@article {pmid30775165,
year = {2019},
author = {Morim, T and Bigg, GR and Madeira, PM and Palma, J and Duvernell, DD and Gisbert, E and Cunha, RL and Castilho, R},
title = {Invasion genetics of the mummichog (Fundulus heteroclitus): recent anthropogenic introduction in Iberia.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6155},
doi = {10.7717/peerj.6155},
pmid = {30775165},
issn = {2167-8359},
abstract = {Human activities such as trade and transport have increased considerably in the last decades, greatly facilitating the introduction and spread of non-native species at a global level. In the Iberian Peninsula, Fundulus heteroclitus, a small euryhaline coastal fish with short dispersal, was found for the first time in the mid-1970s. Since then, F. heteroclitus has undergone range expansions, colonizing the southern region of Portugal, southwestern coast of Spain and the Ebro Delta in the Mediterranean Sea. Cytochrome b sequences were used to elucidate the species invasion pathway in Iberia. Three Iberian locations (Faro, Cádiz and Ebro Delta) and 13 other locations along the native range of F. heteroclitus in North America were sampled. Results revealed a single haplotype, common to all invasive populations, which can be traced to the northern region of the species' native range. We posit that the origin of the founder individuals is between New York and Nova Scotia. Additionally, the lack of genetic structure within Iberia is consistent with a recent invasion scenario and a strong founder effect. We suggest the most probable introduction vector is associated with the aquarium trade. We further discuss the hypothesis of a second human-mediated introduction responsible for the establishment of individuals in the Ebro Delta supported by the absence of adequate muddy habitats linking Cádiz and the Ebro Delta. Although the species has a high tolerance to salinity and temperature, ecological niche modelling indicates that benthic habitat constraints prevent along-shore colonisation suggesting that such expansions would need to be aided by human release.},
}
@article {pmid30772710,
year = {2019},
author = {Zhang, KM and Shen, Y and Yang, J and Miu, X and Bhowmik, PC and Zhou, X and Fang, YM and Xing, BS},
title = {The defense system for Bidens pilosa root exudate treatments in Pteris multifida gametophyte.},
journal = {Ecotoxicology and environmental safety},
volume = {173},
number = {},
pages = {203-213},
doi = {10.1016/j.ecoenv.2019.01.097},
pmid = {30772710},
issn = {1090-2414},
abstract = {According to the novel weapons hypothesis, root exudates are the inhibition factors for native species growth and development through invasive plants. It is hypothesized that antioxidant system (AOS) presents an effective role in plant defense system. The allelopathy indexes of P. multifida gametophyte biomass and sporogonium conversions rates turn negative with the dose and time effects, and the synthetical allelopathic effect index was -55.07% at 100% treatments under root exudates treatments. Under transmission electron microscopy, the cell structures turn burry. Next, AOS and programmed cell death (PCD) were tested in this study. In AOS, strong activities of superoxide dismutase, catalase, glutathione reductase and glutathione S-transferase (GST) were identified in gametophyte cells under the treatments, as well as the contents of glutathione, ascorbic acid and reduced ascorbate, while GPX activity decreased. Based on the input (SOD activity) and the output (GST activity) of antioxidant system, and the decreasing system control would be a reason leading gametophyte death under root exudates. At day 10, PCD would get its peak of 46.93% at 100% root exudates. We found a dynamic balance of PCD and AOS under the exudates treatments. We detected hexadecanoic acid, ethylene glycol and undecane are three major chemicals in root exudates. Our results provide a reference of AOS and PCD working under root exudates treatments in plants and offer novel strategy for the native species protection and invasion plants control in environment science.},
}
@article {pmid30772562,
year = {2019},
author = {Sousa, R and Nogueira, JG and Ferreira, A and Carvalho, F and Lopes-Lima, M and Varandas, S and Teixeira, A},
title = {A tale of shells and claws: The signal crayfish as a threat to the pearl mussel Margaritifera margaritifera in Europe.},
journal = {The Science of the total environment},
volume = {665},
number = {},
pages = {329-337},
doi = {10.1016/j.scitotenv.2019.02.094},
pmid = {30772562},
issn = {1879-1026},
abstract = {The freshwater pearl mussel Margaritifera margaritifera is a highly threatened species in Europe. Several mechanisms may be responsible for the decline in distribution and abundance of European pearl mussel populations, but almost no quantitative data exists about the possible negative impacts of invasive alien species (IAS). In this study, we clearly demonstrate that the invasive signal crayfish Pacifastacus leniusculus predates pearl mussels, using a laboratorial experiment followed by in situ validation in four rivers in the North of Portugal (Mente, Rabaçal, Tuela and Baceiro Rivers; Douro Basin). In the laboratory, the crayfish had a clear preference for small-sized pearl mussels but no differences in predation were found in mesocosms with and without sediment. In addition, we clearly demonstrated that the signal crayfish predates pearl mussels in natural conditions and detected a significant density dependent effect (i.e., sites with more crayfish presented higher number of pearl mussel shells with marks of predation). Given the recent introduction of the signal crayfish and the potential negative impacts on pearl mussel populations we also investigated its autoecology (distribution, abundance, size structure and sex-ratio) in the four studied rivers. Significant differences in average abundance and size of the crayfish were detected between sites and the sex-ratio was highly skewed to females. In view of the widespread distribution of signal crayfish (and other invasive crayfish species) in Europe, future management actions devoted to the conservation of pearl mussels should take in consideration the possible negative effects of these predators, especially on juveniles.},
}
@article {pmid30770146,
year = {2018},
author = {Wilkie, MP and Hubert, TD and Boogaard, MA and Birceanu, O},
title = {Control of invasive sea lampreys using the piscicides TFM and niclosamide: Toxicology, successes & future prospects.},
journal = {Aquatic toxicology (Amsterdam, Netherlands)},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.aquatox.2018.12.012},
pmid = {30770146},
issn = {1879-1514},
abstract = {The invasion of the Laurentian Great Lakes of North America by sea lampreys (Petromyzon marinus) in the early 20th century contributed to the depletion of commercial, recreational and culturally important fish populations, devastating the economies of communities that relied on the fishery. Sea lamprey populations were subsequently controlled using an aggressive integrated pest-management program which employed barriers and traps to prevent sea lamprey from migrating to their spawning grounds and the use of the piscicides (lampricides) 3-trifluoromethyl-4-nitrophenol (TFM) and niclosamide to eliminate larval sea lampreys from their nursery streams. Although sea lampreys have not been eradicated from the Great Lakes, populations have been suppressed to less than 10% of their peak numbers in the mid-1900s. The ongoing use of lampricides provides the foundation for sea lamprey control in the Great Lakes, one of the most successful invasive species control programs in the world. Yet, significant gaps remain in our understanding of how lampricides are taken-up and handled by sea lampreys, how lampricides exert their toxic effects, and how they adversely affect non-target invertebrate and vertebrates species. In this review we examine what has been learned about the uptake, handling and elimination, and the mode of TFM and niclosamide toxicity in lampreys and in non-target animals, particularly in the last 10 years. It is now clear that the mode of TFM toxicity is the same in non-target fishes and lampreys, in which TFM interferes with oxidative phosphorylation by the mitochondria leading to decreased ATP production. Vulnerability to TFM is related to abiotic factors such as water pH and alkalinity, which we propose changes the relative amounts of the bioavailable un-ionized form of TFM in the gill microenvironment. Niclosamide, which is also a molluscicide used to control snails in areas prone to schistosomiasis infections of humans, also likely works by uncoupling oxidative phosphorylation, but less is known about other aspects of its toxicology. The effects of TFM include reductions in energy stores, particularly glycogen and high energy phosphagens. However, non-target fishes readily recover from sub-lethal TFM exposure as demonstrated by the rapid restoration of energy stores and clearance of TFM. Although both TFM and niclosamide are non-persistent in the environment and critical for sea lamprey control, increasing public and institutional concerns about pesticides in the environment makes it imperative to explore other means of sea lamprey control. Accordingly, we also address possible "next-generation" strategies of sea lamprey control including genetic tools such as RNA interference and CRISPR-Cas9 to impair critical physiological processes (e.g. reproduction, digestion, metamorphosis) in lamprey, and the use of green chemistry to develop more environmentally benign chemical methods of sea lamprey control.},
}
@article {pmid30764311,
year = {2008},
author = {Caesar, AJ and Lartey, RT},
title = {First Report of Crown Gall Caused by Agrobacterium tumefaciens on Euphorbia esula/virgata in Europe.},
journal = {Plant disease},
volume = {92},
number = {12},
pages = {1710},
doi = {10.1094/PDIS-92-12-1710A},
pmid = {30764311},
issn = {0191-2917},
abstract = {Hypertrophy and hyperplasia resembling crown galls were found on roots of Euphorbia esula/virgata at a single site in east-central Hungary in 2005. E. esula/virgata, known as leafy spurge in North America, is an invasive species causing substantial economic losses to the value of grazing lands in the Northern Great Plains of the United States and is the target of biological control. E. esula/virgata is widely distributed throughout Eurasia and is found on ditch banks, along roadsides, and in other noncultivated areas in its native range. Large galls on roots resembling crown gall were first noted in 1992 on plants collected for phylogenetic studies from three locations in east-central Hungary. One of these sites was relocated during a 2005 survey and galls were collected from infected plants. Galls were diced and incubated overnight in tubes containing 3 ml of sterile water at room temperature (20 to 25°C). The supernatant was streaked onto plates of potato dextrose agar (PDA), medium 1A, medium 2E, and Roy/Sasser medium. After 7 days, colonies were picked and streaked and subsequently purified on PDA. Of 104 isolates used to inoculate three sunflower plants each (by puncturing roots just below the soil line with a sterile dissecting needle holding a drop of fluid matrix containing bacterial cells), 35 caused galls. Thirty-three isolates were randomly selected from the 104 and used to inoculate three tomato plants each at the soil line. Seventeen caused galls, including two isolates that did not cause galls on sunflower. Finally, none of 20 randomly selected isolates caused galls on kalanchoe plants (Kalanchoe blossfeldiana). Three isolates, which formed the largest galls on sunflower, were used to inoculate five plants of E. esula/virgata growing in a 1:1:1 (peat/sand/Bozeman silt loam) potting mix. The tests were repeated. Galls were visible on inoculated plants within 6 weeks. Diagnostic biochemical tests done prior to and after reisolation indicated that the causal agent was Agrobacterium tumefaciens, which differed from A. rhizogenes in the production of alkali from litmus milk, a positive reaction for the ferric ammonium citrate and 3-ketolactose tests, and negative reactions for tests to detect the production of acid from erythritol and alkali from malonic, l-tartaric, and mucic acid. The three isolates of A. tumefaciens from E. esula/virgata had identical sequences and clustered most closely (99.8 to 99.9% similarity) with five isolates of A. tumefaciens from Tibet and Japan on the basis of cluster analysis using 16S rRNA sequences. Crown gall of E. esula/virgata has also been found in Montana and western North Dakota, and isolates were identified as A. tumefaciens biovars 1 and 2 (1) (the latter is now known as A. rhizogenes). To our knowledge, this the first report of crown gall on E. esula/virgata in Europe. Reference: (1) A. J. Caesar. Plant Dis. 78:796, 1994.},
}
@article {pmid30764194,
year = {2009},
author = {Wood, AR and den Breeÿen, A and Beed, F},
title = {First Report of Smut on Imperata cylindrica Caused by Sporisorium schweinfurthianum in South Africa.},
journal = {Plant disease},
volume = {93},
number = {3},
pages = {322},
doi = {10.1094/PDIS-93-3-0322A},
pmid = {30764194},
issn = {0191-2917},
abstract = {Imperata cylindrica (L.) Raeusch. (Poaceae) is indigenous to the old world but is a problem weed in tropical areas throughout the world (1). A smut fungus was observed frequently on this grass at a single site near Pretoria (25°44'19″S, 28°15'39″E), South Africa during April of 2006. On the basis of the following characteristics, it was identified as Sporisorium schweinfurthianum (Thüm.) K. Vánky (2). Panicles were systemically infected and all ovaries in infected inflorescences were replaced by spores. Spores were globose or subglobose, brown, 10 to 14 × 9 to 12 μm (average 11.2 × 9.8 μm; n = 25), wall 1 μm thick, and finely verruculose. Hyaline, thin-walled sterile cells were present. This identification was confirmed by K. Vánky (personal communication to A. R. Wood). To our knowledge, this is the first report of this smut species from southern Africa. A voucher specimen has been deposited in the South African National Collection of Fungi, ARC-Plant Protection Research Institute (PREM 59895). To test pathogenicity, soil in 15 pots with individual 1-month-old seedlings was drenched with an aqueous suspension of 1 × 108 spores ml-1 amended with 0.1% Tween 80. Before treatment, the pots were placed on pot trays and remained immersed in the spore suspension in the trays at 28°C (relative humidity <80%) for 24 h. To maintain the spore concentration in the soil, the pots were not watered until 7 days after inoculation. Distilled water amended with 0.1% Tween 80 was applied as control treatments to a further 15 pots with plants. Five of the treated plants produced panicles within 4 months of inoculation. Of these, all the ovaries of four emerging inflorescences were completely replaced with a brown, powdery mass of teliospores. No smutted panicles developed on the control plants. This smut fungus may have potential as a classical biological control agent for use against I. cylindrica by reducing dispersal by seed. References: (1) L. G. Holm et al. The World's Worst Weeds: Distribution and Biology. University Press of Hawaii. Honolulu, 1977. (2) K. Vánky. Australas. Plant Pathol. 29:155, 2000.},
}
@article {pmid30767891,
year = {2019},
author = {Prowse, TA and Adikusuma, F and Cassey, P and Thomas, P and Ross, JV},
title = {A Y-chromosome shredding gene drive for controlling pest vertebrate populations.},
journal = {eLife},
volume = {8},
number = {},
pages = {},
doi = {10.7554/eLife.41873},
pmid = {30767891},
issn = {2050-084X},
abstract = {Self-replicating gene drives that modify sex ratios or infer a fitness cost could be used to control populations of invasive alien species. The targeted deletion of Y sex chromosomes using CRISPR technology offers a new approach for sex bias that could be incorporated within gene-drive designs. We introduce a novel gene-drive strategy termed Y-CHromosome deletion using Orthogonal Programmable Endonucleases (Y-CHOPE), incorporating a programmable endonuclease that 'shreds' the Y chromosome, thereby converting XY males into fertile XO females. Firstly, we demonstrate that the CRISPR/Cas12a system can eliminate the Y chromosome in embryonic stem cells with high efficiency (c. 90 %). Next, using stochastic, individual-based models of a pest mouse population, we show that a Y-shredding drive that progressively depletes the pool of XY males could effect population eradication through mate limitation. Our molecular and modelling data suggest that a Y-CHOPE gene drive could be a viable tool for vertebrate pest control.},
}
@article {pmid30766418,
year = {2019},
author = {Egizi, AM and Robbins, RG and Beati, L and Nava, S and Vans, CR and Occi, JL and Fonseca, DM},
title = {A pictorial key to differentiate the recently detected exotic Haemaphysalislongicornis Neumann, 1901 (Acari, Ixodidae) from native congeners in North America.},
journal = {ZooKeys},
volume = {},
number = {818},
pages = {117-128},
doi = {10.3897/zookeys.818.30448},
pmid = {30766418},
issn = {1313-2989},
abstract = {Until recently, only two haemaphysaline species, Haemaphysalischordeilis (Packard, 1869) and Haemaphysalisleporispalustris (Packard, 1869), were known to occur in the United States, and neither was considered to be of significant medical or veterinary importance. In 2017-2018 established populations of the Asian longhorned tick, Haemaphysalislongicornis Neumann, 1901, were detected in the eastern US for the first time. Haemaphysalislongicornis has the potential to be a significant threat to human and animal health, and the urgent need to determine the full extent of its distribution and host range requires availability of a straightforward and practical guide to differentiate it from native species. We created a pictorial dichotomous key to all stages of Haemaphysalis spp. known to occur in North America with scanning electron photomicrographs of all H.longicornis life stages, including rarely seen males, to aid researchers in differentiating these species. The largely Neotropical species Haemaphysalisjuxtakochi Cooley, 1946, with established populations in Mexico and sporadic detections in the US on migrating birds is also included.},
}
@article {pmid30765607,
year = {2019},
author = {Alves, JM and Carneiro, M and Cheng, JY and Lemos de Matos, A and Rahman, MM and Loog, L and Campos, PF and Wales, N and Eriksson, A and Manica, A and Strive, T and Graham, SC and Afonso, S and Bell, DJ and Belmont, L and Day, JP and Fuller, SJ and Marchandeau, S and Palmer, WJ and Queney, G and Surridge, AK and Vieira, FG and McFadden, G and Nielsen, R and Gilbert, MTP and Esteves, PJ and Ferrand, N and Jiggins, FM},
title = {Parallel adaptation of rabbit populations to myxoma virus.},
journal = {Science (New York, N.Y.)},
volume = {},
number = {},
pages = {},
doi = {10.1126/science.aau7285},
pmid = {30765607},
issn = {1095-9203},
abstract = {In the 1950s the myxoma virus was released into European rabbit populations in Australia and Europe, decimating populations and resulting in the rapid evolution of resistance. We investigated the genetic basis of resistance by comparing the exomes of rabbits collected before and after the pandemic. We found a strong pattern of parallel evolution, with selection on standing genetic variation favoring the same alleles in Australia, France and the United Kingdom. Many of these changes occurred in immunity-related genes, supporting a polygenic basis of resistance. We experimentally validated the role of several genes in viral replication and showed that selection acting on an interferon protein has increased its antiviral effect.},
}
@article {pmid30763312,
year = {2019},
author = {Amraoui, F and Ben Ayed, W and Madec, Y and Faraj, C and Himmi, O and Btissam, A and Sarih, M and Failloux, AB},
title = {Potential of Aedes albopictus to cause the emergence of arboviruses in Morocco.},
journal = {PLoS neglected tropical diseases},
volume = {13},
number = {2},
pages = {e0006997},
doi = {10.1371/journal.pntd.0006997},
pmid = {30763312},
issn = {1935-2735},
abstract = {In 2015, the mosquito Aedes albopictus was detected in Rabat, Morocco. This invasive species can be involved in the transmission of more than 25 arboviruses. It is known that each combination of mosquito population and virus genotype leads to a specific interaction that can shape the outcome of infection. Testing the vector competence of local mosquitoes is therefore a prerequisite to assess the risks of emergence. A field-collected strain of Ae. albopictus from Morocco was experimentally infected with dengue (DENV), chikungunya (CHIKV), zika (ZIKV) and yellow fever (YFV) viruses. We found that this species can highly transmit CHIKV and to a lesser extent, DENV, ZIKV and YFV. Viruses can be detected in mosquito saliva at day 3 (CHIKV), day 14 (DENV and YFV), and day 21 (ZIKV) post-infection. These results suggest that the local transmission of these four arboviruses by Ae. albopictus newly introduced in Morocco is a likely scenario. Trial registration: ClinicalTrials.gov APAFIS#6573-201606l412077987v2.},
}
@article {pmid30754298,
year = {2010},
author = {Minnis, AM and Rossman, AY and Clement, DL and Malinoski, MK and Rane, KK},
title = {First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.},
journal = {Plant disease},
volume = {94},
number = {2},
pages = {279},
doi = {10.1094/PDIS-94-2-0279B},
pmid = {30754298},
issn = {0191-2917},
abstract = {Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis &amp; Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.},
}
@article {pmid30743515,
year = {2011},
author = {Yun, HY and Kim, YH and James, TY},
title = {First Report of False Rust Caused by Synchytrium minutum on Kudzu in Korea.},
journal = {Plant disease},
volume = {95},
number = {3},
pages = {358},
doi = {10.1094/PDIS-09-10-0697},
pmid = {30743515},
issn = {0191-2917},
abstract = {Kudzu (Pueraria montana var. lobata (Willd.) Maesen &amp; S. Almeida) is a weedy, fabaceous vine that is native to and widely distributed in Asia where it is used for various medicinal purposes such as treating convulsions and fever (2). In the United States, especially the southeastern states, kudzu has become a problematic invasive species that overgrows nearly every substrate on which it occurs. Thus, biological control strategies for controlling this vine are of great interest (4). From October to November 2004, a disease of kudzu was observed in Gwangju and Pyeongtaek in Gyeonggi Province, Korea. The disease appeared on leaves and stems as numerous, discrete, small galls, which enlarged, becoming yellowish orange and eventually erupting into orange, pulverulent sori. Galls were scattered or gregarious, amphigenous, predominately hypophyllous, and sometimes formed along veins as well as on petioles and stems. Sori that formed from galls were solitary but sometimes became confluent, 0.1 to 1 mm in diameter, globose to subglobose, and orange to dark orange; walls were hyaline and thin. Sporangia were copious in sori, typically polyhedral due to compression or globose, 16 to 32 μm in diameter, with smooth, hyaline walls and orange contents. Zoospores were not observed during several failed attempts to germinate sporangia. On the basis of morphological descriptions and keys (3), the fungus was identified as Synchytrium minutum (Pat.) Gäum. (Chytridiomycota), the only species of Synchytrium known to occur on Pueraria (1,3). Comparison with specimens from China and New Guinea (BPI 794733 and BPI 1109528) confirmed this identification. Portions of the nLSU and nSSU rDNA from one of the two Korean specimens deposited as voucher material in the U.S. National Fungus Collections (BPI 880898 and BPI 880899) were sequenced (GenBank Accession Nos. HQ324138 and HQ324139), and a subsequent BLAST search against GenBank confirmed placement in the genus Synchytrium with 95% similarity to S. decipiens. S. minutum is widespread in Asia and Oceania and also has been reported from California (1,3). To our knowledge, this is the first report of S. minutum in Korea (1) and is noteworthy to those interested in biological control of kudzu because S. minutum may have potential in this regard. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , September, 2010. (2) H. S. Jung. M.S. thesis. Seoul National University, Seoul, Korea, 1997. (3) J. S. Karling. Synchytrium. Academic Press Inc., New York, NY, 1964. (4) M. A. Weaver et al. Biol. Control 50:150, 2009.},
}
@article {pmid30753385,
year = {2019},
author = {Jennings, DE and Wang, XY and Duan, JJ},
title = {Influence of Density on Interspecific Competition Between Spathius galinae (Hymenoptera: Braconidae) and Tetrastichus planipennisi (Hymenoptera: Eulophidae), Larval Parasitoids of the Invasive Emerald Ash Borer (Coleoptera: Buprestidae).},
journal = {Environmental entomology},
volume = {},
number = {},
pages = {},
doi = {10.1093/ee/nvz008},
pmid = {30753385},
issn = {1938-2936},
abstract = {The outcomes of interspecific interactions between parasitoids depend on a variety of factors. Understanding the influence of these factors is important for classical biological control, where the success of parasitoid releases partly depends on interactions with native and other introduced species. However, results from laboratory experiments may not always reflect those in the field, as densities may be artificially inflated. To mitigate this problem, we examined the effects of multiple densities on interspecific competition between two larval parasitoids of emerald ash borer (Agrilus planipennis Fairmaire): Spathius galinae Belokobylskij and Tetrastichus planipennisi Yang. Parasitoid species were housed individually or together at two different densities, and we measured the effects on percent parasitism and progeny production, before calculating the interaction strengths. We found no significant effects of parasitoid density on percent parasitism, but the effect of competition on parasitism generally was reduced at lower densities. However, there were significant differences in parasitism by species, with S. galinae parasitizing more larvae than T. planipennisi. There were also no significant effects of parasitoid density on the number of progeny produced by each species, though the effect of competition on progeny production was greater at higher densities. Similarly, though, there were significant differences between species in the number of progeny produced. Specifically, T. planipennisi consistently produced larger broods than S. galinae. Our findings complement existing research suggesting that competition between these two species in the field will likely be negligible.},
}
@article {pmid30746437,
year = {2019},
author = {Araújo, MB and Anderson, RP and Márcia Barbosa, A and Beale, CM and Dormann, CF and Early, R and Garcia, RA and Guisan, A and Maiorano, L and Naimi, B and O'Hara, RB and Zimmermann, NE and Rahbek, C},
title = {Standards for distribution models in biodiversity assessments.},
journal = {Science advances},
volume = {5},
number = {1},
pages = {eaat4858},
doi = {10.1126/sciadv.aat4858},
pmid = {30746437},
issn = {2375-2548},
abstract = {Demand for models in biodiversity assessments is rising, but which models are adequate for the task? We propose a set of best-practice standards and detailed guidelines enabling scoring of studies based on species distribution models for use in biodiversity assessments. We reviewed and scored 400 modeling studies over the past 20 years using the proposed standards and guidelines. We detected low model adequacy overall, but with a marked tendency of improvement over time in model building and, to a lesser degree, in biological data and model evaluation. We argue that implementation of agreed-upon standards for models in biodiversity assessments would promote transparency and repeatability, eventually leading to higher quality of the models and the inferences used in assessments. We encourage broad community participation toward the expansion and ongoing development of the proposed standards and guidelines.},
}
@article {pmid30744887,
year = {2019},
author = {He, C and Liang, J and Liu, S and Wang, S and Wu, Q and Xie, W and Zhang, Y},
title = {Changes in the expression of four ABC transporter genes in response to imidacloprid in Bemisia tabaci Q (Hemiptera: Aleyrodidae).},
journal = {Pesticide biochemistry and physiology},
volume = {153},
number = {},
pages = {136-143},
doi = {10.1016/j.pestbp.2018.11.014},
pmid = {30744887},
issn = {1095-9939},
abstract = {Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), a globally invasive species complex that causes serious damage to field crops, has developed resistance to imidacloprid and many other pesticides. Insect detoxify to pesticides may partially depend on ABC transporters, which contribute to the detoxification of xenobiotics. To determine whether genes in the ABCG subfamily are involved in imidacloprid detoxification in B. tabaci Q, we cloned four ABCG subfamily genes based on the published MED/Q genome and on our previous study of the transcriptional response of ABC transporters in B. tabaci Q adults to imidacloprid. As indicated by the quantification of mRNA levels after a 6-h exposure, the expression level of ABCG3 was 3.3-fold higher in B. tabaci Q adults exposed to 100 μg/mL imidacloprid rather than to the buffer control. The expression level of ABCG3 was higher in females than in males but did not significantly differ among eggs or nymphal stages and did not significantly differ among head, thorax, and abdomen tissues of adults. Knockdown of ABCG3 via RNA interference significantly increased the mortality of imidacloprid-treated laboratory and field-collected adults of B. tabaci Q. These results indicate that the ABCG3 gene may be involved in imidacloprid detoxification by B. tabaci Q.},
}
@article {pmid30744707,
year = {2019},
author = {Augustinos, AA and Moraiti, CA and Drosopoulou, E and Kounatidis, I and Mavragani-Tsipidou, P and Bourtzis, K and Papadopoulos, NT},
title = {Old residents and new arrivals of Rhagoletis species in Europe.},
journal = {Bulletin of entomological research},
volume = {},
number = {},
pages = {1-12},
doi = {10.1017/S0007485319000063},
pmid = {30744707},
issn = {1475-2670},
abstract = {The genus Rhagoletis (Diptera: Tephritidae) comprises more than 65 species distributed throughout Europe, Asia and America, including many species of high economic importance. Currently, there are three Rhagoletis species that infest fruits and nuts in Europe. The European cherry fruit fly, Rhagoletis cerasi (may have invaded Europe a long time ago from the Caucasian area of West Asia), and two invasive species (recently introduced from North America): the eastern American cherry fruit fly, R. cingulata, and the walnut husk fly, R. completa. The presence of different Rhagoletis species may enhance population dynamics and establish an unpredictable economic risk for several fruit and nut crops in Europe. Despite their excessive economic importance, little is known on population dynamics, genetics and symbiotic associations for making sound pest control decisions in terms of species-specific, environmental friendly pest control methods. To this end, the current paper (a) summarizes recently accumulated genetic and population data for the European Rhagoletis species and their association with the endosymbiont Wolbachia pipientis, and (b) explores the possibility of using the current knowledge for implementing the innovative biological control methods of sterile insect technique and incompatible insect technique.},
}
@article {pmid30742814,
year = {2019},
author = {Barnes, CL and Blay, NW and Wilder, SM},
title = {Upper Thermal Tolerances of Different Life Stages, Sexes, and Species of Widow Spiders (Araneae, Theridiidae).},
journal = {Journal of insect physiology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.jinsphys.2019.02.004},
pmid = {30742814},
issn = {1879-1611},
abstract = {Temperature strongly influences the physiology and behavior of ectotherms. Persistence within different environments can be limited by thermal tolerances. These thermal tolerances can also shift through life stages and differ between sexes. The critical thermal maximum (CTMax) defines the temperature at which animals experience unorganized locomotion or spasms. In this study, we tested if CTMax varied between a native and an invasive widow species. We separately tested if CTMax varied by widow life stage and sex. We predicted that the invasive species would have higher CTMax due to originally inhabiting warmer climates. We also predicted that juveniles and male widows would possess higher CTMax because they are more mobile and could experience a greater scope of thermal extremes throughout landscapes. We did not find a difference in CTMax between the species, but we did find differences across development stages. Temperature of spasms and death decreased with developmental stages, which corresponds with previous studies in spiders. Future studies of ontogenic and interspecific comparisons will be crucial for more broadly understanding how upper tolerances shapes species persistence in changing climates or ability to invade new habitats.},
}
@article {pmid30740563,
year = {2018},
author = {Chen, G and Sun, W},
title = {The role of botanical gardens in scientific research, conservation, and citizen science.},
journal = {Plant diversity},
volume = {40},
number = {4},
pages = {181-188},
doi = {10.1016/j.pld.2018.07.006},
pmid = {30740563},
issn = {2468-2659},
abstract = {Plant diversity is currently being lost at an unprecedented rate, resulting in an associated decrease in ecosystem services. About a third of the world's vascular plant species face the threat of extinction due to a variety of devastating activities, including, over-harvesting and over exploitation, destructive agricultural and forestry practices, urbanization, environmental pollution, land-use changes, exotic invasive species, global climate change, and more. We therefore need to increase our efforts to develop integrative conservation approaches for plant species conservation. Botanical gardens devote their resources to the study and conservation of plants, as well as making the world's plant species diversity known to the public. These gardens also play a central role in meeting human needs and providing well-being. In this minireview, a framework for the integrated missions of botanical gardens, including scientific research, in/ex situ conservation, plant resource utilization, and citizen science are cataloged. By reviewing the history of the development of Kunming Botanical Garden, we illustrate successful species conservation approaches (among others, projects involving Camellia, Rhododendron, Magnolia, Begonia, Allium, Nepenthes, medicinal plants, ornamental plants, and Plant Species with Extreme Small Populations), as well as citizen science, and scientific research at Kunming Botanical Garden over the past 80 years. We emphasize that Kunming Botanical Garden focuses largely on the ex situ conservation of plants from Southwest China, especially those endangered, endemic, and economically important plant species native to the Yunnan Plateau and the southern Hengduan Mountains. We also discuss the future challenges and responsibilities of botanical gardens in a changing world, including: the negative effects of outbreeding and/or inbreeding depression; promoting awareness, study, and conservation of plant species diversity; accelerating global access to information about plant diversity; increasing capacity building and training activities. We hope this minireview can promote understanding of the role of botanical gardens.},
}
@article {pmid30739983,
year = {2019},
author = {Connolly, J and Watkins, JM and Hinchey, EK and Rudstam, LG and Reid, JW},
title = {The Asian cyclopoid copepod Mesocyclops pehpeiensis reported from the western basin of Lake Erie.},
journal = {Journal of Great Lakes research},
volume = {45},
number = {1},
pages = {196-201},
doi = {10.1016/j.jglr.2018.11.005},
pmid = {30739983},
issn = {0380-1330},
support = {EPA999999//Intramural EPA/United States ; },
abstract = {The Asian cyclopoid copepod Mesocyclops pehpeiensis Hu, 1943 has been reported as an introduced species at several locations in the western hemisphere. In the United States, reports of this exotic species are restricted to localities in Louisiana, Mississippi, and Washington D.C. This report documents a new record of occurrence for M. pehpeiensis from the western basin of Lake Erie. The detection of M. pehpeiensis in Lake Erie constitutes the first record of this species from the Laurentian Great Lakes, and the northernmost record in the western hemisphere. The species was found in 2016, 2017 and 2018, including females with egg sacks, and can therefore be considered established in the area. The occurrence of M. pehpeiensis in Lake Erie suggests that this Asian copepod may be more widely distributed in North America than is currently understood.},
}
@article {pmid30739151,
year = {2019},
author = {Balasubramanyam, V and Wilhelm Stanis, S and Morgan, M and Ojewola, O},
