and Goyama, S and Inoue, D and Shikata, S and Takeda, R and Fukushima, T and Yonezawa, T and Fujino, T and Hayashi, Y and Kawabata, KC and Fukuyama, T and Tanaka, Y and Yokoyama, A and Yamazaki, S and Kozuka-Hata, H and Oyama, M and Kojima, S and Kawazu, M and Mano, H and Kitamura, T},
title = {Mutant ASXL1 cooperates with BAP1 to promote myeloid leukaemogenesis.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2733},
pmid = {30013160},
issn = {2041-1723},
mesh = {Animals ; Bone Marrow/metabolism/pathology ; Bone Marrow Transplantation ; CRISPR-Cas Systems ; Carcinogenesis/*genetics/metabolism/pathology ; Core Binding Factor Alpha 2 Subunit/genetics/metabolism ; Female ; Gene Editing ; *Gene Expression Regulation, Leukemic ; HEK293 Cells ; HeLa Cells ; Homeodomain Proteins/genetics/metabolism ; Humans ; Interferon Regulatory Factors/genetics/metabolism ; Leukemia, Myeloid/*genetics/metabolism/mortality/pathology ; Male ; Mice ; Mice, Inbred C57BL ; Mutation ; RUNX1 Translocation Partner 1 Protein/genetics/metabolism ; Repressor Proteins/*genetics/metabolism ; Signal Transduction ; Survival Analysis ; Tumor Suppressor Proteins/*genetics/metabolism ; Ubiquitin Thiolesterase/*genetics/metabolism ; Ubiquitination ; Whole-Body Irradiation ; },
abstract = {ASXL1 mutations occur frequently in myeloid neoplasms and are associated with poor prognosis. However, the mechanisms by which mutant ASXL1 induces leukaemogenesis remain unclear. In this study, we report mutually reinforcing effects between a C-terminally truncated form of mutant ASXL1 (ASXL1-MT) and BAP1 in promoting myeloid leukaemogenesis. BAP1 expression results in increased monoubiquitination of ASXL1-MT, which in turn increases the catalytic function of BAP1. This hyperactive ASXL1-MT/BAP1 complex promotes aberrant myeloid differentiation of haematopoietic progenitor cells and accelerates RUNX1-ETO-driven leukaemogenesis. Mechanistically, this complex induces upregulation of posterior HOXA genes and IRF8 through removal of H2AK119 ubiquitination. Importantly, BAP1 depletion inhibits posterior HOXA gene expression and leukaemogenicity of ASXL1-MT-expressing myeloid leukemia cells. Furthermore, BAP1 is also required for the growth of MLL-fusion leukemia cells with posterior HOXA gene dysregulation. These data indicate that BAP1, which has long been considered a tumor suppressor, in fact plays tumor-promoting roles in myeloid neoplasms.},
}
@article {pmid30012936,
year = {2018},
author = {Nakagawa, Y and Sakuma, T and Takeo, T and Nakagata, N and Yamamoto, T},
title = {Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by IVF via ultra-superovulation.},
journal = {Experimental animals},
volume = {67},
number = {4},
pages = {535-543},
pmid = {30012936},
issn = {1881-7122},
mesh = {Amino Acid Substitution ; Animals ; CRISPR-Cas Systems ; Cryopreservation ; *Electroporation ; Female ; Fertilization in Vitro/*methods ; Gene Editing/*methods ; Gene Knock-In Techniques ; Gene Knockout Techniques ; Mice, Inbred C57BL ; Oocytes ; *Reproductive Techniques ; Ribonucleoproteins ; *Superovulation ; Vitrification ; *Zygote ; },
abstract = {Recently, genome editing in mouse zygotes has become convenient and scalable, in association with various technological developments and improvements such as novel nuclease tools, alternative delivery methods, and contemporary reproductive engineering techniques. We have so far demonstrated the applicability of ultra-superovulation, in vitro fertilization (IVF), and vitrification/warming of zygotes in microinjection-mediated mouse genome editing. Moreover, an electroporation-mediated method has rapidly become established for simple gene knockout and small precise modifications including single amino acid substitutions. Here, we present an updated example of an application coupling the following three latest technologies: 1) CRISPR-Cas9 ribonucleoprotein as the most convenient genome-editing reagent, 2) electroporation as the most effortless delivery method, and 3) cryopreserved oocytes created by IVF via ultra-superovulation as the most animal welfare- and user-friendly strategy. We successfully created gene knockout and knock-in mice carrying insertion/deletion mutations and single amino acid substitutions, respectively, using the streamlined production system of mouse genome editing described above, referred to as the CREATRE (CARD-based Reproductive Engineering-Assisted Technology for RNP Electroporation) system. Owing to its accessibility, robustness, and high efficiency, we believe that our CREATRE protocol will become widely used globally for the production of genome-edited mice.},
}
@article {pmid30006570,
year = {2018},
author = {Liu, Z and Chen, M and Chen, S and Deng, J and Song, Y and Lai, L and Li, Z},
title = {Highly efficient RNA-guided base editing in rabbit.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2717},
pmid = {30006570},
issn = {2041-1723},
mesh = {Adenine/metabolism ; Adenosine Deaminase/genetics/metabolism ; Animals ; Base Pairing ; Base Sequence ; Blastocyst/cytology/metabolism ; CRISPR-Associated Protein 9/*genetics/metabolism ; *CRISPR-Cas Systems ; Codon, Nonsense ; Cytidine/metabolism ; Cytidine Deaminase/genetics/metabolism ; *Disease Models, Animal ; Founder Effect ; Gene Editing/*methods ; Humans ; INDEL Mutation ; Mutation, Missense ; RNA, Guide/*genetics/metabolism ; Rabbits/*genetics ; Sequence Alignment ; },
abstract = {Cytidine base editors (CBEs) and adenine base editors (ABEs), composed of a cytidine deaminase or an evolved adenine deaminase fused to Cas9 nickase, enable the conversion of C·G to T·A or A·T to G·C base pair in organisms, respectively. Here, we show that BE3 and ABE7.10 systems can achieve a targeted mutation efficiency of 53-88% and 44-100%, respectively, in both blastocysts and Founder (F0) rabbits. Meanwhile, this strategy can be used to precisely mimic human pathologies by efficiently inducing nonsense or missense mutations as well as RNA mis-splicing in rabbit. In addition, the reduced frequencies of indels with higher product purity are also determined in rabbit blastocysts by BE4-Gam, which is an updated version of the BE3 system. Collectively, this work provides a simple and efficient method for targeted point mutations and generation of disease models in rabbit.},
}
@article {pmid30006230,
year = {2018},
author = {Carroll, D},
title = {p53 Throws CRISPR a Curve.},
journal = {Trends in pharmacological sciences},
volume = {39},
number = {9},
pages = {783-784},
doi = {10.1016/j.tips.2018.06.005},
pmid = {30006230},
issn = {1873-3735},
mesh = {*CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Humans ; Tumor Suppressor Protein p53/genetics ; },
abstract = {The efficacy of the powerful CRISPR-Cas9 genome-editing platform depends on DNA repair activities in the cells being targeted. Two new papers show that the low efficiency of targeting in some primary human cell lines is the result of p53-dependent cell arrest in response to the Cas9-induced break. This limitation must be overcome for some anticipated therapies.},
}
@article {pmid30005359,
year = {2018},
author = {Mahas, A and Mahfouz, M},
title = {Engineering virus resistance via CRISPR-Cas systems.},
journal = {Current opinion in virology},
volume = {32},
number = {},
pages = {1-8},
doi = {10.1016/j.coviro.2018.06.002},
pmid = {30005359},
issn = {1879-6265},
abstract = {In prokaryotes, CRISPR/Cas adaptive immunity systems target and destroy nucleic acids derived from invading bacteriophages and other foreign genetic elements. In eukaryotes, the native function of these systems has been exploited to combat viruses in mammals and plants. Rewired CRISPR/Cas9 and CRISPR/Cas13 systems have been used to confer resistance against DNA and RNA viruses, respectively. Here, we discuss recent approaches employing CRISPR/Cas systems to combat viruses in eukaryotes, highlight key challenges, and provide future perspectives. Moreover, we discuss the application of CRISPR/Cas systems in genome-wide screens to identify key host factors for virus infection to enhance our understanding of basic virus biology and to identify and study virus-host interactions.},
}
@article {pmid30004018,
year = {2018},
author = {Wang, W and Zhang, L and Wang, X and Zeng, Y},
title = {The advances in CRISPR technology and 3D genome.},
journal = {Seminars in cell &amp; developmental biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.semcdb.2018.07.009},
pmid = {30004018},
issn = {1096-3634},
abstract = {The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system is a prokaryotic immune system that used to resist foreign genetic factors. It rapidly becomes the hot technology in life sciences and is applies for genome editing to solve the problem of genome-derived diseases. Using CRISPR/Cas technique, the biological DNA sequence can be repaired, cut, replaced, or added. It can effectively change the human stem cells and is expected to achieve results in the treatment. Compared with ZFN and TALEN genome editing techniques, CRISPR is more effective, accurate, and convenient. The application of CRISPR technique in three dimensional (3D) genome structure makes us understand the relationship between linear DNA sequence and 3D chromatin structure. Utilizing CRISPR/Cas9 genome editing to reverse or delete CTCF binding sites, to recognize changes of topological isomerism of the genome and interactions between chromatin loops. The purpose of this review is to introduce the characteristics and classification of the current CRISPR/Cas system, multiple functions, and potential therapeutic uses, as well as to outline the effect of the technique on chromatin loops by changing CTCF sites in 3D genomes. We will also briefly describe the importance of ethical dilemmas to be faced in CRISPR applications and provide a perspective for potential CRISPR considerations.},
}
@article {pmid30002234,
year = {2018},
author = {Cohen, J},
title = {A 'gene drive' makes its debut in mammals.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6398},
pages = {118},
doi = {10.1126/science.361.6398.118},
pmid = {30002234},
issn = {1095-9203},
mesh = {Animals ; *CRISPR-Cas Systems ; *Gene Drive Technology ; Gene Editing/*methods ; Mice ; Mice, Inbred Strains/*genetics ; },
}
@article {pmid30002084,
year = {2018},
author = {Shayevitch, R and Askayo, D and Keydar, I and Ast, G},
title = {The importance of DNA methylation of exons on alternative splicing.},
journal = {RNA (New York, N.Y.)},
volume = {24},
number = {10},
pages = {1351-1362},
pmid = {30002084},
issn = {1469-9001},
mesh = {*Alternative Splicing ; CRISPR-Cas Systems ; Cell Line ; DNA (Cytosine-5-)-Methyltransferases/genetics/metabolism ; *DNA Methylation ; *Exons ; Gene Editing ; Gene Targeting ; Humans ; Introns ; RNA, Guide ; },
abstract = {Alternative splicing (AS) contributes to proteome diversity. As splicing occurs cotranscriptionally, epigenetic determinants such as DNA methylation likely play a part in regulation of AS. Previously, we have shown that DNA methylation marks exons and that a loss of DNA methylation alters splicing patterns in a genome-wide manner. To investigate the influence of DNA methylation on splicing of individual genes, we developed a method to manipulate DNA methylation in vivo in a site-specific manner using the deactivated endonuclease Cas9 fused to enzymes that methylate or demethylate DNA. We used this system to directly change the DNA methylation pattern of selected exons and introns. We demonstrated that changes in the methylation pattern of alternatively spliced exons, but not constitutively spliced exons or introns, altered inclusion levels. This is the first direct demonstration that DNA methylation of exon-encoding regions is directly involved in regulation of AS.},
}
@article {pmid30001549,
year = {2018},
author = {Xu, J and Li, W and Hossen, MM and Jia, Y and Li, L and Huang, Z},
title = {Optimized Plasmid Construction Strategy for Cas9.},
journal = {Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology},
volume = {48},
number = {1},
pages = {131-137},
doi = {10.1159/000491669},
pmid = {30001549},
issn = {1421-9778},
mesh = {CRISPR-Cas Systems/*genetics ; Genes, Reporter ; HEK293 Cells ; Humans ; Plasmids/genetics/*metabolism ; RNA, Guide/genetics/*metabolism ; },
abstract = {BACKGROUND/AIMS: The target genome editing technology not only plays an important role in basic biology studies but also holds a great promise for potential clinical applications. The new generation of engineered nuclease RGEN (RNA Guided EndoNuclease) is much easier to construct and modify, and attracts more attentions. In the current study, we compared different plasmid construction strategies of Cas9-gRNA (guide RNA).<br><br>METHODS: Different plasmid construction strategies of Cas9-gRNA were compared. And more modifications were introduced into the plasmid construction strategy.<br><br>RESULTS: The plasmid construction efficiency of expressing the gRNA and Cas9 in one plasmid was lower than expressing them in two separate plasmids. However, they showed the similar genome editing efficiency. We further introduced the Golden-gate assembly and blue-white screening approaches into the Cas9-gRNA construction procedures, without the process of vector digestion and gel purification.<br><br>CONCLUSIONS: Combing with the optimized gRNA structure (gRNA-BL) we identified before, we established one more cost-effective, time-saving and efficient plasmid construction strategy for Cas9-gRNA.},
}
@article {pmid29999229,
year = {2018},
author = {Neve, P},
title = {Gene drive systems: do they have a place in agricultural weed management?.},
journal = {Pest management science},
volume = {74},
number = {12},
pages = {2671-2679},
pmid = {29999229},
issn = {1526-4998},
support = {BBS/OS/CP/000001//Biotechnology and Biological Sciences Research Council/United Kingdom ; BB/L001489/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; //Rothamsted Research/ ; },
mesh = {*Agriculture ; CRISPR-Cas Systems/genetics ; Gene Drive Technology/*methods ; Weed Control/*methods ; },
abstract = {There is a pressing need for novel control techniques in agricultural weed management. Direct genetic control of agricultural pests encompasses a range of techniques to introduce and spread novel, fitness-reducing genetic modifications through pest populations. Recently, the development of CRISPR-Cas9 gene editing has brought these approaches into sharper focus. Proof of concept for CRISPR-Cas9-based gene drives has been demonstrated for the control of disease-vectoring insects. This article considers whether and how gene drives may be applied in agricultural weed management, focusing on CRISPR-Cas9-based systems. Population-suppression drives might be employed to introduce and proliferate deleterious mutations that directly impact fitness and weediness, whereas population-sensitizing drives would seek to edit weed genomes so that populations are rendered more sensitive to subsequent management interventions. Technical challenges relating to plant transformation and gene editing in planta are considered, and the implementation of gene drives for timely and sustainable weed management is reviewed in the light of weed population biology. The technical, biological, practical and regulatory challenges remain significant. Modelling-based studies can inform how and if gene drives could be employed in weed populations. These studies are an essential first step towards determining the utility of gene drives for weed management. © 2018 The Author. Pest Management Science published by John Wiley &amp; Sons Ltd on behalf of Society of Chemical Industry.},
}
@article {pmid29995583,
year = {2018},
author = {Hou, S and Brenes-Álvarez, M and Reimann, V and Alkhnbashi, OS and Backofen, R and Muro-Pastor, AM and Hess, WR},
title = {CRISPR-Cas systems in multicellular cyanobacteria.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1493330},
pmid = {29995583},
issn = {1555-8584},
abstract = {Novel CRISPR-Cas systems possess substantial potential for genome editing and manipulation of gene expression. The types and numbers of CRISPR-Cas systems vary substantially between different organisms. Some filamentous cyanobacteria harbor > 40 different putative CRISPR repeat-spacer cassettes, while the number of cas gene instances is much lower. Here we addressed the types and diversity of CRISPR-Cas systems and of CRISPR-like repeat-spacer arrays in 171 publicly available genomes of multicellular cyanobacteria. The number of 1328 repeat-spacer arrays exceeded the total of 391 encoded Cas1 proteins suggesting a tendency for fragmentation or the involvement of alternative adaptation factors. The model cyanobacterium Anabaena sp. PCC 7120 contains only three cas1 genes but hosts three Class 1, possibly one Class 2 and five orphan repeat-spacer arrays, all of which exhibit crRNA-typical expression patterns suggesting active transcription, maturation and incorporation into CRISPR complexes. The CRISPR-Cas system within the element interrupting the Anabaena sp. PCC 7120 fdxN gene, as well as analogous arrangements in other strains, occupy the genetic elements that become excised during the differentiation-related programmed site-specific recombination. This fact indicates the propensity of these elements for the integration of CRISPR-cas systems and points to a previously not recognized connection. The gene all3613 resembling a possible Class 2 effector protein is linked to a short repeat-spacer array and a single tRNA gene, similar to its homologs in other cyanobacteria. The diversity and presence of numerous CRISPR-Cas systems in DNA elements that are programmed for homologous recombination make filamentous cyanobacteria a prolific resource for their study.<br><br>ABBREVIATIONS: Cas: CRISPR associated sequences; CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats; C2c: Class 2 candidate; SDR: small dispersed repeat; TSS: transcriptional start site; UTR: untranslated region.},
}
@article {pmid29995577,
year = {2018},
author = {Foster, K and Kalter, J and Woodside, W and Terns, RM and Terns, MP},
title = {The ribonuclease activity of Csm6 is required for anti-plasmid immunity by Type III-A CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1493334},
pmid = {29995577},
issn = {1555-8584},
abstract = {CRISPR-Cas systems provide prokaryotes with RNA-based adaptive immunity against viruses and plasmids. A unique feature of Type III CRISPR-Cas systems is that they selectively target transcriptionally-active invader DNA, and can cleave both the expressed RNA transcripts and source DNA. The Type III-A effector crRNP (CRISPR RNA-Cas protein complex), which contains Cas proteins Csm1-5, recognizes and degrades invader RNA and DNA in a crRNA-guided, manner. Interestingly, Type III-A systems also employ Csm6, an HEPN family ribonuclease that does not stably associate with the Type III-A effector crRNP, but nevertheless contributes to defense via mechanistic details that are still being determined. Here, we investigated the mechanism of action of Csm6 in Type III-A CRISPR-Cas systems from Lactococcus lactis, Staphylococcus epidermidis, and Streptococcus thermophilus expressed in Escherichia coli. We found that L. lactis and S. epidermidis Csm6 cleave RNA specifically after purines in vitro, similar to the activity reported for S. thermophilus Csm6. Moreover, L. lactis Csm6 functions as a divalent metal-independent, single strand-specific endoribonuclease that depends on the conserved HEPN domain. In vivo, we show that deletion of csm6 or expression of an RNase-defective form of Csm6 disrupts crRNA-dependent loss of plasmid DNA in all three systems expressed in E. coli. Mutations in the Csm1 palm domain, which are known to deactivate Csm6 ribonuclease activity, also prevent plasmid loss in the three systems. The results indicate that Csm6 ribonuclease activity rather than Csm1-mediated DNase activity effects anti-plasmid immunity by the three Type III-A systems investigated.},
}
@article {pmid29995560,
year = {2018},
author = {Chyou, TY and Brown, CM},
title = {Prediction and diversity of tracrRNAs from type II CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-12},
doi = {10.1080/15476286.2018.1498281},
pmid = {29995560},
issn = {1555-8584},
abstract = {Type II CRISPR-Cas9 systems require a small RNA called the trans-activating CRISPR RNA (tracrRNA) in order to function. The prediction of these non-coding RNAs in prokaryotic genomes is challenging because they have dissimilar structures, having short stems (3-6 bp) and non-canonical base-pairs e.g. G-A. Much of the tracrRNA is involved in base-pairing interactions with the CRISPR RNA, or itself, or in RNA-protein interactions with Cas9. Here we develop a new bioinformatic tool to predict tracrRNAs. On an experimentally verified test set the algorithm achieved a high sensitivity and specificity, and a low false discovery rate (FDR) on genome analysis. Analysis of representative RefSeq genomes (5462) detected 275 tracrRNAs from 165 genera. These tracrRNAs could be grouped into 15 clusters which were used to build covariance models. These clusters included Streptococci and Staphylococci tracrRNAs from the CRISPR-Cas9 systems which are currently used for gene editing. Compensating base changes observed in the models were consistent with the experimental structures of single guide RNAs (sgRNAs). Other clusters, for which there are not yet structures available, were predicted to form novel tracrRNA folds. These clusters included a large and divergent tracrRNA set from Bacteroidetes. These computational models contribute to the understanding of CRISPR-Cas biology, and will assist in the design of further engineered CRISPR-Cas9 systems. The tracrRNA prediction software is available through a galaxy web server.},
}
@article {pmid29995109,
year = {2018},
author = {Ramos, JN and Rodrigues, IDS and Baio, PVP and Veras, JFC and Ramos, RTJ and Pacheco, LG and Azevedo, VA and Hirata Júnior, R and Marín, MA and Mattos-Guaraldi, AL and Vieira, VV},
title = {Genome sequence of a multidrug-resistant Corynebacterium striatum isolated from bloodstream infection from a nosocomial outbreak in Rio de Janeiro, Brazil.},
journal = {Memorias do Instituto Oswaldo Cruz},
volume = {113},
number = {9},
pages = {e180051},
pmid = {29995109},
issn = {1678-8060},
mesh = {Anti-Bacterial Agents/pharmacology ; Bacteremia/*microbiology ; Brazil ; Corynebacterium/*drug effects/*genetics/isolation &amp; purification ; Corynebacterium Infections/*microbiology ; Cross Infection/*microbiology ; Disease Outbreaks ; Drug Resistance, Multiple, Bacterial/drug effects/*genetics ; Electrophoresis, Gel, Pulsed-Field ; Genome, Bacterial/*genetics ; Genotype ; Humans ; Microbial Sensitivity Tests ; Sequence Analysis, DNA ; },
abstract = {Multidrug-resistant (MDR) Corynebacterium striatum has been cited with increased frequency as pathogen of nosocomial infections. In this study, we report the draft genome of a C. striatum isolated from a patient with bloodstream infection in a hospital of Rio de Janeiro, Brazil. The isolate presented susceptibility only to tetracycline, vancomycin and linezolid. The detection of various antibiotic resistance genes is fully consistent with previously observed multidrug-resistant pattern in Corynebacterium spp. A large part of the pTP10 plasmid of MDR C. striatum M82B is present in the genome of our isolate. A SpaDEF cluster and seven arrays of CRISPR-Cas were found.},
}
@article {pmid29991671,
year = {2018},
author = {Cho, LH and Yoon, J and Wai, AH and An, G},
title = {Histone Deacetylase 701 (HDT701) Induces Flowering in Rice by Modulating Expression of OsIDS1.},
journal = {Molecules and cells},
volume = {41},
number = {7},
pages = {665-675},
pmid = {29991671},
issn = {0219-1032},
mesh = {Base Sequence ; CRISPR-Cas Systems/genetics ; Chromatin/metabolism ; Circadian Rhythm/genetics ; Flowers/*enzymology/*physiology ; *Gene Expression Regulation, Plant ; Histone Deacetylases/chemistry/genetics/*metabolism ; Models, Biological ; Mutation/genetics ; Oryza/*enzymology/*genetics/physiology ; Photoperiod ; Plant Leaves/genetics ; Plant Proteins/chemistry/genetics/*metabolism ; },
abstract = {Rice is a facultative short-day (SD) plant in which flowering is induced under SD conditions or by other environmental factors and internal genetic programs. Overexpression of Histone Deacetylase 701 (HDT701) accelerates flowering in hybrid rice. In this study, mutants defective in HDT701 flowered late under both SD and long-day conditions. Expression levels of florigens Heading date 3a (Hd3a) and Rice Flowering Locus T1 (RFT1), and their immediate upstream floral activator Early heading date 1 (Ehd1), were significantly decreased in the hdt701 mutants, indicating that HDT701 functions upstream of Ehd1 in controlling flowering time. Transcript levels of OsINDETERMINATE SPIKELET 1 (OsIDS1), an upstream repressor of Ehd1, were significantly increased in the mutants while those of OsGI and Hd1 were reduced. Chromatin-immunoprecipitation assays revealed that HDT701 directly binds to the promoter region of OsIDS1. These results suggest that HDT701 induces flowering by suppressing OsIDS1.},
}
@article {pmid29987047,
year = {2018},
author = {Verruto, J and Francis, K and Wang, Y and Low, MC and Greiner, J and Tacke, S and Kuzminov, F and Lambert, W and McCarren, J and Ajjawi, I and Bauman, N and Kalb, R and Hannum, G and Moellering, ER},
title = {Unrestrained markerless trait stacking in Nannochloropsis gaditana through combined genome editing and marker recycling technologies.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {30},
pages = {E7015-E7022},
pmid = {29987047},
issn = {1091-6490},
mesh = {*Acyl-CoA Oxidase/genetics/metabolism ; *CRISPR-Cas Systems ; *Gene Editing ; Light-Harvesting Protein Complexes/genetics/metabolism ; *Lipids/biosynthesis/genetics ; *Quantitative Trait, Heritable ; *Stramenopiles/genetics/metabolism ; },
abstract = {Robust molecular tool kits in model and industrial microalgae are key to efficient targeted manipulation of endogenous and foreign genes in the nuclear genome for basic research and, as importantly, for the development of algal strains to produce renewable products such as biofuels. While Cas9-mediated gene knockout has been demonstrated in a small number of algal species with varying efficiency, the ability to stack traits or generate knockout mutations in two or more loci are often severely limited by selectable agent availability. This poses a critical hurdle in developing production strains, which require stacking of multiple traits, or in probing functionally redundant gene families. Here, we combine Cas9 genome editing with an inducible Cre recombinase in the industrial alga Nannochloropsis gaditana to generate a strain, NgCas9+Cre+, in which the potentially unlimited stacking of knockouts and addition of new genes is readily achievable. Cre-mediated marker recycling is first demonstrated in the removal of the selectable marker and GFP reporter transgenes associated with the Cas9/Cre construct in NgCas9+Cre+ Next, we show the proof-of-concept generation of a markerless knockout in a gene encoding an acyl-CoA oxidase (Aco1), as well as the markerless recapitulation of a 2-kb insert in the ZnCys gene 5'-UTR, which results in a doubling of wild-type lipid productivity. Finally, through an industrially oriented process, we generate mutants that exhibit up to ∼50% reduction in photosynthetic antennae size by markerless knockout of seven genes in the large light-harvesting complex gene family.},
}
@article {pmid29987021,
year = {2018},
author = {Banerjee, S and Ji, C and Mayfield, JE and Goel, A and Xiao, J and Dixon, JE and Guo, X},
title = {Ancient drug curcumin impedes 26S proteasome activity by direct inhibition of dual-specificity tyrosine-regulated kinase 2.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {32},
pages = {8155-8160},
pmid = {29987021},
issn = {1091-6490},
support = {R01 DK018024/DK/NIDDK NIH HHS/United States ; R01 DK018849/DK/NIDDK NIH HHS/United States ; R37 DK018024/DK/NIDDK NIH HHS/United States ; T32 CA009523/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; Antineoplastic Agents/*pharmacology/therapeutic use ; Apoptosis/drug effects ; CRISPR-Cas Systems ; Cell Proliferation/drug effects ; Crystallography, X-Ray ; Curcumin/*pharmacology/therapeutic use ; Drug Synergism ; Female ; Gene Editing/methods ; Gene Knockout Techniques/methods ; HEK293 Cells ; Humans ; Inhibitory Concentration 50 ; Mice ; Neoplasms/*drug therapy/pathology ; Oligopeptides/pharmacology ; Proteasome Endopeptidase Complex/*metabolism ; Proteasome Inhibitors/pharmacology ; Protein-Serine-Threonine Kinases/*antagonists &amp; inhibitors/chemistry/genetics/metabolism ; Protein-Tyrosine Kinases/*antagonists &amp; inhibitors/chemistry/genetics/metabolism ; Signal Transduction/drug effects ; Tumor Burden/drug effects ; Xenograft Model Antitumor Assays ; },
abstract = {Curcumin, the active ingredient in Curcuma longa, has been in medicinal use since ancient times. However, the therapeutic targets and signaling cascades modulated by curcumin have been enigmatic despite extensive research. Here we identify dual-specificity tyrosine-regulated kinase 2 (DYRK2), a positive regulator of the 26S proteasome, as a direct target of curcumin. Curcumin occupies the ATP-binding pocket of DYRK2 in the cocrystal structure, and it potently and specifically inhibits DYRK2 over 139 other kinases tested in vitro. As a result, curcumin diminishes DYRK2-mediated 26S proteasome phosphorylation in cells, leading to reduced proteasome activity and impaired cell proliferation. Interestingly, curcumin synergizes with the therapeutic proteasome inhibitor carfilzomib to induce apoptosis in a variety of proteasome-addicted cancer cells, while this drug combination exhibits modest to no cytotoxicity to noncancerous cells. In a breast cancer xenograft model, curcumin treatment significantly reduces tumor burden in immunocompromised mice, showing a similar antitumor effect as CRISPR/Cas9-mediated DYRK2 depletion. These results reveal an unexpected role of curcumin in DYRK2-proteasome inhibition and provide a proof-of-concept that pharmacological manipulation of proteasome regulators may offer new opportunities for anticancer treatment.},
}
@article {pmid29986379,
year = {2018},
author = {Belvedere, R and Saggese, P and Pessolano, E and Memoli, D and Bizzarro, V and Rizzo, F and Parente, L and Weisz, A and Petrella, A},
title = {miR-196a Is Able to Restore the Aggressive Phenotype of Annexin A1 Knock-Out in Pancreatic Cancer Cells by CRISPR/Cas9 Genome Editing.},
journal = {International journal of molecular sciences},
volume = {19},
number = {7},
pages = {},
pmid = {29986379},
issn = {1422-0067},
mesh = {Annexin A1/*genetics ; CRISPR-Cas Systems ; Cell Line, Tumor ; Cell Movement ; Cell Proliferation ; Disease Progression ; Epithelial-Mesenchymal Transition ; Gene Editing ; Gene Expression Regulation, Neoplastic ; Gene Knockout Techniques ; Humans ; MicroRNAs/genetics/*metabolism ; Neoplasm Invasiveness ; Neoplasm Metastasis ; Pancreatic Neoplasms/*genetics/*pathology ; },
abstract = {Annexin A1 (ANXA1) is a Ca2+-binding protein that is involved in pancreatic cancer (PC) progression. It is able to mediate cytoskeletal organization maintaining a malignant phenotype. Our previous studies showed that ANXA1 Knock-Out (KO) MIA PaCa-2 cells partially lost their migratory and invasive capabilities and also the metastatization process appeared affected in vivo. Here, we investigated the microRNA (miRNA) profile in ANXA1 KO cells finding that the modification in miRNA expression suggests the significant involvement of ANXA1 in PC development. In this study, we focused on miR-196a which appeared down modulated in absence of ANXA1. This miRNA is a well known oncogenic factor in several tumour models and it is able to trigger the agents of the epithelial to mesenchymal transition (EMT), like ANXA1. Our results show that the reintroduction in ANXA1 KO cells of miR-196a through the mimic sequence restored the early aggressive phenotype of MIA PaCa-2. Then, ANXA1 seems to support the expression of miR-196a and its role. On the other hand, this miRNA is able to mediate cytoskeletal dynamics and other protein functions promoting PC cell migration and invasion. This work describes the correlation between ANXA1 and specific miRNA sequences, particularly miR-196a. These results could lead to further information on ANXA1 intracellular role in PC, explaining other aspects that are apart from its tumorigenic behaviour.},
}
@article {pmid29985369,
year = {2018},
author = {Naeimi Kararoudi, M and Dolatshad, H and Trikha, P and Hussain, SA and Elmas, E and Foltz, JA and Moseman, JE and Thakkar, A and Nakkula, RJ and Lamb, M and Chakravarti, N and McLaughlin, KJ and Lee, DA},
title = {Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {136},
pages = {},
pmid = {29985369},
issn = {1940-087X},
mesh = {CRISPR-Cas Systems/*genetics ; Genetic Engineering/*methods ; Genetic Therapy/*methods ; Humans ; Immunotherapy/*methods ; Killer Cells, Natural/*metabolism ; Ribonucleoproteins/*metabolism ; },
abstract = {CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging in primary NK cells. For example, transgene delivery using lentiviral or retroviral transduction resulted in a limited yield of genetically-engineered NK cells due to substantial procedure-associated NK cell apoptosis. We describe here a DNA-free method for genome editing of human primary and expanded NK cells using Cas9 ribonucleoprotein complexes (Cas9/RNPs). This method allowed efficient knockout of the TGFBR2 and HPRT1 genes in NK cells. RT-PCR data showed a significant decrease in gene expression level, and a cytotoxicity assay of a representative cell product suggested that the RNP-modified NK cells became less sensitive to TGFβ. Genetically modified cells could be expanded post-electroporation by stimulation with irradiated mbIL21-expressing feeder cells.},