title = {Climate Change Communication in the Midwestern United States: Perceptions of State Park Interpreters.},
journal = {Environmental management},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00267-019-01142-1},
pmid = {30739151},
issn = {1432-1009},
support = {IIA-1355406//National Science Foundation/ ; },
abstract = {Parks and protected areas can be ideal settings for climate change communication since many visitors have an affinity for natural and cultural settings, and an interest in resource protection. However, climate-based education efforts in the Midwestern United States may need a slightly different approach since this region lacks obvious indicators, such as sea level rise and melting glaciers. Interpretation, an informal communication process designed to transmit scientific information to visitors in leisure-based settings, could be a useful strategy for engaging visitors in climate change discussions. Few studies have assessed perceptions of interpreters on this topic, much less, their willingness to communicate such information. To address this issue, a mixed methods approach (surveys, interviews, photovoice) was used to examine interpreters' perceptions of climate change and its impacts in Missouri State Park and Historic Sites. Although nearly 70% of interpreters were either alarmed or concerned about climate change, many of them were unsure about its causation. Interpreters report observing impacts such as flooding, earlier plant blooming, high temperatures, extreme weather, and invasive species, but were uncertain about attributing these impacts to climate change. Interpreters did not believe that visitors would be responsive to climate-based education per se but thought the topic could be addressed in pre-existing programs and activities. Rather than discussing complex science with visitors, interpreters felt more comfortable with conveying the significance of resources at their sites. Implications from this study include acknowledging multiple viewpoints, framing strategic messages, and developing place-based educational materials.},
}
@article {pmid30738853,
year = {2019},
author = {Ding, L and Li, W and Li, N and Liang, L and Zhang, X and Jin, H and Shi, H and Storey, KB and Hong, M},
title = {Antioxidant responses to salinity stress in an invasive species, the red-eared slider (Trachemys scripta elegans) and involvement of a TOR-Nrf2 signaling pathway.},
journal = {Comparative biochemistry and physiology. Toxicology &amp; pharmacology : CBP},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.cbpc.2019.02.004},
pmid = {30738853},
issn = {1532-0456},
abstract = {The red-eared slider (Trachemys scripta elegans), a freshwater turtle, is an invasive species in many parts of the world where it survives in both freshwater and coastal saline habitats. High salinity can induce reactive oxygen species (ROS) production and lead to oxidative damage. In this study, we investigate the antioxidant defense mechanisms of T. s. elegans in response to salinity stress. The results showed that the mRNA expression levels of superoxide dismutase (SODs), catalase (CAT) and glutathione peroxidase (GSH-PXs) were significantly increased in both 5 psu and 15 psu groups at the early stages of salinity exposure (generally 6-48 h), but typically returned to control levels after the longest 30 d exposure. In addition, hepatic and cardiac mRNA levels of the NF-E2-related factor 2 (Nrf2), showed a similar upregulation as an early response to stress, but decreased at 30 d in the 5 psu and 15 psu groups. The mRNA levels of the negative regulator of Nrf2, kelch-like ECH associating protein 1 (Keap1), exhibited the opposite pattern. Moreover, mRNA expression levels of target of rapamycin (TOR) and ribosomal protein S6 kinase 1 (S6K1) in liver and heart showed roughly similar patterns to those for Nrf2. Furthermore, the content of malondialdehyde (MDA) was significantly increased in liver, especially in the 15 psu group by ~2.5-fold. Taken together, these results indicate that T. s. elegans may activate the TOR-Nrf2 pathway to modulate antioxidant genes transcription in order to promote enhanced antioxidant defense in response to salinity stress.},
}
@article {pmid30728252,
year = {2019},
author = {Kerr, PJ and Eden, JS and Giallonardo, FD and Peacock, D and Liu, J and Strive, T and Read, AF and Holmes, EC},
title = {Punctuated evolution of myxoma virus: rapid and disjunct evolution of a recent viral lineage in Australia.},
journal = {Journal of virology},
volume = {},
number = {},
pages = {},
doi = {10.1128/JVI.01994-18},
pmid = {30728252},
issn = {1098-5514},
abstract = {Myxoma virus (MYXV) has been evolving in a novel host species - European rabbits - in Australia since 1950. Previous studies of viruses sampled from 1950 to 1999 revealed a remarkably clock-like evolutionary process across all Australian lineages of MYXV. Through an analysis of 49 newly generated MYXV genome sequences isolated in Australia between 2008 and 2017 we show that MYXV evolution in Australia can be characterized by three lineages, one of which exhibited a greatly elevated rate of evolutionary change and a dramatic break-down of temporal structure. Phylogenetic analysis revealed that this apparently punctuated evolutionary event occurred between 1996 and 2012. The branch leading to the rapidly evolving lineage contained a relatively high number of non-synonymous substitutions, and viruses in this lineage reversed a mutation found in the progenitor standard laboratory strain (SLS) and all previous sequences that disrupts the reading frame of the M005L/R gene. Analysis of genes encoding proteins involved in DNA synthesis or RNA transcription did not reveal any mutations likely to cause rapid evolution. Although there was some evidence for recombination across the MYXV phylogeny, this was not associated with the increase in evolutionary rate. The period from 1996 to 2012 saw significant declines in wild rabbit numbers, due to the introduction of rabbit hemorrhagic disease and prolonged drought in south-eastern Australia, followed by the partial recovery of populations. It is therefore possible that a rapidly changing environment for virus transmission changed the selection pressures faced by MYXV, altering the course and pace of virus evolution.IMPORTANCE The co-evolution of myxoma virus (MYXV) and European rabbits in Australia is one of the most important natural 'experiments' in evolutionary biology, providing insights into virus adaptation to new hosts and the evolution of virulence. Previous studies of MYXV evolution have also shown that the virus evolves both relatively rapidly and in a strongly clock-like manner. Using newly acquired MYXV genome sequences from Australia we show that the virus has experienced a dramatic change in evolutionary behavior over the last 20 years, with a break-down in clock-like structure, the appearance of a rapidly evolving virus lineage, and the accumulation of multiple non-synonymous and indel mutations. We suggest that this punctuated evolutionary event may reflect a change in selection pressures as rabbit numbers declined following the introduction of rabbit hemorrhagic disease virus and drought in the geographic regions inhabited by rabbits.},
}
@article {pmid30715141,
year = {2019},
author = {Fenesi, A and Sándor, D and Pyšek, P and Dawson, W and Ruprecht, E and Essl, F and Kreft, H and Pergl, J and Weigelt, P and Winter, M and Van Kleunen, M},
title = {The role of fruit heteromorphism in the naturalization of Asteraceae.},
journal = {Annals of botany},
volume = {},
number = {},
pages = {},
doi = {10.1093/aob/mcz012},
pmid = {30715141},
issn = {1095-8290},
abstract = {Background and Aims: Fruit heteromorphism is considered to be a bet-hedging strategy to cope with spatially or temporally heterogeneous environments. The different behaviours of the fruit morphs of the same species might also be beneficial during naturalization, once the species has been introduced to a new range. Yet, no study to date has tested the association between fruit heteromorphism and global-scale naturalization success for a large set of plant species.<br><br>Methods: We compiled two large datasets on fruit heteromorphism in Asteraceae. One dataset was on native species in Central Europe (n = 321) and the other was on species frequently planted as ornamentals (n = 584). Using phylogenetic linear and logistic regressions, we tested whether heteromorphic species are more likely to naturalize outside their native range, and in more regions of the world than monomorphic species. We also tested whether the effect of heteromorphism is modulated by life history and height of the species.<br><br>Key Results: We show that heteromorphic species were more likely to naturalize outside their native range. However, among the naturalized species, heteromorphic and monomorphic species did not differ in the number of world regions where they became naturalized. A short life span and tall stature both promoted naturalization success and, when life history and height were included in the models, the effect of fruit heteromorphism on the ability to naturalize became non-significant. Nevertheless, among tall plants, heteromorphic ornamental species were significantly more likely to become naturalized in general and in more regions than monomorphic species.<br><br>Conclusions: Our results provide evidence that in Asteraceae the production of heteromorphic fruits is associated with naturalization success. It appears, however, that not fruit heteromorphism per se, but a successful combination of other biological traits in fruit heteromorphic species, namely short life span and tall stature, contributes to their naturalization success.},
}
@article {pmid30715137,
year = {2019},
author = {Takemori, A and Naiki, A and Takakura, KI and Kanaoka, MM and Nishida, S},
title = {Comparison of mechanisms of reproductive interference in Taraxacum.},
journal = {Annals of botany},
volume = {},
number = {},
pages = {},
doi = {10.1093/aob/mcz007},
pmid = {30715137},
issn = {1095-8290},
abstract = {Background and Aims: Reproductive interference may reduce fitness of either of the involved species, with potentially important ecological and evolutionary consequences. Except for the effect of shared pollinators on reproductive success, however, mechanisms underlying reproductive interference have been little studied, even though the severity of its impact may depend on the specific mechanism. The aim of this study was therefore to explore the mechanisms of reproductive interference between Taraxacum japonicum (native to Japan) and Taraxacum officinale (alien).<br><br>Methods: In a field survey, the association between alien species density and seed set in T. japonicum, and whether pollinator behaviour indicated a preference for the alien, were examined. Effects of heterospecific pollen deposition were measured in a series of hand pollination experiments, including mixed pollination experiments in which the order of application of conspecific and heterospecific pollen was varied. Finally, to investigate hybridization frequency, the parentage of seedlings produced following natural, mixed or heterospecific pollination was compared.<br><br>Key Results: Alien species density did not negatively affect native seed set, nor did pollinators appear to have a preference for alien flowers. The hand pollination experiments showed that heterospecific pollen deposition adversely affected native seed set, especially when alien pollen was applied before conspecific pollen. No viable hybrids were found following natural pollination, which suggests that hybridization might be a rare event.<br><br>Conclusion: Among the examined mechanisms, heterospecific pollen deposition might have the largest deleterious effect on the native species. This effect is frequency dependent; thus, a positive feedback loop may cause the effect on the population dynamics to increase over time, with the result that the alien might eventually displace the native in a population. Effects of the examined mechanisms on population dynamics should be investigated further to improve understanding of the impact of reproductive interference on the structure of plant communities.},
}
@article {pmid30713818,
year = {2019},
author = {Bergshoeff, JA and McKenzie, CH and Favaro, B},
title = {Improving the efficiency of the Fukui trap as a capture tool for the invasive European green crab (Carcinus maenas) in Newfoundland, Canada.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6308},
doi = {10.7717/peerj.6308},
pmid = {30713818},
issn = {2167-8359},
abstract = {The European green crab (Carcinus maenas) is a crustacean species native to European and North African coastlines that has become one of the world's most successful marine invasive species. Targeted fishing programs aimed at removing green crabs from invaded ecosystems commonly use Fukui multi-species marine traps. Improving the efficiency of these traps would improve the ability to respond to green crab invasions. In this study, we developed four distinct trap modifications that were designed to facilitate the successful capture of green crabs, with the goal of improving the performance of the Fukui trap. We tested these modifications in situ during the summer of 2016 at two locations in Placentia Bay, Newfoundland. We discovered that three of our modified Fukui trap designs caught significantly more green crabs than the standard Fukui trap, increasing catch-per-unit-effort (CPUE) by as much as 81%. We conclude that our top-performing modifications have great potential for widespread use with existing Fukui traps that are being used for green crab removal efforts.},
}
@article {pmid30713364,
year = {2018},
author = {Karatayev, AY and Burlakova, LE and Mehler, K and Bocaniov, SA and Collingsworth, PD and Warren, G and Kraus, RT and Hinchey, EK},
title = {Biomonitoring Using Invasive Species in a Large Lake: Dreissena Distribution Maps Hypoxic Zones.},
journal = {Journal of Great Lakes research},
volume = {44},
number = {4},
pages = {639-649},
doi = {10.1016/j.jglr.2017.08.001},
pmid = {30713364},
issn = {0380-1330},
support = {EPA999999//Intramural EPA/United States ; },
abstract = {Due to cultural eutrophication and global climate change, an exponential increase in the number and extent of hypoxic zones in marine and freshwater ecosystems has been observed in the last few decades. Hypoxia, or low dissolved oxygen (DO) concentrations, can produce strong negative ecological impacts and, therefore, is a management concern. We measured biomass and densities of Dreissena in Lake Erie, as well as bottom DO in 2014 using 19 high frequency data loggers distributed throughout the central basin to validate a three-dimensional hydrodynamic-ecological lake model. We found that a deep, offshore hypoxic zone was formed by early August, restricting the Dreissena population to shallow areas of the central basin. Deeper than 20 m, where bottom hypoxia routinely develops, only young of the year mussels were found in small numbers, indicating restricted recruitment and survival of young Dreissena. We suggest that monitoring Dreissena distribution can be an effective tool for mapping the extent and frequency of hypoxia in freshwater. In addition, our results suggest that an anticipated decrease in the spatial extent of hypoxia resulting from nutrient management has the potential to increase the spatial extent of profundal habitat in the central basin available for Dreissena expansion.},
}
@article {pmid30713217,
year = {2019},
author = {Kim, DY and Suk, HY and Park, SK and Kang, SY and Lee, SK and Yeon, SC},
title = {Development of microsatellite markers and the genetic diversity of Myocastor coypus introduced to South Korea.},
journal = {The Journal of veterinary medical science},
volume = {},
number = {},
pages = {},
doi = {10.1292/jvms.18-0564},
pmid = {30713217},
issn = {1347-7439},
abstract = {The nutria (Myocastor coypus) was introduced to South Korea in 1987 for breeding of individuals for fur and meat industry, and was accidentally released into the wild. Here, we report the development of microsatellites for the nutria collected from South Korea using Illumina MiSeq genome sequencing to identify the genetic variability and demographic history of these introduced populations. A total of 626,282 microsatellite sequences were identified, and nine polymorphic loci were characterized. We used four novel loci developed and three previously known loci to investigate the genetic diversity of twelve South Korean populations. A low level of diversity was found, and no signature of genetic structuring was revealed among populations, indicating that Korean nutria individuals originated from a single population or a highly inbred reared herd.},
}
@article {pmid30709335,
year = {2019},
author = {Saarinen, K and Lindström, L and Ketola, T},
title = {Invasion triple trouble: environmental fluctuations, fluctuation-adapted invaders and fluctuation-mal-adapted communities all govern invasion success.},
journal = {BMC evolutionary biology},
volume = {19},
number = {1},
pages = {42},
doi = {10.1186/s12862-019-1348-9},
pmid = {30709335},
issn = {1471-2148},
support = {278751//Biotieteiden ja Ympäristön Tutkimuksen Toimikunta/ ; 250248//Biotieteiden ja Ympäristön Tutkimuksen Toimikunta/ ; },
abstract = {BACKGROUND: It has been suggested that climate change will lead to increased environmental fluctuations, which will undoubtedly have evolutionary consequences for all biota. For instance, fluctuations can directly increase the risk of invasions of alien species into new areas, as these species have repeatedly been proposed to benefit from disturbances. At the same time increased environmental fluctuations may also select for better invaders. However, selection by fluctuations may also influence the resistance of communities to invasions, which has rarely been tested. We tested eco-evolutionary dynamics of invasion with bacterial clones, evolved either in constant or fluctuating temperatures, and conducted experimental invasions in both conditions.<br><br>RESULTS: We found clear evidence that ecological fluctuations, as well as adaptation to fluctuations by both the invader and community, all affected invasions, but played different roles at different stages of invasion. Ecological fluctuations clearly promoted invasions, especially into fluctuation mal-adapted communities. The evolutionary background of the invader played a smaller role.<br><br>CONCLUSIONS: Our results indicate that climate change associated disturbances can directly increase the risk of invasions by altering ecological conditions during invasions, as well as via the evolution of both the invader and communities. Our experiment provides novel information on the complex consequences of climate change on invasions in general, and also charts risk factors associated with the spread of environmentally growing opportunistic pathogens.},
}
@article {pmid30709012,
year = {2019},
author = {Dang, Z and McLenachan, PA and Lockhart, PJ and Waipara, N and Er, O and Reynolds, C and Blanchon, D},
title = {Metagenome Profiling Identifies Potential Biocontrol Agents for Selaginella kraussiana in New Zealand.},
journal = {Genes},
volume = {10},
number = {2},
pages = {},
doi = {10.3390/genes10020106},
pmid = {30709012},
issn = {2073-4425},
abstract = {Metagenomics can be used to identify potential biocontrol agents for invasive species and was used here to identify candidate species for biocontrol of an invasive club moss in New Zealand. Profiles were obtained for Selaginella kraussiana collected from nine geographically disjunct locations in Northern New Zealand. These profiles were distinct from those obtained for the exotic club moss Selaginella moellendorffii and the native club mosses Lycopodium deuterodensum and Lycopodium volubile also collected in Northern New Zealand. Fungi and bacteria implicated elsewhere in causing plant disease were identified on plants of Selaginella that exhibited signs of necrosis. Most notably, high densities of sequence reads from Xanthomonas translucens and Pseudomonas syringae were associated with some populations of Selaginella but not Lycopodium. Since these bacteria are already in use as biocontrol agents elsewhere, further investigation into their potential as biocontrol of Selaginella in New Zealand is suggested.},
}
@article {pmid30707479,
year = {2019},
author = {Żelazowska, M and Halajian, A},
title = {Previtellogenic oocytes of South African largemouth bass Micropterus salmoides Lacépède 1802 (Actinopterygii, Perciformes) - the Balbiani body, cortical alveoli and developing eggshell.},
journal = {Journal of morphology},
volume = {280},
number = {3},
pages = {360-369},
doi = {10.1002/jmor.20948},
pmid = {30707479},
issn = {1097-4687},
support = {K/ZDS/006317//Jagiellonian University, Institute of Zoology and Biomedical Research (funds from the Polish Ministry of Science and Higher Education - MNiSW)/ ; 101054//South African Research Chairs Initiative of the Department of Science and Technology and National Research Foundation of South Africa/ ; },
abstract = {The ovaries of the largemouth bass Micropterus salmoides, an alien and invasive species in South Africa, contain a germinal epithelium which consists of germline and somatic cells, as well as previtellogenic and late vitellogenic ovarian follicles. The ovarian follicle consists of an oocyte surrounded by follicular cells and a basal lamina; thecal cells adjacent to this lamina are covered by an extracellular matrix. In this article, we describe the Balbiani body and the polarization and ultrastructure of the cytoplasm (ooplasm) in previtellogenic oocytes. The nucleoplasm in all examined oocytes contains lampbrush chromosomes, nuclear bodies and several nucleoli near the nuclear envelope. The ultrastructure of the nucleoli is described. Numerous nuage aggregations are present in the perinuclear cytoplasm in germline cells as well as in the ooplasm. Possible roles of these aggregations are discussed. The ooplasm contains the Balbiani body, which defines the future vegetal region in early previtellogenic oocytes. It is comprised of nuage aggregations, rough endoplasmic reticulum, Golgi apparatus, mitochondria, complexes of mitochondria with nuage-like material, and lysosome-like organelles. In mid-previtellogenic oocytes, the Balbiani body surrounds the nucleus and later disperses in the ooplasm. The lysosome-like organelles fuse and transform into vesicles containing material which is highly electron dense. As a result of the fusion of the vesicles of Golgi and rough endoplasmic reticulum, the cortical alveoli arise and distribute uniformly throughout the ooplasm of late previtellogenic oocytes. During this stage, the deposition of the eggshell (zona radiata) begins. The eggshell is penetrated by canals containing microvilli and consists of the following: the internal and the external egg envelope. In the external envelope three sublayers can be distinguished.},
}
@article {pmid30701707,
year = {2019},
author = {Jerde, CL and Wilson, EA and Dressler, TL},
title = {Measuring global fish species richness with eDNA metabarcoding.},
journal = {Molecular ecology resources},
volume = {19},
number = {1},
pages = {19-22},
doi = {10.1111/1755-0998.12929},
pmid = {30701707},
issn = {1755-0998},
support = {AID-OAA-A-16-00057//United States Agency for International Development/ ; },
abstract = {Despite mounting threats to global freshwater and marine biodiversity, including climate change, habitat alteration, overharvesting and pollution, we struggle to know which species are present below the water's surface that are suffering from these stressors. However, the idea that a water sample containing environmental DNA (eDNA) can be screened using high-throughput sequencing and bioinformatics to reveal the identity of aquatic species is a revolutionary advance for studying the patterns of species extirpation, invasive species establishment and the dynamics of species richness. To date, many of the critical tests of fisheries diversity using this metabarcoding approach have been conducted in lower diversity systems (<40 fish species), but in this issue of Molecular Ecology Resources, Cilleros et al. (2018) described their eDNA application in the species-rich French Guiana fishery (>200 fish species) and showed the greater potential and some limitations of using eDNA in species-rich environments.},
}
@article {pmid30698291,
year = {2019},
author = {Niemiec, RM and Willer, R and Ardoin, NM and Brewer, FK},
title = {Motivating landowners to recruit neighbors for private land conservation.},
journal = {Conservation biology : the journal of the Society for Conservation Biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/cobi.13294},
pmid = {30698291},
issn = {1523-1739},
abstract = {Encouraging motivated landowners to not only engage in conservation action on their own property but also to recruit others may enhance effectiveness of conservation on private lands. Landowners may only engage in such recruitment if they believe their neighbors care about the conservation issue, will positively respond to their conservation efforts, and are likely to take action for the conservation cause. We designed a series of microinterventions that can be added to community meetings to change these beliefs to encourage landowner engagement in recruitment of others. The microinterventions included neighbor discussion, public commitment making, collective goal setting, and increased observability of contributions to the conservation cause. In a field experiment, we tested whether adding microinterventions to traditional knowledge-transfer outreach meetings changed those beliefs so as to encourage landowners in Hawaii to recruit their neighbors for private lands conservation. We delivered a traditional outreach meeting about managing the invasive little fire ant (Wasmannia auropunctata) to 5 communities and a traditional outreach approach with added microinterventions to 5 other communities. Analysis of pre- and postsurveys of residents showed that compared with the traditional conservation outreach approach, the microinterventions altered a subset of beliefs that landowners had about others. These microinterventions motivated reputationally minded landowners to recruit and coordinate with other residents to control the invasive fire ant across property boundaries. Our results suggest integration of these microinterventions into existing outreach approaches will encourage some landowners to facilitate collective conservation action across property boundaries. This article is protected by copyright. All rights reserved.},
}
@article {pmid30697485,
year = {2019},
author = {Stępień, E and Zawal, A and Buczyński, P and Buczyńska, E and Szenejko, M},
title = {Effects of dredging on the vegetation in a small lowland river.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6282},
doi = {10.7717/peerj.6282},
pmid = {30697485},
issn = {2167-8359},
abstract = {Background: Conventional river engineering operations have a substantial influence on the fluvial ecosystem. Regulation and channelization generally reduce the physical heterogeneity of river beds and banks and the heterogeneity of habitats. They determine the character, diversity and species richness of plant communities. The effect of river regulation on vegetation has been repeatedly investigated, but few studies have been conducted within reaches of previously regulated rivers. The aim of this work is to expand and current knowledge about the impact of dredging on the vegetation of a regulated section of a lowland river.<br><br>Materials &amp; Methods: The study included pre-dredging (1 year before) and post-dredging surveys (results 1 and 2 years after dredging). The vegetation was analysed in terms of species composition, origin of species, life forms, distribution of Grime's life strategies, and selected ecological factors. The Shannon-Wiener biodiversity index (H) and evenness were also analysed in each year of the study. The impact of dredging on the vascular flora was assessed by 'before-after-control-impact' (BACI) analysis.<br><br>Results: The number of species and biodiversity as measured by the Shannon-Wiener index (H) increased in the analysed section of the river valley. However, enrichment of the flora was observed only on the floodplain, on the surface of the deposited dredging material, while the number of species in the river channel decreased, as dredging of the river bed and levelling of the banks had markedly reduced habitat diversity. Although species richness in the second year after the dredging approached the values recorded before the intervention, the absence of particularly species or phytocenoses associated with shallow river banks and sandbars was still observed. The change in habitat conditions and the destruction of the vegetation cover during the dredging enabled penetration by numerous previously unrecorded alien species of plants and apophytes. There was a perceptible increase in the role of therophytes in the flora. It is worth noting that the number of alien species and therophytes declined significantly in the second year after the dredging. Analysis of the proportions of species representing various life strategies showed that previously unrecorded species with the type R (ruderal) life strategy had appeared, representing by pioneer species occurring in frequently disturbed habitats. There was also a marked increase in the share of species representing the mixed C-R (competitive-ruderal) strategy, occurring in habitats with low levels of stress, whose competitive abilities are limited by repeated disturbances. By the second year after the dredging, however, these changes were largely no longer observed.<br><br>Conclusions: Through appropriate maintenance of the regulated river, it can be rapidly recolonized by vegetation after the procedure, but it may lead to the loss of some species and phytocoenoses.},
}
@article {pmid30689916,
year = {2019},
author = {Milosavljevic, I and McCalla, KA and Ratkowsky, DA and Hoddle, MS},
title = {Effects of Constant and Fluctuating Temperatures on Development Rates and Longevity of Diaphorencyrtus aligarhensis (Hymenoptera: Encyrtidae).},
journal = {Journal of economic entomology},
volume = {},
number = {},
pages = {},
doi = {10.1093/jee/toy429},
pmid = {30689916},
issn = {1938-291X},
abstract = {The effects of fluctuating and constant temperatures on the development and longevity of Diaphorencyrtus aligarhensis (Shafee, Alam, and Argarwal) (Hymenoptera: Encyrtidae), a parasitoid sourced from Pakistan and released in California for the classical biological control of Diaphorina citri Kuwayama (Hemiptera: Liviidae), were examined. The influence of six fluctuating temperatures that averaged 15, 20, 25, 30, 32, and 35°C, over 24 h on the development times and longevity of male and female D. aligarhensis were quantified and compared to six constant temperatures set at the same average temperatures. The development rates of immature stages of D. aligarhensis as a function of temperature were modeled using one linear and four nonlinear models. Fluctuating temperatures had significant effects on parasitoid development times and longevity which differed across experimental temperatures. Degree-days required for completion of cumulative development of D. aligarhensis were significantly different being 21% lower under fluctuating temperature regimens when compared with constant temperatures. The lower temperature threshold estimates above which development occurred were estimated to be lower under constant than fluctuating temperatures. The estimated values of upper and optimum temperature limits were similar for individuals reared under constant and fluctuating temperatures. Diaphorencyrtus aligarhensis lived longer at constant intermediate temperatures and for shorter times at constant lower temperature extremes when compared with their fluctuating temperature counterparts. Daily thermal fluctuations significantly influenced life history parameters of D. aligarhensis and should be considered when assessing likelihoods of establishment and impacts of this parasitoid on D. citri across diverse citrus-growing climates.},
}
@article {pmid30688998,
year = {2019},
author = {Snyder, SA and Kilgore, MA and Emery, MR and Schmitz, M},
title = {Maple Syrup Producers of the Lake States, USA: Attitudes Towards and Adaptation to Social, Ecological, and Climate Conditions.},
journal = {Environmental management},
volume = {63},
number = {2},
pages = {185-199},
doi = {10.1007/s00267-018-1121-7},
pmid = {30688998},
issn = {1432-1009},
support = {Research Joint Venture Agreement 14-JV-11242309-047//USDA Forest Service/ ; MIN-42-54 and MIN-42-65//Minnesota Agricultural Experiment Station/ ; },
abstract = {Maple syrup is an important non-timber forest product derived from the sap of the sugar maple (Acer saccharum Marshall). However, maple syrup producers are facing a diversity of challenges, including: potential range shifts in the maple resource; increasing variability in the timing, duration and yield of sap flow and syrup operations; invasive species, pests and diseases; and intergenerational land and business transfer challenges. Members of Maple Syrup Producer Associations in Minnesota, Wisconsin, and Michigan were surveyed to learn about their operations, adaptation strategies, concerns, and information needs. While many respondents indicated they have undertaken or plan to undertake adaptation activities, only 11% had done so out of specific concern over changing climate conditions. Climate-motivated activities included: being prepared to tap earlier and utilizing newer technology such as vacuum tubing or reverse osmosis to enhance sap collection and processing efficiency. Respondents were generally unlikely to consider planting climate-resilient maple cultivars or tapping trees other than sugar maple. They expressed the greatest concerns over tree health and forest pests, as well as their physical ability and family member interest to continue their operations. Boil season variability and weather issues were viewed with less concern. Respondents were generally optimistic that they can adapt to future conditions, likely in large measure through the adoption of new technologies, and they expect their syrup production levels to slightly increase in the future. If future climate scenarios play out, however, additional planning and adaptation strategies may be called for, particularly as they relate to forest health and productivity issues.},
}
@article {pmid30687373,
year = {2018},
author = {Thouvenot, L and Gauzens, B and Haury, J and Thiébaut, G},
title = {Response of Macrophyte Traits to Herbivory and Neighboring Species: Integration of the Functional Trait Framework in the Context of Ecological Invasions.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1981},
doi = {10.3389/fpls.2018.01981},
pmid = {30687373},
issn = {1664-462X},
abstract = {With the increase in the number of introduced species each year, biological invasions are considered as one of the most important environmental problems for native biodiversity. In invaded habitats, the establishment of exotic plant species depends on the abiotic and biotic environment. Herbivores and neighboring plants (native or exotic) comprise an important part of the latter. Herbivores cause trophic and non-trophic damage to focal plants, which respond to herbivory by varying their different traits quantitatively (e.g., growth rate and biomass changes) and qualitatively (e.g., variation in morphological and chemical defenses strategies affecting plant palatability). Neighboring plant species also affect functional traits and the fitness of focal plant species, thus herbivore effects on a focal plant could also depend indirectly on the palatability and defensive traits of the neighboring species inside the community. Here, in a first step toward the integration of associational susceptibility/resistance theories in the field of ecological invasion, we performed a microcosm experiment to consider the effects of an exotic crayfish on the growth rate, morphological traits and damage level of three macrophytes (two exotic, one native) growing in pairwise combinations. We found that (i) the response to herbivore presence and to neighboring species identity seemed to be species specific, and (ii) crayfish enhance the fragmentation rate of the two exotic macrophytes Ludwigia grandiflora and Egeria densa in the presence of the native macrophyte Myriophyllum spicatum, which could indirectly facilitate their invasion success. Indeed, fragmentation can increase dispersal abilities of the exotic macrophytes considered in this study as they are able to generate new plants from their fragments. However, our results showed that the interaction herbivore-neighbor species was hardly significant. Our paper presents some first results on associational resistance/susceptibility and lays the foundation for developing a general framework that combines plant community ecology and biological invasion ecology to explain invasive species success.},
}
@article {pmid30687294,
year = {2018},
author = {Baker, JL and Edlund, A},