}
@article {pmid29982016,
year = {2018},
author = {Schuh, RS and Poletto, É and Fachel, FNS and Matte, U and Baldo, G and Teixeira, HF},
title = {Physicochemical properties of cationic nanoemulsions and liposomes obtained by microfluidization complexed with a single plasmid or along with an oligonucleotide: Implications for CRISPR/Cas technology.},
journal = {Journal of colloid and interface science},
volume = {530},
number = {},
pages = {243-255},
doi = {10.1016/j.jcis.2018.06.058},
pmid = {29982016},
issn = {1095-7103},
mesh = {*CRISPR-Cas Systems ; Cations/chemistry ; Cells, Cultured ; Clustered Regularly Interspaced Short Palindromic Repeats ; Emulsions/*chemistry ; Fatty Acids, Monounsaturated/chemistry ; Fibroblasts/metabolism ; *Gene Transfer Techniques ; HEK293 Cells ; Hep G2 Cells ; Humans ; Liposomes/*chemistry ; Oligonucleotides/*administration &amp; dosage/genetics ; Phosphatidylethanolamines/*chemistry ; Plasmids/*administration &amp; dosage/genetics ; Polyethylene Glycols/*chemistry ; Quaternary Ammonium Compounds/chemistry ; },
abstract = {In this study, we investigated the effects of the association of a single plasmid or its co-complexation along with an oligonucleotide on the physicochemical properties of cationic nanoemulsions and liposomes intended for gene editing. Formulations composed of DOPE, DOTAP, DSPE-PEG (liposomes), MCT (nanoemulsions), and water were obtained by microfluidization. DSPE-PEG was found to play a crucial role on the size and polydispersity index of nanocarriers. Nucleic acids were complexated by adsorption at different charge ratios. No significant differences were noticed in the physicochemical properties of nanocarriers (i.e. droplet size, polydispersity index, or zeta potential) when a single plasmid or both plasmid and oligonucleotide were adsorbed to the formulations. Transmission electron microscopy photomicrographs suggested round nanostructures with the nucleic acids and DSPE-PEG enfolding the surface. Complexes at +4/-1 charge ratio protected nucleic acids against DNase I degradation. The oligonucleotide seemed to be released from the liposomal complexes, while nanoemulsions only released the plasmid after 24 and 48 h of incubation in DMEM supplemented or not. In vitro experiments demonstrated that complexes were highly tolerable to human fibroblasts, Hep-G2, and HEK-293 cells, demonstrating also an uptake ability of about 30%, 30%, and 90%, respectively, no matter what the formulation or the combination of nucleic acids used. Transfection efficiency of the formulations was around 25% in human fibroblasts, 32% in HEK-293, and 15% in Hep-G2 cells. The overall results demonstrated the behavior of liposomes and nanoemulsions complexed with a plasmid or a mixture of a plasmid and an oligonucleotide, and demonstrated that the association with one or two nucleic acids sequences of different length does not seem to interfere in the physicochemical characteristics of complexes or in the uptake capacity by three different types of cells.},
}
@article {pmid29980799,
year = {2018},
author = {Ungewiß, H and Rötzer, V and Meir, M and Fey, C and Diefenbacher, M and Schlegel, N and Waschke, J},
title = {Dsg2 via Src-mediated transactivation shapes EGFR signaling towards cell adhesion.},
journal = {Cellular and molecular life sciences : CMLS},
volume = {75},
number = {22},
pages = {4251-4268},
pmid = {29980799},
issn = {1420-9071},
support = {SPP1782//Deutsche Forschungsgemeinschaft/ ; SPP1782//Deutsche Forschungsgemeinschaft/ ; },
mesh = {CRISPR-Cas Systems/genetics ; Caco-2 Cells ; Cell Adhesion ; Cell Line, Tumor ; Cell Proliferation ; Desmoglein 2/deficiency/genetics/*metabolism ; Desmosomes/metabolism ; ErbB Receptors/*metabolism ; Humans ; Intestinal Mucosa/cytology/metabolism ; Microscopy, Atomic Force ; Protein Binding ; Signal Transduction ; Transcriptional Activation ; p38 Mitogen-Activated Protein Kinases/metabolism ; src-Family Kinases/genetics/*metabolism ; },
abstract = {Rapidly renewing epithelial tissues such as the intestinal epithelium require precise tuning of intercellular adhesion and proliferation to preserve barrier integrity. Here, we provide evidence that desmoglein 2 (Dsg2), an adhesion molecule of desmosomes, controls cell adhesion and proliferation via epidermal growth factor receptor (EGFR) signaling. Dsg2 is required for EGFR localization at intercellular junctions as well as for Src-mediated EGFR activation. Src binds to EGFR and is required for localization of EGFR and Dsg2 to cell-cell contacts. EGFR is critical for cell adhesion and barrier recovery. In line with this, Dsg2-deficient enterocytes display impaired barrier properties and increased cell proliferation. Mechanistically, Dsg2 directly interacts with EGFR and undergoes heterotypic-binding events on the surface of living enterocytes via its extracellular domain as revealed by atomic force microscopy. Thus, our study reveals a new mechanism by which Dsg2 via Src shapes EGFR function towards cell adhesion.},
}
@article {pmid29980644,
year = {2018},
author = {Tan, ZY and Huang, T and Ngeow, J},
title = {65 YEARS OF THE DOUBLE HELIX: The advancements of gene editing and potential application to hereditary cancer.},
journal = {Endocrine-related cancer},
volume = {25},
number = {8},
pages = {T141-T158},
doi = {10.1530/ERC-18-0039},
pmid = {29980644},
issn = {1479-6821},
abstract = {Hereditary cancer predisposition syndromes are associated with germline mutations that lead to increased vulnerability for an individual to develop cancers. Such germline mutations in tumour suppressor genes, oncogenes and genes encoding for proteins essential in DNA repair pathways and cell cycle control can cause overall chromosomal instability in the genome and increase risk in developing cancers. Gene correction of these germline mutations to restore normal protein functions is anticipated as a new therapeutic option. This can be achieved through disruption of gain-of-function pathogenic mutation, restoration of loss-of-function mutation, addition of a transgene essential for cell function and single nucleotide changes. Genome editing tools are applicable to precise gene correction. Development of genome editing tools comes in two waves. The first wave focuses on improving targeting specificity and editing efficiency of nucleases, and the second wave of gene editing draws on innovative engineering of fusion proteins combining deactivated nucleases and other enzymes that are able to create limitless functional molecular tools. This gene editing advancement is going to impact medicine, particularly in hereditary cancers. In this review, we discuss the application of gene editing as an early intervention and possible treatment for hereditary cancers, by highlighting a selection of highly penetrant cancer syndromes as examples of how this may be achieved in clinical practice.},
}
@article {pmid29980564,
year = {2018},
author = {York, JR and Yuan, T and Lakiza, O and McCauley, DW},
title = {An ancestral role for Semaphorin3F-Neuropilin signaling in patterning neural crest within the new vertebrate head.},
journal = {Development (Cambridge, England)},
volume = {145},
number = {14},
pages = {},
doi = {10.1242/dev.164780},
pmid = {29980564},
issn = {1477-9129},
mesh = {Animals ; *Body Patterning ; CRISPR-Cas Systems ; Cell Movement ; Gene Expression Regulation, Developmental ; Gene Knockout Techniques ; Head/*embryology ; Lampreys/genetics ; Melanocytes/cytology/metabolism ; Neural Crest/cytology/*embryology ; Neuropilins/genetics/*metabolism ; Phylogeny ; Semaphorins/genetics/*metabolism ; Sensory Receptor Cells/metabolism ; *Signal Transduction ; Skull/cytology ; },
abstract = {The origin of the vertebrate head is one of the great unresolved issues in vertebrate evolutionary developmental biology. Although many of the novelties in the vertebrate head and pharynx derive from the neural crest, it is still unknown how early vertebrates patterned the neural crest within the ancestral body plan they inherited from invertebrate chordates. Here, using a basal vertebrate, the sea lamprey, we show that homologs of Semaphorin3F (Sema3F) ligand and its Neuropilin (Nrp) receptors show complementary and dynamic patterns of expression that correlate with key periods of neural crest development (migration and patterning of cranial neural crest-derived structures). Using CRISPR/Cas9-mediated mutagenesis, we demonstrate that lamprey Sema3F is essential for patterning of neural crest-derived melanocytes, cranial ganglia and the head skeleton, but is not required for neural crest migration or patterning of trunk neural crest derivatives. Based on comparisons with jawed vertebrates, our results suggest that the deployment of Nrp-Sema3F signaling, along with other intercellular guidance cues, was pivotal in allowing early vertebrates to organize and pattern cranial neural crest cells into many of the hallmark structures that define the vertebrate head.},
}
@article {pmid29979631,
year = {2018},
author = {Wei, W and Zhang, S and Fleming, J and Chen, Y and Li, Z and Fan, S and Liu, Y and Wang, W and Wang, T and Liu, Y and Ren, B and Wang, M and Jiao, J and Chen, Y and Zhou, Y and Zhou, Y and Gu, S and Zhang, X and Wan, L and Chen, T and Zhou, L and Chen, Y and Zhang, XE and Li, C and Zhang, H and Bi, L},
title = {Mycobacterium tuberculosis type III-A CRISPR/Cas system crRNA and its maturation have atypical features.},
journal = {FASEB journal : official publication of the Federation of American Societies for Experimental Biology},
volume = {},
number = {},
pages = {fj201800557RR},
doi = {10.1096/fj.201800557RR},
pmid = {29979631},
issn = {1530-6860},
abstract = {Clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (Cas) systems are prokaryotic adaptive immune systems against invading nucleic acids. CRISPR locus variability has been exploited in evolutionary and epidemiological studies of Mycobacterium tuberculosis, the causative agent of tuberculosis, for over 20 yr, yet the biological function of this type III-A system is largely unexplored. Here, using cell biology and biochemical, mutagenic, and RNA-seq approaches, we show it is active in invader defense and has features atypical of type III-A systems: mature CRISPR RNA (crRNA) in its crRNA-CRISPR/Cas protein complex are of uniform length (∼71 nt) and appear not to be subject to 3'-end processing after Cas6 cleavage of repeat RNA 8 nt from its 3' end. crRNAs generated resemble mature crRNA in type I systems, having both 5' (8 nt) and 3' (28 nt) repeat tags. Cas6 cleavage of repeat RNA is ion dependent, and accurate cleavage depends on the presence of a 3' hairpin in the repeat RNA and the sequence of its stem base nucleotides. This study unveils further diversity among CRISPR/Cas systems and provides insight into the crRNA recognition mechanism in M. tuberculosis, providing a foundation for investigating the potential of a type III-A-based genome editing system.-Wei, W., Zhang, S., Fleming, J., Chen, Y., Li, Z., Fan, S., Liu, Y., Wang, W., Wang, T., Liu, Y., Ren, B., Wang, M., Jiao, J., Chen, Y., Zhou, Yi., Zhou, Ya., Gu, S., Zhang, X., Wan, L., Chen, T., Zhou, L., Chen, Y., Zhang, X.-E., Li, C., Zhang, H., Bi, L. Mycobacterium tuberculosis type III-A CRISPR/Cas system crRNA and its maturation have atypical features.},
}
@article {pmid29974860,
year = {2018},
author = {Wu, RS and Lam, II and Clay, H and Duong, DN and Deo, RC and Coughlin, SR},
title = {A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish.},
journal = {Developmental cell},
volume = {46},
number = {1},
pages = {112-125.e4},
doi = {10.1016/j.devcel.2018.06.003},
pmid = {29974860},
issn = {1878-1551},
support = {F32 HL116194/HL/NHLBI NIH HHS/United States ; },
mesh = {Animals ; Base Sequence ; CRISPR-Cas Systems/genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/genetics ; GTP-Binding Protein alpha Subunits, G12-G13/genetics ; Gene Knockout Techniques/*methods ; Genetic Engineering/methods ; Heart/*embryology ; Morpholinos/genetics ; Myocytes, Cardiac/cytology ; Promyelocytic Leukemia Zinc Finger Protein/*genetics ; Transcription, Genetic/genetics ; Zebrafish/embryology/*genetics ; Zebrafish Proteins/*genetics ; },
abstract = {Zebrafish is a powerful model for forward genetics. Reverse genetic approaches are limited by the time required to generate stable mutant lines. We describe a system for gene knockout that consistently produces null phenotypes in G0 zebrafish. Yolk injection of sets of four CRISPR/Cas9 ribonucleoprotein complexes redundantly targeting a single gene recapitulated germline-transmitted knockout phenotypes in >90% of G0 embryos for each of 8 test genes. Early embryonic (6 hpf) and stable adult phenotypes were produced. Simultaneous multi-gene knockout was feasible but associated with toxicity in some cases. To facilitate use, we generated a lookup table of four-guide sets for 21,386 zebrafish genes and validated several. Using this resource, we targeted 50 cardiomyocyte transcriptional regulators and uncovered a role of zbtb16a in cardiac development. This system provides a platform for rapid screening of genes of interest in development, physiology, and disease models in zebrafish.},
}
@article {pmid29974342,
year = {2018},
author = {Sato, M and Ohtsuka, M and Nakamura, S and Sakurai, T and Watanabe, S and Gurumurthy, CB},
title = {In vivo genome editing targeted towards the female reproductive system.},
journal = {Archives of pharmacal research},
volume = {41},
number = {9},
pages = {898-910},
doi = {10.1007/s12272-018-1053-z},
pmid = {29974342},
issn = {0253-6269},
mesh = {Animals ; CRISPR-Cas Systems/*genetics ; Female ; *Gene Editing ; Genitalia, Female/*metabolism ; Humans ; },
abstract = {The discovery of sequence specific nucleases such as ZFNs, TALENs, and CRISPR/Cas9 has revolutionized genome editing. The CRISPR/Cas9 system has particularly emerged as a highly simple and efficient approach towards generating genome-edited animal models of most of the experimental species. The limitation of these novel genome editing tools is that, till date, they depend on traditional pronuclear injection (PI)-based transgenic technologies developed over the last three decades. PI requires expensive micromanipulator systems and the equipment operators must possess a high level of skill. Therefore, since the establishment of PI-based transgenesis, various research groups worldwide have attempted to develop alternative and simple gene delivery methods. However, owing to the failure of chromosomal integration of the transgene, none of these methods gained the level of confidence as that by the PI method in order to be adapted as a routine approach. The recently developed genome editing systems do not require complicated techniques. Therefore, presently, attention is being focused on non-PI-based gene delivery into germ cells for simple and rapid production of genetically engineered animals. For example, a few reports during the previous 1-2 years demonstrated the use of electroporation (EP) in isolated zygotes that helped to overcome the absolute dependency on PI techniques. Recently, another breakthrough technology called genome editing via oviductal nucleic acids delivery (GONAD) that directly delivers nucleic acids into zygotes within the oviducts in situ was developed. This technology completely relieves the bottlenecks of animal transgenesis as it does not require PI and ex vivo handling of embryos. This review discusses in detail the in vivo gene delivery methods targeted towards female reproductive tissues as these methods that have been developed over the past 2-3 decades can now be re-evaluated for their suitability to deliver the CRISPR/Cas9 components to produce transgenic animals. This review also provides an overview of the latest advances in CRISPR-enabled delivery technologies that have caused paradigm shifts in animal transgenesis methodologies.},
}
@article {pmid29973285,
year = {2018},
author = {Tang, X and Liu, G and Zhou, J and Ren, Q and You, Q and Tian, L and Xin, X and Zhong, Z and Liu, B and Zheng, X and Zhang, D and Malzahn, A and Gong, Z and Qi, Y and Zhang, T and Zhang, Y},
title = {A large-scale whole-genome sequencing analysis reveals highly specific genome editing by both Cas9 and Cpf1 (Cas12a) nucleases in rice.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {84},
pmid = {29973285},
issn = {1474-760X},
support = {31330017//National Natural Science Foundation of China (CN)/International ; 31771486//National Natural Science Foundation of China/International ; 2018ZX08022001-003//National Transgenic Major Project/International ; },
mesh = {CRISPR-Cas Systems/*genetics ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Endonucleases/*genetics ; Gene Editing/methods ; Genome, Plant/*genetics ; High-Throughput Nucleotide Sequencing/methods ; Mutation/genetics ; Oryza/*genetics ; RNA, Guide/genetics ; Whole Genome Sequencing/methods ; },