title = {Exploiting the Oral Microbiome to Prevent Tooth Decay: Has Evolution Already Provided the Best Tools?.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {3323},
doi = {10.3389/fmicb.2018.03323},
pmid = {30687294},
issn = {1664-302X},
support = {F32 DE026947/DE/NIDCR NIH HHS/United States ; R00 DE024543/DE/NIDCR NIH HHS/United States ; },
abstract = {To compete in the relatively exposed oral cavity, resident microbes must avoid being replaced by newcomers. This selective constraint, coupled with pressure on the host to cultivate a beneficial microbiome, has rendered a commensal oral microbiota that displays colonization resistance, protecting the human host from invasive species, including pathogens. Rapid increases in carbohydrate consumption have disrupted the evolved homeostasis between the oral microbiota and dental health, reflected by the high prevalence of dental caries. Development of novel modalities to prevent caries has been the subject of a breadth of research. This mini review provides highlights of these endeavors and discusses the rationale and pitfalls behind the major avenues of approach. Despite efficacy, fluoride and other broad-spectrum interventions are unlikely to further reduce the incidence of dental caries. The most promising methodologies in development are those that exploit the exclusive nature of the healthy oral microbiome. Probiotics derived from the dental plaque of healthy individuals sharply antagonize cariogenic species, such as Streptococcus mutans. Meanwhile, targeted antimicrobials allow for the killing of specific pathogens, allowing reestablishment of a healthy microbiome, presumably with its protective effects. The oral microbiota manufactures a massive array of small molecules, some of which are correlated with health and are likely to antagonize pathogens. The prohibitive cost associated with sufficiently rigorous clinical trials, and the status of dental caries as a non-life-threatening condition will likely continue to impede the advancement of new therapeutics to market. Nevertheless, there is room for optimism, as it appears evolution may have already provided the best tools.},
}
@article {pmid30686739,
year = {2019},
author = {Liu, X and Blackburn, TM and Song, T and Li, X and Huang, C and Li, Y},
title = {Risks of Biological Invasion on the Belt and Road.},
journal = {Current biology : CB},
volume = {29},
number = {3},
pages = {499-505.e4},
doi = {10.1016/j.cub.2018.12.036},
pmid = {30686739},
issn = {1879-0445},
abstract = {China's Belt and Road Initiative (BRI) is an unprecedented global development program that involves nearly half of the world's countries [1]. It not only will have economic and political influences, but also may generate multiple environmental challenges and is a focus of considerable academic and public concerns [2-6]. The Chinese government expects BRI to be a sustainable development, paying equal attention to economic development and environmental conservation [7]. However, BRI's high expenditure on infrastructure construction, by accelerating trade and transportation, is likely to promote alien species invasions [5], one of the primary anthropogenic threats to global biodiversity [8]. BRI countries may have different susceptibilities to invasive species due to different financial and response capacities [9]. Moreover, these countries overlap 27 of 35 recognized global biodiversity hotspots [10]. Identifying those areas with high-invasion risks, and species with high invasive potentials within BRI countries, is therefore of vital importance for the sustainable implementation of the BRI, and the development of early, economical, and effective biosecurity strategies [11]. In response, we present here a comprehensive study to evaluate invasion risks by alien vertebrates within BRI. We identified a total of 14 invasion hotspots, the majority of which fall along the six proposed BRI economic corridors, with the proportion of grid cells in invasion hotspots 1.6 times higher than other regions. Based on our results, we recommend the initiation of a project targeting early prevention, strict surveillance, rapid response, and effective control of alien species in BRI countries to ensure that this development is sustainable.},
}
@article {pmid30686419,
year = {2019},
author = {Roselli, L and Vadrucci, MR and Fanelli, F and Ungaro, N and Caroppo, C},
title = {First bloom event of the small dinoflagellate Prorocentrum shikokuense in the Mediterranean Sea: cryptogenic or introduced?.},
journal = {Marine pollution bulletin},
volume = {139},
number = {},
pages = {197-204},
doi = {10.1016/j.marpolbul.2018.12.034},
pmid = {30686419},
issn = {1879-3363},
abstract = {A bloom of putatively non-indigenous species (NIS) Prorocentrum shikokuense was detected for the first time in the Mediterranean Sea at the Brindisi harbor (Southern Adriatic Sea) on September 2016, in the context of EU Marine Strategy Framework Directive monitoring in the ports. This species is usually observed in the East China Sea and Japanese and Korean waters. In the Brindisi harbor this dinoflagellate reached the concentration 105 cell/L and represented from 30 to 50% of the total phytoplankton population. Besides this event, Prorocentrum shikokuense has not been found blooming until today in Mediterranean waters. This study suggests the necessity to improve the monitoring surveys in areas that are known vulnerable systems to alien and invasive species, such as ports.},
}
@article {pmid30682808,
year = {2019},
author = {Matoušková, M and Jurová, J and Gruľová, D and Wajs-Bonikowska, A and Renčo, M and Sedlák, V and Poráčová, J and Gogaľová, Z and Kalemba, D},
title = {Phytotoxic Effect of Invasive Heracleum mantegazzianum Essential Oil on Dicot and Monocot Species.},
journal = {Molecules (Basel, Switzerland)},
volume = {24},
number = {3},
pages = {},
doi = {10.3390/molecules24030425},
pmid = {30682808},
issn = {1420-3049},
abstract = {Spreading of the plant species in new areas is supported by the hypothesis in which chemicals produced by alien species are allopathic to native plants. A novel weapon hypothesis was tested by using essential oil of dangerous alien species Heracleum mantegazzianum in laboratory conditions. Aboveground plant material was collected in south-east part of Slovakia, dried and hydrodistilled for essential oil isolation. Dominant compounds as octyl acetate (62.6%), hexyl 2-metylbutyrate (10.7%), hexyl isobutyrate (7.5%) and hexyl butyrate (6.5%) were identified by GC-MS. Potential phytotoxic activity was tested on three dicot plant species garden cress (Lepidium sativum L.), radish (Raphanus sativus L.) and lettuce (Lactuca sativa L.) and on one monocot plant species wheat Triticum aestivum L. Germination of the seeds of model plant species after influencing by different doses of essential oil of H. mantegazzianum as well as the roots length was evaluated. Lepidium sativum L. and Raphanus sativus L. were generally not sensitive to applied doses of essential oil although a little stimulation effect at some concentrations prevailed over inhibition effect. Similarly, in monocot species Triticum aestivum L., stimulation was visible in both root length and root number at two or one highest doses, respectively.},
}
@article {pmid30681187,
year = {2019},
author = {Faisal, M and Loch, TP and Shavalier, M and VanDeuren, MG and Standish, I and Winters, A and Glenney, G and Aho, J and Wolgamood, M and VanAmberg, J and Eisch, E and Whelan, GE},
title = {Resurgence of Salmonid Herpesvirus-3 Infection (Epizootic Epitheliotropic Disease) in Hatchery-Propagated Lake Trout in Michigan.},
journal = {Journal of aquatic animal health},
volume = {},
number = {},
pages = {},
doi = {10.1002/aah.10051},
pmid = {30681187},
issn = {1548-8667},
support = {751N3200799//Michigan Department of Natural Resources/ ; 751P1300041//Michigan Department of Natural Resources/ ; 2014.1455//Great Lakes Fishery Trust/ ; },
abstract = {Over the past century, populations of Lake Trout Salvelinus namaycush have declined throughout the Great Lakes basin due to overfishing, habitat destruction, introduction of invasive species, and associated recruitment issues from high thiaminase, as well as emerging infectious diseases. To combat these declines, state and federal fishery management agencies undertook substantial stock enhancement efforts, including more stringent regulation of sport and commercial catch limits and increasing hatchery propagation of Lake Trout stocked into Great Lakes basin waterways. One state fish hatchery involved in these rehabilitation efforts experienced mass mortality events in 2012 and 2017. In 2012, following a period of abnormally heavy rain, hatchery staff observed abnormal behavior followed by increased mortalities in two strains of Lake Trout fingerlings, reaching upwards of 20% mortality and totaling a loss of approximately 100,000 fish. In 2017, following another heavy-rain season, 6-8% of 2-year-old Lake Trout experienced morbidity and mortality similar to that observed in 2012. During the 2012 event, Brook Trout Salvelinus fontinalis and splake (Lake Trout × Brook Trout hybrid) reared in flow-through systems receiving water from diseased Lake Trout remained clinically unaffected. Molecular analyses revealed all lots of affected Lake Trout were infected with the salmonid herpesvirus-3 (epizootic epitheliotropic disease virus [EEDV]), a disease that caused complete depopulation of this hatchery in the late 1980s and until 2012 was never again detected in this hatchery or in Michigan. Further sampling detected EEDV in apparently healthy 5-year-old Lake Trout and in wild Mottled Sculpin Cottus bairdii collected in the hatchery source water. The ability of the virus to replicate in tissues of infected fish was verified by exposing naïve Lake Trout to the filtered tissue homogenates of infected fish resulting in similar disease signs. Despite the virus going undetected for many years, these two EEDV episodes clearly demonstrate the continued presence of this deadly herpesvirus in the Great Lakes basin.},
}
@article {pmid30680106,
year = {2019},
author = {Brossette, L and Meunier, J and Dupont, S and Bagnères, AG and Lucas, C},
title = {Unbalanced biparental care during colony foundation in two subterranean termites.},
journal = {Ecology and evolution},
volume = {9},
number = {1},
pages = {192-200},
doi = {10.1002/ece3.4710},
pmid = {30680106},
issn = {2045-7758},
abstract = {Parental care is a major component of reproduction in social organisms, particularly during the foundation steps. Because investment into parental care is often costly, each parent is predicted to maximize its fitness by providing less care than its partner. However, this sexual conflict is expected to be low in species with lifelong monogamy, because the fitness of each parent is typically tied to the other's input. Somewhat surprisingly, the outcomes of this tug-of-war between maternal and paternal investments have received important attention in vertebrate species, but remain less known in invertebrates. In this study, we investigated how queens and kings share their investment into parental care and other social interactions during colony foundation in two termites with lifelong monogamy: the invasive species Reticulitermes flavipes and the native species R. grassei. Behaviors of royal pairs were recorded during six months using a non-invasive approach. Our results showed that queens and kings exhibit unbalanced investment in terms of grooming, antennation, trophallaxis, and vibration behavior. Moreover, both parents show behavioral differences toward their partner or their descendants. Our results also revealed differences among species, with R. flavipes exhibiting shorter periods of grooming and antennation toward eggs or partners. They also did more stomodeal trophallaxis and less vibration behavior. Overall, this study emphasizes that despite lifelong monogamy, the two parents are not equally involved in the measured forms of parental care and suggests that kings might be specialized in other tasks. It also indicates that males could play a central, yet poorly studied role in the evolution and maintenance of the eusocial organization.},
}
@article {pmid30680103,
year = {2019},
author = {Dalerum, F and Retief, TA and Havemann, CP and Chimimba, CT and Janse van Rensburg, B},
title = {The influence of distance to perennial surface water on ant communities in Mopane woodlands, northern Botswana.},
journal = {Ecology and evolution},
volume = {9},
number = {1},
pages = {154-165},
doi = {10.1002/ece3.4692},
pmid = {30680103},
issn = {2045-7758},
abstract = {Studies of biodiversity along environmental gradients provide information on how ecological communities change in response to biotic and abiotic factors. For instance, distance to water is associated with several factors that shape the structure and the functioning of ecosystems at a range of spatial scales. We investigated the influence of distance to a perennial water source on ant communities in a semi-arid savanna in northern Botswana. Ant abundance, taxonomic richness, and both alpha and beta diversity were generally higher during the wet than the dry season. However, there were strong seasonal influences on the effects of distance to water, with more pronounced effects during the wet season. While both abundance and beta diversity declined with increasing distances to water during the wet season, there was a contrasting increase in alpha diversity. There was no major effect of distance to water on taxonomic richness during either season. Beta diversity was as high across as along gradients, and we found support for modular rather than nested community structures along gradients. Our study demonstrated that small-scale gradients in distance to water can influence several aspects of ant communities in semi-arid savannas. However, our results also point to strong effects of small-scale environmental variation, for instance associated with vegetation characteristics, soil properties, and plant community structure that are not directly linked to water access.},
}
@article {pmid30679623,
year = {2019},
author = {Wang, S and Liu, C and Wu, J and Xu, C and Zhang, J and Bai, C and Gao, X and Liu, X and Li, X and Zhu, W and Li, Y},
title = {Propagule pressure and hunting pressure jointly determine genetic evolution in insular populations of a global frog invader.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {448},
doi = {10.1038/s41598-018-37007-6},
pmid = {30679623},
issn = {2045-2322},
support = {31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31530088//National Natural Science Foundation of China (National Science Foundation of China)/ ; },
abstract = {Islands are often considered to be more susceptible to biological invasions and to suffer greater impacts from invaders than mainland areas, and this difference is generally attributed to differences in species introductions, ecological factors or human activities between islands and mainland areas. Genetic variation, as a good estimate of evolutionary potential, can influence the invasion process and impacts of alien species. However, few studies have compared the genetic diversity of alien species between islands and a corresponding mainland. Here, we examined the genetic variation and differentiation in feral populations (30 sampled individuals/population) of a globally invasive species (the American bullfrog, Lithobates catesbeianus) that was extensively farmed on 14 islands in the Zhoushan Archipelago of China and in three nearby regions on the mainland. We quantified the relative importance of propagule pressure and hunting pressures on the genetic variation of bullfrog populations and found that insular populations have greater genetic variation than their mainland counterparts. Although genetic differentiation between the populations was observed, no evidence of recent bottlenecks or population expansion in any of the tested population was found. Our results suggest that the propagule pressures of bullfrogs escaping from farms, multiple releases and hunting pressure influence the genetic variation among bullfrog populations. These results might have important implications for understanding the establishment and evolution of alien species on islands and for the management of invasive species.},
}
@article {pmid30674335,
year = {2019},
author = {Eritja, R and Ruiz-Arrondo, I and Delacour-Estrella, S and Schaffner, F and Álvarez-Chachero, J and Bengoa, M and Puig, MÁ and Melero-Alcíbar, R and Oltra, A and Bartumeus, F},
title = {First detection of Aedes japonicus in Spain: an unexpected finding triggered by citizen science.},
journal = {Parasites &amp; vectors},
volume = {12},
number = {1},
pages = {53},
doi = {10.1186/s13071-019-3317-y},
pmid = {30674335},
issn = {1756-3305},
mesh = {*Aedes ; Animals ; Female ; *Introduced Species ; Mosquito Vectors ; Spain ; },
abstract = {BACKGROUND: Aedes japonicus is an invasive vector mosquito from Southeast Asia which has been spreading across central Europe since the year 2000. Unlike the Asian Tiger mosquito (Aedes albopictus) present in Spain since 2004, there has been no record of Ae. japonicus in the country until now.<br><br>RESULTS: Here, we report the first detection of Ae. japonicus in Spain, at its southernmost location in Europe. This finding was triggered by the citizen science platform Mosquito Alert. In June 2018, a citizen sent a report via the Mosquito Alert app from the municipality of Siero in the Asturias region (NW Spain) containing pictures of a female mosquito compatible with Ae. japonicus. Further information was requested from the participant, who subsequently provided several larvae and adults that could be classified as Ae. japonicus. In July, a field mission confirmed its presence at the original site and in several locations up to 9 km away, suggesting a long-time establishment. The strong media impact in Asturias derived from the discovery raised local participation in the Mosquito Alert project, resulting in further evidence from surrounding areas.<br><br>CONCLUSIONS: Whilst in the laboratory Ae. japonicus is a competent vector for several mosquito-borne pathogens, to date only West Nile virus is a concern based on field evidence. Nonetheless, this virus has yet not been detected in Asturias so the vectorial risk is currently considered low. The opportunity and effectiveness of combining citizen-sourced data to traditional surveillance methods are discussed.},
}
@article {pmid30673581,
year = {2018},
author = {Mayorquin, JS and Carrillo, JD and Twizeyimana, M and Peacock, BB and Sugino, KY and Na, F and Wang, DH and Kabashima, JN and Eskalen, A},
title = {Chemical Management of Invasive Shot Hole Borer and Fusarium Dieback in California Sycamore (Platanus racemosa) in Southern California.},
journal = {Plant disease},
volume = {102},
number = {7},
pages = {1307-1315},
doi = {10.1094/PDIS-10-17-1569-RE},
pmid = {30673581},
issn = {0191-2917},
abstract = {Fusarium dieback (FD) is a new vascular disease of hardwood trees caused by Fusarium spp. and other associated fungal species which are vectored by two recently introduced and highly invasive species of ambrosia beetle (Euwallacea spp. nr. fornicatus). One of these ambrosia beetles is known as the polyphagous shot hole borer (PSHB) and the other as the Kuroshio shot hole borer (KSHB). Together with the fungi that they vector, this pest-disease complex is known as the shot hole borer-Fusarium dieback (SHB-FD) complex. Mitigation of this pest-disease complex currently relies on tree removal; however, this practice is expensive and impractical given the wide host range and rapid advancement of the beetles throughout hardwoods in southern California. This study reports on the assessment of various pesticides for use in the management of SHB-FD. In vitro screening of 13 fungicides revealed that pyraclostrobin, trifloxystrobin, and azoxystrobin generally have lower effective concentration that reduces 50% of mycelial growth (EC50) values across all fungal symbionts of PSHB and KSHB; metconazole was found to have lower EC50 values for Fusarium spp. and Paracremonium pembeum. Triadimefon and fluxapyroxad were not capable of inhibiting any fungal symbiont at the concentrations tested. A 1-year field study showed that two insecticides, emamectin benzoate alone and in combination with propiconazole, and bifenthrin, could significantly reduce SHB attacks. Two injected fungicides (tebuconazole and a combination of carbendazim and debacarb) and one spray fungicide (metconazole) could also significantly reduce SHB attacks. Bioassays designed to assess fungicide retention 1 year postapplication revealed that six of the seven fungicides exhibited some level of inhibition in vitro and all thiabendazole-treated trees sampled exhibiting inhibition. This study has identified several pesticides which can be implemented as part of an integrated pest management strategy to reduce SHB infestation in low to moderately infested landscape California sycamore trees and potentially other landscape trees currently affected by SHB-FD.},
}
@article {pmid30673152,
year = {2019},
author = {Katris, NJ and Ke, H and McFadden, GI and van Dooren, GG and Waller, RF},
title = {Calcium negatively regulates secretion from dense granules in Toxoplasma gondii.},
journal = {Cellular microbiology},
volume = {},
number = {},
pages = {e13011},
doi = {10.1111/cmi.13011},
pmid = {30673152},
issn = {1462-5822},
support = {MR/M011690/1//Medical Research Council/United Kingdom ; DP120100599//Australian Research Council/ ; },
abstract = {Apicomplexan parasites including Toxoplasma gondii and Plasmodium spp. manufacture a complex arsenal of secreted proteins used to interact with and manipulate their host environment. These proteins are organised into three principle exocytotic compartment types according to their functions: micronemes for extracellular attachment and motility, rhoptries for host cell penetration, and dense granules for subsequent manipulation of the host intracellular environment. The order and timing of these events during the parasite's invasion cycle dictates when exocytosis from each compartment occurs. Tight control of compartment secretion is, therefore, an integral part of apicomplexan biology. Control of microneme exocytosis is best understood, where cytosolic intermediate molecular messengers cGMP and Ca2+ act as positive signals. The mechanisms for controlling secretion from rhoptries and dense granules, however, are virtually unknown. Here, we present evidence that dense granule exocytosis is negatively regulated by cytosolic Ca2+ , and we show that this Ca2+ -mediated response is contingent on the function of calcium-dependent protein kinases TgCDPK1 and TgCDPK3. Reciprocal control of micronemes and dense granules provides an elegant solution to the mutually exclusive functions of these exocytotic compartments in parasite invasion cycles and further demonstrates the central role that Ca2+ signalling plays in the invasion biology of apicomplexan parasites.},
}
@article {pmid30672635,
year = {2019},
author = {Javal, M and Lombaert, E and Tsykun, T and Courtin, C and Kerdelhué, C and Prospero, S and Roques, A and Roux, G},
title = {Deciphering the worldwide invasion of the Asian long-horned beetle: a recurrent invasion process from the native area together with a bridgehead effect.},
journal = {Molecular ecology},
volume = {},
number = {},
pages = {},
doi = {10.1111/mec.15030},
pmid = {30672635},
issn = {1365-294X},
abstract = {Retracing introduction routes is crucial for understanding the evolutionary processes involved in an invasion, as well as for highlighting the invasion history of a species at the global scale. The Asian long-horned beetle (ALB) Anoplophora glabripennis is a xylophagous pest native to Asia and invasive in North America and Europe. It is responsible for severe losses of urban trees, in both its native and invaded ranges. Based on historical and genetic data, several hypotheses have been formulated concerning its invasion history, including the possibility of multiple introductions from the native zone and secondary dispersal within the invaded areas, but none have been formally tested. In this study, we characterized the genetic structure of ALB in both its native and invaded ranges using microsatellites. In order to test different invasion scenarios we used an approximate Bayesian &quot;random forest&quot; algorithm together with traditional population genetics approaches. The strong population differentiation observed in the native area was not geographically structured, suggesting complex migration events that were probably human-mediated. Both native and invasive populations had low genetic diversity, but this characteristic did not prevent the success of the ALB invasions. Our results highlight the complexity of invasion pathways for insect pests. Specifically, our findings indicate that invasive species might be repeatedly introduced from their native range, and they emphasize the importance of multiple, human-mediated introductions in successful invasions. Finally, our results demonstrate that invasive species can spread across continents following a bridgehead path, in which an invasive population may have acted as a source for another invasion. This article is protected by copyright. All rights reserved.},
}
@article {pmid30671729,
year = {2019},
author = {Seyfarth, M and Khaireh, BA and Abdi, AA and Bouh, SM and Faulde, MK},
title = {Five years following first detection of Anopheles stephensi (Diptera: Culicidae) in Djibouti, Horn of Africa: populations established-malaria emerging.},
journal = {Parasitology research},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00436-019-06213-0},
pmid = {30671729},
issn = {1432-1955},
abstract = {The Asian malaria mosquito, Anopheles stephensi, is a well-known and important vector of Plasmodium falciparum and P. vivax. Until 2013, its geographical distribution was confined to central and southern Asia including the Arabian Peninsula. In the Horn of Africa (HoA) Region, An. stephensi was first recorded from Djibouti in 2012, when it was linked geographically and temporally with an unusual outbreak of urban P. falciparum malaria. In 2016, An. stephensi was detected in the neighbouring Somali Region of Ethiopia. In order to determine whether An. stephensi populations have become established in Djibouti and contributed to the unusual rise in local malaria cases there, we carried out continuous vector surveillance from January 2013 to December 2017, investigated seasonal changes in An. stephensi population densities and bionomics, analysed available literature describing malaria in Djibouti since 2013, and investigated whether An. stephensi may have contributed to local malaria transmission by detecting circumsporozoite antigen of P. falciparum and P. vivax in female anophelines. From 2013 to 2016, seasonal activity of An. stephensi in urban Djibouti City primarily occurred during the colder, wetter season between September and May, with either no or rare trap catches from June to August. Unlike past years, this species was detected year-round, including the extremely hot summer months of June to August 2017. This change in seasonal occurrence may indicate that An. stephensi populations are adapting to their new environment in sub-Saharan Africa, facilitating their spread within Djibouti City. Among the 96 female An. stephensi investigated for malaria infectivity, three (3.1%) were positive for P. falciparum circumsporozoite antigen, including one P. falciparum/P. vivax VK 210 double infection. Subsequent to the unusual resurgence of local malaria in 2013, with 1684 confirmed cased reported for that year, malaria case numbers increased continuously, peaking at 14,810 in 2017. Prior to 2016, only P. falciparum malaria cases had been reported, but in 2016, autochthonously acquired P. vivax malaria cases occurred for the first time at a rate of 16.7% among all malaria cases recorded that year. This number increased to 36.7% in 2017. Our data indicate that the dynamics of malaria species in Djibouti is currently changing rapidly, and that An. stephensi can be involved in the transmission of both P. falciparum and P. vivax, simultaneously. Considering the extremely high potential impact of urban malaria on public health, the timely deployment of optimal multinational vector surveillance and control programs against An. stephensi is strongly recommended, not only for the HoA Region, but for the entire African continent.},
}
@article {pmid30668628,
year = {2019},
author = {Liu, H and Wu, F and Wu, X and Ye, J},
title = {Differential effects of rapamycin on Bursaphelenchus xylophilus with different virulence and differential expression of autophagy genes under stresses in nematodes.},
journal = {Acta biochimica et biophysica Sinica},
volume = {},
number = {},
pages = {},
doi = {10.1093/abbs/gmy172},
pmid = {30668628},
issn = {1745-7270},
abstract = {Pine wilt disease (PWD) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus, is a devastating disease for Pinus spp. The virulence and resilience of PWN are closely linked to the spread and development of PWD. Numerous studies have shown that autophagy has important physiological and pathological functions in eukaryotes. But little is known about the relationships between autophagy and PWNs' virulence and resistance. In this study, through observation under the microscope and recording, we found the induction of autophagy by rapamycin could dramatically improve movement ability of PWNs with different virulence, and the highly virulent AMA3 isolate moved more than the low virulent YW4 isolate when autophagy was over-induced. High concentrations of rapamycin substantially improved the feeding and reproduction of AMA3 but not YW4. Conserved domains of autophagy genes BxATG3, BxATG4, and BxATG7 were first cloned from PWNs by reverse transcription-polymerase chain reaction (RT-PCR). Expression profiling of these three autophagy genes under biotic and abiotic stresses in PWNs with different virulence was determined by quantitative RT-PCR. The results revealed the expression levels of these three autophagy genes in PWNs with different virulence were increased significantly when nematodes were subject to high and low temperatures, oxidative stress, and defensive responses of pine trees. The expression levels of autophagy genes under biotic and abiotic stresses in AMA3 were higher than those in YW4, and different genes showed different performance. Our study clarified that autophagy was closely related to virulence and resistance of PWN, and the ability of a highly virulent isolate to regulate autophagy activity under stresses was stronger than that of a low virulent isolate.},
}
@article {pmid30665453,
year = {2019},
author = {Camp, JV and Kolodziejek, J and Nowotny, N},
title = {Targeted surveillance reveals native and invasive mosquito species infected with Usutu virus.},
journal = {Parasites &amp; vectors},
volume = {12},
number = {1},
pages = {46},
doi = {10.1186/s13071-019-3316-z},
pmid = {30665453},
issn = {1756-3305},
support = {H-282474/2017//Hochschuljubiläumsstiftung der Stadt Wien/ ; },
mesh = {Aedes/*virology ; Animals ; Culex/*virology ; Epidemiological Monitoring ; Female ; Flavivirus/*physiology ; Flavivirus Infections/epidemiology/*transmission/virology ; Humans ; Introduced Species ; Mosquito Vectors/*virology ; },
abstract = {BACKGROUND: The emergence of Usutu virus (USUV) in Europe was first reported in Austria, 2001, and the virus has since spread to many European countries. Initial outbreaks are marked by a mass die-off of European blackbirds (Turdus merula) and other bird species. During outbreaks, the virus has been detected in pools of Culex pipiens mosquitoes, and these mosquitoes are probably the most important enzootic vectors. Beginning in 2017, a second wave of blackbird deaths associated with USUV was observed in eastern Austria; the affected areas expanded to the Austrian federal states of Styria in the south and to Upper Austria in the west in 2018. We sampled the potential vector population at selected sites of bird deaths in 2018 in order to identify infected mosquitoes.<br><br>RESULTS: We detected USUV RNA in 16 out of 19 pools of Cx. pipiens/Cx. torrentium mosquitoes at sites of USUV-linked blackbird mortality in Linz and Graz, Austria. A disseminated virus infection was detected in individuals from selected pools, suggesting that Cx. pipiens form pipiens was the principal vector. In addition to a high rate of infected Cx. pipiens collected from Graz, a disseminated virus infection was detected in a pool of Aedes japonicus japonicus.<br><br>CONCLUSIONS: We show herein that naturally-infected mosquitoes at foci of USUV activity are primarily Cx. pipiens form pipiens. In addition, we report the first natural infection of Ae. j. japonicus with USUV, suggesting that it may be involved in the epizootic transmission of USUV in Europe. Ae. j. japonicus is an invasive mosquito whose range is expanding in Europe.},
}
@article {pmid30661709,
year = {2019},
author = {Jarić, I and Heger, T and Castro Monzon, F and Jeschke, JM and Kowarik, I and McConkey, KR and Pyšek, P and Sagouis, A and Essl, F},
title = {Crypticity in Biological Invasions.},
journal = {Trends in ecology &amp; evolution},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tree.2018.12.008},
pmid = {30661709},
issn = {1872-8383},
abstract = {Ecological effects of alien species can be dramatic, but management and prevention of negative impacts are often hindered by crypticity of the species or their ecological functions. Ecological functions can change dramatically over time, or manifest after long periods of an innocuous presence. Such cryptic processes may lead to an underestimation of long-term impacts and constrain management effectiveness. Here, we present a conceptual framework of crypticity in biological invasions. We identify the underlying mechanisms, provide evidence of their importance, and illustrate this phenomenon with case studies. This framework has potential to improve the recognition of the full risks and impacts of invasive species.},
}
@article {pmid30660844,
year = {2019},
author = {Gerhard, WA and Gunsch, CK},
title = {Metabarcoding and machine learning analysis of environmental DNA in ballast water arriving to hub ports.},
journal = {Environment international},
volume = {124},
number = {},
pages = {312-319},
doi = {10.1016/j.envint.2018.12.038},
pmid = {30660844},
issn = {1873-6750},
abstract = {While ballast water has long been linked to the global transport of invasive species, little is known about its microbiome. Herein, we used 16S rRNA gene sequencing and metabarcoding to perform the most comprehensive microbiological survey of ballast water arriving to hub ports to date. In total, we characterized 41 ballast, 20 harbor, and 6 open ocean water samples from four world ports (Shanghai, China; Singapore; Durban, South Africa; Los Angeles, California). In addition, we cultured Enterococcus and E. coli to evaluate adherence to International Maritime Organization standards for ballast discharge. Five of the 41 vessels - all of which were loaded in China - did not comply with standards for at least one indicator organism. Dominant bacterial taxa of ballast water at the class level were Alphaproteobacteria, Gammaproteobacteria, and Bacteroidia. Ballast water samples were composed of significantly lower proportions of Oxyphotobacteria than either ocean or harbor samples. Linear discriminant analysis (LDA) effect size (LEfSe) and machine learning were used to identify and test potential biomarkers for classifying sample types (ocean, harbor, ballast). Eight candidate biomarkers were used to achieve 81% (k nearest neighbors) to 88% (random forest) classification accuracy. Further research of these biomarkers could aid the development of techniques to rapidly assess ballast water origin.},
}
@article {pmid30659222,
year = {2019},
author = {Doody, JS and McHenry, CR and Rhind, D and Clulow, S},
title = {Novel habitat causes a shift to diurnal activity in a nocturnal species.},
journal = {Scientific reports},
volume = {9},
number = {1},
pages = {230},
doi = {10.1038/s41598-018-36384-2},
pmid = {30659222},
issn = {2045-2322},
abstract = {Plastic responses may allow individuals to survive and reproduce in novel environments, and can facilitate the establishment of viable populations. But can novel environments reveal plasticity by causing a shift in a behavior as fundamental and conspicuous as daily activity? We studied daily activity times near the invasion front of the cane toad (Rhinella marina), an invasive species that has colonized much of northern Australia. Cane toads in Australia are nocturnal, probably because diurnal activity would subject them to intolerably hot and dry conditions in the tropical savannah during the dry season. Our study can demonstrate, however, that upon reaching novel environments some toad populations became diurnal. Sandstone gorges offered cane toads novel, deeply shaded habitat. Gorges with an east-west axis (day-long northern shadow), narrow gorges and narrow sections of gorges contained toads that were primarily diurnal, while gorges with a north-south axis, wide gorges and wide sections of gorges contained mainly nocturnal toads. For example, remote camera data (1314 observations of toad activity times over 789 trap days) revealed strictly nocturnal activity at four 'exposed' sites (99% of 144 observations over 179 days), compared to mostly diurnal activity at a 'shaded' site (78% of 254 observations). Visual encounter surveys confirmed that diurnal activity occurred exclusively at shaded sites, while most nocturnal activity occurred at exposed sites. The close proximity of diurnal and nocturnal toads (4-7 km) provided compelling evidence for the abovementioned physical factors as the proximate cause of the behavioral dichotomy, and for a novel (deeply shaded gorges) environment causing the shift to diurnal activity.},