abstract = {BACKGROUND: Targeting specificity has been a barrier to applying genome editing systems in functional genomics, precise medicine and plant breeding. In plants, only limited studies have used whole-genome sequencing (WGS) to test off-target effects of Cas9. The cause of numerous discovered mutations is still controversial. Furthermore, WGS-based off-target analysis of Cpf1 (Cas12a) has not been reported in any higher organism to date.<br><br>RESULTS: We conduct a WGS analysis of 34 plants edited by Cas9 and 15 plants edited by Cpf1 in T0 and T1 generations along with 20 diverse control plants in rice. The sequencing depths range from 45× to 105× with read mapping rates above 96%. Our results clearly show that most mutations in edited plants are created by the tissue culture process, which causes approximately 102 to 148 single nucleotide variations (SNVs) and approximately 32 to 83 insertions/deletions (indels) per plant. Among 12 Cas9 single guide RNAs (sgRNAs) and three Cpf1 CRISPR RNAs (crRNAs) assessed by WGS, only one Cas9 sgRNA resulted in off-target mutations in T0 lines at sites predicted by computer programs. Moreover, we cannot find evidence for bona fide off-target mutations due to continued expression of Cas9 or Cpf1 with guide RNAs in T1 generation.<br><br>CONCLUSIONS: Our comprehensive and rigorous analysis of WGS data across multiple sample types suggests both Cas9 and Cpf1 nucleases are very specific in generating targeted DNA modifications and off-targeting can be avoided by designing guide RNAs with high specificity.},
}
@article {pmid29972722,
year = {2018},
author = {Lee, K and Zhang, Y and Kleinstiver, BP and Guo, JA and Aryee, MJ and Miller, J and Malzahn, A and Zarecor, S and Lawrence-Dill, CJ and Joung, JK and Qi, Y and Wang, K},
title = {Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize.},
journal = {Plant biotechnology journal},
volume = {},
number = {},
pages = {},
doi = {10.1111/pbi.12982},
pmid = {29972722},
issn = {1467-7652},
support = {K99 CA218870/CA/NCI NIH HHS/United States ; },
abstract = {CRISPR/Cas9 and Cas12a (Cpf1) nucleases are two of the most powerful genome editing tools in plants. In this work, we compared their activities by targeting maize glossy2 gene coding region that has overlapping sequences recognized by both nucleases. We introduced constructs carrying SpCas9-guide RNA (gRNA) and LbCas12a-CRISPR RNA (crRNA) into maize inbred B104 embryos using Agrobacterium-mediated transformation. On-target mutation analysis showed that 90%-100% of the Cas9-edited T0 plants carried indel mutations and 63%-77% of them were homozygous or biallelic mutants. In contrast, 0%-60% of Cas12a-edited T0 plants had on-target mutations. We then conducted CIRCLE-seq analysis to identify genome-wide potential off-target sites for Cas9. A total of 18 and 67 potential off-targets were identified for the two gRNAs, respectively, with an average of five mismatches compared to the target sites. Sequencing analysis of a selected subset of the off-target sites revealed no detectable level of mutations in the T1 plants, which constitutively express Cas9 nuclease and gRNAs. In conclusion, our results suggest that the CRISPR/Cas9 system used in this study is highly efficient and specific for genome editing in maize, while CRISPR/Cas12a needs further optimization for improved editing efficiency.},
}
@article {pmid29970232,
year = {2018},
author = {Koh, HR and Myong, S},
title = {Single-Cell Imaging Approaches for Studying Small-RNA-Induced Gene Regulation.},
journal = {Biophysical journal},
volume = {115},
number = {2},
pages = {203-208},
pmid = {29970232},
issn = {1542-0086},
abstract = {RNA interference (RNAi) is a process by which gene expression is downregulated by small interfering RNAs or microRNAs. The quantification of the RNAi efficiency can be performed at both the messenger RNA (mRNA) and the protein level, which is required to assess the potency of small interfering RNAs or microRNAs. Recently, we employed a single-cell mRNA imaging method to study RNAi in which we visualized individual mRNA targets with high precision while resolving the cellular localization and cell-to-cell heterogeneity in addition to RNAi efficiency. In this Biophysical Perspective, we highlight our recent work on quantitative analysis of the RNAi pathway and point out some important future directions. Alongside, we discuss about several single-cell imaging techniques that can be applied to study RNAi. The single-cell imaging techniques discussed here are widely applicable to other gene regulation processes such as the CRISPR-CAS system.},
}
@article {pmid29968520,
year = {2018},
author = {Perez Rojo, F and Nyman, RKM and Johnson, AAT and Navarro, MP and Ryan, MH and Erskine, W and Kaur, P},
title = {CRISPR-Cas systems: ushering in the new genome editing era.},
journal = {Bioengineered},
volume = {9},
number = {1},
pages = {214-221},
pmid = {29968520},
issn = {2165-5987},
abstract = {In recent years there has been great progress with the implementation and utilization of Clustered Regularly Interspaced Palindromic Repeats (CRISPR) and CRISPR-associated protein (Cas) systems in the world of genetic engineering. Many forms of CRISPR-Cas9 have been developed as genome editing tools and techniques and, most recently, several non-genome editing CRISPR-Cas systems have emerged. Most of the CRISPR-Cas systems have been classified as either Class I or Class II and are further divided among several subtypes within each class. Research teams and companies are currently in dispute over patents for these CRISPR-Cas systems as numerous powerful applications are concurrently under development. This mini review summarizes the appearance of CRISPR-Cas systems with a focus on the predominant CRISPR-Cas9 system as well as the classifications and subtypes for CRISPR-Cas. Non-genome editing uses of CRISPR-Cas are also highlighted and a brief overview of the commercialization of CRISPR is provided.},
}
@article {pmid29968018,
year = {2018},
author = {Greene, M and Master, Z},
title = {Ethical Issues of Using CRISPR Technologies for Research on Military Enhancement.},
journal = {Journal of bioethical inquiry},
volume = {15},
number = {3},
pages = {327-335},
pmid = {29968018},
issn = {1176-7529},
abstract = {This paper presents an overview of the key ethical questions of performing gene editing research on military service members. The recent technological advance in gene editing capabilities provided by CRISPR/Cas9 and their path towards first-in-human trials has reinvigorated the debate on human enhancement for non-medical purposes. Human performance optimization has long been a priority of military research in order to close the gap between the advancement of warfare and the limitations of human actors. In spite of this focus on temporary performance improvement, biomedical enhancement is an extension of these endeavours and the ethical issues of such research should be considered. In this paper, we explore possible applications of CRISPR to military human gene editing research and how it could be specifically applied towards protection of service members against biological or chemical weapons. We analyse three normative areas including risk-benefit analysis, informed consent, and inequality of access as it relates to CRISPR applications for military research to help inform and provide considerations for military institutional review boards and policymakers.},
}
@article {pmid29967764,
year = {2018},
author = {Duensing, N and Sprink, T and Parrott, WA and Fedorova, M and Lema, MA and Wolt, JD and Bartsch, D},
title = {Novel Features and Considerations for ERA and Regulation of Crops Produced by Genome Editing.},
journal = {Frontiers in bioengineering and biotechnology},
volume = {6},
number = {},
pages = {79},
pmid = {29967764},
issn = {2296-4185},
abstract = {Genome editing describes a variety of molecular biology applications enabling targeted and precise alterations of the genomes of plants, animals and microorganisms. These rapidly developing techniques are likely to revolutionize the breeding of new crop varieties. Since genome editing can lead to the development of plants that could also have come into existence naturally or by conventional breeding techniques, there are strong arguments that these cases should not be classified as genetically modified organisms (GMOs) and be regulated no differently from conventionally bred crops. If a specific regulation would be regarded necessary, the application of genome editing for crop development may challenge risk assessment and post-market monitoring. In the session &quot;Plant genome editing-any novel features to consider for ERA and regulation?&quot; held at the 14th ISBGMO, scientists from various disciplines as well as regulators, risk assessors and potential users of the new technologies were brought together for a knowledge-based discussion to identify knowledge gaps and analyze scenarios for the introduction of genome-edited crops into the environment. It was aimed to enable an open exchange forum on the regulatory approaches, ethical aspects and decision-making considerations.},
}
@article {pmid29967137,
year = {2018},
author = {Shao, J and Wang, M and Yu, G and Zhu, S and Yu, Y and Heng, BC and Wu, J and Ye, H},
title = {Synthetic far-red light-mediated CRISPR-dCas9 device for inducing functional neuronal differentiation.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {29},
pages = {E6722-E6730},
pmid = {29967137},
issn = {1091-6490},
mesh = {Basic Helix-Loop-Helix Transcription Factors/*biosynthesis/genetics ; *CRISPR-Cas Systems ; *Cell Differentiation ; *Cellular Reprogramming ; *Epigenesis, Genetic ; HEK293 Cells ; HeLa Cells ; Humans ; *Light ; Nerve Tissue Proteins/*biosynthesis/genetics ; Neurons/cytology/*metabolism ; Optogenetics/methods ; Synthetic Biology ; },
abstract = {The ability to control the activity of CRISPR-dCas9 with precise spatiotemporal resolution will enable tight genome regulation of user-defined endogenous genes for studying the dynamics of transcriptional regulation. Optogenetic devices with minimal phototoxicity and the capacity for deep tissue penetration are extremely useful for precise spatiotemporal control of cellular behavior and for future clinic translational research. Therefore, capitalizing on synthetic biology and optogenetic design principles, we engineered a far-red light (FRL)-activated CRISPR-dCas9 effector (FACE) device that induces transcription of exogenous or endogenous genes in the presence of FRL stimulation. This versatile system provides a robust and convenient method for precise spatiotemporal control of endogenous gene expression and also has been demonstrated to mediate targeted epigenetic modulation, which can be utilized to efficiently promote differentiation of induced pluripotent stem cells into functional neurons by up-regulating a single neural transcription factor, NEUROG2 This FACE system might facilitate genetic/epigenetic reprogramming in basic biological research and regenerative medicine for future biomedical applications.},
}
@article {pmid29964176,
year = {2018},
author = {Fernandez, JP and Vejnar, CE and Giraldez, AJ and Rouet, R and Moreno-Mateos, MA},
title = {Optimized CRISPR-Cpf1 system for genome editing in zebrafish.},
journal = {Methods (San Diego, Calif.)},
volume = {150},
number = {},
pages = {11-18},
doi = {10.1016/j.ymeth.2018.06.014},
pmid = {29964176},
issn = {1095-9130},
abstract = {The impact of the CRISPR-Cas biotechnological systems has recently broadened the genome editing toolbox available to different model organisms further with the addition of new efficient RNA-guided endonucleases. We have recently optimized CRISPR-Cpf1 (renamed Cas12a) system in zebrafish. We showed that (i) in the absence of Cpf1 protein, crRNAs are unstable and degraded in vivo, and CRISPR-Cpf1 RNP complexes efficiently mutagenize the zebrafish genome; and (ii) temperature modulates Cpf1 activity especially affecting AsCpf1, which experiences a reduced performance below 37 °C. Here, we describe a step-by-step protocol on how to easily design and generate crRNAs in vitro, purify recombinant Cpf1 proteins, and assemble ribonucleoprotein complexes to carry out efficient mutagenesis in zebrafish in a constitutive and temperature-controlled manner. Finally, we explain how to induce Cpf1-mediated homology-directed repair using single-stranded DNA oligonucleotides. In summary, this protocol includes the steps to efficiently modify the zebrafish genome and other ectothermic organisms using the CRISPR-Cpf1 system.},
}
@article {pmid29963037,
year = {2018},
author = {Toro, N and Martínez-Abarca, F and González-Delgado, A and Mestre, MR},
title = {On the Origin and Evolutionary Relationships of the Reverse Transcriptases Associated With Type III CRISPR-Cas Systems.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1317},
pmid = {29963037},
issn = {1664-302X},
abstract = {Reverse transcriptases (RTs) closely related to those encoded by group II introns but lacking the intron RNA structure have been found associated with type III clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems, a prokaryotic immune system against invading viruses and foreign genetic elements. Two models have been proposed to explain the origin and evolutionary relationships of these RTs: (i) the &quot;single point of origin&quot; model, according to which these RTs originated from a single acquisition event in bacterial, with the various protein domains (RT, RT-Cas1, and Cas6-RT-Cas1 fusions) corresponding to single points in evolution; and (ii) the &quot;various origins&quot; model, according to which, independent acquisition events in different evolutionary episodes led to these fusions. We tested these alternative hypotheses, by analyzing and integrating published datasets of RT sequences associated with CRISPR-Cas systems and inferring phylogenetic trees by maximum likelihood (ML) methods. The RTs studied could be grouped into 13 clades, mostly in bacteria, in which they probably evolved. The various clades appear to form three independent lineages in bacteria and a recent lineage in archaea. Our data show that the Cas6 domain was acquired twice, independently, through RT-Cas1 fusion, in the bacterial lineages. Taken together, there more evidence to support the &quot;various origins&quot; hypothesis.},
}
@article {pmid29962404,
year = {2018},
author = {Tsukamoto, T and Sakai, E and Iizuka, S and Taracena-Gándara, M and Sakurai, F and Mizuguchi, H},
title = {Generation of the Adenovirus Vector-Mediated CRISPR/Cpf1 System and the Application for Primary Human Hepatocytes Prepared from Humanized Mice with Chimeric Liver.},
journal = {Biological &amp; pharmaceutical bulletin},
volume = {41},
number = {7},
pages = {1089-1095},
doi = {10.1248/bpb.b18-00222},
pmid = {29962404},
issn = {1347-5215},
mesh = {Adenoviridae/*genetics ; Animals ; Bacterial Proteins/*genetics ; CRISPR-Cas Systems/*genetics ; Cell Line, Tumor ; Endonucleases/*genetics ; Genetic Vectors/*genetics ; HEK293 Cells ; Hepatocytes/metabolism ; Humans ; Liver/cytology ; Mice ; Primary Cell Culture ; RNA, Guide/genetics ; Transplantation Chimera ; },
abstract = {The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) 9 system is now widely used as a genome editing tool. CRISPR-associated endonuclease in Prevotella and Francisella 1 (Cpf1) is a recently discovered Cas endonuclease that is designable and highly specific with efficiencies comparable to those of Cas9. Here we generated the adenovirus (Ad) vector carrying an Acidaminococcus sp. Cpf1 (AsCpf1) expression cassette (Ad-AsCpf1) for the first time. Ad-AsCpf1 was applied to primary human hepatocytes prepared from humanized mice with chimeric liver in combination with the Ad vector expressing the guide RNA (gRNA) directed to the Adeno-associated virus integration site 1 (AAVS1) region. The mutation rates were estimated by T7 endonuclease I assay around 12% of insertion/deletion (indel). Furthermore, the transduced human hepatocytes were viable (ca. 60%) at two weeks post transduction. These observations suggest that the Ad vector-mediated delivery of the CRISPR/AsCpf1 system provides a useful tool for genome manipulation of human hepatocytes.},
}
@article {pmid29959923,
year = {2018},
author = {Ford, K and McDonald, D and Mali, P},
title = {Functional Genomics via CRISPR-Cas.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.06.034},
pmid = {29959923},
issn = {1089-8638},
support = {R01 CA222826/CA/NCI NIH HHS/United States ; R01 GM123313/GM/NIGMS NIH HHS/United States ; R01 HG009285/HG/NHGRI NIH HHS/United States ; T32 GM007198/GM/NIGMS NIH HHS/United States ; },