}
@article {pmid30659082,
year = {2019},
author = {McCormick, GL and Robbins, TR and Cavigelli, SA and Langkilde, T},
title = {Population history with invasive predators predicts innate immune function response to early life glucocorticoid exposure.},
journal = {The Journal of experimental biology},
volume = {},
number = {},
pages = {},
doi = {10.1242/jeb.188359},
pmid = {30659082},
issn = {1477-9145},
abstract = {Early life stress can suppress immune function, but it is unclear if transgenerational stress exposure modulates the immune consequences of early stress. In populations where, historically, the immune system is frequently activated, e.g. persistent stressors that cause injury, it may be maladaptive to suppress immune function after early life stress. Thus, the relationship between early life stress and immune function may vary with population-level historical stressor exposure. We collected gravid fence lizards (Sceloporus undulatus) from populations that naturally differ in long-term exposure to invasive fire ants (Solenopsis invicta). We manipulated early life stress in resulting offspring via weekly exposure to fire ants, application of the stress-relevant hormone corticosterone, or control treatment from 2 to 43 weeks of age. We quantified adult immune function in these offspring with baseline and antigen-induced hemagglutination and plasma bacterial killing ability. Early life corticosterone exposure suppressed baseline hemagglutination in offspring of lizards from populations without fire ants but enhanced hemagglutination in those from populations with fire ants. This enhancement may prepare lizards for high rates of wounding, toxin exposure, and infection associated with fire ant attack. Adult bacterial killing ability and hemagglutination were not affected by early life exposure to fire ants, but the latter was higher in offspring of lizards from invaded sites. A population's history of persistent wounding may thus alter individual long-term immunological responses to early life stressors. Further consideration of historical stressor exposure (type and duration) may be important to better understand how early life stressors affect adult physiology.},
}
@article {pmid30657879,
year = {2019},
author = {Stockton, D and Wallingford, A and Rendon, D and Fanning, P and Green, CK and Diepenbrock, L and Ballman, E and Walton, VM and Isaacs, R and Leach, H and Sial, AA and Drummond, F and Burrack, H and Loeb, GM},
title = {Interactions Between Biotic and Abiotic Factors Affect Survival in Overwintering Drosophila suzukii (Diptera: Drosophilidae).},
journal = {Environmental entomology},
volume = {},
number = {},
pages = {},
doi = {10.1093/ee/nvy192},
pmid = {30657879},
issn = {1938-2936},
abstract = {Drosophila suzukii Matsumura is an invasive species affecting berry crops and cherries throughout North America, South America, and Europe. Previous research suggests that in temperate climates, the overwintering success of D. suzukii is likely dependent on access to food, shelter, and adequate cold hardening. We performed a multi-state study under field conditions for two winters to determine whether D. suzukii sex, phenotype (summer-morphotype, winter-morphotype), and life stage (adults, pupae) affected survival over time while recording naturally-occurring spatial and temporal variation in temperature. Access to food was provided and the flies were buried under leaf litter. Baited traps were deployed to determine whether local populations of D. suzukii were active throughout the winter season. The duration of exposure, mean daily temperature, and cumulative time below freezing significantly affected survival. Below freezing, D. suzukii survival was significantly reduced, particularly in northern locations. In contrast, we observed sustained survival up to 10 wk in southern locations among adults and pupae. Biotic factors also significantly affected survival outcomes: female survival was greater than male survival, winter-morphotype survival was greater than summer-morphotype survival, and adult survival was greater than pupal survival. In the north, wild D. suzukii were captured only in early winter, while in the south they were found throughout the winter. These data suggest that although adult D. suzukii may overwinter in sheltered microclimates, this ability may be limited in regions where the ground temperature, or site of overwintering, falls below freezing for extended durations.},
}
@article {pmid30651649,
year = {2019},
author = {Van Patter, L and Flockhart, T and Coe, J and Berke, O and Goller, R and Hovorka, A and Bateman, S},
title = {Perceptions of community cats and preferences for their management in Guelph, Ontario. Part I: A quantitative analysis.},
journal = {The Canadian veterinary journal = La revue veterinaire canadienne},
volume = {60},
number = {1},
pages = {41-47},
pmid = {30651649},
issn = {0008-5286},
abstract = {In 2014, 116 Guelph residents were surveyed to investigate attitudes about community cats and preferences for population management. There are an estimated 29 579 owned cats in Guelph, an estimated 40% of residents allow outdoor access to their cat(s), and 8054 households (15%) feed community cats. Participants reported more concern with community cat welfare than nuisance behavior. There were high levels of support for responsible pet ownership education (90%), accessible or low-cost spay/neuter (86%), and trap-neuter-return (78%), and low levels of support for inaction (4%) and euthanasia (20%). Respondents who did not own cats or who considered cats as &quot;pests&quot; or a &quot;non-native, invasive species&quot; were more supportive of euthanasia. Results suggest that Guelph residents want to see action taken to address community cat population concerns, and that proactive management tools such as education, accessible or low-cost spay/neuter, and trap-neuter-return would be well supported and less divisive than euthanasia.},
}
@article {pmid30651473,
year = {2018},
author = {Marinho, CF and Costa, VA and Zucchi, RA},
title = {Annotated checklist and illustrated key to braconid parasitoids (Hymenoptera, Braconidae) of economically important fruit flies (Diptera, Tephritidae) in Brazil.},
journal = {Zootaxa},
volume = {4527},
number = {1},
pages = {21-36},
doi = {10.11646/zootaxa.4527.1.2},
pmid = {30651473},
issn = {1175-5334},
mesh = {Animals ; Brazil ; Drosophila ; *Hymenoptera ; *Tephritidae ; },
abstract = {The braconid parasitoids of fruit-infesting flies have been more intensively studied from the middle to late 1990s, when taxonomic research was restarted in Brazil. At the same time, efforts toward the biological control of fruit flies intensified, and an exotic species, Diachasmimorpha longicaudata, was introduced. In the decade 2010, another exotic species, Fopius arisanus, was introduced, and two new species of Doryctobracon were described. Currently, 12 species of braconids from the subfamilies Alysiinae (two species) and Opiinae (10 species) are associated with fruit flies of economic importance in Brazil, two of which are introduced species. More than half of the species belong to the genus Doryctobracon, with D. areolatus (Szépligeti) the most widely distributed species in Brazil.},
}
@article {pmid30648210,
year = {2019},
author = {Heshmati, I and Khorasani, N and Shams-Esfandabad, B and Riazi, B},
title = {Forthcoming risk of Prosopis juliflora global invasion triggered by climate change: implications for environmental monitoring and risk assessment.},
journal = {Environmental monitoring and assessment},
volume = {191},
number = {2},
pages = {72},
doi = {10.1007/s10661-018-7154-9},
pmid = {30648210},
issn = {1573-2959},
mesh = {*Climate Change ; Ecosystem ; *Environmental Monitoring ; Middle East ; Prosopis/*physiology ; Risk Assessment ; },
abstract = {Climate is a determinant factor in species distribution and climate change will affect the species abilities to occupy geographic regions. Prosopis juliflora is one of the most problematic invasive species and its biological invasion causes various negative effects in tropical, arid, and semi-arid regions of the world. As eradication efforts subsequent to the establishment of an alien invasive species are costly and time-consuming, assessing patterns of the introduction of an invasive species to new regions is among the most cost-effective means of monitoring and management of natural ecosystems. In this study by using the concept of species distribution modeling (SDM) and maximum entropy (MaxEnt) method, the effect of climate change on the current and future distribution of P. juliflora has been assessed at a global scale. Bioclimatic variables in current condition and 2050 regarding two global circulation models (GCM) and two climate change scenarios were considered as explanatory variables. Our results showed that annual mean temperature (BIO1), annual precipitation (BIO12), and temperature mean diurnal range (BIO2) represented more than 87% of the variations in the model, and with an AUC of 0.854 and TSS of 0.51, the model showed a good predictive performance. Our results indicate that on a global scale, suitable ranges for P. juliflora increase across all the GCM and RCP scenarios. In a global scale, Mediterranean Basin, Middle East, and North America are regions with the highest risk of range expansion in the future. Regarding the negative impacts of P. juliflora on structure and function of natural habitats in the invaded areas, findings of this study could be considered as a warning appliance for the environmental monitoring of the regions highly sensitive to the global invasion of the species. We suggest that assessing impacts of climate change on the global distribution of the invasive species could be used as an efficient tool to implement broad-scale and priority-setting monitoring programs in natural ecosystems.},
}
@article {pmid30648203,
year = {2019},
author = {Gouws, AJ and Shackleton, CM},
title = {A spatio-temporal, landscape perspective on Acacia dealbata invasions and broader land use and cover changes in the northern Eastern Cape, South Africa.},
journal = {Environmental monitoring and assessment},
volume = {191},
number = {2},
pages = {74},
doi = {10.1007/s10661-019-7204-y},
pmid = {30648203},
issn = {1573-2959},
support = {14/5/3/WR60010/1368//Agricultural Research Council/ ; },
mesh = {Acacia/*physiology ; *Conservation of Natural Resources ; Ecosystem ; *Environmental Monitoring ; South Africa ; },
abstract = {Biological invasions and human land use both have the potential to drastically alter the patterns and processes of landscapes, driving habitat fragmentation and altering natural disturbance regimes. The proliferation of an invasive species depends on composition and configuration of the landscape, as well as the invasiveness of the species. To effectively manage a highly invasive species, such as Acacia dealbata, it is crucial to understand the historical progression of the invasion within the landscape. This study sought to examine the landscape dynamics of biological invasions by tracking the historical spread of A. dealbata and broader land use/land cover (LULC) changes at different spatio-temporal scales in the northern Eastern Cape. A time-series of aerial photographs were systematically classified according to designated A. dealbata and LULC categories in ArcGIS to track the changes in the extent and rate of spread of A. dealbata. Markedly dynamic, multi-directional, and spatio-temporally variable LULC transitions were observed across the northern Eastern Cape over the last six decades. A. dealbata frequently retained a high proportion of cover over time, and despite the loss of cover to other LULC classes, a net increase in A. dealbata cover occurred as it spread at an overall annual rate of 0.11-0.21%, occupying approximately 8-18% of land cover across all sampled sites by 2013. Any management interventions to limit or control A. dealbata should therefore consider the spatio-temporal and LULC nuances of landscapes.},
}
@article {pmid30648021,
year = {2019},
author = {Purdon, J and Parr, CL and Somers, MJ},
title = {Grazing by large savanna herbivores indirectly alters ant diversity and promotes resource monopolisation.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6226},
doi = {10.7717/peerj.6226},
pmid = {30648021},
issn = {2167-8359},
abstract = {In savannas, grazing is an important disturbance that modifies the grass layer structure and composition. Habitat structural complexity influences species diversity and assemblage functioning. By using a combination of natural sites and manipulated experiments, we explored how habitat structure (grazing lawns and adjacent bunch grass) affects ant diversity and foraging behaviour, specifically the efficiency of resource acquisition, resource monopolisation and ant body size. We found that in the natural sites there was no difference in the amount of time ants took to locate resources, but in the manipulated experiments, ants were faster at locating resources and were more abundant in the simple treatments than in the more complex treatments. Ant body size was only affected by the manipulated experiments, with smaller ants found in the more complex treatments. In both the grazing lawn and bunch grass habitats there were differences in assemblage patterns of ants discovering resources and those dominating them. Seasonality, which was predicted to affect the speed at which ants discovered resources and the intensity of resource monopolisation, also played a role. We show that ants in winter monopolised more baits and discovered resources at a slower rate, but only at certain times within the experiment. Grazing in conjunction with season thus had a significant effect on ant diversity and foraging behaviour, with dominant ants promoted where habitat complexity was simplified when temperatures were low. Our results indicate that structural complexity plays a major role in determining ant assemblage structure and function in African savannas.},
}
@article {pmid30648019,
year = {2019},
author = {Clemmer, JH and Rettig, JE},
title = {Native bluegill influence the foraging and aggressive behavior of invasive mosquitofish.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6203},
doi = {10.7717/peerj.6203},
pmid = {30648019},
issn = {2167-8359},
abstract = {Two fish species that are common invaders of aquatic ecosystems world-wide are Gambusia affinis and G. holbrooki, commonly known as mosquitofish. In North America, introduced G. affinis are thought to have contributed to the population decline of several native fish species. Sunfish (family Centrarchidae) naturally occur across much of North American, thus mosquitofish and sunfish are likely to come into contact and interact more frequently as mosquitofish spread. However, the nature of this interaction is not well known. We used a lab experiment to explore whether and how the aggressive and foraging behaviors of G. affinis might be influenced by a representative and ubiquitous native centrarchid (Lepomis macrochirus; bluegill sunfish), a species with juveniles that inhabit littoral habitats also preferred by mosquitofish. The experiment partnered an individual male or female mosquitofish (focal fish) with a juvenile bluegill, or a same- or opposite-sex conspecific, filmed these one-to-one interactions, and quantified foraging and aggressive actions for the focal mosquitofish. We found that juvenile bluegill affect foraging in male mosquitofish, resulting in lower percent of handling attempts and handling time in which the male consumed a food item. The presence of juvenile bluegill also led to a reduction in the number of aggressive acts by mosquitofish compared to aggression levels when focal mosquitofish were with conspecifics. In nature, when mosquitofish encounter juvenile bluegill in littoral habitats, our results suggest that the foraging and aggressive behaviors of mosquitofish will be modified, especially for males. This mechanism may influence the rate or geographic extent of the spread of mosquitofish into North American waterbodies.},
}
@article {pmid30647243,
year = {2019},
author = {Lawrence, JF and Kirejtshuk, AG},
title = {Review of the Australian Cyllodini (Coleoptera: Nitidulidae: Nitidulinae), with descriptions of new taxa, and notes on the genus Macleayania (Nitidulini).},
journal = {Zootaxa},
volume = {4544},
number = {3},
pages = {301-334},
doi = {10.11646/zootaxa.4544.3.1},
pmid = {30647243},
issn = {1175-5334},
mesh = {Animals ; Australia ; *Coleoptera ; *Introduced Species ; },
abstract = {The genera of the nitiduline tribe Cyllodini occurring in Australia are reviewed and a key is provided for their separation. Each genus is discussed, with an emphasis on the Australian fauna, and an hypothesis is given concerning the source of the introduced Camptodes species and its connection with the program for biological control of Opuntia cacti. The specimens identified by Kirejtshuk (2003) as Macleayania amphotiformis (Reitter, 1880b) were found to represent two widely overlapping species later named by Olliff (1886) in the trogossitid genus Ancyrona. The following new genus and species are included: Cyllopallodes, gen. nov., Gymnocychramus bicolor, sp. nov., Pallodes nigroapicalis, sp. nov. The following new combinations and synonymies are also included: Coxollodes loriai (Grouvelle, 1906) (Pallodes) (= Pallodes opacus Grouvelle, 1906, syn. nov.); Cyllodes ruficeps (Reitter, 1880a) (Strongylus) (= Pseudocamptodes blackburni Grouvelle, 1902, syn. nov.; Pseudocamptodes fulviceps Grouvelle, 1906, syn. nov.); Cyllopallodes limbicollis (Reitter, 1880b) (Pallodes), comb. nov.; Pallodes beccarii Grouvelle, 1906 (= Pallodes gestroi Grouvelle, 1906, syn. nov.); Macleayania amphotiformis (Reitter, 1880b) (= Ancyrona amica Olliff, 1886, syn. nov.); Macleayania vesca (Olliff, 1886) (Ancyrona) comb. nov. The lectotypes of Camptodes humeralis (Brullé, 1842), Coxollodes loriai (Grouvelle, 1906), C. opacus (Grouvelle, 1906), Cyllodes fulvipes (Grouvelle, 1906), Pallodes beccarii Grouvelle, 1906, P. gestroi Grouvelle, 1906, and P. misellus Grouvelle, 1906 are designated. Information on and syntype information from Macleayania amica (Olliff, 1886), M. vesca (Olliff, 1886), Cyllodes blackburni (Grouvelle, 1906) and C. rufipes (Reitter, 1880a) are given.},
}
@article {pmid30645636,
year = {2019},
author = {Alves, DFR and López Greco, LS and Barros-Alves, SP and Hirose, GL},
title = {Sexual system, reproductive cycle and embryonic development of the red-striped shrimp Lysmata vittata, an invader in the western Atlantic Ocean.},
journal = {PloS one},
volume = {14},
number = {1},
pages = {e0210723},
doi = {10.1371/journal.pone.0210723},
pmid = {30645636},
issn = {1932-6203},
abstract = {Several decapod crustaceans are invaders, but little is known about the biological characteristics that potentiate the success of these decapods in invaded ecosystems. Here, we evaluate and describe some aspects of the reproductive biology and development of Lysmata vittata, an invasive shrimp species in the Atlantic Ocean. In addition, we intend to provide important insights into the biology of invasion by comparing the reproductive traits of this shrimp with some of the predictions about aquatic invasive species. We used experimental and laboratory observations to evaluate the functionality of protandric simultaneous hermaphroditism (PSH), the macro and microscopic development of the ovarian portion of the ovotestes, the reproductive cycle, and the embryonic development of L. vittata. We confirm the functionality of PSH in L. vittata. This shrimp has a rapid reproductive cycle; the ovarian portion of the ovotestes develops (mean ± SD) 6.28 ± 1.61 days after spawning. Embryonic development also occurs over a short time, with a mean (± SD) of 8.37 ± 0.85 days. The larvae hatch without macroscopically visible yolk reserves. Our study provides evidence that the invasive shrimp L. vittata has reproductive and embryonic developmental characteristics (i.e., short generation time and high reproductive capacity) that may be favorable to the establishment of populations during invasive processes.},
}
@article {pmid30643699,
year = {2019},
author = {Dong, Z and Morandini, AC and Schiariti, A and Wang, L and Sun, T},
title = {First record of Phyllorhiza sp. (Cnidaria: Scyphozoa) in a Chinese coastal aquaculture pond.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6191},
doi = {10.7717/peerj.6191},
pmid = {30643699},
issn = {2167-8359},
abstract = {Background: It has been suggested that aquaculture ponds on the Chinese coast could act as breeding grounds for scyphozoans. Here, we present the first record of the scyphomedusa Phyllorhiza sp. in an aquaculture pond on the coast of the southern Yellow Sea, based on a combination of morphological characteristics and mitochondrial 16S DNA sequence data.<br><br>Methods: A field survey was performed on June 29, 2017 in a pond used for culturing the shrimp Penaeus japonicus, located in the southern Yellow Sea, China. Jellyfish specimens were collected for morphological and genetic analysis. The morphological characters of the jellyfish specimens were compared to taxonomic literature. Additionally, phylogenetic analysis of the mitochondrial 16S fragments of these specimens were also conducted.<br><br>Results: These specimens had the following morphological characters: hemispherical umbrella without scapulets; J-shaped oral arms; a single larger terminal club on each arm; bluish colored with a slightly expanded white tip; and mouthlets present only in the lower half to one-third of each arm. These morphological features of the medusae indicated that the specimens found in the shrimp culture ponds belong to the genus Phyllorhiza Agassiz, 1862, but did not match with the description of any of the known species of the genus Phyllorhiza. Phylogenetic analyses of the mtDNA 16S regions revealed that these specimens, together with Phyllorhiza sp. from Malaysian coastal waters, belong to a sister group of Phyllorhiza punctata. Juveniles and ephyrae of Phyllorhiza sp. were observed in the aquaculture pond. The mean density of Phyllorhiza sp. medusa in the surface water within the pond was estimated to be 0.05 individuals/m2.<br><br>Discussion: Based on our observations of the gross morphology and molecular data, we state that the specimens collected in the aquaculture pond can be identified as Phyllorhiza sp. This is the first record of Phyllorhiza sp. in Chinese seas. Large scale dispersal through ballast water or the expansion of jellyfish aquarium exhibitions are possible pathways of invasion, but this needs to be confirmed in further studies.},
}
@article {pmid30643698,
year = {2019},
author = {Campbell, CD and Pecon-Slattery, J and Pollak, R and Joseph, L and Holleley, CE},
title = {The origin of exotic pet sugar gliders (Petaurus breviceps) kept in the United States of America.},
journal = {PeerJ},
volume = {7},
number = {},
pages = {e6180},
doi = {10.7717/peerj.6180},
pmid = {30643698},
issn = {2167-8359},
abstract = {The demand for exotic non-domesticated animals kept as pets in the United States of America (USA) is increasing the exportation rates of these species from their native ranges. Often, illegal harvesting of these species is used to boost captive-bred numbers and meet this demand. One such species, the sugar glider (Petaurus breviceps), endemic to Australia and New Guinea is a popular domestic pet due to its small size and &quot;cute&quot; demeanour. Despite a legal avenue for trade existing in Indonesia, concerns have been raised that sugar gliders may be entering the USA from other parts of their native range where exportation is prohibited such as Australia, Papua New Guinea and the surrounding Indonesian islands. We compared previously published DNA sequences from across the native range of sugar gliders with samples collected from domestically kept sugar gliders within the USA to determine provenance and gene flow between source and introduced populations. Here we show that as predicted, the USA sugar glider population originates from West Papua, Indonesia with no illegal harvesting from other native areas such as Papua New Guinea or Australia evident in the samples tested within this study.},
}
@article {pmid30641133,
year = {2019},
author = {Dong, F and Zhang, N and Xie, Z and Meng, X and Qian, K and Ji, C and Lu, M and Du, Y and Wang, J},
title = {Characterization and in vitro expression of arginine kinase gene in the invasive western flower thrips, Frankliniella occidentalis.},
journal = {Comparative biochemistry and physiology. Part B, Biochemistry &amp; molecular biology},
volume = {229},
number = {},
pages = {51-57},
doi = {10.1016/j.cbpb.2019.01.003},
pmid = {30641133},
issn = {1879-1107},
mesh = {Animals ; *Arginine Kinase/biosynthesis/chemistry/genetics ; *Gene Expression ; *Insect Proteins/biosynthesis/chemistry/genetics ; *Introduced Species ; Recombinant Proteins/biosynthesis/genetics ; *Thysanoptera/enzymology/genetics ; },
abstract = {Arginine kinase (AK) plays a critical role in insect energy metabolism and has been proposed to be a potential insecticide target for commercial exploitation. In this study, the full length cDNA encoding a typical group 1 insect AK (FoAK) was isolated from the western flower thrips (WFT), Frankliniella occidentalis (Pergande). Sequence analysis showed that FoAK contains an open reading frame of 1068 nucleotides, which encods a protein of 355 amino acid residues including the signature sequence pattern of ATP-guanidino kinases. Genomic structure analysis showed that the coding region of FoAK contains five exons connected by four introns. RT-qPCR analysis revealed that the mRNA expression of FoAK was developmentally regulated with the lowest level in prepupal stage. Enzymatic activity analysis of the recombinant enzymes expressed in Escherichia coli showed that FoAK is highly stereo specific for L-arginine versus D-arginine and the apparent Michaelis constant for L-arginine (KmArg) is comparable to that of AKs from a variety of species. This research should enable further investigation of the function as well as in vitro screening for inhibitors of FoAK.},
}
@article {pmid30640963,
year = {2019},
author = {Beasley, I and Cherel, Y and Robinson, S and Betty, E and Hagihara, R and Gales, R},
title = {Stomach contents of long-finned pilot whales, Globicephala melas mass-stranded in Tasmania.},
journal = {PloS one},
volume = {14},
number = {1},
pages = {e0206747},
doi = {10.1371/journal.pone.0206747},
pmid = {30640963},
issn = {1932-6203},
abstract = {New data are reported from analyses of stomach contents from 114 long-finned pilot whales mass-stranded at four locations around Tasmania, Australia from 1992-2006. Identifiable prey remains were recovered from 84 (74%) individuals, with 30 (26%) individuals (17 females and 13 males) having empty stomachs. Prey remains comprised 966 identifiable lower beaks and 1244 upper beaks, belonging to 17 families (26 species) of cephalopods. Ommastrephidae spp. were the most important cephalopod prey accounting for 16.9% by number and 45.6% by reconstructed mass. Lycoteuthis lorigera was the next most important, followed by Ancistrocheirus lesueurii. Multivariate statistics identified significant differences in diet among the four stranding locations. Long-finned pilot whales foraging off Southern Australia appear to be targeting a diverse assemblage of prey (≥10 species dominated by cephalopods). This is compared to other similar studies from New Zealand and some locations in the Northern Hemisphere, where the diet has been reported to be primarily restricted to ≤3 species dominated by cephalopods. This study emphasises the importance of cephalopods as primary prey for Southern long-finned pilot whales and other marine vertebrates, and has increased our understanding of long-finned pilot whale diet in Southern Ocean waters.},
}
@article {pmid30639717,
year = {2019},
author = {Guareschi, S and Wood, PJ},
title = {Taxonomic changes and non-native species: An overview of constraints and new challenges for macroinvertebrate-based indices calculation in river ecosystems.},
journal = {The Science of the total environment},
volume = {660},
number = {},
pages = {40-46},
doi = {10.1016/j.scitotenv.2019.01.008},
pmid = {30639717},
issn = {1879-1026},
abstract = {Freshwater ecosystems face many threats in the form of reduced water quantity, poor water quality and the loss of biodiversity. As a result, aquatic biomonitoring tools are required to enable the evaluation of these critical changes. Currently, macroinvertebrate-based indices are globally the most widely used biomonitoring tools in fluvial ecosystems. However, very little is known about the potential effects of changes in taxonomic understanding (updating of classification and nomenclature) or the presence of new non-native species for biotic indices calculation. This is especially relevant given that errors, incorrect classification or exclusion of new/updated nomenclature may affect ecological status evaluations and have direct consequences for the management and conservation of freshwater systems. In this discussion paper the main constraints, challenges and implications of these issues are outlined and case studies from a range of European countries are discussed. However, similar challenges affect rivers and managers globally and will potentially be amplified further in the future. Bioassessment science needs to be open to improvements, and current tools and protocols need to be flexible so that they can be updated and revised rapidly to allow new scientific developments to be integrated. This discussion highlights specific examples and new ideas that may contribute to the future development of aquatic biomonitoring using macroinvertebrates and other faunal and floral groups in riverine ecosystems.},
}
@article {pmid30637759,
year = {2019},
author = {Li, Q and Wang, N and Liu, X and Liu, S and Wang, H and Zhang, W and Wang, R and Du, N},
title = {Growth and physiological responses to successional water deficit and recovery in four warm-temperate woody species.},
journal = {Physiologia plantarum},
volume = {},
number = {},
pages = {},
doi = {10.1111/ppl.12922},
pmid = {30637759},
issn = {1399-3054},
abstract = {Plant responses to drought and their subsequent rehydration can provide evidence for forest dynamics within the context of climate change. In this study, the seedlings of two native species (Vitex negundo var. heterophylla, Quercus acutissima) and two exotic species (Robinia pseudoacacia, Amorpha fruticosa) in China were selected in a greenhouse experiment. The gas exchange, stem hydraulic parameters, plant osmoprotectant contents and antioxidant activities of the seedlings that were subjected to sustained drought and rehydration (test group) as well as those of well-irrigated seedlings (control group) were measured. The two native species exhibited a greater degree of isohydry with drought because they limited the stomatal opening timely from the onset of the drought. However, the two exotic species showed a more &quot;water spender&quot;-like strategy with R. pseudoacacia showing anisohydric responses and A. fruticosa showing isohydrodynamic responses to drought. Severe drought significantly decreased the leaf gas exchange rates and hydraulic properties, whereas the instantaneous water use efficiency and osmoprotectant contents increased markedly. Most of the physiological parameters recovered rapidly after mild drought rehydration, but the water potential and/or supply of nonstructural carbohydrates did not recover after severe drought rehydration. The results demonstrate that the xylem hydraulic conductivity and shoot water potential jointly play a crucial role in the drought recovery of woody plants. In brief, the native species may play a dominant role in the future in warm-temperate forests because they employ a better balance between carbon gain and water loss than the alien species under extreme drought conditions. This article is protected by copyright. All rights reserved.},
}
@article {pmid30633812,
year = {2019},
author = {Williams, J and Lambert, AM and Long, R and Saltonstall, K},
title = {Does hybrid Phragmites australis differ from native and introduced lineages in reproductive, genetic, and morphological traits?.},
journal = {American journal of botany},
volume = {106},
number = {1},
pages = {29-41},
doi = {10.1002/ajb2.1217},
pmid = {30633812},
issn = {1537-2197},
support = {//UCSB/ ; },
abstract = {PREMISE OF THE STUDY: Hybridization between previously isolated species or lineages can stimulate invasiveness because of increased genetic diversity and inherited traits facilitating competitive and reproductive potential. We evaluated differences in stand characteristics and sexual and vegetative reproduction among native, introduced, and hybrid Phragmites australis lineages in the southwestern United States. We also assessed the degree of hybridization among lineages and backcrossing of hybrids with parental lineages.<br><br>METHODS: Growth and morphological characteristics were measured in native, introduced, and hybrid Phragmites stands to evaluate relative cover and dominance in associated plant communities. Panicles were collected from stands to evaluate germination, dormancy, and differences in seed traits. Seedlings from germination trials were genotyped to determine frequency of crossing and backcrossing among lineages.<br><br>KEY RESULTS: Introduced and hybrid Phragmites stands had significantly greater stem and panicle densities than native stands and were more likely to be dominant members of their respective plant communities. Hybrid seed outputs were significantly greater, but hybrid seeds had lower germination rates than those from native and introduced lineages. We detected a novel hybridization event between native and introduced lineages, but found no strong evidence of hybrids backcrossing with parental lineages.<br><br>CONCLUSIONS: Hybrid Phragmites in the Southwest exhibits reproductive, genetic, and morphological characteristics from both parental lineages that facilitate dispersal, establishment, and aggressive growth, including high reproductive output, rhizome viability, and aboveground biomass, with smaller seeds and greater genetic diversity than its progenitors. Our results show hybrids can inherit traits that confer invasiveness and provide insight for managing this species complex and other cryptic species with native and introduced variants with potential for intraspecific hybridization.},
}
@article {pmid30629894,
year = {2019},
author = {Rodriguez-Saona, C and Vincent, C and Isaacs, R},
title = {Blueberry IPM: Past Successes and Future Challenges.},
journal = {Annual review of entomology},
volume = {64},
number = {},
pages = {95-114},
doi = {10.1146/annurev-ento-011118-112147},
pmid = {30629894},
issn = {1545-4487},
abstract = {Blueberry is a crop native to North America with expanding production and consumption worldwide. In the historical regions of production, integrated pest management (IPM) programs have been developed and provided effective control of key insect pests. These have integrated monitoring programs with physical, cultural, biological, behavioral, and chemical controls to meet the intense demands of consumers and modern food systems. Globalization of the blueberry industry has resulted in new pest-crop associations and the introduction of invasive pests into existing and new blueberry-growing areas. Invasive pests-in particular spotted wing drosophila-have been highly disruptive to traditional IPM programs, resulting in increased use of insecticides and the potential to disrupt beneficial insects. Moreover, regulatory agencies have reduced the number of broad-spectrum insecticides available to growers while facilitating registration and adoption of reduced-risk insecticides that have a narrower spectrum of activity. Despite these new tools, increasing international trade has constrained insecticide use because of maximum residue limits, which are often not standardized across countries. Great potential remains for biological, behavioral, cultural, and physical methods to contribute to blueberry IPM, and with more regions investing in blueberry research, we expect regionally relevant IPM programs to develop in the new production regions.},
}
@article {pmid30628723,
year = {2019},
author = {Carlucci, R and Mentino, D and Semeraro, D and Ricci, P and Sion, L and Scillitani, G},