abstract = {RNA-guided CRISPR (clustered regularly interspaced short palindromic repeat)-associated Cas proteins have recently emerged as versatile tools to investigate and engineer the genome. The programmability of CRISPR-Cas has proven especially useful for probing genomic function in high-throughput. Facile single-guide RNA library synthesis allows CRISPR-Cas screening to rapidly investigate the functional consequences of genomic, transcriptomic, and epigenomic perturbations. Furthermore, by combining CRISPR-Cas perturbations with downstream single-cell analyses (flow cytometry, expression profiling, etc.), forward screens can generate robust data sets linking genotypes to complex cellular phenotypes. In the following review, we highlight recent advances in CRISPR-Cas genomic screening while outlining protocols and pitfalls associated with screen implementation. Finally, we describe current challenges limiting the utility of CRISPR-Cas screening as well as future research needed to resolve these impediments. As CRISPR-Cas technologies develop, so too will their clinical applications. Looking ahead, patient centric functional screening in primary cells will likely play a greater role in disease management and therapeutic development.},
}
@article {pmid29959919,
year = {2018},
author = {Zhang, XY and Shan, HJ and Zhang, P and She, C and Zhou, XZ},
title = {LncRNA EPIC1 protects human osteoblasts from dexamethasone-induced cell death.},
journal = {Biochemical and biophysical research communications},
volume = {503},
number = {4},
pages = {2255-2262},
doi = {10.1016/j.bbrc.2018.06.146},
pmid = {29959919},
issn = {1090-2104},
abstract = {Dexamethasone (Dex) can induce injury to human osteoblasts. Long non-coding RNA (LncRNA) EPIC1 (Lnc-EPIC1) is a novel Myc-interacting LncRNA. Its effect on Dex-treated human osteoblasts is studied here. In OB-6 osteoblastic cells and primary human osteoblasts, treatment with Dex increased expression of Lnc-EPIC1. Its expression is also elevated in the necrotic femoral head tissues of Dex-taking patients. Ectopic overexpression of Lnc-EPIC1 inhibited Dex-induced apoptosis and programmed necrosis in OB-6 cells and primary human osteoblasts. Reversely, Lnc-EPIC1 silencing by targeted siRNA potentiated Dex-induced cytotoxicity. Myc is the target of Lnc-EPIC1 in osteoblasts. Exogenous overexpression of Myc protected OB-6 cells from Dex. Conversely, Myc knockout by CRISPR-Cas-9 method abolished Lnc-EPIC1-induced OB-6 cytoprotection against Dex. Together, Lnc-EPIC1 expression protects human osteoblasts from Dex possible via regulation of Myc.},
}
@article {pmid29959585,
year = {2018},
author = {Singh, M and Kumar, M and Albertsen, MC and Young, JK and Cigan, AM},
title = {Concurrent modifications in the three homeologs of Ms45 gene with CRISPR-Cas9 lead to rapid generation of male sterile bread wheat (Triticum aestivum L.).},
journal = {Plant molecular biology},
volume = {97},
number = {4-5},
pages = {371-383},
pmid = {29959585},
issn = {1573-5028},
mesh = {Amino Acid Sequence ; *CRISPR-Cas Systems ; Flowers/genetics/growth &amp; development ; Mutation ; Plant Infertility/*genetics ; Plant Proteins/genetics/*metabolism ; Pollen/genetics/growth &amp; development ; Sequence Alignment ; Triticum/*genetics/growth &amp; development ; },
abstract = {KEY MESSAGE: Hexaploid bread wheat is not readily amenable to traditional mutagenesis approaches. In this study, we show efficient utilization of CRISPR-Cas system and Next Generation Sequencing for mutant analysis in wheat. Identification and manipulation of male fertility genes in hexaploid bread wheat is important for understanding the molecular basis of pollen development and to obtain novel sources of nuclear genetic male sterility (NGMS). The maize Male sterile 45 (Ms45) gene encodes a strictosidine synthase-like enzyme and has been shown to be required for male fertility. To investigate the role of Ms45 gene in wheat, mutations in the A, B and D homeologs were produced using CRISPR-Cas9. A variety of mutations in the three homeologs were recovered, including a plant from two different genotypes each with mutations in all three homeologs. Genetic analysis of the mutations demonstrated that all three wheat Ms45 homeologs contribute to male fertility and that triple homozygous mutants are required to abort pollen development and achieve male sterility. Further, it was demonstrated that a wild-type copy of Ms45 gene from rice was able to restore fertility to these wheat mutant plants. Taken together, these observations provide insights into the conservation of MS45 function in a polyploid species. Ms45 based NGMS can be potentially utilized for a Seed Production Technology (SPT)-like hybrid seed production system in wheat.},
}
@article {pmid29959543,
year = {2018},
author = {Anand, A and Jones, TJ},
title = {Advancing Agrobacterium-Based Crop Transformation and Genome Modification Technology for Agricultural Biotechnology.},
journal = {Current topics in microbiology and immunology},
volume = {418},
number = {},
pages = {489-507},
doi = {10.1007/82_2018_97},
pmid = {29959543},
issn = {0070-217X},
abstract = {The last decade has seen significant strides in Agrobacterium-mediated plant transformation technology. This has not only expanded the number of crop species that can be transformed by Agrobacterium, but has also made it possible to routinely transform several recalcitrant crop species including cereals (e.g., maize, sorghum, and wheat). However, the technology is limited by the random nature of DNA insertions, genotype dependency, low frequency of quality events, and variation in gene expression arising from genomic insertion sites. A majority of these deficiencies have now been addressed by improving the frequency of quality events, developing genotype-independent transformation capability in maize, developing an Agrobacterium-based site-specific integration technology for precise gene targeting, and adopting Agrobacterium-delivered CRISPR-Cas genes for gene editing. These improved transformation technologies are discussed in detail in this chapter.},
}
@article {pmid29956290,
year = {2018},
author = {Cheong, TC and Blasco, RB and Chiarle, R},
title = {The CRISPR/Cas9 System as a Tool to Engineer Chromosomal Translocation In Vivo.},
journal = {Advances in experimental medicine and biology},
volume = {1044},
number = {},
pages = {39-48},
doi = {10.1007/978-981-13-0593-1_4},
pmid = {29956290},
issn = {0065-2598},
support = {R01 CA196703/CA/NCI NIH HHS/United States ; R01 CA222598/CA/NCI NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Embryonic Stem Cells/metabolism ; Genetic Engineering/*methods ; Mice ; *Translocation, Genetic ; },
abstract = {The CRISPR/Cas9 system has emerged as a powerful tool to edit the genome. Among many applications, the system generates the exciting possibility of engineering small and large portions of chromosomes to induce a variety of structural alterations such as deletions, inversions, insertions and inter-chromosomal translocations. Furthermore, the availability of viral vectors that express Cas9 has been critical to deliver the CRISPR/Cas9 system directly in vivo to induce chromosomal rearrangements. This review provides an overview of the state-of-the-art CRISPR/Cas9 technology to model a variety of rearrangements in vivo in animal models.},
}
@article {pmid29956288,
year = {2018},
author = {Brunet, E and Jasin, M},
title = {Induction of Chromosomal Translocations with CRISPR-Cas9 and Other Nucleases: Understanding the Repair Mechanisms That Give Rise to Translocations.},
journal = {Advances in experimental medicine and biology},
volume = {1044},
number = {},
pages = {15-25},
doi = {10.1007/978-981-13-0593-1_2},
pmid = {29956288},
issn = {0065-2598},
support = {P30 CA008748/CA/NCI NIH HHS/United States ; R01 CA185660/CA/NCI NIH HHS/United States ; R35 GM118175/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; DNA Breaks, Double-Stranded ; *DNA Repair ; *Endonucleases ; Humans ; Mice ; *Translocation, Genetic ; },
abstract = {Chromosomal translocations are associated with several tumor types, including hematopoietic malignancies, sarcomas, and solid tumors of epithelial origin, due to their activation of a proto-oncogene or generation of a novel fusion protein with oncogenic potential. In many cases, the availability of suitable human models has been lacking because of the difficulty in recapitulating precise expression of the fusion protein or other reasons. Further, understanding how translocations form mechanistically has been a goal, as it may suggest ways to prevent their occurrence. Chromosomal translocations arise when DNA ends from double-strand breaks (DSBs) on two heterologous chromosomes are improperly joined. This review provides a summary of DSB repair mechanisms and their contribution to translocation formation, the various programmable nuclease platforms that have been used to generate translocations, and the successes that have been achieved in this area.},
}
@article {pmid29951376,
year = {2018},
author = {He, Y and Wang, M and Liu, M and Huang, L and Liu, C and Zhang, X and Yi, H and Cheng, A and Zhu, D and Yang, Q and Wu, Y and Zhao, X and Chen, S and Jia, R and Zhang, S and Liu, Y and Yu, Y and Zhang, L},
title = {Cas1 and Cas2 From the Type II-C CRISPR-Cas System of Riemerella anatipestifer Are Required for Spacer Acquisition.},
journal = {Frontiers in cellular and infection microbiology},
volume = {8},
number = {},
pages = {195},
pmid = {29951376},
issn = {2235-2988},
abstract = {Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins provide acquired genetic immunity against the entry of mobile genetic elements (MGEs). The immune defense provided by various subtypes of the CRISPR-Cas system has been confirmed and is closely associated with the formation of immunological memory in CRISPR arrays, called CRISPR adaptation or spacer acquisition. However, whether type II-C CRISPR-Cas systems are also involved in spacer acquisition remains largely unknown. This study explores and provides some definitive evidence regarding spacer acquisition of the type II-C CRISPR-Cas system from Riemerella anatipestifer (RA) CH-2 (RA-CH-2). Firstly, introducing an exogenous plasmid into RA-CH-2 triggered spacer acquisition of RA CRISPR-Cas system, and the acquisition of new spacers led to plasmid instability in RA-CH-2. Furthermore, deletion of cas1 or cas2 of RA-CH-2 abrogated spacer acquisition and subsequently stabilized the exogenous plasmid, suggesting that both Cas1 and Cas2 are required for spacer acquisition of RA-CH-2 CRISPR-Cas system, consistent with the reported role of Cas1 and Cas2 in type I-E and II-A systems. Finally, assays for studying Cas1 nuclease activity and the interaction of Cas1 with Cas2 contributed to a better understanding of the adaptation mechanism of RA CRISPR-Cas system. This is the first experimental identification of the naïve adaptation of type II-C CRISPR-Cas system.},
}
@article {pmid29951046,
year = {2018},
author = {White Iii, RA and Wong, HL and Ruvindy, R and Neilan, BA and Burns, BP},
title = {Viral Communities of Shark Bay Modern Stromatolites.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1223},
pmid = {29951046},
issn = {1664-302X},
abstract = {Single stranded DNA viruses have been previously shown to populate the oceans on a global scale, and are endemic in microbialites of both marine and freshwater systems. We undertook for the first time direct viral metagenomic shotgun sequencing to explore the diversity of viruses in the modern stromatolites of Shark Bay Australia. The data indicate that Shark Bay marine stromatolites have similar diversity of ssDNA viruses to that of Highbourne Cay, Bahamas. ssDNA viruses in cluster uniquely in Shark Bay and Highbourne Cay, potentially due to enrichment by phi29-mediated amplification bias. Further, pyrosequencing data was assembled from the Shark Bay systems into two putative viral genomes that are related to Genomoviridae family of ssDNA viruses. In addition, the cellular fraction was shown to be enriched for antiviral defense genes including CRISPR-Cas, BREX (bacteriophage exclusion), and DISARM (defense island system associated with restriction-modification), a potentially novel finding for these systems. This is the first evidence for viruses in the Shark Bay stromatolites, and these viruses may play key roles in modulating microbial diversity as well as potentially impacting ecosystem function through infection and the recycling of key nutrients.},
}
@article {pmid29951040,
year = {2018},
author = {Mašlaňová, I and Wertheimer, Z and Sedláček, I and Švec, P and Indráková, A and Kovařovic, V and Schumann, P and Spröer, C and Králová, S and Šedo, O and Krištofová, L and Vrbovská, V and Füzik, T and Petráš, P and Zdráhal, Z and Ružičková, V and Doškař, J and Pantuček, R},
title = {Description and Comparative Genomics of Macrococcus caseolyticus subsp. hominis subsp. nov., Macrococcus goetzii sp. nov., Macrococcus epidermidis sp. nov., and Macrococcus bohemicus sp. nov., Novel Macrococci From Human Clinical Material With Virulence Potential and Suspected Uptake of Foreign DNA by Natural Transformation.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1178},
pmid = {29951040},
issn = {1664-302X},
abstract = {The genus Macrococcus is a close relative of the genus Staphylococcus. Whilst staphylococci are widespread as human pathogens, macrococci have not yet been reported from human clinical specimens. Here we investigated Gram-positive and catalase-positive cocci recovered from human clinical material and identified as Macrococcus sp. by a polyphasic taxonomic approach and by comparative genomics. Relevant phenotypic, genotypic and chemotaxonomic methods divided the analyzed strains into two separate clusters within the genus Macrococcus. Comparative genomics of four representative strains revealed enormous genome structural plasticity among the studied isolates. We hypothesize that high genomic variability is due to the presence of a com operon, which plays a key role in the natural transformation of bacilli and streptococci. The possible uptake of exogenous DNA by macrococci can contribute to a different mechanism of evolution from staphylococci, where phage-mediated horizontal gene transfer predominates. The described macrococcal genomes harbor novel plasmids, genomic islands and islets, as well as prophages. Capsule gene clusters, intracellular protease, and a fibronectin-binding protein enabling opportunistic pathogenesis were found in all four strains. Furthermore, the presence of a CRISPR-Cas system with 90 spacers in one of the sequenced genomes corresponds with the need to limit the burden of foreign DNA. The highly dynamic genomes could serve as a platform for the exchange of virulence and resistance factors, as was described for the methicillin resistance gene, which was found on the novel composite SCCmec-like element containing a unique mec gene complex that is considered to be one of the missing links in SCC evolution. The phenotypic, genotypic, chemotaxonomic and genomic results demonstrated that the analyzed strains represent one novel subspecies and three novel species of the genus Macrococcus, for which the names Macrococcus caseolyticus subsp. hominis subsp. nov. (type strain CCM 7927T = DSM 103682T), Macrococcus goetzii sp. nov. (type strain CCM 4927T = DSM 103683T), Macrococcus epidermidis sp. nov. (type strain CCM 7099T = DSM 103681T), and Macrococcus bohemicus sp. nov. (type strain CCM 7100T = DSM 103680T) are proposed. Moreover, a formal description of Macrococcus caseolyticus subsp. caseolyticus subsp. nov. and an emended description of the genus Macrococcus are provided.},
}
@article {pmid29950558,
year = {2018},
author = {Dong, C and Fontana, J and Patel, A and Carothers, JM and Zalatan, JG},
title = {Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2489},
pmid = {29950558},
issn = {2041-1723},
abstract = {Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains. Effective gene activation requires target sites situated in a narrow region just upstream of the transcription start site, in sharp contrast to the relatively flexible target site requirements for gene activation in eukaryotic cells. Together with existing tools for CRISPRi gene repression, these bacterial activators enable programmable control over multiple genes with simultaneous activation and repression. Further, the entire gene expression program can be switched on by inducing expression of the CRISPR-Cas system. This work will provide a foundation for engineering synthetic bacterial cellular devices with applications including diagnostics, therapeutics, and industrial biosynthesis.},
}
@article {pmid29950431,
year = {2018},
author = {Xu, Y and Wang, Y and Song, Y and Deng, J and Chen, M and Ouyang, H and Lai, L and Li, Z},
title = {Generation and Phenotype Identification of PAX4 Gene Knockout Rabbit by CRISPR/Cas9 System.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2833-2840},
pmid = {29950431},
issn = {2160-1836},