title = {Comparative histochemical analysis of intestinal glycoconjugates in the blunthead pufferfish Sphoeroides pachygaster and grey triggerfish Balistes capriscus (Teleostei: Tetraodontiformes).},
journal = {Journal of fish biology},
volume = {94},
number = {1},
pages = {122-131},
doi = {10.1111/jfb.13871},
pmid = {30628723},
issn = {1095-8649},
abstract = {The localization of intestinal glycoconjugates of the blunthead pufferfish Sphoeroides pachygaster and the grey triggerfish Balistes capriscus from the north-western Ionian Sea was analysed by histochemical methods (PAS, AB pH 2.5, HID) and lectin binding experiments (WGA, LFA, SBA, sialidase-SBA, PNA, sialidase-PNA, ConA, AAA, UEA-I, LTA) to assess how evolutionary loss of a functional stomach in S. pachygaster affects intestinal secretions relative to the B. capriscus, which retains the plesiomorphic gastric condition. Sphoeroides pachygaster had a lower content of acid mucins but more complex sialylation patterns than B. capriscus. GalNAc and GlcNAc residuals were present in both, but GalNAc residuals in S. pachygaster were subterminal to sialic acid. Balistes capriscus lacked galactosylated residuals and its enterocytes had a glycocalyx that differed in composition between the small intestine and the rectum and was missing from S. pachygaster. Functional and ecological implications of these findings are discussed.},
}
@article {pmid30627765,
year = {2019},
author = {Junge, X and Hunziker, M and Bauer, N and Arnberger, A and Olschewski, R},
title = {Invasive Alien Species in Switzerland: Awareness and Preferences of Experts and the Public.},
journal = {Environmental management},
volume = {63},
number = {1},
pages = {80-93},
doi = {10.1007/s00267-018-1115-5},
pmid = {30627765},
issn = {1432-1009},
abstract = {Invasive alien species (IAS) can cause ecological and economic damages. To reduce or prevent these damages different management and prevention strategies aim to impede new establishments or a further spreading of IAS. However, for these measures to be successful, public knowledge of risks and threats of IAS as well as public support for eradication measures are important prerequisites. We conducted a survey to examine (i) public and experts' awareness and knowledge of IAS, (ii) their preferences for six invasive plant species and (iii) their preferences for and trade-offs among management alternatives in Switzerland. In addition, a choice experiment was applied to analyse preferences concerning the intensity, priority and costs of interventions. Both, the Swiss public and the experts have a preference for intervening against invasive alien species. However, the public and the experts differ in their priorities of combatting particular species, resulting in a different ranking of intervention necessities. Further, differences were found in the willingness to pay for interventions between the German-, French- and Italian-speaking parts of Switzerland. The results suggest that a higher problem awareness increases the willingness to pay for countermeasures. We conclude that education programs or information campaigns are promising instruments to raise public awareness and to avoid conflicts concerning the management of invasive alien species.},
}
@article {pmid30626952,
year = {2019},
author = {Ivey, PJ and Hill, MP and Coetzee, JA},
title = {South Africa beats back invasive plants.},
journal = {Nature},
volume = {565},
number = {7738},
pages = {161},
doi = {10.1038/d41586-019-00037-9},
pmid = {30626952},
issn = {1476-4687},
mesh = {Conservation of Natural Resources ; *Introduced Species ; Plants, Medicinal ; South Africa ; *Water ; },
}
@article {pmid30626082,
year = {2019},
author = {Xue, Q and Wu, XQ and Zhang, WJ and Deng, LN and Wu, MM},
title = {Cathepsin L-like Cysteine Proteinase Genes Are Associated with the Development and Pathogenicity of Pine Wood Nematode, Bursaphelenchus xylophilus.},
journal = {International journal of molecular sciences},
volume = {20},
number = {1},
pages = {},
doi = {10.3390/ijms20010215},
pmid = {30626082},
issn = {1422-0067},
support = {CX (16) 1005//Jiangsu Provincial Agricultural Science and Technology Innovation Fund/ ; PAPD//Priority Academic Program Development of Jiangsu Higher Education Institutions/ ; KYZZ16_0315//Innovation Plan for Graduate Students of Jiangsu, China/ ; },
abstract = {The pine wood nematode (PWN), Bursaphelenchus xylophilus, is the pathogen of pine wilt disease (PWD), resulting in huge losses in pine forests. However, its pathogenic mechanism remains unclear. The cathepsin L-like cysteine proteinase (CPL) genes are multifunctional genes related to the parasitic abilities of plant-parasitic nematodes, but their functions in PWN remain unclear. We cloned three cpl genes of PWN (Bx-cpls) by rapid amplification of cDNA ends (RACE) and analyzed their characteristics using bioinformatic methods. The tissue specificity of cpl gene of PWN (Bx-cpl) was studied using in situ mRNA hybridization (ISH). The functions of Bx-cpls in development and pathogenicity were investigated using real-time quantitative PCR (qPCR) and RNA interference (RNAi). The results showed that the full-length cDNAs of Bx-cpl-1, Bx-cpl-2, and Bx-cpl-3 were 1163 bp, 1305 bp, and 1302 bp, respectively. Bx-cpls could accumulate specifically in the egg, intestine, and genital system of PWN. During different developmental stages of PWN, the expression of Bx-cpls in the egg stage was highest. After infection, the expression levels of Bx-cpls increased and reached their highest at the initial stage of PWD, then declined gradually. The silencing of Bx-cpl could reduce the feeding, reproduction, and pathogenicity of PWN. These results revealed that Bx-cpls play multiple roles in the development and pathogenic processes of PWN.},
}
@article {pmid30175244,
year = {2018},
author = {Kamgang, B and Wilson-Bahun, TA and Irving, H and Kusimo, MO and Lenga, A and Wondji, CS},
title = {Geographical distribution of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) and genetic diversity of invading population of Ae. albopictus in the Republic of the Congo.},
journal = {Wellcome open research},
volume = {3},
number = {},
pages = {79},
doi = {10.12688/wellcomeopenres.14659.3},
pmid = {30175244},
issn = {2398-502X},
abstract = {Background: The arbovirus vector, Aedes albopictus, originating from Asia, has recently invaded African countries, including the Republic of the Congo, where it was associated with a chikungunya outbreak. Up until now, little was known about its distribution in relation to the native Aedes aegypti and how the invasion will modify the epidemiology of arboviral diseases. Here, we assessed the current distribution of Ae. albopictus and Ae. aegypti in the Republic of the Congo and explored the genetic diversity of the invading species, Ae. albopictus. Methods: Immature stages of Aedes were collected in nine locations in the Republic of the Congo in 2017 following a north-south transect and reared to adult stage. Adults were morphologically identified, counted and grouped according to species and location. Genetic diversity of Ae. albopictus was assessed by analyzing the cytochrome oxidase I (COI) gene. Results:Ae.albopictus and Ae. aegypti were found together across the country in all the locations investigated. The invasive species is predominant over the native species in all locations except Brazzaville, suggesting that Ae. albopictus is displacing Ae. aegypti across Congo. When comparing the species distributions across the two largest cities, Brazzaville and Pointe Noire, Ae. albopictus was more prevalent than Ae. aegypti in the suburbs whereas the opposite situation was reported in the city centre. Mitochondrial DNA analysis revealed very low genetic diversity of Ae. albopictus with only three haplotypes recorded across the country supporting the recent introduction of this species in the Republic of the Congo. Phylogenetic tree analysis revealed that Ae. albopictus from Congo originated from other tropical Asian countries such as China, likely as a result of increasing trade links. Conclusion: These findings are important for the implementation of vector control strategies and can serve as a foundation for further research on these vectors in the country.},
}
@article {pmid30624797,
year = {2019},
author = {Munro, D and Steer, J and Linklater, W},
title = {On allegations of invasive species denialism.},
journal = {Conservation biology : the journal of the Society for Conservation Biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/cobi.13278},
pmid = {30624797},
issn = {1523-1739},
abstract = {Science denialism retards evidenced-based policy and practice and should be challenged. It has been a particular concern for mitigating global environmental issues, like anthropogenic climate change. But allegations of science denialism must also be well founded and evidential or they risk eroding public-trust in science and scientists. Recently, 67 scholars, scientists and science writers were accused of 'invasive species denialism' (ISD) - the rejection of well-supported facts about invasive species, particularly the global scientific consensus about their negative impacts. We re-evaluated the ISD literature but could find no examples where scientific facts were refuted and just five articles with text perhaps consistent with one of the five characteristics of science denialism. We found, therefore, that allegations of ISD were misplaced. To understand why these accusations of science denialism have occurred we make two observations. First, invasion biology defines its subjects - invasive species - using multiple subjective and normative judgements. Thus, more than other applied sciences its consensus is one of shared values as much as agreed knowledge. Second, criticisms of invasion biology have largely targeted those subjective and normative judgments and their global imposition, not the discipline's knowledge. Regrettably, a few invasion biologists have misinterpreted the critique of their values-based consensus as a denial of their science when it is not. We provide some recommendations for making invasion biology a more robust and widely accepted, conservation science. A key recommendation is that invasion biology could avoid unnecessary misunderstandings and conflicts by being more accepting of perspectives originating from other disciplines, and more open to values-based critique from other scholars and scientists. This recommendation applies to all conservation sciences, especially those addressing global challenges, because they must serve and be relevant to communities with an extraordinary diversity of cultures and values. This article is protected by copyright. All rights reserved.},
}
@article {pmid30623885,
year = {2019},
author = {Vo, NTK and Seymour, CB and Mothersill, CE},
title = {The common field lampricide 3-trifluoromethyl-4-nitrophenol is a potential radiosensitizer in fish cells.},
journal = {Environmental research},
volume = {170},
number = {},
pages = {383-388},
doi = {10.1016/j.envres.2018.12.060},
pmid = {30623885},
issn = {1096-0953},
abstract = {PURPOSE: To evaluate if the common field lampricide 3-trifluoromethyl-4-nitrophenol (TFM) that is intended to eradicate the invasive species sea lampreys in the Great Lakes has the potential to sensitize radiation responses in cells from non-targeted native fish MATERIALS AND METHODS: The TFM toxicity was assessed acutely and chronically with the clonogenic fish cell line eelB. The acute toxicity (24-h exposure) was determined by the fluorescent cell viability probe Alamar Blue. The chronic toxicity was determined either by Alamar Blue (7-d exposure) or the clonogenic survival assay (14-d exposure). Pre- and post-exposure of fish cells to environmentally relevant TFM concentrations following gamma irradiation were performed. Clonogenic survival was determined to assess the damage level of radiation-induced reproductive cell death.<br><br>RESULTS: The chronic toxicity tests were more sensitive than the acute toxicity tests. The 14-d EC50 using the clonogenic survival endpoint was 2.09 ± 0.28 μg/mL and was statistically similar to the 7-d EC50 (1.85 ± 0.07 μg/mL) based on the Alamar Blue-based cytotoxicity endpoint. Post-exposure of cells to environmentally relevant TFM concentrations following irradiation did not have any effect as compared to the irradiation alone group. In contrast, pre-exposure of cells to TFM following irradiation had a negative additive effect when the total radiation dose was 2 Gy, but not 0.1 or 0.5 Gy.<br><br>CONCLUSION: Our results suggest that the common field lampricide TFM is a potential radiation sensitizer in cells from non-targeted native fish. This could be a health problem of concern for non-targeted native fish if a large accidental radioactive release occurs.},
}
@article {pmid30623106,
year = {2019},
author = {Wyckhuys, KAG and Hughes, AC and Buamas, C and Johnson, AC and Vasseur, L and Reymondin, L and Deguine, JP and Sheil, D},
title = {Biological control of an agricultural pest protects tropical forests.},
journal = {Communications biology},
volume = {2},
number = {},
pages = {10},
doi = {10.1038/s42003-018-0257-6},
pmid = {30623106},
issn = {2399-3642},
abstract = {Though often perceived as an environmentally-risky practice, biological control of invasive species can restore crop yields, ease land pressure and thus contribute to forest conservation. Here, we show how biological control against the mealybug Phenacoccus manihoti (Hemiptera) slows deforestation across Southeast Asia. In Thailand, this newly-arrived mealybug caused an 18% decline in cassava yields over 2009-2010 and an escalation in prices of cassava products. This spurred an expansion of cassava cropping in neighboring countries from 713,000 ha in 2009 to > 1 million ha by 2011: satellite imagery reveals 388%, 330%, 185% and 608% increases in peak deforestation rates in Cambodia, Lao PDR, Myanmar and Vietnam focused in cassava crop expansion areas. Following release of the host-specific parasitoid Anagyrus lopezi (Hymenoptera) in 2010, mealybug outbreaks were reduced, cropping area contracted and deforestation slowed by 31-95% in individual countries. Hence, when judiciously implemented, insect biological control can deliver substantial environmental benefits.},
}
@article {pmid30621776,
year = {2019},
author = {Zhu, GL and Tang, YY and Limpanont, Y and Wu, ZD and Li, J and Lv, ZY},
title = {Zoonotic parasites carried by invasive alien species in China.},
journal = {Infectious diseases of poverty},
volume = {8},
number = {1},
pages = {2},
doi = {10.1186/s40249-018-0512-6},
pmid = {30621776},
issn = {2049-9957},
support = {2016YFC1202003//the National Key Research and Development Program of China/ ; },
abstract = {BACKGROUND: The invasive alien species may lead to great environmental and economic crisis due to its strong capability of occupying the biological niche of native species and altering the ecosystem of the invaded area. However, its potential to serve as the vectors of some specific zoonotic pathogens, especially parasites, has been neglected. Thus, the damage that it may cause has been hugely underestimated in this aspect, which is actually an important public health problem. This paper aims to discuss the current status of zoonotic parasites carried by invasive alien species in China.<br><br>MAIN BODY: This review summarizes the reported zoonotic parasites carried by invasive alien species in China based on the Database of Invasive Alien Species in China. We summarize their prevalence, threat to human health, related reported cases, and the roles of invasive alien species in the life cycle of these parasites, and the invasion history of some invasive alien species. Furthermore, we sum up the current state of prevention and control of invasive alien species in China, and discuss about the urgency and several feasible strategies for the prevention and control of these zoonoses under the background of booming international communications and inevitable globalization.<br><br>CONCLUSIONS: Information of the zoonotic parasites carried by invasive alien species neither in China or worldwide, especially related case reports, is limited due to a long-time neglection and lack of monitoring. The underestimation of their damage requires more attention to the monitoring and control and compulsory measures should be taken to control the invasive alien species carrying zoonotic parasites.},
}
@article {pmid30620129,
year = {2019},
author = {Postigo, JL and Strubbe, D and Mori, E and Ancillotto, L and Carneiro, I and Latsoudis, P and Menchetti, M and Pârâu, LG and Parrott, D and Reino, L and Weiserbs, A and Senar, JC},
title = {Mediterranean versus Atlantic monk parakeets Myiopsitta monachus: Towards differentiated management at the European scale.},
journal = {Pest management science},
volume = {},
number = {},
pages = {},
doi = {10.1002/ps.5320},
pmid = {30620129},
issn = {1526-4998},
abstract = {BACKGROUND: The monk parakeet Myiopsitta monachus (Boddaert), native to South America is an invasive species in several European countries, causing crop damage and potential negative impacts on wildlife. Only Spain and Great Britain have regulations to control monk parakeets, thus fast growth and spread of populations are likely to occur on a wide scale. Aims of this research are to update the information on the distribution and population size of monk parakeets in Europe, to assess whether differences in population growth or spread rate exist between populations and to provide recommendations to decision makers.<br><br>RESULTS: Our study estimates 23758 monk parakeets in the wild across 179 municipalities in 8 EU countries, 84% of those municipalities held between 1-100 monk parakeets. All countries with a representative historical record are experiencing exponential growth of monk parakeets. The Mediterranean countries are experiencing higher exponential growth, spread rate and faster colonization of new municipalities than Atlantic countries.<br><br>CONCLUSIONS: We recommend to EU Mediterranean countries to consider the declaration of the monk parakeet as invasive alien species of regional concern, and to develop coordinated efforts in monitoring and managing the species, taking advantage of the low population sizes in most municipalities. This article is protected by copyright. All rights reserved.},
}
@article {pmid30615858,
year = {2019},
author = {Grumiaux, C and Andersen, MK and Colinet, H and Overgaard, J},
title = {Fluctuating thermal regime preserves physiological homeostasis and reproductive capacity in Drosophila suzukii.},
journal = {Journal of insect physiology},
volume = {113},
number = {},
pages = {33-41},
doi = {10.1016/j.jinsphys.2019.01.001},
pmid = {30615858},
issn = {1879-1611},
abstract = {Drosophila suzukii, an invasive species recently introduced in Europe, lays eggs in thin-skinned fruits and causes huge financial losses to fruit growers. One potential way to control this pest is the sterile insect technique (SIT) which demands a large stock of reproductive females to produce millions of sterile males to be released on demand. Unfortunately, Drosophila stocks age quickly, show declining fecundity when maintained at warm temperatures and conversely, they die from chill injury if they are maintained at constant low temperature. Here we investigate the potential of fluctuating thermal regime (FTR) as a storage method that harness the benefits of both warm and cold storage. Using a FTR with a daily warm period (1 h 20 at 25 °C) and cold period (20 h at 3 °C), interspaced by gradual heating and cooling, we compared longevity, fecundity and physiological condition between FTR females and females exposed to constant 25 °C and 3 °C. As hypothesised, FTR flies experienced much slower senescence (>3-fold increase in lifespan) and they preserved fecundity to a much higher age than flies from constant 25 °C. Flies maintained at constant 3 °C quickly died from chill injuries caused by a gradual loss of ion and water balance. In contrast, FTR flies were able to maintain ion and water balance (similar to 25 °C flies) as they were allowed to recover homeostasis during the short warm periods. Together these results demonstrate that FTR represents a useful protocol for storage of Drosophila stocks, and more broadly, this shows that the benefits of FTR are tightly linked with the insect ability to recover physiological homeostasis during the short warm periods.},
}
@article {pmid30604087,
year = {2019},
author = {Denley, D and Metaxas, A and Fennel, K},
title = {Community composition influences the population growth and ecological impact of invasive species in response to climate change.},
journal = {Oecologia},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00442-018-04334-4},
pmid = {30604087},
issn = {1432-1939},
support = {RGPIN-2016-04878//Natural Sciences and Engineering Research Council of Canada/ ; },
abstract = {Predicting long-term impacts of introduced species is challenging, since stressors related to global change can influence species-community interactions by affecting both demographic rates of invasive species and the structure of the invaded ecosystems. Invasive species can alter ecosystem structure over time, further complicating interactions between invasive species and invaded communities in response to additional stressors. Few studies have considered how cumulative impacts of species invasion and global change on the structure of invaded ecosystems may influence persistence and population growth of introduced species. Here, we present an empirically based population model for an invasive epiphytic bryozoan that can dramatically alter the structure of its invaded kelp bed ecosystems. We use this model to predict the response of invasive species to climate change and associated changes in the invaded community. Population growth of the bryozoan increased under near-future projections of increasing ocean temperature; however, the magnitude of population growth depended on the community composition of invaded kelp beds. Our results suggest that, in some cases, indirect effects of climate change mediated through changes to the structure of the invaded habitat can modulate direct effects of climate change on invasive species, with consequences for their long-term ecological impact. Our findings have important implications for management of invasive species, as modifying invaded habitats at local to regional scales may be more logistically feasible than addressing stressors related to global climate change.},
}
@article {pmid30604085,
year = {2019},
author = {Evangelista, C and Cucherousset, J and Lecerf, A},
title = {Contrasting ecological impacts of geographically close invasive populations.},
journal = {Oecologia},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00442-018-04333-5},
pmid = {30604085},
issn = {1432-1939},
support = {Projects ISOLAC//Onema/ ; ERADINVA//Onema/ ; Inva_Eco_Evo_Lac//PRES-Toulouse/ ; },
abstract = {Intraspecific trait variability is now well recognized as a key component of biodiversity explaining how individuals within a species can differentially interact with their environment. To date, however, this concept has rarely been incorporated in the study of biological invasions, despite its provision of new insights into invasive species management. Here, we used an experimental approach to investigate how invasive red swamp crayfish (Procambarus clarkii) derived from geographically close ecosystems can differentially impact prey community structure and relevant ecosystem processes. We also compared the magnitude of the effects induced by invasive species introduction with those induced by intraspecific variability. Our results showed that effects of intraspecific variability can be strong for direct interactions such as resource (e.g., leaf litter, snails) consumption and of similar magnitude to the effects induced by the introduction of the invasive species when considering indirect interactions (e.g., primary production, ecosystem metabolism). Overall, these results highlighted that invasive populations of the same species are not ecologically equivalent, with each population acting differently on their recipient ecosystem.},
}
@article {pmid30603992,
year = {2019},
author = {Alqawasmeh, Y and Lutscher, F},
title = {Persistence and spread of stage-structured populations in heterogeneous landscapes.},
journal = {Journal of mathematical biology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00285-018-1317-8},
pmid = {30603992},
issn = {1432-1416},
support = {RGPIN-2016-04795//Natural Sciences and Engineering Research Council of Canada/ ; },
abstract = {Conditions for population persistence in heterogeneous landscapes and formulas for population spread rates are important tools for conservation ecology and invasion biology. To date, these tools have been developed for unstructured populations, yet many, if not all, species show two or more distinct phases in their life cycle. We formulate and analyze a stage-structured model for a population in a heterogeneous habitat. We divide the population into pre-reproductive and reproductive stages. We consider an environment consisting of two types of patches, one where population growth is positive, one where it is negative. Individuals move randomly within patches but can show preference towards one patch type at the interface between patches. We use linear stability analysis to determine persistence conditions, and we derive a dispersion relation to find spatial spread rates. We illustrate our results by comparing the structured population model with an appropriately scaled unstructured model. We find that a long pre-reproductive state typically increases habitat requirements for persistence and decreases spatial spread rates, but we also identify scenarios in which a population with intermediate maturation rate spreads fastest.},
}
@article {pmid30601574,
year = {2019},
author = {Peng, S and Kinlock, NL and Gurevitch, J and Peng, S},
title = {Correlation of native and exotic species richness: a global meta-analysis finds no invasion paradox across scales.},
journal = {Ecology},
volume = {100},
number = {1},
pages = {e02552},
doi = {10.1002/ecy.2552},
pmid = {30601574},
issn = {0012-9658},
support = {31030015//National Natural Science Foundation of China/ ; //Chinese Scholarship Council and the Scientific Research Foundation/ ; //Sun Yat-sen University/ ; },
abstract = {Support for the &quot;biotic resistance hypothesis,&quot; that species-rich communities are more successful at resisting invasion by exotic species than are species-poor communities, has long been debated. It has been argued that native-exotic richness relationships (NERR) are negative at small spatial scales and positive at large scales, but evidence for the role of spatial scale on NERR has been contradictory. However, no formal quantitative synthesis has previously examined whether NERR is scale-dependent across multiple studies, and previous studies on NERR have not distinguished spatial grain and extent, which may drive very different ecological processes. We used a global systematic review and hierarchical mixed-effects meta-analysis to provide a comprehensive quantitative assessment of the patterns of NERR over a range of spatial grain sizes and spatial extents, based on 204 individual cases of observational (non-experimental) NERRs from 101 publications. We show that NERR was indeed highly scale dependent across studies and increased with the log of grain size. However, mean NERR was not negative at any grain size, although there was high heterogeneity at small grain sizes. We found no clear patterns of NERR across different spatial extents, suggesting that extent plays a less important role in determining NERR than does grain, although there was a complex interaction between extent and grain size. Almost all studies on NERR were conducted in North America, western Europe, and a few other regions, with little information on tropical or Arctic regions. We did find that NERR increased northward in temperate regions and also varied with longitude. We discuss possible explanations for the patterns we found, and caution that our results do not show that invasive species are benign or have no negative consequences for biodiversity preservation. This study represents the first global quantitative analysis of scale-based NERR, and casts doubt on the existence of an &quot;invasion paradox&quot; of negative NERR at small scales and positive correlations at large scales in non-experimental studies.},
}
@article {pmid30598861,
year = {2018},
author = {Leimbach-Maus, HB and Parks, SR and Partridge, CG},
title = {Microsatellite primer development for the invasive perennial herb Gypsophila paniculata (Caryophyllaceae).},
journal = {Applications in plant sciences},
volume = {6},
number = {12},
pages = {e01203},
doi = {10.1002/aps3.1203},
pmid = {30598861},
issn = {2168-0450},
abstract = {Premise of the Study: Gypsophila paniculata (baby's breath; Caryophyllaceae) is a herbaceous perennial that has invaded much of northern and western United States and Canada, outcompeting and crowding out native and endemic species. Microsatellite primers were developed to analyze the genetic structure of invasive populations.<br><br>Methods and Results: We identified 16 polymorphic nuclear microsatellite loci for G. paniculata out of 73 loci that successfully amplified from a primer library created using Illumina sequencing technology. Microsatellite primers were developed to amplify di-, tri-, and tetranucleotide repeats and tested in three invasive populations in Michigan.<br><br>Conclusions: These markers will be useful in characterizing the genetic structure of invasive populations throughout North America to aid targeted management efforts, and in native Eurasian populations to better understand invasion history. Five of these developed primers also amplified in G. elegans.},
}
@article {pmid30598809,
year = {2018},
author = {Fukui, S and May-McNally, SL and Taylor, EB and Koizumi, I},
title = {Maladaptive secondary sexual characteristics reduce the reproductive success of hybrids between native and non-native salmonids.},
journal = {Ecology and evolution},
volume = {8},
number = {23},
pages = {12173-12182},
doi = {10.1002/ece3.4676},
pmid = {30598809},
issn = {2045-7758},
abstract = {Human-mediated hybridization between introduced and native species is one of the most serious threats to native taxa. Although field studies have attempted to quantify the relative fitness or reproductive success of parental species and their hybrids, only a few studies have unraveled the factors determining the fitness of hybrids. Here, we hypothesized that maladaptive secondary sexual characteristics may reduce fitness of hybrids between two fish species. To test this, we evaluated the reproductive success of introduced brook trout (BT: Salvelinus fontinalis), native white-spotted charr (WSC: S. leucomaenis) and their hybrids in a natural stream in Hokkaido, Japan, where the two parental species show remarkably different male secondary sexual characteristics, such as elongated jaws and deeper bodies. We predicted that introgression from WSC is maladaptive for BT males because the BT male has more prominent secondary sexual characteristics. Our results suggest that both sexual selection and outbreeding depression in males and females significantly influence an individual's reproductive success. Our results also suggest that asymmetric introgression may increase the risks to persistence in the recipient species.},
}
@article {pmid30598787,
year = {2018},
author = {Ng, WT and Cândido de Oliveira Silva, A and Rima, P and Atzberger, C and Immitzer, M},
title = {Ensemble approach for potential habitat mapping of invasive Prosopis spp. in Turkana, Kenya.},
journal = {Ecology and evolution},
volume = {8},
number = {23},
pages = {11921-11931},
doi = {10.1002/ece3.4649},
pmid = {30598787},
issn = {2045-7758},
abstract = {Aim: Prosopis spp. are an invasive alien plant species native to the Americas and well adapted to thrive in arid environments. In Kenya, several remote-sensing studies conclude that the genus is well established throughout the country and is rapidly invading new areas. This research aims to model the potential habitat of Prosopis spp. by using an ensemble model consisting of four species distribution models. Furthermore, environmental and expert knowledge-based variables are assessed.<br><br>Location: Turkana County, Kenya.<br><br>Methods: We collected and assessed a large number of environmental and expert knowledge-based variables through variable correlation, collinearity, and bias tests. The variables were used for an ensemble model consisting of four species distribution models: (a) logistic regression, (b) maximum entropy, (c) random forest, and (d) Bayesian networks. The models were evaluated through a block cross-validation providing statistical measures.<br><br>Results: The best predictors for Prosopis spp. habitat are distance from water and built-up areas, soil type, elevation, lithology, and temperature seasonality. All species distribution models achieved high accuracies while the ensemble model achieved the highest scores. Highly and moderately suitable Prosopis spp. habitat covers 6% and 9% of the study area, respectively.<br><br>Main conclusions: Both ensemble and individual models predict a high risk of continued invasion, confirming local observations and conceptions. Findings are valuable to stakeholders for managing invaded area, protecting areas at risk, and to raise awareness.},
}
@article {pmid30595990,
year = {2018},
author = {Holland, EP and Binny, RN and James, A},
title = {Optimal control of irrupting pest populations in a climate-driven ecosystem.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e6146},
doi = {10.7717/peerj.6146},
pmid = {30595990},
issn = {2167-8359},
abstract = {Irruptions of small consumer populations, driven by pulsed resources, can lead to adverse effects including the decline of indigenous species or increased disease spread. Broad-scale pest management to combat such effects benefits from forecasting of irruptions and an assessment of the optimal control conditions for minimising consumer abundance. We use a climate-based consumer-resource model to predict irruptions of a pest species (Mus musculus) population in response to masting (episodic synchronous seed production) and extend this model to account for broad-scale pest control of mice using toxic bait. The extended model is used to forecast the magnitude and frequency of pest irruptions under low, moderate and high control levels, and for different timings of control operations. In particular, we assess the optimal control timing required to minimise the frequency with which pests reach 'plague' levels, whilst avoiding excessive toxin use. Model predictions suggest the optimal timing for mouse control in beech forest, with respect to minimising plague time, is mid-September. Of the control regimes considered, a seedfall driven biannual-biennial regime gave the greatest reduction in plague time and plague years for low and moderate control levels. Although inspired by a model validated using house mouse populations in New Zealand forests, our modelling approach is easily adapted for application to other climate-driven systems where broad-scale control is conducted on irrupting pest populations.},
}
@article {pmid30594137,
year = {2018},
author = {Eyer, PA and McDowell, B and Johnson, LNL and Calcaterra, LA and Fernandez, MB and Shoemaker, D and Puckett, RT and Vargo, EL},
title = {Supercolonial structure of invasive populations of the tawny crazy ant Nylanderia fulva in the US.},
journal = {BMC evolutionary biology},
volume = {18},
number = {1},
pages = {209},
doi = {10.1186/s12862-018-1336-5},
pmid = {30594137},
issn = {1471-2148},
mesh = {Aggression ; Animals ; Ants/*classification/*genetics/physiology ; Female ; Genetic Variation ; Genetics, Population ; Male ; Microsatellite Repeats ; Social Behavior ; United States ; },
abstract = {BACKGROUND: Social insects are among the most serious invasive pests in the world, particularly successful at monopolizing environmental resources to outcompete native species and achieve ecological dominance. The invasive success of some social insects is enhanced by their unicolonial structure, under which the presence of numerous queens and the lack of aggression against non-nestmates allow high worker densities, colony growth, and survival while eliminating intra-specific competition. In this study, we investigated the population genetics, colony structure and levels of aggression in the tawny crazy ant, Nylanderia fulva, which was recently introduced into the United States from South America.<br><br>RESULTS: We found that this species experienced a genetic bottleneck during its invasion lowering its genetic diversity by 60%. Our results show that the introduction of N. fulva is associated with a shift in colony structure. This species exhibits a multicolonial organization in its native range, with colonies clearly separated from one another, whereas it displays a unicolonial system with no clear boundaries among nests in its invasive range. We uncovered an absence of genetic differentiation among populations across the entire invasive range, and a lack of aggressive behaviors towards conspecifics from different nests, even ones separated by several hundreds of kilometers.<br><br>CONCLUSIONS: Overall, these results suggest that across its entire invasive range in the U.S.A., this species forms a single supercolony spreading more than 2000 km. In each invasive nest, we found several, up to hundreds, of reproductive queens, each being mated with a single male. The many reproductive queens per nests, together with the free movement of individuals between nests, leads to a relatedness coefficient among nestmate workers close to zero in introduced populations, calling into question the stability of this unicolonial system in which indirect fitness benefits to workers is apparently absent.},