mesh = {Animals ; Animals, Genetically Modified ; *CRISPR-Cas Systems ; Gene Expression ; Gene Knockout Techniques ; Gene Order ; Gene Targeting ; Genetic Vectors ; Immunohistochemistry ; Mutation ; Paired Box Transcription Factors/*deficiency/*genetics/metabolism ; *Phenotype ; RNA, Guide ; Rabbits ; },
abstract = {Paired-homeodomain transcription factor 4 (PAX4) gene encodes a transcription factor which plays an important role in the generation, differentiation, development, and survival of insulin-producing β-cells during mammalian pancreas development. PAX4 is a key diabetes mellitus (DM) susceptibility gene, which is associated with many different types of DM, including T1DM, T2DM, maturity onset diabetes of the young 9 (MODY9) and ketosis prone diabetes. In this study, a novel PAX4 gene knockout (KO) model was generated through co-injection of clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) mRNA/sgRNA into rabbit zygotes. Typical phenotypes of growth retardation, persistent hyperglycemia, decreased number of insulin-producing β cells and increased number of glucagon-producing α cells were observed in the homozygous PAX4 KO rabbits. Furthermore, DM associated phenotypes including diabetic nephropathy, hepatopathy, myopathy and cardiomyopathy were also observed in the homozygous PAX4 KO rabbits but not in the wild type (WT) controls and the heterozygous PAX4 KO rabbits. In summary, this is the first PAX4 gene KO rabbit model generated by CRISPR/Cas9 system. This novel rabbit model may provide a new platform for function study of PAX4 gene in rabbit and gene therapy of human DM in clinical trails.},
}
@article {pmid29950430,
year = {2018},
author = {Chen, X and Liao, S and Huang, X and Xu, T and Feng, X and Guang, S},
title = {Targeted Chromosomal Rearrangements via Combinatorial Use of CRISPR/Cas9 and Cre/LoxP Technologies in Caenorhabditis elegans.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2697-2707},
pmid = {29950430},
issn = {2160-1836},
support = {P40 OD010440/OD/NIH HHS/United States ; },
mesh = {Animals ; *CRISPR-Cas Systems ; Caenorhabditis elegans/genetics ; *Chromosome Inversion ; Gene Editing/*methods ; Gene Targeting/*methods ; Integrases/genetics/metabolism ; },
abstract = {Rearranged chromosomes have been applied to construct genetic balancers to manipulate essential genes in C. elegans Although much effort has been put into constructing balancer chromosomes, approximately 6% (map units) of the C. elegans genome has not been covered, and this area lies mostly in pairing centers (PCs). Here, we developed a method for conditional chromosomal engineering through combinatorial use of the CRISPR/Cas9 and Cre/LoxP technologies. Functional DNA fragments containing LoxP sequences were inserted into designated genomic loci using a modified counterselection (cs)-CRISPR method. Then, heat-shock-induced Cre recombinase induced an inversion of the chromosomal region between the two LoxP sites. The chromosomal inversions were subsequently detected by the appearance of pharyngeal GFP. Through this method, we have successfully generated several chromosomal inversion lines, providing valuable resources for studying essential genes in pairing centers.},
}
@article {pmid29949763,
year = {2018},
author = {Goodwin, PR and Meng, A and Moore, J and Hobin, M and Fulga, TA and Van Vactor, D and Griffith, LC},
title = {MicroRNAs Regulate Sleep and Sleep Homeostasis in Drosophila.},
journal = {Cell reports},
volume = {23},
number = {13},
pages = {3776-3786},
pmid = {29949763},
issn = {2211-1247},
support = {F32 GM109531/GM/NIGMS NIH HHS/United States ; P01 NS090994/NS/NINDS NIH HHS/United States ; T32 GM007122/GM/NIGMS NIH HHS/United States ; T32 NS007292/NS/NINDS NIH HHS/United States ; },
abstract = {To discover microRNAs that regulate sleep, we performed a genetic screen using a library of miRNA sponge-expressing flies. We identified 25 miRNAs that regulate baseline sleep; 17 were sleep-promoting and 8 promoted wake. We identified one miRNA that is required for recovery sleep after deprivation and 8 miRNAs that limit the extent of recovery sleep. 65% of the hits belong to human-conserved families. Interestingly, the majority (75%), but not all, of the baseline sleep-regulating miRNAs are required in neurons. Sponges that target miRNAs in the same family, including the miR-92a/92b/310 family and the miR-263a/263b family, have similar effects. Finally, mutation of one of the screen's strongest hits, let-7, using CRISPR/Cas-9, phenocopies sponge-mediated let-7 inhibition. Cell-type-specific and temporally restricted let-7 sponge expression experiments suggest that let-7 is required in the mushroom body both during development and in adulthood. This screen sets the stage for understanding the role of miRNAs in sleep.},
}
@article {pmid29946325,
year = {2018},
author = {Lapham, R and Lee, LY and Tsugama, D and Lee, S and Mengiste, T and Gelvin, SB},
title = {VIP1 and Its Homologs Are Not Required for Agrobacterium-Mediated Transformation, but Play a Role in Botrytis and Salt Stress Responses.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {749},
pmid = {29946325},
issn = {1664-462X},
abstract = {The bZIP transcription factor VIP1 interacts with the Agrobacterium virulence protein VirE2, but the role of VIP1 in Agrobacterium-mediated transformation remains controversial. Previously tested vip1-1 mutant plants produce a truncated protein containing the crucial bZIP DNA-binding domain. We generated the CRISPR/Cas mutant vip1-2 that lacks this domain. The transformation susceptibility of vip1-2 and wild-type plants is similar. Because of potential functional redundancy among VIP1 homologs, we tested transgenic lines expressing VIP1 fused to a SRDX repression domain. All VIP1-SRDX transgenic lines showed wild-type levels of transformation, indicating that neither VIP1 nor its homologs are required for Agrobacterium-mediated transformation. Because VIP1 is involved in innate immune response signaling, we tested the susceptibility of vip1 mutant and VIP1-SRDX plants to Pseudomonas syringae and Botrytis cinerea. vip1 mutant and VIP1-SRDX plants show increased susceptibility to B. cinerea but not to P. syringae infection, suggesting a role for VIP1 in B. cinerea, but not in P. syringae, defense signaling. B. cinerea susceptibility is dependent on abscisic acid (ABA) which is also important for abiotic stress responses. The germination of vip1 mutant and VIP1-SRDX seeds is sensitive to exogenous ABA, suggesting a role for VIP1 in response to ABA. vip1 mutant and VIP1-SRDX plants show increased tolerance to growth in salt, indicating a role for VIP1 in response to salt stress.},
}
@article {pmid29946262,
year = {2018},
author = {Dangi, AK and Sinha, R and Dwivedi, S and Gupta, SK and Shukla, P},
title = {Cell Line Techniques and Gene Editing Tools for Antibody Production: A Review.},
journal = {Frontiers in pharmacology},
volume = {9},
number = {},
pages = {630},
pmid = {29946262},
issn = {1663-9812},
abstract = {The present day modern formulation practices for drugs are based on newer tools and techniques toward effective utilization. The methods of antibody formulations are to be revolutionized based on techniques of cell engineering and gene editing. In the present review, we have discussed innovations in cell engineering toward production of novel antibodies for therapeutic applications. Moreover, this review deciphers the use of RNAi, ribozyme engineering, CRISPR-Cas-based techniques for better strategies for antibody production. Overall, this review describes the multidisciplinary aspects of the production of therapeutic proteins that has gained more attention due to its increasing demand.},
}
@article {pmid29946130,
year = {2018},
author = {Wang, T and Guan, C and Guo, J and Liu, B and Wu, Y and Xie, Z and Zhang, C and Xing, XH},
title = {Pooled CRISPR interference screening enables genome-scale functional genomics study in bacteria with superior performance.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {2475},
pmid = {29946130},
issn = {2041-1723},
support = {NSFC21627812//National Natural Science Foundation of China (National Science Foundation of China)/International ; },
mesh = {Bacteria/drug effects/*genetics/metabolism ; Butanols/toxicity ; *CRISPR-Cas Systems ; Chromosome Mapping ; Escherichia coli/drug effects/genetics/metabolism ; Furaldehyde/toxicity ; Gene Library ; Gene Regulatory Networks ; Genes, Essential ; Genome, Bacterial ; Genomics ; High-Throughput Nucleotide Sequencing ; INDEL Mutation ; Metabolic Networks and Pathways/genetics ; RNA, Bacterial/genetics ; RNA, Guide/genetics ; RNA, Untranslated/genetics ; Transcriptome ; },
abstract = {To fully exploit the microbial genome resources, a high-throughput experimental platform is needed to associate genes with phenotypes at the genome level. We present here a novel method that enables investigation of the cellular consequences of repressing individual transcripts based on the CRISPR interference (CRISPRi) pooled screening in bacteria. We identify rules for guide RNA library design to handle the unique structure of prokaryotic genomes by tiling screening and construct an E. coli genome-scale guide RNA library (~60,000 members) accordingly. We show that CRISPRi outperforms transposon sequencing, the benchmark method in the microbial functional genomics field, when similar library sizes are used or gene length is short. This tool is also effective for mapping phenotypes to non-coding RNAs (ncRNAs), as elucidated by a comprehensive tRNA-fitness map constructed here. Our results establish CRISPRi pooled screening as a powerful tool for mapping complex prokaryotic genetic networks in a precise and high-throughput manner.},
}
@article {pmid29945655,
year = {2018},
author = {Chuai, G and Ma, H and Yan, J and Chen, M and Hong, N and Xue, D and Zhou, C and Zhu, C and Chen, K and Duan, B and Gu, F and Qu, S and Huang, D and Wei, J and Liu, Q},
title = {DeepCRISPR: optimized CRISPR guide RNA design by deep learning.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {80},
pmid = {29945655},
issn = {1474-760X},
mesh = {CRISPR-Cas Systems/*genetics ; Cell Line ; Cell Line, Tumor ; Clustered Regularly Interspaced Short Palindromic Repeats/*genetics ; Computational Biology/methods ; Computer Simulation ; HCT116 Cells ; HEK293 Cells ; HL-60 Cells ; HeLa Cells ; Humans ; Machine Learning ; RNA Editing/genetics ; RNA, Guide/*genetics ; },
abstract = {A major challenge for effective application of CRISPR systems is to accurately predict the single guide RNA (sgRNA) on-target knockout efficacy and off-target profile, which would facilitate the optimized design of sgRNAs with high sensitivity and specificity. Here we present DeepCRISPR, a comprehensive computational platform to unify sgRNA on-target and off-target site prediction into one framework with deep learning, surpassing available state-of-the-art in silico tools. In addition, DeepCRISPR fully automates the identification of sequence and epigenetic features that may affect sgRNA knockout efficacy in a data-driven manner. DeepCRISPR is available at http://www.deepcrispr.net/ .},
}
@article {pmid29943304,
year = {2018},
author = {Yao, J and Dai, HL},
title = {Is Pooled CRISPR-Screening the Dawn of a New Era for Functional Genomics.},
journal = {Advances in experimental medicine and biology},
volume = {1068},
number = {},
pages = {171-176},
doi = {10.1007/978-981-13-0502-3_14},
pmid = {29943304},
issn = {0065-2598},
mesh = {Animals ; CRISPR-Cas Systems ; *Clustered Regularly Interspaced Short Palindromic Repeats ; Genetic Testing/methods/trends ; Genomics/*methods/trends ; Humans ; },
abstract = {Functional genomics aims to develop an in-depth understanding of how specific gene dysfunctions are related to diseases. A common method for investigating the genome and its complex functions is via perturbation of the interactions between the DNA, RNA and their protein respective protein derivatives. Commonly, arrayed and pooled genetic screens are utilized to achieve this and in recent years have been fundamental in achieving the current level of understanding for gene dysfunctions. However, they are limited in specific aspects which scientists have attempted to address. Clustered regularly palindromic repeats (CRISPR)-based methods for genetic screens have in recent years become more prevalent but crucially shared similar properties to previous methods and failing to provide a distinct advantage over previous methods. CROP-seq, Perturb-seq, and CRISPR-seq have combined CRISPR and single-cell RNA-sequencing (scRNA-seq) and is the newest addition to the geneticist's arsenal, providing scientists with methods to edit DNA with improved speed, accuracy, and efficiency which could usher us into a new era of study methods for functional genomics. We briefly overview the CRISPR-Cas9 systems, the evolution of genetic screening in recent years, and evaluate and discuss the significance of CROP-seq, Perturb-seq, and CRISPR-seq.},
}
@article {pmid29940185,
year = {2018},
author = {O'Connell, MR},
title = {Molecular Mechanisms of RNA Targeting by Cas13-containing Type VI CRISPR-Cas Systems.},
journal = {Journal of molecular biology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jmb.2018.06.029},
pmid = {29940185},
issn = {1089-8638},
abstract = {Prokaryotic adaptive immune systems use Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and CRISPR-associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, contain a single protein, Cas13 (formerly C2c2) that when assembled with a CRISPR RNA (crRNA) forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two Higher Eukaryotes and Prokaryotes Nucleotide-binding (HEPN) domains, is required for degradation of target-RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications.},
}
@article {pmid29939173,
year = {2018},
author = {Feng, W and Herbst, L and Lichter, P and Pfister, SM and Liu, HK and Kawauchi, D},
title = {CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {136},
pages = {},
pmid = {29939173},
issn = {1940-087X},
mesh = {Animals ; Brain/*metabolism/pathology ; CRISPR-Cas Systems/*genetics ; Electroporation/*methods ; Gene Transfer Techniques/*instrumentation ; Mice ; Neurons/metabolism ; },
abstract = {Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors of the diseases. To validate the contribution of a dysfunction of the mutated genes to disease development, the generation of animal models carrying the mutations is one obvious approach. While germline genetically engineered mouse models (GEMMs) are popular biological tools and exhibit reproducible results, it is restricted by time and costs. Meanwhile, non-germline GEMMs often enable exploring gene function in a more feasible manner. Since some brain diseases (e.g., brain tumors) appear to result from somatic but not germline mutations, non-germline chimeric mouse models, in which normal and abnormal cells coexist, could be helpful for disease-relevant analysis. In this study, we report a method for the induction of CRISPR-mediated somatic mutations in the cerebellum. Specifically, we utilized conditional knock-in mice, in which Cas9 and GFP are chronically activated by the CAG (CMV enhancer/chicken ß-actin) promoter after Cre-mediated recombination of the genome. The self-designed single-guide RNAs (sgRNAs) and the Cre recombinase sequence, both encoded in a single plasmid construct, were delivered into cerebellar stem/progenitor cells at an embryonic stage using in utero electroporation. Consequently, transfected cells and their daughter cells were labeled with green fluorescent protein (GFP), thus facilitating further phenotypic analyses. Hence, this method is not only showing electroporation-based gene delivery into embryonic cerebellar cells but also proposing a novel quantitative approach to assess CRISPR-mediated loss-of-function phenotypes.},
}
@article {pmid29937759,
year = {2018},
author = {Prihatna, C and Barbetti, MJ and Barker, SJ},
title = {A Novel Tomato Fusarium Wilt Tolerance Gene.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {1226},
pmid = {29937759},
issn = {1664-302X},
abstract = {The reduced mycorrhizal colonization (rmc) tomato mutant is unable to form mycorrhiza and is more susceptible to Fusarium wilt compared with its wild-type isogenic line 76R. The rmc mutant has a chromosomal deletion affecting five genes, one of which is similar to CYCLOPS. Loss of this gene is responsible for non-mycorrhizality in rmc but not enhanced Fusarium wilt susceptibility. Here, we describe assessment of a second gene in the rmc deletion, designated Solyc08g075770 that is expressed in roots. Sequence analyses show that Solyc08g075770 encodes a small transmembrane protein with putative phosphorylation and glycosylation sites. It is predicted to be localized in the plasma membrane and may function in transmembrane ion transport and/or as a cell surface receptor. Complementation and knock-out strategies were used to test its function. Some putative CRISPR/Cas-9 knock-out transgenic events exhibited Fusarium wilt susceptibility like rmc and some putative complementation lines were 76R-like, suggesting that the tomato Solyc08g075770 functions in Fusarium wilt tolerance. This is the first study to demonstrate that Solyc08g075770 is the contributor to the Tfw locus, conferring tolerance to Fusarium wilt in 76R which was lost in rmc.},
}
@article {pmid29937048,
year = {2018},
author = {Huang, CH and Lee, KC and Doudna, JA},
title = {Applications of CRISPR-Cas Enzymes in Cancer Therapeutics and Detection.},
journal = {Trends in cancer},
volume = {4},
number = {7},
pages = {499-512},
doi = {10.1016/j.trecan.2018.05.006},
pmid = {29937048},
issn = {2405-8025},
support = {//Howard Hughes Medical Institute/United States ; },
abstract = {Cancer is a complex disease caused by combinations of cellular genetic alterations and heterogeneous microenvironments. The use of the robust and programmable CRISPR-Cas systems has greatly improved genome editing for precision cancer modeling and enabled multiplexed genetic manipulation for cancer treatment and mutation detection. In this review, we outline the current CRISPR-Cas toolkit, and discuss the promises and hurdles in translating this revolutionary technology into effective and safe clinical applications for cancer treatment and diagnosis.},
}
@article {pmid29937002,
year = {2018},
author = {Nunes Dos Santos, RM and Carneiro D'Albuquerque, LA and Reyes, LM and Estrada, JL and Wang, ZY and Tector, M and Tector, AJ},
title = {CRISPR/Cas and recombinase-based human-to-pig orthotopic gene exchange for xenotransplantation.},
journal = {The Journal of surgical research},
volume = {229},
number = {},
pages = {28-40},
doi = {10.1016/j.jss.2018.03.051},
pmid = {29937002},
issn = {1095-8673},
abstract = {BACKGROUND: Tools for genome editing in pigs are improving rapidly so that making precise cuts in DNA for the purposes of deleting genes is straightforward. Development of means to replace pig genes with human genes with precision is very desirable for the future development of donor pigs for xenotransplantation.<br><br>MATERIALS AND METHODS: We used Cas9 to cut pig thrombomodulin (pTHBD) and replace it with a plasmid containing a promoterless antibiotic selection marker and the exon for human thrombomodulin. PhiC31 recombinase was used to remove the antibiotic selection marker to create porcine aortic endothelial cells expressing human instead of pTHBD, driven by the endogenous pig promoter.<br><br>RESULTS: The promoterless selection cassette permitted efficient enrichment of cells containing correctly inserted transgene. Recombinase treatment of selected cells excised the resistance marker permitting expression of the human transgene by the endogenous pTHBD promoter. Gene regulation was maintained after gene replacement because pig endogenous promoter was kept intact in the correct position.<br><br>CONCLUSIONS: Cas9 and recombinase technology make orthotopic human for pig gene exchange feasible and pave the way for creation of pigs with human genes that can be expressed in the appropriate tissues preserving gene regulation.},
}
@article {pmid29934375,
year = {2018},
author = {Ewen-Campen, B and Perrimon, N},
title = {ovoD Co-selection: A Method for Enriching CRISPR/Cas9-Edited Alleles in Drosophila.},
journal = {G3 (Bethesda, Md.)},
volume = {8},
number = {8},
pages = {2749-2756},
pmid = {29934375},
issn = {2160-1836},
support = {R01 GM084947/GM/NIGMS NIH HHS/United States ; F32 GM113395/GM/NIGMS NIH HHS/United States ; /HHMI/Howard Hughes Medical Institute/United States ; },
mesh = {Alleles ; Animals ; *CRISPR-Cas Systems ; Drosophila/*genetics ; Female ; Gene Editing/methods ; Gene Targeting/*methods ; Oogonia/metabolism ; Phenotype ; *Selection, Genetic ; },
abstract = {Screening for successful CRISPR/Cas9 editing events remains a time consuming technical bottleneck in the field of Drosophila genome editing. This step can be particularly laborious for events that do not cause a visible phenotype, or those which occur at relatively low frequency. A promising strategy to enrich for desired CRISPR events is to co-select for an independent CRISPR event that produces an easily detectable phenotype. Here, we describe a simple negative co-selection strategy involving CRISPR-editing of a dominant female sterile allele, ovoD1 In this system (&quot;ovoD co-selection&quot;), the only functional germ cells in injected females are those that have been edited at the ovoD1 locus, and thus all offspring of these flies have undergone editing of at least one locus. We demonstrate that ovoD co-selection can be used to enrich for knock-out mutagenesis via nonhomologous end-joining (NHEJ), and for knock-in alleles via homology-directed repair (HDR). Altogether, our results demonstrate that ovoD co-selection reduces the amount of screening necessary to isolate desired CRISPR events in Drosophila.},
}
@article {pmid29928285,
year = {2018},
author = {Stukenberg, D and Zauner, S and Dell'Aquila, G and Maier, UG},
title = {Optimizing CRISPR/Cas9 for the Diatom Phaeodactylum tricornutum.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {740},
pmid = {29928285},
issn = {1664-462X},
abstract = {CRISPR/Cas9 is a powerful tool for genome editing. We constructed an easy-to-handle expression vector for application in the model organism Phaeodactylum tricornutum and tested its capabilities in order to apply CRISPR/Cas9 technology for our purpose. In our experiments, we targeted two different genes, screened for mutations and analyzed mutated diatoms in a three-step process. In the end, we identified cells, showing either monoallelic or homo-biallelic targeted mutations. Thus, we confirm that application of the CRISPR/Cas9 system for P. tricornutum is very promising, although, as discussed, overlooked pitfalls have to be considered.},
}
@article {pmid29926763,
year = {2018},
author = {McCaughey, T and Budden, DM and Sanfilippo, PG and Gooden, GEC and Fan, L and Fenwick, E and Rees, G and MacGregor, C and Si, L and Chen, C and Liang, HH and Pébay, A and Baldwin, T and Hewitt, AW},
title = {A Need for Better Understanding Is the Major Determinant for Public Perceptions of Human Gene Editing.},
journal = {Human gene therapy},
volume = {},
number = {},
pages = {},
doi = {10.1089/hum.2018.033},
pmid = {29926763},
issn = {1557-7422},
abstract = {The CRISPR/Cas system could provide an efficient and reliable means of editing the human genome and has the potential to revolutionize modern medicine; however, rapid developments are raising complex ethical issues. There has been significant scientific debate regarding the acceptability of some applications of CRISPR/Cas, with leaders in the field highlighting the need for the lay public's views to shape expert discussion. As such, we sought to determine the factors that influence public opinion on gene editing. We created a 17-item online survey translated into 11 languages and advertised worldwide. Topic modeling was used to analyze textual responses to determine what factors influenced respondents' opinions toward human somatic or embryonic gene editing, and how this varied among respondents with differing attitudes and demographic backgrounds. A total of 3,988 free-text responses were analyzed. Respondents had a mean age of 32 (range, 11-90) years, and 37% were female. The most prevalent topics cited were Future Generations, Research, Human Editing, Children, and Health. Respondents who disagreed with gene editing for health-related purposes were more likely to cite the topic Better Understanding than those who agreed to both somatic and embryonic gene editing. Respondents from Western backgrounds more frequently discussed Future Generations, compared with participants from Eastern countries. Religious respondents did not cite the topic Religious Beliefs more frequently than did nonreligious respondents, whereas Christian respondents were more likely to cite the topic Future Generations. Our results suggest that public resistance to human somatic or embryonic gene editing does not stem from an inherent mistrust of genome modification, but rather a desire for greater understanding. Furthermore, we demonstrate that factors influencing public opinion vary greatly amongst demographic groups. It is crucial that the determinants of public attitudes toward CRISPR/Cas be well understood so that the technology does not suffer the negative public sentiment seen with previous genetic biotechnologies.},
}
@article {pmid29925039,
year = {2018},
author = {Santo, EE and Paik, J},
title = {A splice junction-targeted CRISPR approach (spJCRISPR) reveals human FOXO3B to be a protein-coding gene.},
journal = {Gene},
volume = {673},
number = {},
pages = {95-101},
pmid = {29925039},
issn = {1879-0038},
support = {R01 AG048284/AG/NIA NIH HHS/United States ; R01 CA219957/CA/NCI NIH HHS/United States ; },
mesh = {Alternative Splicing ; *CRISPR-Cas Systems ; Cloning, Molecular ; Cytosol/metabolism ; Deoxyribonuclease I/metabolism ; Embryonic Stem Cells/cytology ; Forkhead Box Protein O3/*genetics ; Gene Editing ; Gene Expression Regulation ; Genetic Techniques ; HEK293 Cells ; Humans ; Mutation ; Myoblasts/metabolism ; Phosphorylation ; Proto-Oncogene Proteins c-akt/genetics ; RNA, Guide/genetics ; RNA, Small Interfering/metabolism ; },
abstract = {The rapid development of CRISPR technology is revolutionizing molecular approaches to the dissection of complex biological phenomena. Here we describe an alternative generally applicable implementation of the CRISPR-Cas9 system that allows for selective knockdown of extremely homologous genes. This strategy employs the lentiviral delivery of paired sgRNAs and nickase Cas9 (Cas9D10A) to achieve targeted deletion of splice junctions. This general strategy offers several advantages over standard single-guide exon-targeting CRISPR-Cas9 such as greatly reduced off-target effects, more restricted genomic editing, routine disruption of target gene mRNA expression and the ability to differentiate between closely related genes. Here we demonstrate the utility of this strategy by achieving selective knockdown of the highly homologous human genes FOXO3A and suspected pseudogene FOXO3B. We find the spJCRISPR strategy to efficiently and selectively disrupt FOXO3A and FOXO3B mRNA and protein expression; thus revealing that the human FOXO3B locus encodes a bona fide human gene. Unlike FOXO3A, we find the FOXO3B protein to be cytosolically localized in both the presence and absence of active Akt. The ability to selectively target and efficiently disrupt the expression of the closely-related FOXO3A and FOXO3B genes demonstrates the efficacy of the spJCRISPR approach.},
}
@article {pmid29924860,
year = {2018},
author = {Kweon, J and Kim, DE and Jang, AH and Kim, Y},
title = {CRISPR/Cas-based customization of pooled CRISPR libraries.},
journal = {PloS one},
volume = {13},
number = {6},
pages = {e0199473},
pmid = {29924860},
issn = {1932-6203},
abstract = {Pooled CRISPR libraries are widely used in high-throughput screening to study various biological processes. Various pooled CRISPR libraries have been shared for CRISPR screens and useful tools have been developed to construct researcher's own libraries, however, many researchers are struggling to create their own pooled CRISPR libraries: it is a time-consuming, labor-intensive, and expensive process. In this study, we develop a simple method to customize conventional pooled CRISPR libraries using the CRISPR/Cas9 system. We show that conventional pooled CRISPR libraries can be modified by eliminating gRNAs that target positive genes, enabling the identification of unknown target genes in CRISPR screening. CRISPR/Cas9 system can be applied as a precise tool for customizing conventional pooled CRISPR libraries and will broaden the scope of high-throughput screening technology.},
}
@article {pmid29923454,
year = {2018},
author = {Yair, Y and Gophna, U},
title = {Repeat modularity as a beneficial property of multiple CRISPR-Cas systems.},
journal = {RNA biology},
volume = {},
number = {},
pages = {1-3},
doi = {10.1080/15476286.2018.1474073},
pmid = {29923454},
issn = {1555-8584},
abstract = {CRISPR-Cas systems are a highly effective immune mechanism for prokaryotes, providing defense against invading foreign DNA. By definition, all CRISPR-Cas systems have short repeats interspersing their spacers. These repeats play a key role in preventing cleavage of self DNA and in the integration of new spacers. Here we focus on the phenomenon of repeat modularity, namely the unexpectedly high degree of repeat conservation across different systems within a genome or between different species. We hypothesize that modularity can be beneficial for CRISPR-Cas containing organisms, because it facilitates horizontal acquisition of 'pre-immunized' CRISPR arrays and allows the utilization of spacers acquired by one system for use by other systems within the same cell.},
}
@article {pmid29921752,
year = {2018},
author = {Hatoum-Aslan, A},
title = {Phage Genetic Engineering Using CRISPR⁻Cas Systems.},
journal = {Viruses},
volume = {10},
number = {6},
pages = {},
pmid = {29921752},
issn = {1999-4915},
support = {K22 AI113106/AI/NIAID NIH HHS/United States ; },
mesh = {Archaea/virology ; Bacteria/virology ; Bacteriophages/*genetics ; *CRISPR-Cas Systems ; Genetic Engineering/*methods ; },
abstract = {Since their discovery over a decade ago, the class of prokaryotic immune systems known as CRISPR⁻Cas have afforded a suite of genetic tools that have revolutionized research in model organisms spanning all domains of life. CRISPR-mediated tools have also emerged for the natural targets of CRISPR⁻Cas immunity, the viruses that specifically infect bacteria, or phages. Despite their status as the most abundant biological entities on the planet, the majority of phage genes have unassigned functions. This reality underscores the need for robust genetic tools to study them. Recent reports have demonstrated that CRISPR⁻Cas systems, specifically the three major types (I, II, and III), can be harnessed to genetically engineer phages that infect diverse hosts. Here, the mechanisms of each of these systems, specific strategies used, and phage editing efficacies will be reviewed. Due to the relatively wide distribution of CRISPR⁻Cas systems across bacteria and archaea, it is anticipated that these immune systems will provide generally applicable tools that will advance the mechanistic understanding of prokaryotic viruses and accelerate the development of novel technologies based on these ubiquitous organisms.},
}
@article {pmid29921414,
year = {2018},
author = {Jo, DH and Kim, JH},
title = {Application of genome engineering for treatment of retinal diseases.},
journal = {BMB reports},
volume = {51},
number = {7},
pages = {315-316},
pmid = {29921414},
issn = {1976-670X},
mesh = {Animals ; Bacterial Proteins/genetics/metabolism ; CRISPR-Cas Systems/genetics ; Endonucleases/genetics/metabolism ; *Gene Editing ; Humans ; Hypoxia-Inducible Factor 1, alpha Subunit/genetics/metabolism ; RNA, Guide/genetics/metabolism ; Retinal Diseases/genetics/*therapy ; Vascular Endothelial Growth Factor A/chemistry/metabolism ; },
abstract = {Genome engineering with clustered regularly interspaced short palindromic repeats (CRISPR) system can be used as a tool to correct pathological mutations or modulate gene expression levels associated with pathogenesis of human diseases. Owing to well-established local administration methods including intravitreal and subretinal injection, it is relatively easy to administer therapeutic genome engineering machinery to ocular tissues for treating retinal diseases. In this context, we have investigated the potential of in vivo genome engineering as a therapeutic approach in the form of ribonucleoprotein or CRISPR packaged in viral vectors. Major issues in therapeutic application of genome engineering include specificity and efficacy according to types of CRISPR system. In addition to previous platforms based on ribonucleoprotein and CRISPRassociated protein 9 derived from Campylobacter jejuni, we evaluated the therapeutic effects of a CRISPR RNA-guided endonuclease derived from Lachnospiraceae bacterium ND2006 (LbCpf1) in regulating pathological angiogenesis in an animal model of wet-type age-related macular degeneration. LbCpf1 targeting Vegfa or Hif1a effectively disrupted the expression of genes in ocular tissues, resulting in suppression of choroidal neovascularization. It was also notable that there were no significant off-target effects in vivo. [BMB Reports 2018; 51(7): 315-316].},
}
@article {pmid29917318,
year = {2018},
author = {Tarasava, K and Oh, EJ and Eckert, CA and Gill, RT},
title = {CRISPR-Enabled Tools for Engineering Microbial Genomes and Phenotypes.},
journal = {Biotechnology journal},
volume = {13},