}
@article {pmid30587673,
year = {2018},
author = {Kuninaga, N and Asano, M and Matsuyama, R and Minemoto, T and Mori, T and Suzuki, M},
title = {Serological and histological evaluation of species-specific immunocontraceptive vaccine antigens based on zona pellucida 3 in the small Indian mongoose (Herpestes auropunctatus).},
journal = {The Journal of veterinary medical science},
volume = {},
number = {},
pages = {},
doi = {10.1292/jvms.17-0605},
pmid = {30587673},
issn = {1347-7439},
abstract = {The small Indian mongoose (Herpestes auropunctatus) was introduced to Japanese islands and has impacted on the island's biodiversity. Population control has been attempted through capturing but its efficiency has rapidly declined. Therefore, new additional control methods are required. Our focus has been on the immunocontraceptive vaccines, which act in an especially species-specific manner. The amino-acid sequence of the mongoose ovum zona pellucida protein 3 (ZP3) was decoded and two types of synthetic peptides (A and B) were produced. In this study, these peptides were administered to mongooses (each n=3) and the sera were collected to verify immunogenicity using ELISA and IHC. Treated mongoose sera showed an increasing of antibody titer according to immunizations and the antigen-antibody reactions against the endogenous mongoose ZP. In addition, IHC revealed that immune sera absorbed with each peptide showed a marked reduction in reactivity, which indicated the specificity of induced antibodies. These reactions were marked in peptide A treated mongoose sera, and the antibody titer of one of them lasted for at least 21 weeks. These results indicated that peptide A was a potential antigen, inducing autoantibody generation. Moreover, immunized rabbit antibodies recognized mongoose ZP species-specifically. However, the induction of robust immune memory was not observed. Also, the actual sterility effects of peptides remain unknown, it should be verified as a next step. In any case, this study verified synthetic peptides we developed are useful as the antigen candidates for immunocontraception of mongooses.},
}
@article {pmid30587105,
year = {2018},
author = {Kutch, IC and Fedorka, KM},
title = {Y-chromosomes can constrain adaptive evolution via epistatic interactions with other chromosomes.},
journal = {BMC evolutionary biology},
volume = {18},
number = {1},
pages = {204},
doi = {10.1186/s12862-018-1327-6},
pmid = {30587105},
issn = {1471-2148},
mesh = {Animals ; Drosophila melanogaster/*genetics/physiology ; *Epistasis, Genetic ; Female ; Gene Expression Regulation ; Genetic Variation ; Genome ; Male ; Sex Characteristics ; *Y Chromosome ; },
abstract = {BACKGROUND: Variation in the non-coding regions of Y-chromosomes have been shown to influence gene regulation throughout the genome in some systems; a phenomenon termed Y-linked regulatory variation (YRV). This type of sex-specific genetic variance could have important implications for the evolution of male and female traits. If YRV contributes to the additive genetic variation of an autosomally coded trait shared between the sexes (e.g. body size), then selection could facilitate sexually dimorphic evolution via the Y-chromosome. In contrast, if YRV is entirely non-additive (i.e. interacts epistatically with other chromosomes), then Y-chromosomes could constrain trait evolution in both sexes whenever they are selected for the same trait value. The ability for this phenomenon to influence such fundamental evolutionary dynamics remains unexplored.<br><br>RESULTS: Here we address the evolutionary contribution of Y-linked variance by selecting for improved male geotaxis in populations possessing multiple Y-chromosomes (i.e. possessed Y-linked additive and/or epistatic variation) or a single Y-chromosome variant (i.e. possessed no Y-linked variation). We found that males from populations possessing Y-linked variation did not significantly respond to selection; however, males from populations with no Y-linked variation did respond. These patterns suggest the presence of a large quantity of Y-linked epistatic variance in the multi-Y population that dramatically slowed its response.<br><br>CONCLUSIONS: Our results imply that YRV is unlikely to facilitate the evolution of sexually dimorphic traits (at least for the trait examined here), but can interfere with the rate of trait evolution in both males and females. This result could have real biological implications as it suggests that YRV can affect how quickly a population responds to new selective pressures (e.g. invasive species, novel pathogens, or climate change). Considering that YRV influences hundreds of genes and is likely typical of other independently-evolved hemizygous chromosomes, YRV-like phenomena may represent common and significant costs to hemizygous sex determination.},
}
@article {pmid30586169,
year = {2018},
author = {Policelli, N and Bruns, TD and Vilgalys, R and Nuñez, MA},
title = {Suilloid fungi as global drivers of pine invasions.},
journal = {The New phytologist},
volume = {},
number = {},
pages = {},
doi = {10.1111/nph.15660},
pmid = {30586169},
issn = {1469-8137},
support = {1554181//NSF/ ; PICT 2014-0662//FONCyT/ ; PICT 2016-1412//FONCyT/ ; },
abstract = {Belowground biota can deeply influence plant invasion. The presence of appropriate soil mutualists can act as a driver to enable plants to colonize new ranges. We reviewed the species of ectomycorrhizal fungi (EMF) that facilitate pine establishment in both native and non-native ranges, and that are associated with their invasion into nonforest settings. We found that one particular group of EMF, suilloid fungi, uniquely drive pine invasion in the absence of other EMF. Although the association with other EMF is variable, suilloid EMF are always associated with invasive pines, particularly at early invasion, when invasive trees are most vulnerable. We identified five main ecological traits of suilloid fungi that may explain their key role at pine invasions: their long-distance dispersal capacity, the establishment of positive biotic interactions with mammals, their capacity to generate a resistant spore bank, their rapid colonization of roots and their long-distance exploration type. These results suggest that the identity of mycorrhizal fungi and their ecological interactions, rather than simply the presence of compatible fungi, are key to the understanding of plant invasion processes and their success or failure. Particularly for pines, their specific association with suilloid fungi determines their invasion success in previously uninvaded ecosystems.},
}
@article {pmid30585425,
year = {2018},
author = {Richard, SA and Tillman, EA and Humphrey, JS and Avery, ML and Parker, MR},
title = {Male Burmese pythons follow female scent trails and show sex-specific behaviors.},
journal = {Integrative zoology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1749-4877.12376},
pmid = {30585425},
issn = {1749-4877},
abstract = {Animals communicate with potential mates using species-specific signals, and pheromones are powerful sexual signals that modify conspecific behavior to facilitate mate location. Among the vertebrates, snakes are especially adept in mate searching via chemical trailing, which is particularly relevant given that many snake species are invasive outside their native ranges. Chemical signals used in mate choice are thus potentially valuable tools for management of invasive snake species. The Burmese python (Python bivittatus) is an invasive snake in the Florida Everglades where it is negatively impacting native fauna. In this study, we sought to (1) determine if males can follow conspecific chemical trails in a Y-maze and (2) describe the mate searching behaviors exhibited by males while trailing. All males consistently followed a single female scent trail in the maze, but when only a male scent trail was present they did not discriminate between the male and blank arms. Rate of tongue-flicking, a proxy for chemosensory sampling, was also marginally higher when males were following female vs. male scent trails. However, when both female and male scent trails were simultaneously present in the Y-maze, males did not show a preference for the female arm, though tongue-flick rate was higher in the female-only trial compared to female vs. male. Analyses of multiple male behaviors individually and using an ethogram revealed that behaviors were more frequent and complex in the female-only trials compared to male-only. Additional behavioral trials are needed to determine if an effective pheromonal approach to Burmese python management is possible. This article is protected by copyright. All rights reserved.},
}
@article {pmid30584393,
year = {2018},
author = {Karpiński, L and Szczepański, WT and Lewa, R and Walczak, M and Hilszczański, J and Kruszelnicki, L and Łoś, K and Jaworski, T and Marek Bidas, and Tarwacki, G},
title = {New data on the distribution, biology and ecology of the longhorn beetles from the area of South and East Kazakhstan (Coleoptera, Cerambycidae).},
journal = {ZooKeys},
volume = {},
number = {805},
pages = {59-126},
doi = {10.3897/zookeys.805.29660},
pmid = {30584393},
issn = {1313-2989},
abstract = {New data on the distribution, biology and ecology of the longhorn beetles occurring in southern and eastern regions of Kazakhstan are presented together with a list of 78 species that were collected during two entomological expeditions conducted in May and June 2017. New localities of some rare taxa endemic to this region of Asia, such as Psilotarsusbrachypterusbrachypterus (Gebler, 1830), Stenocorusminutus (Gebler, 1841) and Dorcadioncrassipescrassipes Ballion, 1878 are given. Exocentrusstierlini Ganglbauer, 1883 is recorded from Kazakhstan for the first time. Moreover, the occurrence of three species: Amarysiusduplicatus Tsherepanov, 1980, Rhopaloscelisunifasciatus Blessig, 1873 and Saperdaalberti Plavilstshikov, 1916, which were recently found in the country, is also confirmed. Furthermore, high-quality photographs of several unique taxa, i.e. Psilotarsusbrachypteruspubiventris (Semenov, 1900), Xylotrechusadspersus (Gebler, 1830), X.alakolensis Karpiński &amp; Szczepański, 2018, Anoplistesgalusoi (Kostin, 1974), A.jacobsoni Baeckmann, 1904 and Obereakostini Danilevsky, 1988 along with images of their habitats and feeding galleries are also presented. New localities of species considered serious pests or invasive, such as Turaniumscabrum (Kraatz, 1882) and Trichoferuscampestris (Faldermann, 1835), respectively, are also given. A new synonymy is proposed: Cerambyxscalaris Linnaeus, 1758 = Cerambyxhieroglyphicus Pallas, 1773, syn. n.},
}
@article {pmid30580472,
year = {2018},
author = {Gutowsky, LFG and Giacomini, HC and de Kerckhove, DT and Mackereth, R and McCormick, D and Chu, C},
title = {Quantifying multiple pressure interactions affecting populations of a recreationally and commercially important freshwater fish.},
journal = {Global change biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/gcb.14556},
pmid = {30580472},
issn = {1365-2486},
support = {//Priorities and Planning Section of MNRF's Climate Change Fund, 2016-2017 and 2017-2018/ ; },
abstract = {The expanding human global footprint and growing demand for freshwater have placed tremendous stress on inland aquatic ecosystems. Aichi Target 10 of the Convention on Biological Diversity aims to minimize anthropogenic pressures affecting vulnerable ecosystems, and pressure interactions are increasingly being incorporated into environmental management and climate change adaptation strategies. In this study, we explore how climate change, overfishing, forest disturbance, and invasive species pressures interact to affect inland lake walleye (Sander vitreus) populations. Walleye support subsistence, recreational, and commercial fisheries and are one of most sought-after freshwater fish species in North America. Using data from 444 lakes situated across an area of 475 000 km2 in Ontario, Canada, we apply a novel statistical tool, R-INLA, to determine how walleye biomass deficit (carrying capacity-observed biomass) is impacted by multiple pressures. Individually, angling activity and the presence of invasive zebra mussels (Dreissena polymorpha) were positively related to biomass deficits. In combination, zebra mussel presence interacted negatively and antagonistically with angling activity and percentage decrease in watershed mature forest cover. Velocity of climate change in growing degree days above 5°C and decrease in mature forest cover interacted to negatively affect walleye populations. Our study demonstrates how multiple pressure evaluations can be conducted for hundreds of populations to identify influential pressures and vulnerable ecosystems. Understanding pressure interactions is necessary to guide management and climate change adaptation strategies, and achieve global biodiversity targets.},
}
@article {pmid30578812,
year = {2018},
author = {Galal, L and Schares, G and Stragier, C and Vignoles, P and Brouat, C and Cuny, T and Dubois, C and Rohart, T and Glodas, C and Dardé, ML and Kane, M and Niang, Y and Diallo, M and Sow, A and Aubert, D and Hamidović, A and Ajzenberg, D and Mercier, A},
title = {Diversity of Toxoplasma gondii strains shaped by commensal communities of small mammals.},
journal = {International journal for parasitology},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.ijpara.2018.11.004},
pmid = {30578812},
issn = {1879-0135},
abstract = {Commensal rodent species are key reservoirs for Toxoplasma gondii in the domestic environment. In rodents, different T. gondii strains show variable patterns of virulence according to host species. Toxoplasma gondii strains causing non-lethal chronic infections in local hosts will be more likely to persist in a given environment, but few studies have addressed the possible role of these interactions in shaping the T. gondii population structure. In addition, the absence of validated techniques for upstream detection of T. gondii chronic infection in wild rodents hinders exploration of this issue under natural conditions. In this study, we took advantage of an extensive survey of commensal small mammals in three coastal localities of Senegal, with a species assemblage constituted of both native African species and invasive species. We tested 828 individuals for T. gondii chronic infection using the modified agglutination test for antibody detection in serum samples and a quantitative PCR assay for detection of T. gondii DNA in brain samples. The infecting T. gondii strains were genotyped whenever possible by the analysis of 15 microsatellite markers. We found (i) a very poor concordance between molecular detection and serology in the invasive house mouse, (ii) significantly different levels of prevalence by species and (iii) the autochthonous T. gondii Africa 1 lineage strains, which are lethal for laboratory mice, only in the native African species of commensal small mammals. Overall, this study highlights the need to reconsider the use of MAT serology in natural populations of house mice and provides the first known data about T. gondii genetic diversity in invasive and native species of small mammals from Africa. In light of these results, we discuss the role of invasive and native species, with their variable adaptations to different T. gondii strains, in shaping the spatial structure of T. gondii genetic diversity in Africa.},
}
@article {pmid30569438,
year = {2018},
author = {Brattland, C and Eythórsson, E and Weines, J and Sunnanå, K},
title = {Social-ecological timelines to explore human adaptation to coastal change.},
journal = {Ambio},
volume = {},
number = {},
pages = {},
doi = {10.1007/s13280-018-1129-5},
pmid = {30569438},
issn = {1654-7209},
support = {255767//Norges Forskningsråd/ ; },
abstract = {Through the construction of a socio-ecological timeline for the Porsanger fjord ecosystem, this article illustrates the different ways in which environmental and social-ecological changes have influenced the adaptations of rural households in coastal Sami communities in Finnmark, north Norway. The main finding is that, although environmental change in the form of seal invasions and dwindling fish stocks directly impacted the fisheries, the introduction of a new vessel quota system decisively changed adaptive capacity and coastal Sami household adaptation strategies. These changes represented a tipping point for the social-ecological system in the period between 1986 and 1990. It is thus important to discuss the ways in which governance systems may facilitate actions to adapt to climate and biodiversity change and foster sustainable rural livelihood systems in coastal Norway. Based on traditional and local ecological knowledge on the state of the ecosystem prior to the tipping point, two relevant actions to increase the resilience of the system were identified: ensuring the possibility of re-entry into fisheries as part of rural livelihood combinations, and ecological restoration of kelp beds. Flexible diversification of livelihoods allows exploitation of a range of adjacent species without large investments in a fossile fuel-driven fisheries economy. Investing in regrowth of macroalgae to foster cod nursery areas and increase carbon sequestration can be a relevant alternative for communities that are interested in contributing to climate change mitigation on a larger scale.},
}
@article {pmid30568860,
year = {2018},
author = {Simões, MVP and Peterson, AT},
title = {Importance of biotic predictors in estimation of potential invasive areas: the example of the tortoise beetle Eurypedus nigrosignatus, in Hispaniola.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e6052},
doi = {10.7717/peerj.6052},
pmid = {30568860},
issn = {2167-8359},
abstract = {Climatic variables have been the main predictors employed in ecological niche modeling and species distribution modeling, although biotic interactions are known to affect species' spatial distributions via mechanisms such as predation, competition, and mutualism. Biotic interactions can affect species' responses to abiotic environmental changes differently along environmental gradients, and abiotic environmental changes can likewise influence the nature of biotic interactions. Understanding whether and how to integrate variables at different scales in ecological niche models is essential to better estimate spatial distributions of species on macroecological scales and their responses to change. We report the leaf beetle Eurypedus nigrosignatus as an alien species in the Dominican Republic and investigate whether biotic factors played a meaningful role in the distributional expansion of the species into the Caribbean. We evaluate ecological niche models built with an additive gradient of unlinked biotic predictors-host plants, using likelihood-based model evaluation criteria (Akaike information criterion and Bayesian information criterion) within a range of regularization multiplier parameter values. Our results support the argument that ecological niche models should be more inclusive, as selected biotic predictors can improve the performance of models, despite the increased model complexity, and show that biotic interactions matter at macroecological scales. Moreover, we provide an alternative approach to select optimal combination of relevant variables, to improve estimation of potential invasive areas using global minimum model likelihood scores.},
}
@article {pmid30568533,
year = {2018},
author = {Maddison, DR and Will, K and Crews, S and LaBonte, J},
title = {Bembidion ambiguum (Coleoptera: Carabidae) is established in California.},
journal = {Biodiversity data journal},
volume = {},
number = {6},
pages = {e30763},
doi = {10.3897/BDJ.6.e30763},
pmid = {30568533},
issn = {1314-2828},
abstract = {Background: The ground beetle Bembidion (Neja) ambiguum Dejean is native to Europe and north Africa, in the Mediterranean region.<br><br>New information: We report it from North America for the first time, from five localities around San Francisco Bay, California. The earliest record is from 2012.},
}
@article {pmid30568529,
year = {2018},
author = {Valdez-Mondragón, A and Cortez-Roldán, MR and Juárez-Sánchez, AR and Solís-Catalán, KP},
title = {A new species of Loxosceles Heineken &amp; Lowe (Araneae, Sicariidae), with updated distribution records and biogeographical comments for the species from Mexico, including a new record of Loxoscelesrufescens (Dufour).},
journal = {ZooKeys},
volume = {},
number = {802},
pages = {39-66},
doi = {10.3897/zookeys.802.28445},
pmid = {30568529},
issn = {1313-2989},
abstract = {A new species of the spider genus Loxosceles Heineken &amp; Lowe, 1832, Loxoscelesmalintzisp. n., is described from the states of Puebla, Morelos and Guerrero, in the central region of Mexico. The description is based on adult males and females with morphological and ultra-morphological images. Updated distribution maps are provided for the 39 species recorded from the Mexican territory (including the new species). The states with the greatest diversity are Baja California Sur, Baja California and Sonora, with five species each. A total of 441 records for the 39 species, based on arachnological collections, data bases and literature, were used to update the distribution maps. Loxoscelesboneti Gertsch, 1958 is the species with the highest number of records in Mexico, with a total of 58 records from different localities. The states with the most records so far are Guerrero, with 55 records, Morelos, with 35 records, and Baja California Sur, with 30 records. Loxoscelesrufescens (Dufour, 1820), an introduced species, is recorded for the second time in Mexico, from the state of Chihuahua, being the first well-documented record for the country. Mexico has the greatest diversity of species of Loxosceles worldwide, with 39 (two introduced species) of the 134 described species. Additionally, biogeographical comments for the species from Mexico are provided.},
}
@article {pmid30568068,
year = {2019},
author = {Shi, W and Hu, X and Chen, X and Ou, X and Yang, J and Geng, Y},
title = {Increased population epigenetic diversity of the clonal invasive species Alternanthera philoxeroides in response to salinity stress.},
journal = {Genes &amp; genetic systems},
volume = {93},
number = {6},
pages = {259-269},
doi = {10.1266/ggs.18-00039},
pmid = {30568068},
issn = {1880-5779},
abstract = {Epigenetic modification can change the pattern of gene expression without altering the underlying DNA sequence, which may be adaptive in clonal plant species. In this study, we used MSAP (methylation-sensitive amplification polymorphism) to examine epigenetic variation in Alternanthera philoxeroides, a clonal invasive species, in response to salinity stress. We found that salinity stress could significantly increase the level of epigenetic diversity within a population. This effect increased with increasing stress duration and was specific to particular genotypes. In addition, the epigenetic modification of young plants seems less sensitive to salinity than that of mature plants. This elevated epigenetic diversity in response to environmental stress may compensate for genetic impoverishment and contribute to evolutionary potential in clonal species.},
}
@article {pmid30566612,
year = {2018},
author = {Shragai, T and Harrington, LC},
title = {Aedes albopictus (Diptera: Culicidae) on an Invasive Edge: Abundance, Spatial Distribution, and Habitat Usage of Larvae and Pupae Across Urban and Socioeconomic Environmental Gradients.},
journal = {Journal of medical entomology},
volume = {},
number = {},
pages = {},
doi = {10.1093/jme/tjy209},
pmid = {30566612},
issn = {1938-2928},
abstract = {The Asian tiger mosquito [Aedes albopictus (Skuse)] is an invasive species of public health importance that is currently expanding its range in the Northeast United States. Effective Ae. albopictus control depends on a thorough understanding of factors influencing their abundance, spatial distribution, and habitat preference. We conducted a series of container surveys for Ae. albopictus larvae/pupae over 2 yr across nine sites in neighborhoods along its invasive range in southern New York. Selected sites represented a gradient of percent impervious surface and median household income. Two hypotheses were tested: 1) Ae. albopictus larval/pupal abundance increases and spatial distribution becomes less clustered as site-level median income decreases and percent impervious surface increases because of increased larval habitat quality and availability; and 2) container-level characteristics are predictive of Ae. albopictus larval/pupal infestation across a range of sites. In 2016, neither median household income nor impervious surface predicted Ae. albopictus abundance. In 2017, sites with greater impervious surface were more heavily infested by some measures. In both years, Ae. albopictus larval/pupal spatial distribution as measured by K-function was more clustered in with greater median household income. Most container characteristics were either not predictive of Ae. albopictus or varied between years. Based on the variability of predictive container characteristics, we conclude that identification of key containers is not useful in this region. However, Ae. albopictus can be nonhomogenously distributed or abundant based on income level and impervious surface. Improved control of immatures should consider these regional predictors of Ae. albopictus populations.},
}
@article {pmid30565370,
year = {2018},
author = {Nimmo, DG and Avitabile, S and Banks, SC and Bliege Bird, R and Callister, K and Clarke, MF and Dickman, CR and Doherty, TS and Driscoll, DA and Greenville, AC and Haslem, A and Kelly, LT and Kenny, SA and Lahoz-Monfort, JJ and Lee, C and Leonard, S and Moore, H and Newsome, TM and Parr, CL and Ritchie, EG and Schneider, K and Turner, JM and Watson, S and Westbrooke, M and Wouters, M and White, M and Bennett, AF},
title = {Animal movements in fire-prone landscapes.},
journal = {Biological reviews of the Cambridge Philosophical Society},
volume = {},
number = {},
pages = {},
doi = {10.1111/brv.12486},
pmid = {30565370},
issn = {1469-185X},
support = {DE170101466//Australian Research Council/ ; Mallee Hawkeye Project//Victorian Department of Land, Water and Planning/ ; //LaTrobe University and Deakin University/ ; //Department of Land, Water and Planning as part of the Mallee Hawkeye Project/ ; },
abstract = {Movement is a trait of fundamental importance in ecosystems subject to frequent disturbances, such as fire-prone ecosystems. Despite this, the role of movement in facilitating responses to fire has received little attention. Herein, we consider how animal movement interacts with fire history to shape species distributions. We consider how fire affects movement between habitat patches of differing fire histories that occur across a range of spatial and temporal scales, from daily foraging bouts to infrequent dispersal events, and annual migrations. We review animal movements in response to the immediate and abrupt impacts of fire, and the longer-term successional changes that fires set in train. We discuss how the novel threats of altered fire regimes, landscape fragmentation, and invasive species result in suboptimal movements that drive populations downwards. We then outline the types of data needed to study animal movements in relation to fire and novel threats, to hasten the integration of movement ecology and fire ecology. We conclude by outlining a research agenda for the integration of movement ecology and fire ecology by identifying key research questions that emerge from our synthesis of animal movements in fire-prone ecosystems.},
}
@article {pmid30565194,
year = {2019},
author = {Mori, E and Sala, JP and Fattorini, N and Menchetti, M and Montalvo, T and Senar, JC},
title = {Ectoparasite sharing among native and invasive birds in a metropolitan area.},
journal = {Parasitology research},
volume = {118},
number = {2},
pages = {399-409},
doi = {10.1007/s00436-018-6174-2},
pmid = {30565194},
issn = {1432-1955},
abstract = {Parasite-mediated competition has been reported to be one of the most harmful, although overlooked, impacts that alien species have on native ecosystems. Monk parakeets Myiopsitta monachus are successful invaders in Europe, where they have been introduced from South America. Colonial nests of these parrots may also host other species, e.g. the rock pigeon Columba livia forma domestica. In this work, we analysed the ectoparasite composition of monk parakeets in Barcelona (Spain) and we evaluated their potential role as parasite-mediated competitors, by comparing their parasitic load with that of coexisting rock pigeons. Only two arthropod species were observed on monk parakeets, whereas four species were detected on pigeons. Parakeets were rarely infested by pigeon parasites (prevalence = 0.66%), whereas parakeet mites were recorded more often on pigeons (prevalence = 10.00%). The number of total parasites per bird increased with increasing densities of monk parakeets, both for pigeons and for parakeets. Therefore, overcrowding of birds due to the increasing population of monk parakeets in Barcelona may affect the health status of native pigeons, suggesting a potential role for parasite mediated competition by introduced parakeets. Furthermore, spill-over of alien mites (Ornithonyssus bursa) by monk parakeets to rock pigeons should be monitoring as it may affect human health.},
}
@article {pmid30564044,
year = {2018},
author = {Hornung, E and Kásler, A and Tóth, Z},
title = {The role of urban forest patches in maintaining isopod diversity (Oniscidea).},
journal = {ZooKeys},
volume = {},
number = {801},
pages = {371-388},
doi = {10.3897/zookeys.801.22829},
pmid = {30564044},
issn = {1313-2989},
abstract = {Compositional changes in natural communities associated with anthropogenic influence often lead to localised extinctions and biodiversity loss. Soil invertebrates are also threatened by urbanisation due to habitat fragmentation, vegetation changes and management, soil alteration, degradation, and disappearing shelter sites. The aim was to assess terrestrial isopod (Oniscidea) assemblages in differently degraded urban forest patches of a metropolitan area (Budapest, Hungary). Study sites were compared by their species richness, composition and the relevant background factors (soil properties, dead wood, litter characteristics, and canopy closure). The degree of urban disturbance was expressed using an urbanisation index (UI) based on built-up density and vegetation cover. The isopods were identified to species level, and were qualified by their habitat preference and naturalness index (TINI). Average Rarity Index (ARI), derived from TINIs provided information on the degree of naturalness/disturbance of each habitat. Altogether 14 isopod species were collected from 23 sample sites. Urbanisation indirectly affected on the composition of isopod assemblages through the quantity of dead wood and soil plasticity. ARIs and UIs of sample sites were negatively correlated. Urban patches harboured habitat generalist, synanthropic and established introduced species with low naturalness value of assemblages. Areas with no or low anthropogenic disturbance maintained stable native, autochthonous assemblages that were characteristic of rural sites in the region. Transitional zones between rural and urban habitats usually maintained a mixed isopod fauna consisting of both urban and rural elements.},
}
@article {pmid30563122,
year = {2018},
author = {Souza-Gonçalves, I and Orsetti, A and Lopes-Andrade, C},
title = {Synopsis of Cis Latreille (Coleoptera: Ciidae) from southern Africa.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040184},
pmid = {30563122},
issn = {2075-4450},
support = {Edital 01/2016 - Demanda Universal, APQ-02675-16//Fundação de Amparo à Pesquisa do Estado de Minas Gerais/ ; research grant to C.L.A. n° 307116/2015-8//Conselho Nacional de Desenvolvimento Científico e Tecnológico/ ; Finance Code 001; doctorate degree grant to I.S.G.; PROTAX - Edital n° 001/2015//Coordenação de Aperfeiçoamento de Pessoal de Nível Superior/ ; },
abstract = {A synopsis of the Cis Latreille, 1796 from southern Africa is provided, with the description of 10 new species: Cis bicaesariatussp. n., Cis foveocephalussp. n., Cis grobbelaaraesp. n., Cis lacinipennissp. n., Cis makrosomasp. n., Cis mpumalangaensissp. n., Cis parvisetosussp. n., Cis tessariplacussp. n., Cis umlalaziensissp. n. and Cis westerncapensissp. n. The introduced species Cis fuscipes Mellié, 1849 is recorded for the first time from the Republic of South Africa. New geographic records are provided for the following species: Cis neserorum Souza-Gonçalves &amp; Lopes-Andrade, 2017; Cis regius Orsetti &amp; Lopes-Andrade, 2016 and Cis stalsi Souza-Gonçalves &amp; Lopes-Andrade, 2017. Most southern African Cis are placed in available or newly proposed species-groups and a provisional identification key is provided.},
}
@article {pmid30562501,
year = {2019},
author = {Alharbi, W and Petrovskii, S},
title = {Effect of complex landscape geometry on the invasive species spread: Invasion with stepping stones.},
journal = {Journal of theoretical biology},
volume = {464},
number = {},
pages = {85-97},
doi = {10.1016/j.jtbi.2018.12.019},
pmid = {30562501},
issn = {1095-8541},
abstract = {Spatial proliferation of invasive species often causes serious damage to agriculture, ecology and environment. Evaluation of the extent of the area potentially invadable by an alien species is an important problem. Landscape features that reduces dispersal space to narrow corridors can make some areas inaccessible to the invading species. On the other hand, the existence of stepping stones - small areas or 'patches' with better environmental conditions - is known to assist species spread. How an interplay between these factors can affect the invasion success remains unclear. In this paper, we address this question theoretically using a mechanistic model of population dynamics. Such models have been generally successful in predicting the rate and pattern of invasive spread; however, they usually consider the spread in an unbounded, uniform space hence ignoring the complex geometry of a real landscape. In contrast, here we consider a reaction-diffusion model in a domain of a complex shape combining corridors and stepping stones. We show that the invasion success depends on a subtle interplay between the stepping stone size, location and the strength of the Allee effect inside. In particular, for a stepping stone of a small size, there is only a narrow range of locations where it can unblock the otherwise impassable corridor.},
}
@article {pmid30548757,
year = {2018},
author = {Roy, HE and Bacher, S and Essl, F and Adriaens, T and Aldridge, DC and Bishop, JDD and Blackburn, TM and Branquart, E and Brodie, J and Carboneras, C and Cottier-Cook, EJ and Copp, GH and Dean, HJ and Eilenberg, J and Gallardo, B and Garcia, M and García-Berthou, E and Genovesi, P and Hulme, PE and Kenis, M and Kerckhof, F and Kettunen, M and Minchin, D and Nentwig, W and Nieto, A and Pergl, J and Pescott, OL and M Peyton, J and Preda, C and Roques, A and Rorke, SL and Scalera, R and Schindler, S and Schönrogge, K and Sewell, J and Solarz, W and Stewart, AJA and Tricarico, E and Vanderhoeven, S and van der Velde, G and Vilà, M and Wood, CA and Zenetos, A and Rabitsch, W},
title = {Developing a list of invasive alien species likely to threaten biodiversity and ecosystems in the European Union.},
journal = {Global change biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/gcb.14527},
pmid = {30548757},
issn = {1365-2486},