number = {9},
pages = {e1700586},
doi = {10.1002/biot.201700586},
pmid = {29917318},
issn = {1860-7314},
support = {//US Department of Energy Office of Science Biological and Environmental Research Program/ ; },
mesh = {CRISPR-Cas Systems/*genetics ; Escherichia coli/genetics/metabolism ; Gene Editing/*methods ; Genome, Microbial/*genetics ; Phenotype ; Saccharomyces cerevisiae/genetics/metabolism ; },
abstract = {In recent years CRISPR-Cas technologies have revolutionized microbial engineering approaches. Genome editing and non-editing applications of various CRISPR-Cas systems have expanded the throughput and scale of engineering efforts, as well as opened up new avenues for manipulating genomes of non-model organisms. As we expand the range of organisms used for biotechnological applications, we need to develop better, more versatile tools for manipulation of these systems. Here the authors summarize the current advances in microbial gene editing using CRISPR-Cas based tools and highlight state-of-the-art methods for high-throughput, efficient genome-scale engineering in model organisms Escherichia coli and Saccharomyces cerevisiae. The authors also review non-editing CRISPR-Cas applications available for gene expression manipulation, epigenetic remodeling, RNA editing, labeling, and synthetic gene circuit design. Finally, the authors point out the areas of research that need further development in order to expand the range of applications and increase the utility of these new methods.},
}
@article {pmid29917197,
year = {2018},
author = {Bakhrebah, MA and Nassar, MS and Alsuabeyl, MS and Zaher, WA and Meo, SA},
title = {CRISPR technology: new paradigm to target the infectious disease pathogens.},
journal = {European review for medical and pharmacological sciences},
volume = {22},
number = {11},
pages = {3448-3452},
doi = {10.26355/eurrev_201806_15169},
pmid = {29917197},
issn = {2284-0729},
abstract = {OBJECTIVE: Infectious diseases are one of the prime causes of death worldwide. An innovative sequence specific editing technology &quot;Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)&quot; has been tested on a broad range of microorganisms to target and destroy invading foreign DNA to human cells or tissues. This study aimed to discuss the mechanism and therapeutic usage of CRISPR/Cas9 genome editing technology in the management of various infectious disease pathogens.<br><br>MATERIALS AND METHODS: We conducted a broad search of the English-language literature in &quot;PubMed&quot; using the search terms &quot;CRISPR&quot;, &quot;Cas-9&quot;, &quot;Genome editing&quot;, &quot;Gene therapy&quot;, &quot;infectious disease pathogens&quot;. All the articles were reviewed and required information was recorded.<br><br>RESULTS: CRISPR technology is used to modify and modulate the gene expression in biomedical research and therapeutic development. This technology facilitates the understanding of fundamental biology and broadens the horizon of treatments of germ-laden conditions.<br><br>CONCLUSIONS: The applications of CRISPR technology are widely established in the diagnosis and treatment of various bacterial, viral, fungal and parasitic infectious diseases. CRISPR technology is a simple, efficient and tested on a broad range of microorganisms to rectify disease-associated genetic defects and destroy invading foreign DNA to human cells or tissues.},
}
@article {pmid29915899,
year = {2018},
author = {Miao, Z and Li, Q and Zhao, J and Wang, P and Wang, L and He, HP and Wang, N and Zhou, H and Zhang, TC and Luo, XG},
title = {Stable expression of infliximab in CRISPR/Cas9-mediated BAK1-deficient CHO cells.},
journal = {Biotechnology letters},
volume = {},
number = {},
pages = {},
doi = {10.1007/s10529-018-2578-4},
pmid = {29915899},
issn = {1573-6776},
support = {NO. 14CZDSY0005//Tianjin Science and Technology Support Program/ ; },
abstract = {OBJECTIVES: To establish stable infliximab-expressing Chinese hamster ovary (CHO) cells with high tolerance to serum-free culture.<br><br>RESULTS: Bcl-2 antagonist/killer 1 (BAK1), which is a key mediator of the apoptosis pathway, was disrupted, and infliximab, which is a broadly used monoclonal antibody for the treatment of rheumatoid arthritis and other autoimmune diseases, was incorporated into the BAK1 locus of the CHO chromosome using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas genome-editing technique. The activating effects of serum starvation on BAK1 and cytochrome C (CytC) were suppressed in the genome-edited cells, and the ability of the cells to resist the serum starvation-induced loss of mitochondrial membrane potential and apoptosis was increased, as indicated by the results of polymerase chain reaction (PCR), flow cytometry, enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC) analysis. In addition, during subsequent passages, infliximab could be stably produced in the genome-edited CHO cells, and the recombinant antibody could effectively antagonize the cytotoxic effect of tumor necrosis factor α (TNFα).<br><br>CONCLUSIONS: A CHO cell line capable of stably expressing infliximab and adapting to serum-free culture was constructed. This work lays the foundation for the development of infliximab biosimilars.},
}
@article {pmid29915307,
year = {2018},
author = {Crispim, JS and Dias, RS and Vidigal, PMP and de Sousa, MP and da Silva, CC and Santana, MF and de Paula, SO},
title = {Screening and characterization of prophages in Desulfovibrio genomes.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {9273},
pmid = {29915307},
issn = {2045-2322},
abstract = {Bacteria of the genus Desulfovibrio belong to the group of Sulphate Reducing Bacteria (SRB). SRB generate significant liabilities in the petroleum industry, mainly due to their ability to microbiologically induce corrosion, biofilm formation and H2S production. Bacteriophages are an alternative control method for SRB, whose information for this group of bacteria however, is scarce. The present study developed a workflow for the identification of complete prophages in Desulfovibrio. Poly-lysogenesis was shown to be common in Desulfovibrio. In the 47 genomes analyzed 53 complete prophages were identified. These were classified within the order Caudovirales, with 69.82% belonging to the Myoviridade family. More than half the prophages identified have genes coding for lysozyme or holin. Four of the analyzed bacterial genomes present prophages with identity above 50% in the same strain, whose comparative analysis demonstrated the existence of colinearity between the sequences. Of the 17 closed bacterial genomes analyzed, 6 have the CRISPR-Cas system classified as inactive. The identification of bacterial poly-lysogeny, the proximity between the complete prophages and the possible inactivity of the CRISPR-Cas in closed bacterial genomes analyzed allowed the choice of poly-lysogenic strains with prophages belonging to the Myoviridae family for the isolation of prophages and testing of related strains for subsequent studies.},
}
@article {pmid29915237,
year = {2018},
author = {Wu, WY and Lebbink, JHG and Kanaar, R and Geijsen, N and van der Oost, J},
title = {Genome editing by natural and engineered CRISPR-associated nucleases.},
journal = {Nature chemical biology},
volume = {14},
number = {7},
pages = {642-651},
doi = {10.1038/s41589-018-0080-x},
pmid = {29915237},
issn = {1552-4469},
abstract = {Over the last decade, research on distinct types of CRISPR systems has revealed many structural and functional variations. Recently, several novel types of single-polypeptide CRISPR-associated systems have been discovered including Cas12a/Cpf1 and Cas13a/C2c2. Despite distant similarities to Cas9, these additional systems have unique structural and functional features, providing new opportunities for genome editing applications. Here, relevant fundamental features of natural and engineered CRISPR-Cas variants are compared. Moreover, practical matters are discussed that are essential for dedicated genome editing applications, including nuclease regulation and delivery, target specificity, as well as host repair diversity.},
}
@article {pmid29914939,
year = {2018},
author = {Jokl, EJ and Hughes, GL and Cracknell, T and Pownall, ME and Blanco, G},
title = {Transcriptional upregulation of Bag3, a chaperone-assisted selective autophagy factor, in animal models of KY-deficient hereditary myopathy.},
journal = {Disease models &amp; mechanisms},
volume = {11},
number = {7},
pages = {},
pmid = {29914939},
issn = {1754-8411},
support = {//Wellcome Trust/United Kingdom ; BB/J014443/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; 204829//Wellcome Trust/United Kingdom ; },
mesh = {Adaptor Proteins, Signal Transducing/*genetics/metabolism ; Animals ; Apoptosis Regulatory Proteins/*genetics/metabolism ; *Autophagy ; Base Sequence ; CRISPR-Cas Systems/genetics ; Cell Differentiation ; Cell Line ; Disease Models, Animal ; Filamins/metabolism ; Gene Editing ; Mechanotransduction, Cellular ; Mice, Knockout ; Muscle Fibers, Skeletal/metabolism/pathology ; Muscle Proteins/*deficiency/metabolism ; Muscular Diseases/*genetics/*pathology ; Mutagenesis/genetics ; Transcription, Genetic ; Up-Regulation/*genetics ; Zebrafish ; Zebrafish Proteins/*deficiency/genetics/metabolism ; },
abstract = {The importance of kyphoscoliosis peptidase (KY) in skeletal muscle physiology has recently been emphasised by the identification of novel human myopathies associated with KY deficiency. Neither the pathogenic mechanism of KY deficiency nor a specific role for KY in muscle function have been established. However, aberrant localisation of filamin C (FLNC) in muscle fibres has been shown in humans and mice with loss-of-function mutations in the KY gene. FLNC turnover has been proposed to be controlled by chaperone-assisted selective autophagy (CASA), a client-specific and tension-induced pathway that is required for muscle maintenance. Here, we have generated new C2C12 myoblast and zebrafish models of KY deficiency by CRISPR/Cas9 mutagenesis. To obtain insights into the pathogenic mechanism caused by KY deficiency, expression of the co-chaperone BAG3 and other CASA factors was analyzed in the cellular, zebrafish and ky/ky mouse models. Ky-deficient C2C12-derived clones show trends of higher transcription of CASA factors in differentiated myotubes. The ky-deficient zebrafish model (kyyo1/kyyo1) lacks overt signs of pathology, but shows significantly increased bag3 and flnca/b expression in embryos and adult muscle. Additionally, kyyo1/kyyo1 embryos challenged by swimming in viscous media show an inability to further increase expression of these factors in contrast with wild-type controls. The ky/ky mouse shows elevated expression of Bag3 in the non-pathological exterior digitorum longus (EDL) and evidence of impaired BAG3 turnover in the pathological soleus. Thus, upregulation of CASA factors appears to be an early and primary molecular hallmark of KY deficiency.},
}
@article {pmid29914921,
year = {2018},
author = {Ma, N and Zhang, JZ and Itzhaki, I and Zhang, SL and Chen, H and Haddad, F and Kitani, T and Wilson, KD and Tian, L and Shrestha, R and Wu, H and Lam, CK and Sayed, N and Wu, JC},
title = {Determining the Pathogenicity of a Genomic Variant of Uncertain Significance Using CRISPR/Cas9 and Human-Induced Pluripotent Stem Cells.},
journal = {Circulation},
volume = {138},
number = {23},
pages = {2666-2681},
doi = {10.1161/CIRCULATIONAHA.117.032273},
pmid = {29914921},
issn = {1524-4539},
support = {R01 HL113006/HL/NHLBI NIH HHS/United States ; R01 HL130020/HL/NHLBI NIH HHS/United States ; K08 HL119251/HL/NHLBI NIH HHS/United States ; K01 HL135455/HL/NHLBI NIH HHS/United States ; R01 HL141371/HL/NHLBI NIH HHS/United States ; R01 HL126527/HL/NHLBI NIH HHS/United States ; },
abstract = {BACKGROUND: The progression toward low-cost and rapid next-generation sequencing has uncovered a multitude of variants of uncertain significance (VUS) in both patients and asymptomatic &quot;healthy&quot; individuals. A VUS is a rare or novel variant for which disease pathogenicity has not been conclusively demonstrated or excluded, and thus cannot be definitively annotated. VUS, therefore, pose critical clinical interpretation and risk-assessment challenges, and new methods are urgently needed to better characterize their pathogenicity.<br><br>METHODS: To address this challenge and showcase the uncertainty surrounding genomic variant interpretation, we recruited a &quot;healthy&quot; asymptomatic individual, lacking cardiac-disease clinical history, carrying a hypertrophic cardiomyopathy (HCM)-associated genetic variant (NM_000258.2:c.170C>A, NP_000249.1:p.Ala57Asp) in the sarcomeric gene MYL3, reported by the ClinVar database to be &quot;likely pathogenic.&quot; Human-induced pluripotent stem cells (iPSCs) were derived from the heterozygous VUS MYL3(170C>A) carrier, and their genome was edited using CRISPR/Cas9 to generate 4 isogenic iPSC lines: (1) corrected &quot;healthy&quot; control; (2) homozygous VUS MYL3(170C>A); (3) heterozygous frameshift mutation MYL3(170C>A/fs); and (4) known heterozygous MYL3 pathogenic mutation (NM_000258.2:c.170C>G), at the same nucleotide position as VUS MYL3(170C>A), lines. Extensive assays including measurements of gene expression, sarcomere structure, cell size, contractility, action potentials, and calcium handling were performed on the isogenic iPSC-derived cardiomyocytes (iPSC-CMs).<br><br>RESULTS: The heterozygous VUS MYL3(170C>A)-iPSC-CMs did not show an HCM phenotype at the gene expression, morphology, or functional levels. Furthermore, genome-edited homozygous VUS MYL3(170C>A)- and frameshift mutation MYL3(170C>A/fs)-iPSC-CMs lines were also asymptomatic, supporting a benign assessment for this particular MYL3 variant. Further assessment of the pathogenic nature of a genome-edited isogenic line carrying a known pathogenic MYL3 mutation, MYL3(170C>G), and a carrier-specific iPSC-CMs line, carrying a MYBPC3(961G>A) HCM variant, demonstrated the ability of this combined platform to provide both pathogenic and benign assessments.<br><br>CONCLUSIONS: Our study illustrates the ability of clustered regularly interspaced short palindromic repeats/Cas9 genome-editing of carrier-specific iPSCs to elucidate both benign and pathogenic HCM functional phenotypes in a carrier-specific manner in a dish. As such, this platform represents a promising VUS risk-assessment tool that can be used for assessing HCM-associated VUS specifically, and VUS in general, and thus significantly contribute to the arsenal of precision medicine tools available in this emerging field.},
}
@article {pmid29914884,
year = {2018},
author = {Wells, DJ},
title = {Tracking progress: an update on animal models for Duchenne muscular dystrophy.},
journal = {Disease models &amp; mechanisms},
volume = {11},
number = {6},
pages = {},
pmid = {29914884},
issn = {1754-8411},
mesh = {Animals ; CRISPR-Cas Systems/genetics ; *Disease Models, Animal ; Muscular Dystrophy, Duchenne/genetics/*pathology ; Mutation/genetics ; Translational Medical Research ; },
abstract = {Duchenne muscular dystrophy (DMD) is a progressive, fatal, X-linked monogenic muscle disorder caused by mutations in the DMD gene. In order to test treatments for DMD, a range of natural and engineered animal models have been developed, including mice, rats, dogs and pigs. Sui and colleagues have now added a dystrophic rabbit model to this range using CRISPR/Cas9 to disrupt exon 51 of DMD Rabbits have the advantage of being easier to breed and less costly than dog or pig models, but having clear clinical signs, in contrast to many mouse models. There appears to be an effect of body size in models of DMD, as the severity of the clinical signs increases with increasing body size across species. All DMD models have advantages and disadvantages, and it is crucial that investigators understand the limitations of each model when testing novel therapies for DMD in pre-clinical studies.},
}
@article {pmid29914659,
year = {2018},
author = {Forsythe, S},
title = {Microbial Source Tracking of Cronobacter spp.},
journal = {Advances in applied microbiology},
volume = {103},
number = {},
pages = {49-101},
doi = {10.1016/bs.aambs.2018.01.004},
pmid = {29914659},
issn = {0065-2164},
abstract = {Being able to track bacterial pathogens is essential for epidemiological purposes as well as monitoring in-house production facilities. Common bacterial pathogens, such as Salmonella serovars, are already been well defined, and their detection methods are very advanced. However, this will not be the case for emergent bacterial pathogens, as was the case for Cronobacter. The clinical significance of the organism is due to its association with rare sporadic infections in adults, and severe life-threatening outbreaks of necrotizing enterocolitis and meningitis in newborn babies. The main recognized route of infection being through t