abstract = {The European Union (EU) has recently published its first list of invasive alien species (IAS) of EU concern to which current legislation must apply. The list comprises species known to pose great threats to biodiversity and needs to be maintained and updated. Horizon scanning is seen as critical to identify the most threatening potential IAS that do not yet occur in Europe to be subsequently risk assessed for future listing. Accordingly, we present a systematic consensus horizon scanning procedure to derive a ranked list of potential IAS likely to arrive, establish, spread and have an impact on biodiversity in the region over the next decade. The approach is unique in the continental scale examined, the breadth of taxonomic groups and environments considered, and the methods and data sources used. International experts were brought together to address five broad thematic groups of potential IAS. For each thematic group the experts first independently assembled lists of potential IAS not yet established in the EU but potentially threatening biodiversity if introduced. Experts were asked to score the species within their thematic group for their separate likelihoods of i) arrival, ii) establishment, iii) spread, and iv) magnitude of the potential negative impact on biodiversity within the EU. Experts then convened for a 2-day workshop applying consensus methods to compile a ranked list of potential IAS. From an initial working list of 329 species, a list of 66 species not yet established in the EU that were considered to be very high (8 species), high (40 species) or medium (18 species) risk species was derived. Here, we present these species highlighting the potential negative impacts and the most likely biogeographic regions to be affected by these potential IAS.},
}
@article {pmid30548338,
year = {2018},
author = {Graham, S and Metcalf, AL and Gill, N and Niemiec, R and Moreno, C and Bach, T and Ikutegbe, V and Hallstrom, L and Ma, Z and Lubeck, A},
title = {Opportunities for better use of collective action theory in research and governance for invasive species management.},
journal = {Conservation biology : the journal of the Society for Conservation Biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/cobi.13266},
pmid = {30548338},
issn = {1523-1739},
support = {MDM-2015-0552//Spanish Ministry of Science, Innovation and Universities through the María de Maeztu program for Units of Excellence/ ; //UNSW School of Social Sciences and the Canadian Weed Science Society/ ; DP130102588//Australian Research Council/ ; //University of Wollongong Faculty of Social Science/ ; DG-114747//NSF Graduate Research Fellowship/ ; DP130103341//College of Agriculture and Life Sciences at the University of Idaho and CWSS/ ; //College of Agriculture at Purdue University/ ; MDM-2015-0552//Ministerio de Ciencia, Innovación y Universidades/ ; },
abstract = {Controlling invasive species presents a public-good dilemma. Although environmental, social, and economic benefits of control accrue to society, costs are borne by only a few individuals and organizations. For decades, policy makers have used incentives and sanctions to encourage or coerce individual actors to contribute to the public good, with limited success. Diverse, subnational efforts to collectively manage invasive plants, insects, and animals provide effective alternatives to traditional command-and-control approaches. Despite this work, there has been little systematic evaluation of collective efforts to determine whether there are consistent principles underpinning success. We reviewed 32 studies to identify the extent to which collective-action theories from related agricultural and environmental fields explain collaborative invasive species management approaches; describe and differentiate emergent invasive species collective-action efforts; and provide guidance on how to enable more collaborative approaches to invasive species management. We identified 4 types of collective action aimed at invasive species-externally led, community led, comanaged, and organizational coalitions-that provide blueprints for future invasive species management. Existing collective-action theories could explain the importance attributed to developing shared knowledge of the social-ecological system and the need for social capital. Yet, collection action on invasive species requires different types of monitoring, sanctions, and boundary definitions. We argue that future government policies can benefit from establishing flexible boundaries that encourage social learning and enable colocated individuals and organizations to identify common goals, pool resources, and coordinate efforts.},
}
@article {pmid30545083,
year = {2018},
author = {Guo, P and Yu, F and Ren, Y and Liu, D and Li, J and Ouyang, Z and Wang, X},
title = {Response of Ruderal Species Diversity to an Urban Environment: Implications for Conservation and Management.},
journal = {International journal of environmental research and public health},
volume = {15},
number = {12},
pages = {},
doi = {10.3390/ijerph15122832},
pmid = {30545083},
issn = {1660-4601},
abstract = {Anthropogenic activities have weakened the invasion of ruderals and increased the number of non-native species in urban areas. Ruderals are an important component of urban plant diversity and are of great significance to the sustainable development of urban green space. We used the tessellation⁻randomized plot method to examine the composition and biodiversity of ruderal species among urban land use types (LUTs) in the built-up areas of Beijing. Soil samples from the surface to a depth of 10 cm were taken from each site to examine the impact of soil characteristics on ruderal species diversity. Results showed that a total of 120 ruderal species were observed, including 71 native and 49 non-native species. Among them, 90% were identified as Cosmopolitan. Native species accounted for the majority of ruderals across all the eight LUTs. Institutional, residential, and woodlot areas with coarser management had higher ruderal species richness than did commercial areas and roadside lawns. Allergenic species showed the highest proportions in municipal parks, and invasive species accounted for 20% of all ruderal species. Ruderal species diversity was related to distance from the urban center, pruning intensity, and soil characteristics. These results suggest that with ruderals playing an important role in urban grass species diversity, there is tremendous potential for more native species in Beijing lawns, which would contribute substantially to increasing the ecological system's functional benefits. Ruderal species accustomed to the causal processes and environmental conditions of different LUTs should be used and conserved properly to improve the harsh conditions of different LUTs and to sustain ecosystem health.},
}
@article {pmid30535812,
year = {2018},
author = {Brusch, GA and Christian, K and Brown, GP and Shine, R and DeNardo, DF},
title = {Cane toads (Rhinella marina) rely on water access, not drought tolerance, to invade xeric Australian environments.},
journal = {Oecologia},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00442-018-4321-1},
pmid = {30535812},
issn = {1432-1939},
support = {1311230//Directorate for Biological Sciences/ ; 1606367//Directorate for Biological Sciences/ ; },
abstract = {The invasion of habitats with novel environmental challenges may require physiological tolerances not seen in conspecifics from the native range. We used a combination of field and laboratory-based experiments to assess physiological tolerance to limited water access at four sites distributed across the historical invasion path of cane toads (Rhinella marina) in Australia that, from east to west, alternated between mesic and seasonally xeric habitats. Toads from all locations were well hydrated at the time of capture. However, experimental dehydration caused greater mass loss, higher plasma osmolality, and inhibition of lytic ability in toads from xeric compared to mesic locations. These results suggest somewhat surprisingly that toads from xeric environments are physiologically more vulnerable to water loss. In contrast, bactericidal ability was not sensitive to hydric state and was greater in toads from eastern (long-colonized) areas. Similar patterns in lytic ability in hydrated toads and agglutination ability in wild toads suggest that toads along the invasion front face a tradeoff between enhanced dispersal ability and physiological responses to dehydration. The ability of this invasive species to spread into drier environments may be underpinned by a combination of phenotypic plasticity and evolved (heritable) traits.},
}
@article {pmid30532618,
year = {2018},
author = {Kovalenko, YN and Akulov, EN and Yunakov, N},
title = {The easternmost discovery of the Mediterranean weevil Pachyrhinuslethierryi (Coleoptera, Curculionidae, Entiminae): Is a further invasion possible?.},
journal = {ZooKeys},
volume = {},
number = {799},
pages = {89-93},
doi = {10.3897/zookeys.799.29934},
pmid = {30532618},
issn = {1313-2989},
abstract = {Pachyrhinuslethierryi (Desbrochers des Loges, 1875) is a Mediterranean weevil species that has become remarkably well known as a result of a series of recent introductions across Western and Central Europe. This species has recently reached Asia Minor and the Crimean Peninsula, as confirmed by several new records. The vectors of invasion in Crimea and possible further expansion are suggested.},
}
@article {pmid30532047,
year = {2019},
author = {Wu, N and Zhang, S and Li, X and Cao, Y and Liu, X and Wang, Q and Liu, Q and Liu, H and Hu, X and Zhou, XJ and James, AA and Zhang, Z and Huang, Y and Zhan, S},
title = {Fall webworm genomes yield insights into rapid adaptation of invasive species.},
journal = {Nature ecology &amp; evolution},
volume = {3},
number = {1},
pages = {105-115},
doi = {10.1038/s41559-018-0746-5},
pmid = {30532047},
issn = {2397-334X},
abstract = {Invasive species cause considerable ecological and economic damage. Despite decades of broad impacts of invasives on diversity and agriculture, the genetic adaptations and near-term evolution of invading populations are poorly understood. The fall webworm, Hyphantria cunea, a highly successful invasive species that originated in North America, spread throughout the Northern Hemisphere during the past 80 years. Here, we use whole-genome sequencing of invasive populations and transcriptome profiling to probe the underlying genetic bases for the rapid adaptation of this species to new environments and host plants. We find substantial reductions in genomic diversity consistent with founder effects. Genes and pathways associated with carbohydrate metabolism and gustatory receptors are substantially expanded in the webworm genome and show strong signatures of functional polymorphisms in the invasive population. We also find that silk-yielding-associated genes maintained a relatively low level of functional diversity, and identify candidate genes that may regulate the development of silk glands in fall webworms. These data suggest that the fall webworm's ability to colonize novel hosts, mediated by plasticity in their gustatory capabilities along with an increased ability to utilize novel nutrition sources and substrates, has facilitated the rapid and successful adaptation of the species throughout its range.},
}
@article {pmid30529414,
year = {2018},
author = {Watkins, C and Caplenor, CA and Poudyal, NC and Muller, LI and Yoest, C},
title = {Comparing landowner support for wild hog management options in Tennessee.},
journal = {Journal of environmental management},
volume = {232},
number = {},
pages = {722-728},
doi = {10.1016/j.jenvman.2018.11.075},
pmid = {30529414},
issn = {1095-8630},
abstract = {Wild hogs (Sus scrofa) are an invasive, non-native species quickly gaining ground on private, as well as public, lands in Tennessee and much of the United States. Wildlife management personnel may benefit from assessing stakeholders' views towards various management options to control and eradicate wild hogs. A statewide mail survey of 5000 randomly selected landowners in Tennessee counties known to have wild hogs yielded 1620 completed responses (33% response rate). Using this dataset, an index of potential for conflict among landowner groups was computed for each of eleven management options, which varied from leaving the wild hogs alone, to both lethal and non-lethal options. Results indicate varying levels of potential for conflict depending on hunter status, wild hog hunter status, presence of wild hogs on land, percent of income derived from land, and amount of land damage caused by wild hogs. Overall, three management options including leaving the wild hogs alone, allowing sale of wild hogs, and capturing and relocating were found unacceptable whereas many other options including capturing and killing, providing technical assistance to landowners and educating people on preventing damage were found to have high level of acceptability and most consensus among landowner subgroups. Findings will be useful in understanding how support for wild hog control options vary across population segments, and which options are likely to see more or less resistance from certain landowners.},
}
@article {pmid30527748,
year = {2018},
author = {de Ramos, B and da Costa, GB and Ramlov, F and Maraschin, M and Horta, PA and Figueroa, FL and Korbee, N and Bonomi-Barufi, J},
title = {Ecophysiological implications of UV radiation in the interspecific interaction of Pyropia acanthophora and Grateloupia turuturu (Rhodophyta).},
journal = {Marine environmental research},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.marenvres.2018.11.014},
pmid = {30527748},
issn = {1879-0291},
abstract = {Radiation, both photosynthetic active radiation (PAR, l = 400-700 nm) and Ultraviolet (UVR, l = 280-400 nm) is one of the key factors regulating algal distribution in aquatic environments. Pyropia acanthophora and Grateloupia turuturu have been found over upper rocky shore areas in Southern Brazil, occupying the same niche space. The first species is native and the second one is exotic and considered a potential invader of South Atlantic. The aim of the present study was to evaluate the effects of radiation on physiological responses of both species and infer mechanisms that allow their niche competition in the environment. Samples were cultured in the following conditions: associated or separated, and with an addition of PAR, PAR + UVA (PA) and PAR + UVA + UVB (PAB), totalizing six factorial treatments during 5 days of exposure. Photosynthetic responses of Fv/Fm and ETR were daily evaluated. At the beginning and at the end of the experiment, samples were analyzed for pigment content (chlorophyll a and phycobiliproteins), and mycosporine-like amino acids (MAAs), while oxygen evolution was evaluated at the end of the experiment. As the main results, G. turuturu died when cultivated in PAB conditions. P. acanthophora presented higher amounts of chlorophyll a than G. turuturu during the whole experiment. Phycoerythrin and Fv/Fm remained constant in P. acanthophora but diminished for G. turuturu in UV treatments. ETR was higher for samples that were cultivated in associative treatment. The presence of G. turuturu in the same flask enhanced MAA synthesis in P. acanthophora, regardless of radiation condition. In addition, UV radiation can be a factor controlling species distribution and could counteract the spreading of invasive species, like G. turuturu, allowing P. acanthophora survival in upper rocky shore zones of the natural ecological distribution area.},
}
@article {pmid30526682,
year = {2018},
author = {Habib, MR and Lv, S and Guo, YH and Gu, WB and Standley, CJ and Caldeira, RL and Zhou, XN},
title = {Morphological and molecular characterization of invasive Biomphalaria straminea in southern China.},
journal = {Infectious diseases of poverty},
volume = {7},
number = {1},
pages = {120},
pmid = {30526682},
issn = {2049-9957},
support = {2016YFC1202001//National Key Research and Development Program of China/ ; CB-1603//Research Fund for the Technical Reserves, National Institute of Parasitic Diseases, Chinese CDC/ ; 304121/2014-2//Conselho Nacional de Desenvolvimento Científico e Tecnológico/CNPq/ ; },
abstract = {BACKGROUND: Schistosomiasis is a common parasitic disease designated as a neglected tropical disease by the World Health Organization. Schistosomiasis mansoni is a form of the disease that is caused by the digenean trematode Schistosoma mansoni, transmitted through Biomphalaria spp. as an intermediate host. Biomphalaria was introduced to Hong Kong, China in aquatic plants shipments coming from Brazil and the snail rapidly established its habitats in southern China. Earlier studies of Biomphalaria spp. introduced to southern China identified the snails as Biomphalaria straminea, one of the susceptible species implicated in S. mansoni transmission in South America. However, recent molecular investigations also indicated the presence of another South American species, B. kuhniana, which is refractory to infection. As such, it is important to identify accurately the species currently distributed in southern China, especially with emerging reports of active S. mansoni infections in Chinese workers returning from Africa.<br><br>METHODS: We combined morphological and molecular taxonomy tools to precisely identify Biomphalaria spp. distributed in Guangdong Province, southern China. In order to clearly understand the molecular profile of the species, we constructed a phylogeny using mtDNA data (COI and 16S rRNA sequences) from six populations of Biomphalaria spp. from Shenzhen City in Guangdong Province. In addition, we examined the external morphology of the shell and internal anatomy of the reproductive organs.<br><br>RESULTS: Both morphological and molecular evidences indicated a close affinity between Biomphalaria spp. populations from Guangdong and B. straminea from Brazil. The shell morphology was roughly identical in all the populations collected with rounded whorls on one side and subangulated on the other, a smooth periphery, an egg-shaped aperture bowed to one side, and a deep umbilicus. The shape and number of prostate diverticula (ranged from 11.67 to 17.67) in Guangdong populations supports its close affinity to B. straminea rather than B. kuhniana. Molecular analysis did not conflict with morphological analysis. Little genetic differentiation was observed within Biomphalaria populations collected. Phylogenetic analysis of COI and 16S rRNA haplotypes from snails collected and B. straminea sequences from Brazil and China using Bayesian inference revealed that Guangdong populations were clustered in one clade with B. straminea from Hong Kong of China and B. straminea from Brazil indicating their close affinity to each other.<br><br>CONCLUSIONS: Data obtained in the current study clearly show that the populations of Biomphalaria spp. investigated are B. straminea, and we assume that those snails were either introduced via passive dispersal from Hong Kong of China or as a result of multiple introduction routes from Brazil.},
}
@article {pmid30526493,
year = {2018},
author = {Chen, Y and Shenkar, N and Ni, P and Lin, Y and Li, S and Zhan, A},
title = {Rapid microevolution during recent range expansion to harsh environments.},
journal = {BMC evolutionary biology},
volume = {18},
number = {1},
pages = {187},
pmid = {30526493},
issn = {1471-2148},
mesh = {Adaptation, Physiological/genetics ; Animals ; Bayes Theorem ; *Biological Evolution ; Ciona intestinalis/*genetics/physiology ; *Ecosystem ; Gene Frequency/genetics ; Gene Ontology ; Genetic Loci ; Genetic Variation ; Genetics, Population ; Genome ; Microsatellite Repeats/genetics ; Molecular Sequence Annotation ; Selection, Genetic ; },
abstract = {BACKGROUND: Adaptive evolution is one of the crucial mechanisms for organisms to survive and thrive in new environments. Recent studies suggest that adaptive evolution could rapidly occur in species to respond to novel environments or environmental challenges during range expansion. However, for environmental adaptation, many studies successfully detected phenotypic features associated with local environments, but did not provide ample genetic evidence on microevolutionary dynamics. It is therefore crucial to thoroughly investigate the genetic basis of rapid microevolution in response to environmental changes, in particular on what genes and associated variation are responsible for environmental challenges. Here, we genotyped genome-wide gene-associated microsatellites to detect genetic signatures of rapid microevolution of a marine tunicate invader, Ciona robusta, during recent range expansion to the harsh environment in the Red Sea.<br><br>RESULTS: The Red Sea population was significantly differentiated from the other global populations. The genome-wide scan, as well as multiple analytical methods, successfully identified a set of adaptive genes. Interestingly, the allele frequency largely varied at several adaptive loci in the Red Sea population, and we found significant correlations between allele frequency and local environmental factors at these adaptive loci. Furthermore, a set of genes were annotated to get involved in local temperature and salinity adaptation, and the identified adaptive genes may largely contribute to the invasion success to harsh environments.<br><br>CONCLUSIONS: All the evidence obtained in this study clearly showed that environment-driven selection had left detectable signatures in the genome of Ciona robusta within a few generations. Such a rapid microevolutionary process is largely responsible for the harsh environmental adaptation and therefore contributes to invasion success in different aquatic ecosystems with largely varied environmental factors.},
}
@article {pmid30521096,
year = {2019},
author = {Pregitzer, CC and Charlop-Powers, S and Bibbo, S and Forgione, HM and Gunther, B and Hallett, RA and Bradford, MA},
title = {A city-scale assessment reveals that native forest types and overstory species dominate New York City forests.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {29},
number = {1},
pages = {e01819},
doi = {10.1002/eap.1819},
pmid = {30521096},
issn = {1051-0761},
abstract = {Cities are increasingly focused on expanding tree canopy cover as a means to improve the urban environment by, for example, reducing heat island effects, promoting better air quality, and protecting local habitat. The majority of efforts to expand canopy cover focus on planting street trees or on planting native tree species and removing nonnatives in natural areas through reforestation. Yet many urban canopy assessments conducted at the city-scale reveal co-dominance by nonnative trees, fueling debates about the value of urban forests and native-specific management targets. In contrast, assessments within cities at site or park scales find that some urban forest stands harbor predominantly native biodiversity. To resolve this apparent dichotomy in findings, about the extent to which urban forests are native dominated, between the city-scale canopy and site-level assessments, we measure forest structure and composition in 1,124 plots across 53 parks in New York City's 2,497 ha of natural area forest. That is, we assess urban forests at the city-scale and deliberately omit sampling trees existing outside of forest stands but which are enumerated in citywide canopy assessments. We find that on average forest stand canopy is comprised of 82% native species in New York City forests, suggesting that conclusions that the urban canopy is co-dominated by nonnatives likely results from predominantly sampling street trees in prior city-scale assessments. However, native tree species' proportion declines to 75% and 53% in the midstory and understory, respectively, suggesting potential threats to the future native dominance of urban forest canopies. Furthermore, we find that out of 57 unique forest types in New York City, the majority of stands (81%) are a native type. We find that stand structure in urban forest stands is more similar to rural forests in New York State than to stand structure reported for prior assessments of the urban canopy at the city scale. Our results suggest the need to measure urban forest stands apart from the entire urban canopy. Doing so will ensure that city-scale assessments return data that align with conservation policy and management strategies that focus on maintaining and growing native urban forests rather than individual trees.},
}
@article {pmid30519436,
year = {2018},
author = {Boltovskoy, D and Sylvester, F and Paolucci, EM},
title = {Invasive species denialism: Sorting out facts, beliefs, and definitions.},
journal = {Ecology and evolution},
volume = {8},
number = {22},
pages = {11190-11198},
pmid = {30519436},
issn = {2045-7758},
abstract = {In the last decades, thousands of investigations confirmed the detrimental effects of species translocated by man outside of their native ranges (nonindigenous species, or NIS). However, results concluding that many NIS have null, neutral, or positive impacts on the biota and on human interests are as common in the scientific literature as those that point at baneful impacts. Recently, several scholars confronted the stand that origin per se is not a reliable indicator of negative effects, suggesting that such conclusions are the expression of scientific denialism, often led by spurious purposes, and that their numbers are increasing. When assessed in the context of the growing interest in introduced species, the proportion of academic publications claiming that NIS pose no threats to the environment and to social and economic interests is extremely low, and has not increased since 1990. The widely prevailing notion that many NIS are effectively or potentially harmful does not conflict with the fact that most have mixed (negative, neutral, and positive) impacts. When based on solid grounds, reports of positive or neutral impacts should not be labeled as manipulative or misleading unless proven otherwise, even if they may hamper interest in- and funding of research and control bioinvasion programs.},
}
@article {pmid30519430,
year = {2018},
author = {Cheeseman, AE and Ryan, SJ and Whipps, CM and Cohen, JB},
title = {Competition alters seasonal resource selection and promotes use of invasive shrubs by an imperiled native cottontail.},
journal = {Ecology and evolution},
volume = {8},
number = {22},
pages = {11122-11133},
pmid = {30519430},
issn = {2045-7758},
abstract = {Many ecosystems face multiple invaders, and interactions among invasive and native species may complicate conservation efforts for imperiled species. Examination of fine-scale resource selection can be used to detect patterns in habitat selection resulting from species interactions and assess the value of specific resources, including invasive plants, to wildlife. We used animal location data with mixed-effects resource selection models to examine seasonal competitive interactions and species-specific selection for forage and cover resources by an imperiled native lagomorph, the New England cottontail Sylvilagus transitionalis and its nonnative competitor, the eastern cottontail S. floridanus in the eastern Hudson Valley, NY. We found evidence that resource selection by New England cottontails depended on the relative prevalence of eastern cottontails to New England cottontails. Where eastern cottontails were less prevalent New England cottontail selected for resources characteristic of early successional shrublands. Where eastern cottontails were more prevalent, New England cottontails selected for resources characteristic of later successional shrublands. New England cottontail use of certain invasive shrubs depended on the prevalence of eastern cottontails relative to New England cottontails, suggesting response to invasive plants is confounded by interactions with a nonnative competitor. Our results further emphasize the need for conservation efforts to consider invasive management within the ecosystem context. We demonstrate the utility of resource selection studies to assist in this regard by exploring competitive interactions in the absence of removal studies, while simultaneously assessing the impact of habitat components such as invasive vegetation on species of conservation concern. Synthesis and applications Resource selection studies can be directly applied to inform ongoing species conservation where multiple invaders are present or where species interactions influence resource selection. Fine-scale assessments of resource selection, similar to those presented here, can be used to selectively manage habitat to benefit desired species within the ecosystem context.},
}
@article {pmid30519414,
year = {2018},
author = {Davis, AJ and Williams, KE and Snow, NP and Pepin, KM and Piaggio, AJ},
title = {Accounting for observation processes across multiple levels of uncertainty improves inference of species distributions and guides adaptive sampling of environmental DNA.},
journal = {Ecology and evolution},
volume = {8},
number = {22},
pages = {10879-10892},
pmid = {30519414},
issn = {2045-7758},
abstract = {Understanding factors that influence observation processes is critical for accurate assessment of underlying ecological processes. When indirect methods of detection, such as environmental DNA, are used to determine species presence, additional levels of uncertainty from observation processes need to be accounted for. We conducted a field trial to evaluate observation processes of a terrestrial invasive species (wild pigs- Sus scrofa) from DNA in water bodies. We used a multi-scale occupancy analysis to estimate different levels of observation processes (detection, p): the probability DNA is available per sample (θ), the probability of capturing DNA per extraction (γ), and the probability of amplification per qPCR run (δ). We selected four sites for each of three water body types and collected 10 samples per water body during two months (September and October 2016) in central Texas. Our methodology can be used to guide sampling adaptively to minimize costs while improving inference of species distributions. Using a removal sampling approach was more efficient than pooling samples and was unbiased. Availability of DNA varied by month, was considerably higher when water pH was near neutral, and was higher in ephemeral streams relative to wildlife guzzlers and ponds. To achieve a cumulative detection probability >90% (including availability, capture, and amplification), future studies should collect 20 water samples per site, conduct at least two extractions per sample, and conduct five qPCR replicates per extraction. Accounting for multiple levels of uncertainty of observation processes improved estimation of the ecological processes and provided guidance for future sampling designs.},
}
@article {pmid30506833,
year = {2018},
author = {Candia, IF and Bautista, V and Larsson Herrera, S and Walter, A and Ortuño Castro, N and Tasin, M and Dekker, T},
title = {Potential of locally sustainable food baits and traps against the Mediterranean fruit fly Ceratitis capitata in Bolivia.},
journal = {Pest management science},
volume = {},
number = {},
pages = {},
doi = {10.1002/ps.5286},
pmid = {30506833},
issn = {1526-4998},
support = {2012-156//Vetenskapsrådet/ ; 2016-05660//Vetenskapsrådet/ ; //SIDA-Bolivia bilateral program/ ; },
abstract = {BACKGROUND: Small-scale farmers often take a double hit from pests such as tephritid fruit-flies. The high price of products against fruit-flies, together with the higher risk of reinfestation from neighboring orchards, limits options for control. Therefore, management requires low-cost local products and concerted action. Peach production in central Bolivia is increasingly affected by invasive Ceratitis capitata. To provide locally sustainable techniques that could incentivize area-wide cooperation of growers, we tested efficiency and specificity of low-cost lures and traps compared with commercial lures and traps (Tephritrap).<br><br>RESULTS: In the laboratory, the local fermented beverage 'chicha' and baker's yeast were equally or more attractive than commercial lures. Both chicha and baker's yeast trapped more flies in field (average FTD 10.31 and 9.49), whereas commercially hydrolyzed protein lure (4.71) or Torula yeast (6.82). However, many non-target species were caught (57.3% and 53.4%). Of the six PET bottles-based traps used, the T-trap caught a similar number of flies (average FTD 5.55), but fewer beneficial insects (0.16) compared to the Tephritrap (0.92).<br><br>CONCLUSIONS: This study provides fruit growers with an economical and effective method to capture large numbers of C. capitata, suitable to be part of integrated pest management programs for fruit fly control. © 2018 Society of Chemical Industry.},
}
@article {pmid30505000,
year = {2018},
author = {Barnes, I and Fourie, A and Wingfield, MJ and Harrington, TC and McNew, DL and Sugiyama, LS and Luiz, BC and Heller, WP and Keith, LM},
title = {New Ceratocystis species associated with rapid death of Metrosideros polymorpha in Hawai'i.},
journal = {Persoonia},
volume = {40},
number = {},
pages = {154-181},
pmid = {30505000},
issn = {0031-5850},
abstract = {The native 'ōhi'a lehua (Metrosideros polymorpha) has cultural, biological and ecological significance to Hawai'i, but it is seriously threatened by a disease commonly referred to as rapid 'ōhi'a death (ROD). Preliminary investigations showed that a Ceratocystis species similar to C. fimbriata s.lat. was the cause of the disease. In this study, we used a combination of the phylogenetic, morphological and biological species concepts, as well as pathogenicity tests and microsatellite analyses, to characterise isolates collected from diseased 'ōhi'a trees across Hawai'i Island. Two distinct lineages, representing new species of Ceratocystis, were evident based on multigene phylogenetic analyses. These are described here as C. lukuohia and C. huliohia. Ceratocystis lukuohia forms part of the Latin American clade (LAC) and was most closely associated with isolates from Syngonium and Xanthosoma from the Caribbean and elsewhere, including Hawai'i, and C. platani, which is native to eastern USA. Ceratocystis huliohia resides in the Asian-Australian clade (AAC) and is most closely related to C. uchidae, C. changhui and C. cercfabiensis, which are thought to be native to Asia. Morphology and interfertility tests support the delineation of these two new species and pathogenicity tests show that both species are aggressive pathogens on seedlings of M. polymorpha. Characterisation of isolates using microsatellite markers suggest that both species are clonal and likely represent recently-introduced strains. Intensive research is underway to develop rapid screening protocols for early detection of the pathogens and management strategies in an attempt to prevent the spread of the pathogens to the other islands of Hawai'i, which are currently disease free.},
}
@article {pmid30504923,
year = {2018},
author = {Labaude, S and O'Donnell, N and Griffin, CT},
title = {Description of a personality syndrome in a common and invasive ground beetle (Coleoptera: Carabidae).},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {17479},
pmid = {30504923},
issn = {2045-2322},
support = {612713//EC | Seventh Framework Programme (European Union Seventh Framework Programme)/ ; 612713//EC | Seventh Framework Programme (European Union Seventh Framework Programme)/ ; },
abstract = {Animal personality, defined as consistent differences among individuals in their behaviour, is being increasingly studied as it might lead to a new understanding of the evolution of behaviours. Despite a clear interest in studying personality in a wide range of taxa for comparative analyses, studies on invertebrates are still scarce. Here, we investigated the personality of a ground beetle, Nebria brevicollis, which is widespread in Europe and invasive in North America. We measured seven behavioural traits from an array of three different tests: (i) activity and exploration related traits; (ii) reaction to a threat, and (iii) phototaxis. The repeatability was tested by measuring all behaviours twice, on different days. All behavioural traits were consistent through time, highlighting the presence of personality in the beetle. In addition, we analysed the relationship between the different traits and highlighted two clusters of behaviours (behavioural syndrome), one grouping activity, exploration and boldness traits, and a second one consisting of responses to a threat. This study is the first to our knowledge to provide evidence for personality dimensions within the vast group of the Carabidae. It also constitutes a preliminary step in the experimental investigation of the importance of animal personality in invasive species.},
}
@article {pmid30503460,
year = {2018},
author = {Epstein, G and Smale, DA},
title = {Between-habitat variability in the population dynamics of a global marine invader may drive management uncertainty.},
journal = {Marine pollution bulletin},
volume = {137},
number = {},
pages = {488-500},
doi = {10.1016/j.marpolbul.2018.10.055},
pmid = {30503460},
issn = {1879-3363},
mesh = {Biomass ; Conservation of Water Resources/methods ; Ecosystem ; Environmental Monitoring ; *Introduced Species ; Kelp/*physiology ; Spatio-Temporal Analysis ; Undaria/*physiology ; United Kingdom ; },
abstract = {Understanding population dynamics of established invasive species is important for designing effective management measures and predicting factors such as invasiveness and ecological impact. The kelp Undaria pinnatifida has spread to most temperate regions of the world, however a basic understanding of population dynamics is lacking for many regions. Here, Undaria was monitored for 2 years, at 9 sites, across 3 habitats to investigate habitat-related variation in population structure, reproductive capacity and morphology. Populations on marina pontoons were distinct from those in reef habitats, with extended recruitment periods and higher abundance, biomass, maturation rates and fecundity; potentially driven by lower inter-specific and higher intra-specific competition within marinas. This suggests that artificial habitats are likely to facilitate the spread, proliferation and reproductive fitness of Undaria across its non-native range. More broadly, generalising population dynamics of invasive species across habitat types is problematic, thus adding high complexity to management options.},
}
@article {pmid30503454,
year = {2018},
author = {Hwang, J and Park, SY and Lee, S and Lee, TK},
title = {High diversity and potential translocation of DNA viruses in ballast water.},
journal = {Marine pollution bulletin},
volume = {137},
number = {},
pages = {449-455},
doi = {10.1016/j.marpolbul.2018.10.053},
pmid = {30503454},
issn = {1879-3363},
mesh = {Animals ; DNA Viruses/*genetics/*isolation &amp; purification ; Introduced Species ; Metagenomics ; Mexico ; New York ; Panama ; Republic of Korea ; Saudi Arabia ; *Ships ; Water/*analysis/chemistry ; Water Microbiology ; },
abstract = {Ballast water is a common vector for the transport of invasive species to new marine and aquatic environments. We used a metagenomics approach to examine the composition and diversity of viral communities in ballast water from ships originating in Mexico, Saudi Arabia, New York, and Panama, and in water from the port of their destination in Busan, Korea. Myoviridae was the most abundant virus family in ballast water, followed Podoviridae and Siphoviridae. We also identified viruses that infect invertebrates, amoebas, and algae in ballast water and in the Busan port water. Interestingly, there were several viruses that infect humans or other animals (Swinepox virus, Raccoonpox virus, Suid herpesvirus, and Human endogenous retrovirus) in the samples from New York and Panama. In addition, there were giant viruses in all the ballast water samples, especially, identified Megavirus chilensis in New York and Panama, and Pandoravirus salinus in Mexico and Saudi Arabia. These results provide detailed descriptions of the characteristics of the viruses present in ballast water, document significant viral diversity, and indicate the potential translocation of viruses via ballast water.},
}
@article {pmid30502471,
year = {2019},
author = {Karsten, M and Lebenzon, JE and Sinclair, BJ and Terblanche, JS},
title = {Loss of ion homeostasis is not the cause of chill coma or impaired dispersal in false codling moth Thaumatotibia leucotreta (Lepidoptera: Tortricidae).},
journal = {Comparative biochemistry and physiology. Part A, Molecular &amp; integrative physiology},
volume = {229},
number = {},
pages = {40-44},
doi = {10.1016/j.cbpa.2018.11.016},
pmid = {30502471},
issn = {1531-4332},
abstract = {Dispersal is a central requirement of a successful sterile insect release programme, but field-released false codling moth (FCM) typically suffer from poor dispersal ability, especially at low ambient temperatures. Here we test the hypothesis that poor activity and dispersal in FCM is caused by delayed or perturbed recovery of ion and/or water homeostasis after chilling for handling and transport prior to field release. Hemolymph and flight muscle were collected from two treatment groups at three time points that targeted thermal conditions above and below the chill coma induction threshold of ~ 6 °C: 1) control moths kept at 25 °C, 2) moths exposed to 3 °C or 9 °C for 4 h, and 3) moths allowed to recover at 25 °C for 24 h after exposure to either 3 °C or 9 °C. We measured concentrations of Na+, K+ and Mg2+ in the hemolymph and muscle collected at each time point. Exposure to a chill-coma inducing temperature had little effect overall on ion balance in the hemolymph and flight muscle of false codling moth, but hemolymph [Na+] decreased from 10.4 ± 0.4 mM to 6.9 ± 0.7 mM as moths were chilled to 3 °C and then increased to 10.4 ± 0.9 mM after the 24 h recovery period. In the 9 °C cooling treatment, [K+] increased from 8.2 ± 0.5 mM during chilling to 14.1 ± 1.9 mM after the 24 h recovery period. No changes were seen in equilibrium potentials in either of the ions measured. Thus, we did not find evidence that water and ion homeostasis are lost by the moths in chill coma and conclude that reduced dispersal in field-released moths is not direct a consequence of the costs of re-establishment of homeostasis.},
}
@article {pmid30515687,
year = {2019},
author = {Schneider, EV and Hasler, CT and Suski, CD},
title = {Swimming performance of a freshwater fish during exposure to high carbon dioxide.},
journal = {Environmental science and pollution research international},
volume = {26},
number = {4},
pages = {3447-3454},
doi = {10.1007/s11356-018-3849-2},
pmid = {30515687},
issn = {1614-7499},
support = {G14AC00119//U.S. Geological Survey/ ; },
abstract = {Deterring the spread of invasive fishes is a challenge for managers, and bigheaded carp (including bighead and silver carp, Hypophthalmichthys spp.) are invasive fish that have spread throughout large portions of the Mississippi River basin and threaten to invade the Great Lakes' ecosystem. Studies have shown that elevated levels of carbon dioxide gas (CO2) have the ability to act as a nonphysical fish barrier, but little work has been done on the efficacy of CO2 to deter fish movement in flowing water. An annular swim flume was used to measure Uburst and sprint duration of the model species largemouth bass (Micropterus salmoides) across a range of pCO2 levels (< 400 μatm [ambient]; 10,000 μatm; 50,000 μatm; and 100,000 μatm). This species was tested as a proxy because of the likelihood of a similar CO2 response being produced, as well as constraints in obtaining and housing appropriately sized Asian carp. A significant decrease in Uburst swimming occurred when exposed to 100,000 μatm. No effects on sprint duration were detected. In both swimming tests, 15% of fish lost equilibrium when exposed to 50,000 μatm pCO2, while 50% of fish lost equilibrium when exposed to 100,000 μatm. Together, results define target levels for managers to impede the spread of largemouth bass and potentially other invasive freshwater fishes, helping guide policy to conserve aquatic ecosystems.},
}
@article {pmid30514581,
year = {2019},
author = {Hui, C and Richardson, DM},
title = {How to Invade an Ecological Network.},
journal = {Trends in ecology &amp; evolution},
volume = {34},
number = {2},
pages = {121-131},
doi = {10.1016/j.tree.2018.11.003},
pmid = {30514581},
issn = {1872-8383},
abstract = {Invasion science is in a state of paradox, having low predictability despite strong, identifiable covariates of invasion performance. We propose shifting the foundation metaphor of biological invasions from a linear filtering scheme to one that invokes complex adaptive networks. We link invasion performance and invasibility directly to the loss of network stability and indirectly to network topology through constraints from the emergence of the stability criterion in complex systems. We propose the wind vane of an invaded network - the major axis of its adjacency matrix - which reveals how species respond dynamically to invasions. We suggest that invasion ecology should steer away from comparative macroecological studies, to rather explore the ecological network centred on the focal species.},
}
@article {pmid30513969,
year = {2018},
author = {Nugnes, F and Russo, E and Viggiani, G and Bernardo, U},
title = {First Record of an Invasive Fruit Fly Belonging to Bactrocera dorsalis Complex (Diptera: Tephritidae) in Europe.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040182},
pmid = {30513969},
issn = {2075-4450},
support = {.//Campania Region/ ; Urcofi//Regione Campania/ ; },
abstract = {Emerging pests are increasingly threatening fruit orchard health across the Mediterranean area. Tephritidae, representing serious threats for Europe, are numerous, and the fruit flies Bactrocera zonata and those belonging to Bactrocera dorsalis complex are among the most alarming species. These species are highly polyphagous and B. zonata has already spread to some Mediterranean countries. Due to these ongoing threats, in the Campania Region (southern Italy), a survey with traps and infested fruits analysis was performed with the aim of detecting the presence of species of Bactrocera dorsalis complex. In two mixed fruit-trees fields, some adults belonging to a species of Bactrocera were captured in traps baited with the highly attractive male lure (methyl eugenol). They were distinguished from similar-looking Bactrocera spp. by morphological and molecular comparative analyses. Considering the existing morphological keys, specimens were tentatively identified as B. dorsalis but molecular characterization with COI split them into two clades. Some specimens were grouped with B. dorsalis similar to B. kandiensis and B. kandiensis and others in a clade including B. dorsalis and B. invadens (syn. B. dorsalis). ITS1 sequences instead confirmed morphological identification. The integrative approach allowed identifying all the specimens collected as belonging to the B. dorsalis complex. This finding represents the first field interception in Europe of a member of one of the most dangerous groups of fruit flies.},
}
@article {pmid30511315,
year = {2019},
author = {Kalnicky, EA and Brunson, MW and Beard, KH},
title = {Predictors of Participation in Invasive Species Control Activities Depend on Prior Experience with the Species.},
journal = {Environmental management},
volume = {63},
number = {1},
pages = {60-68},
doi = {10.1007/s00267-018-1126-2},
pmid = {30511315},
issn = {1432-1009},
abstract = {The increasing worldwide spread of non-native species is both a component and a consequence of environmental change, and islands are especially vulnerable to negative effects. Efforts to control non-native species often include public education intended to promote behaviors designed to reduce or reverse their spread. To inform the use of information strategies to control the invasive, non-native frog Eleutherodactylus coqui in Hawaii, USA, we surveyed over 700 property owners about their attitudes and behaviors regarding the species. Included were residents of the island of Hawaii, where the species is common and management emphasizes prevention of further spread, and three other islands where the species is largely absent and management emphasizes detection and eradication. Where frogs are present, 61% of respondents reported taking actions to reduce their population, typically clearing vegetation or hand-capturing individual frogs. For these individuals, intentions to engage in future control activities were not significantly related to reports of past behavior. Intentions to participate in future control efforts on the island of Hawaii were best predicted by attitudes toward practices. On the other islands, behavioral intentions were best predicted by subjective norms (i.e., beliefs about others' expectations that they should manage frogs). Thus, intentions to engage in non-native species management behaviors appear to be influenced by prior exposure to, and experience with, that species. Understanding the predictors of behavioral intentions at different stages of invasion have implications for the design of information strategies that can promote participation in control activities.},
}
@article {pmid30509909,
year = {2018},
author = {Schulz, CJ and Cañedo-Argüelles, M},
title = {Lost in translation: the German literature on freshwater salinization.},
journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences},
volume = {374},
number = {1764},
pages = {},
doi = {10.1098/rstb.2018.0007},
pmid = {30509909},
issn = {1471-2970},
abstract = {Human activities have globally increased and altered the ion concentration of freshwater ecosystems. The proliferation of potash mines in Germany (especially intense in the early 1900s) constitutes a good example of it. The effluents and runoff coming from potash mines led to extreme salt concentrations (e.g. 72 g l-1 of total salt content, approx. 149 mS cm-1) in surrounding rivers and streams, causing ecosystem degradation (e.g. massive algal blooms and fish kills). This promoted scientific research that was mostly published in German, thereby being neglected by the wide scientific community. Here, the findings of the German literature on freshwater salinization are discussed in the light of current knowledge. German studies revealed that at similar ion concentrations potassium (K+) can be the most toxic ion to freshwater organisms, whereas calcium (Ca2+) could have a toxicity ameliorating effect. Also, they showed that salinization could lead to biodiversity loss, major shifts in the composition of aquatic communities (e.g. dominance of salt-tolerant algae, proliferation of invasive species) and alter organic matter processing. The biological degradation caused by freshwater salinization related to potash mining has important management implications, e.g. it could prevent many European rivers and streams from reaching the good ecological status demanded by the Water Framework Directive. Within this context, German publications show several examples of salinity thresholds and biological indices that could be useful to monitor and regulate salinization (i.e. developing legally enforced salinity and ion-specific standards). They also provide potential management techniques (i.e. brine collection and disposal) and some estimates of the economic costs of freshwater salinization. Overall, the German literature on freshwater salinization provides internationally relevant information that has rarely been cited by the English literature. We suggest that the global editorial and scientific community should take action to make important findings published in non-English literature more widely available.This article is part of the theme issue 'Salt in freshwaters: causes, ecological consequences and future prospects'.},
}
@article {pmid30509832,
year = {2018},
author = {Hutchings, P},
title = {Marine introduced species in Australia, where to from here? A personal perspective from a practising taxonomist.},
journal = {Marine pollution bulletin},
volume = {136},
number = {},
pages = {477-480},
doi = {10.1016/j.marpolbul.2018.09.047},
pmid = {30509832},
issn = {1879-3363},
mesh = {Aquatic Organisms/*classification ; Australia ; Dinoflagellida ; Environmental Monitoring ; Environmental Policy ; *Introduced Species ; *Ships ; Surveys and Questionnaires ; Transportation Facilities ; },
abstract = {While introduced marine species have been arriving in Australia for centuries, it was the advent of container shipping and the discharge of ballast water into Australian ports that highlighted the problem. A summary is provided of how Australia responded to this challenge and continues to. More recently there has been an acceptance that hull fouling is also an important vector of introductions. A major problem in Australia is distinguishing introduced species from as yet undescribed native species. This is a particular problem in northern Australia where the native fauna is poorly documented. Despite the economic and environmental threats posed by introduced species, the impetus to undertake expensive comprehensive surveys has declined and attention is now focusing on targeted surveys especially of known marine pest species and molecular data to identify introductions. Ongoing research is still needed to monitor other species identified as being introduced and their potential to become pests.},
}
@article {pmid30509645,
year = {2018},
author = {Liwanag, HEM and Haro, D and Callejas, B and Labib, G and Pauly, GB},
title = {Thermal tolerance varies with age and sex for the nonnative Italian Wall Lizard (Podarcis siculus) in Southern California.},
journal = {Journal of thermal biology},
volume = {78},
number = {},
pages = {263-269},
doi = {10.1016/j.jtherbio.2018.10.010},
pmid = {30509645},
issn = {0306-4565},
mesh = {Animals ; Biological Variation, Population ; Female ; *Introduced Species ; Lizards/growth &amp; development/*physiology ; Male ; *Thermotolerance ; },
abstract = {Temperature has a substantial effect on both the physiology and behavior of ectothermic animals such as lizards. Physiology and behavior can also be influenced by ontogenetic and sex differences, but these effects are largely understudied in lizards. We examined ontogenetic and sex-based differences in thermal tolerances, preferred temperature, and temperature-dependent evaporative water loss rates in Italian Wall Lizards, Podarcis siculus, collected from an introduced population near Los Angeles, California, USA that were acclimated to laboratory conditions. Podarcis siculus has been introduced to multiple localities in the USA and the Mediterranean region and has demonstrated remarkable ability to adapt to novel climatic conditions. In the California population, adults of both sexes had a higher critical thermal maximum (CTmax) than juveniles, and adult females had a lower critical thermal minimum (CTmin) than juveniles and adult males. Thus, adult females had a significantly wider thermal breadth (CTmax - CTmin) compared to adult males and juveniles. Mass-specific evaporative water loss was higher in juveniles compared to adult males at intermediate temperatures. There was no significant difference among groups for preferred temperature. This implies that thermal tolerance, a physiological characteristic, varies with age and sex for this population, whereas thermal preference, a behavioral characteristic, does not. Interestingly, CTmin for all age and sex classes was above temperatures likely experienced by some nonnative populations in winter, suggesting individuals need to find urban thermal retreats. These results add to the growing literature demonstrating that thermal tolerances and breadths can vary between sexes and across age classes in squamate species.},
}
@article {pmid30509239,
year = {2018},
author = {Dunker, S and Boho, D and Wäldchen, J and Mäder, P},
title = {Combining high-throughput imaging flow cytometry and deep learning for efficient species and life-cycle stage identification of phytoplankton.},
journal = {BMC ecology},
volume = {18},
number = {1},
pages = {51},
pmid = {30509239},
issn = {1472-6785},
support = {01LC1319A//Bundesministerium für Bildung und Forschung/ ; 01LC1319B//Bundesministerium für Bildung und Forschung/ ; },
abstract = {BACKGROUND: Phytoplankton species identification and counting is a crucial step of water quality assessment. Especially drinking water reservoirs, bathing and ballast water need to be regularly monitored for harmful species. In times of multiple environmental threats like eutrophication, climate warming and introduction of invasive species more intensive monitoring would be helpful to develop adequate measures. However, traditional methods such as microscopic counting by experts or high throughput flow cytometry based on scattering and fluorescence signals are either too time-consuming or inaccurate for species identification tasks. The combination of high qualitative microscopy with high throughput and latest development in machine learning techniques can overcome this hurdle.<br><br>RESULTS: In this study, image based cytometry was used to collect ~ 47,000 images for brightfield and Chl a fluorescence at 60× magnification for nine common freshwater species of nano- and micro-phytoplankton. A deep neuronal network trained on these images was applied to identify the species and the corresponding life cycle stage during the batch cultivation. The results show the high potential of this approach, where species identity and their respective life cycle stage could be predicted with a high accuracy of 97%.<br><br>CONCLUSIONS: These findings could pave the way for reliable and fast phytoplankton species determination of indicator species as a crucial step in water quality assessment.},
}
@article {pmid30496181,
year = {2018},
author = {Orlova-Bienkowskaja, MJ and Spiridonov, SE and Butorina, NN and Bieńkowski, AO},
title = {Coinvasion by the ladybird Harmonia axyridis (Coleoptera: Coccinellidae) and its parasites, Hesperomyces virescens (Ascomycota: Laboulbeniales) and Parasitylenchus bifurcatus (Nematoda: Tylenchida, Allantonematidae), in the Caucasus.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0202841},
doi = {10.1371/journal.pone.0202841},
pmid = {30496181},
issn = {1932-6203},
abstract = {The study of parasites in recently established populations of invasive species can shed light on the sources of invasion and possible indirect interactions between the alien species and native ones. We studied parasites of the global invader Harmonia axyridis (Coleoptera: Coccinellidae) in the Caucasus. In 2012, the first established population of Ha. axyridis was recorded in the Caucasus in Sochi (south of European Russia, Black Sea coast). By 2018, the ladybird had spread to a vast area: Armenia, Georgia and south Russia (Adygea, the Krasnodar territory, the Stavropol territory, Dagestan, Kabardino-Balkaria and North Ossetia). The examination of 213 adults collected in Sochi in 2018 showed that 53% were infested with Hesperomyces virescens fungi (Ascomycota: Laboulbeniales) and that 8% were infested with Parasitylenchus bifurcatus nematodes (Nematoda: Tylenchida, Allantonematidae). The examined Ha. axyridis specimens were free of the parasitic mite Coccipolipus hippodamiae. An analysis of the phylogenetic relationships of P. bifurcatus based on 18S rDNA confirmed the morphological identification of this species. Hesperomyces virescens and P. bifurcatus were first recorded in the Caucasus and Russia, although they are rather widespread in Europe. This likely indicates that they appeared as a result of coinvasion with their host because the populations of Ha. axyridis, He. virescens and P. bifurcatus in the Caucasus are isolated from the main parts of the ranges of these species in Europe. The nearest localities of Ha. axyridis is on another shore of the Black Sea, and the nearest localities of He. virescens and P. bifurcatus are more than 1000 km from the Caucasus. It is impossible to determine whether the first founders of the Caucasian population were infested with the parasites or whether the parasites were introduced by specimens of Ha. axyridis that arrived later from Europe. Harmonia axyridis was released in the region for pest control, but laboratory cultures are always free of He. virescens and P. bifurcatus. Therefore, the detection of He. virescens and P. bifurcatus indicates that the population of Ha. axyridis in the Caucasus could not have derived exclusively from released specimens. We did not find He. virescens on 400 specimens of 29 other ladybird species collected from the same localities as Ha. axyridis in the Caucasus. No reliable correlation between infestation by He. virescens and that by P. bifurcatus has been found. In addition to these two parasites, an unidentified species of the order Mermithida was recorded. This is the first documented case of Ha. axyridis infestation by a parasitic nematode of this order in nature.},
}
@article {pmid30489559,
year = {2018},
author = {Tomlinson, H and Elston, DM},
title = {Aquatic antagonists: lionfish (Pterois volitans).},
journal = {Cutis},
volume = {102},
number = {4},
pages = {232-234},
pmid = {30489559},
issn = {2326-6929},
abstract = {Lionfish (Pterois volitans) are an invasive species originally from the Indian and Pacific oceans and the Red Sea that now are found all along the southeastern coast of the United States. Prompt and comprehensive treatment provides benefit to the patient. As lionfish numbers continue to increase, physicians across multiple specialties and regions may see an increase in envenomation injuries. It is important that physicians are aware of how to recognize and treat lionfish stings.},
}
@article {pmid30489182,
year = {2018},
author = {Takahashi, J and Okuyama, H and Kiyoshi, T and Takeuchi, T and Martin, SJ},
title = {Origins of Vespa velutina hornets that recently invaded Iki Island, Japan and Jersey Island, UK.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {},
number = {},
pages = {1-6},
doi = {10.1080/24701394.2018.1538366},
pmid = {30489182},
issn = {2470-1408},
abstract = {The native distribution of the yellow-legged hornet, Vespa velutina, is throughout East Asia. Around 15 years ago this species was accidentally introduced into South Korea and France, where it became established and then spread into neighbouring countries. Previous mitochondrial DNA studies showed that the South Korean, Japanese, and French populations all originated from Eastern China. Recently, the hornet has invaded Iki Island, Japan and Jersey Island, UK. In this study, we analyze the complete mitochondrial DNA sequence of V. velutina to trace the origin of these two populations. The mitochondrial DNA haplotypes (COI, Cytb, and 16S rRNA) of V. velutina in Iki Island matched the unique haplotype present in China, South Korea, and Japan, while the haplotype from Jersey Island matched that of V. velutina found in France and China. These findings were supported by data from the complete mitochondrial DNA sequence of V. velutina from Iki Island, which was consistent with the sequence from South Korea and Tsushima, whereas V. velutina in Jersey was most similar to the French population.},
}
@article {pmid30488524,
year = {2019},
author = {Thawley, CJ and Goldy-Brown, M and McCormick, GL and Graham, SP and Langkilde, T},
title = {Presence of an invasive species reverses latitudinal clines of multiple traits in a native species.},
journal = {Global change biology},
volume = {25},
number = {2},
pages = {620-628},
doi = {10.1111/gcb.14510},
pmid = {30488524},
issn = {1365-2486},
abstract = {Understanding the processes driving formation and maintenance of latitudinal clines has become increasingly important in light of accelerating global change. Many studies have focused on the role of abiotic factors, especially temperature, in generating clines, but biotic factors, including the introduction of non-native species, may also drive clinal variation. We assessed the impact of invasion by predatory fire ants on latitudinal clines in multiple fitness-relevant traits-morphology, physiological stress responsiveness, and antipredator behavior-in a native fence lizard. In areas invaded by fire ants, a latitudinal cline in morphology is opposite both the cline found in museum specimens from historical populations across the species' full latitudinal range and that found in current populations uninvaded by fire ants. Similarly, clines in stress-relevant hormone response to a stressor and in antipredator behavior differ significantly between the portions of the fence lizard range invaded and uninvaded by fire ants. Changes in these traits within fire ant-invaded areas are adaptive and together support increased and more effective antipredator behavior that allows escape from attacks by this invasive predator. However, these changes may mismatch lizards to the environments under which they historically evolved. This research shows that novel biotic pressures can alter latitudinal clines in multiple traits within a single species on ecological timescales. As global change intensifies, a greater understanding of novel abiotic and biotic pressures and how affected organisms adapt to them across space and time will be central to predicting and managing our changing environment.},
}
@article {pmid30486189,
year = {2018},
author = {Johnson, PJ and Yefremova, ZA and Manuel, J and LÓpez, P and Yegorenkova, EN},
title = {Aprostocetus chilophagae new species (Hymenoptera: Eulophidae) from South Dakota, with taxonomic notes on A. bromi (Kostjukov) and A. nebraskensis (Girault).},
journal = {Zootaxa},
volume = {4514},
number = {4},
pages = {473-486},
doi = {10.11646/zootaxa.4514.4.2},
pmid = {30486189},
issn = {1175-5334},
mesh = {Animals ; *Diptera ; Female ; *Hymenoptera ; Male ; North America ; Russia ; South Dakota ; },
abstract = {Aprostocetus chilophagae Yefremova and Yegorenkova, new species (Hymenoptera: Eulophidae: Tetrastichinae) is described from eastern South Dakota, U.S.A., and is reported as a parasitoid of the larva of Chilophaga virgati Gagné (Diptera: Cecidomyiidae), an ovule predator of Panicum virgatum. This new species is separated from sympatric A. bromi (Kostjukov) and A. nebraskensis (Girault) by structural morphology and host associations. Aprostocetus bromi was recently recognized from North America as an introduced species from Russia that is a primary parasitoid of the introduced ovule feeding gall midge Stenodiplosis bromicola Marikovskij and Agafonova (Cecidomyiidae) on the invasive grass Bromus inermis. Aprostocetus nebraskensis is a native species that is known as a parasitoid only from S. wattsi Gagné, also an ovule predator on the native prairie grasses Andropogon girardii, Schizachyrium scoparium, and Sorghastrum nutans. Trichacis rufipes Ashmead (Platygastridae) co-occurs with A. chilophagae new species on C. virgati, and a Centrodora sp. (Aphelinidae) may be a hyperparasitoid. The females of A. bromi and A. nebraskensis are redescribed and the males for each species are described for the first time.},
}
@article {pmid30486001,
year = {2018},
author = {Brito, LC and Santos, SMD and BarÃo, KR},
title = {Immature stages of Murgantia histrionica (Hemiptera: Pentatomidae).},
journal = {Zootaxa},
volume = {4508},
number = {1},
pages = {131-140},
doi = {10.11646/zootaxa.4508.1.8},
pmid = {30486001},
issn = {1175-5334},
mesh = {Animals ; California ; *Hemiptera ; Heteroptera ; Microscopy, Electron, Scanning ; Nymph ; *Ovum ; },
abstract = {Immature stages of Murgantia histrionica (Hemiptera: Pentatomidae) are described using light and scanning electron microscopy. Specimens of all life stages of M. histrionica were collected on Peritoma arborea (Cleomaceae) in Palm Springs, California. Specimens were observed in light and scanning microscopies, imagens taken and described based on specimens and photographs. We provide images of the eggs and immatures in light microscopy, and SEM of the eggs and first and fifth instars. Eggs of M. histrionica are barrel-shaped, white, with brown band and circular spot; the corium surface carinated, forming hexagonal cells; carinae irregular apically. The nymphal color pattern; the reflexed lateral margins of pro- and mesothorax; and the scattered punctuation of the tegument are a combination of characteristics enabling M. histrionica identification in its nymphal stages. The eggs of M. histrionica are similar in shape, color, and size to other Strachiini genera, such as Bagrada, Eurydema and Stenozygum. Among the Strachiini, the correct identification of M. histrionica based on immatures is possible by the shape of the head and pronotum, overall size of immatures, and coloration patterns.},
}
@article {pmid30485967,
year = {2018},
author = {Kamitani, S},
title = {First record of the alien bamboo leafhopper, Branchana xanthota, in Japan (Hemiptera: Cicadellidae: Deltocephalinae).},
journal = {Zootaxa},
volume = {4508},
number = {4},
pages = {579-581},
doi = {10.11646/zootaxa.4508.4.7},
pmid = {30485967},
issn = {1175-5334},
mesh = {Animals ; *Hemiptera ; Japan ; Poaceae ; },
abstract = {An alien bamboo leafhopper, Branchana xanthota Li, is recorded from Japan for the first time. Three species of bamboos are recognized as host plants: Phyllostachys bambusoides, Phyllostachys edulis and Pleioblastus simonii.},
}
@article {pmid30484882,
year = {2019},
author = {Raffa, RB and Pergolizzi, JV and Taylor, R and Kitzen, JM and , },
title = {Sunscreen bans: Coral reefs and skin cancer.},
journal = {Journal of clinical pharmacy and therapeutics},
volume = {44},
number = {1},
pages = {134-139},
doi = {10.1111/jcpt.12778},
pmid = {30484882},
issn = {1365-2710},
abstract = {WHAT IS KNOWN AND OBJECTIVE: Hawaii will ban two major ingredients of sunscreens. This article reviews the reasons and future directions. Hawaii recently enacted legislation that will ban the use of two major ingredients of the majority of commonly used sunscreens. The reason for the ban is the ingredients' putative deleterious impact on marine ecosystems, particularly coral reefs. But sunscreens also save lives by decreasing the risk of UV-induced skin cancers. We review both sides of the issue and potential implications for the healthcare system.<br><br>COMMENT: Coral reefs consist of organisms in delicate equilibria that are susceptible to small changes in their surroundings. Recent natural and man-made disruptions, direct or indirect, such as changes in ocean temperature and chemistry, ingress of invasive species, pathogens, pollution and deleterious fishing practices, have been blamed for the poor health, or even the outright destruction, of some coral reefs. The most popular sunscreen products contain two ingredients-oxybenzone and octinoxate-that have also been implicated in coral toxicity and will be banned. This creates a healthcare dilemma: Will the protection of coral reefs result in an increase in human skin cancers?<br><br>WHAT IS NEW AND CONCLUSION: Concentration estimates and mechanism studies support an association-direct or indirect (via promotion of viral infection)-of sunscreens with bleaching of coral reefs. A ban on the two most common sunscreen ingredients goes into effect in Hawaii on January 1, 2021. Proponents suggest that this is a trend, just the first of many such bans worldwide; opponents warn of a dire increase in human skin cancers. As a result, alternative sunscreen compounds are being sought.},
}
@article {pmid30482898,
year = {2018},
author = {Pereira Dos Santos, T and Roiz, D and Santos de Abreu, FV and Luz, SLB and Santalucia, M and Jiolle, D and Santos Neves, MSA and Simard, F and Lourenço-de-Oliveira, R and Paupy, C},
title = {Potential of Aedes albopictus as a bridge vector for enzootic pathogens at the urban-forest interface in Brazil.},
journal = {Emerging microbes &amp; infections},
volume = {7},
number = {1},
pages = {191},
pmid = {30482898},
issn = {2222-1751},
abstract = {The invasive species Aedes albopictus is present in 60% of Brazilian municipalities, including at the interfaces between urban settings and forests that are zoonotic arbovirus hotspots. We investigated Ae. albopictus colonization, adult dispersal and host feeding patterns in the anthropic-natural interface of three forested sites covering three biomes in Brazil in 2016. To evaluate whether an ecological overlap exists between Ae. albopictus and sylvatic yellow fever virus (YFV) in forests, we performed similar investigations in seven additional urban-forest interfaces where YFV circulated in 2017. We found Ae. albopictus in all forested sites. We detected eggs and adults up to 300 and 500 m into the forest, respectively, demonstrating that Ae. albopictus forest colonization and dispersal decrease with distance from the forest edge. Analysis of the host identity in blood-engorged females indicated that they fed mainly on humans and domestic mammals, suggesting rare contact with wildlife at the forest edge. Our results show that Ae. albopictus frequency declines as it penetrates into the forest and highlight its potential role as a bridge vector of zoonotic diseases at the edge of the Brazilian forests studied.},
}
@article {pmid30481226,
year = {2018},
author = {Riedl, HL and Stinson, L and Pejchar, L and Clements, WH},
title = {An introduced plant affects aquatic-derived carbon in the diets of riparian birds.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0207389},
pmid = {30481226},
issn = {1932-6203},
abstract = {Non-native plants can impact riparian ecosystem function through diverse terrestrial and aquatic pathways, with cascading effects on food webs. Invasion-mediated vegetation changes can depress terrestrial arthropod communities and alter arthropod flux across the aquatic-terrestrial interface. We investigated the effects of a non-native woody plant, Robinia neomexicana, on insect contributions to riparian songbird diets. This plant was introduced over 100 years ago to the Clear Creek drainage in northwestern Colorado (USA) from its native range, which extends into southern Colorado. We used stable isotope analysis of insects and avian feces to 1) assess whether the relative contributions of aquatic- and terrestrial-derived arthropod prey differed between reference sites and sites invaded by R. neomexicana, and 2) quantify the amount of aquatic- and terrestrial-derived resources consumed by an insectivorous songbird assemblage. Two species of insectivorous songbirds consumed more aquatic insects in invaded sites compared to reference sites. This change in terrestrial- and aquatic-derived prey in bird diets in response to a near-range plant invasion suggests that the introduction of novel species from more distant native ranges could produce similar or stronger effects. Overall, the songbird community consumed approximately 34% aquatic resources, which highlights the importance of these subsidies to riparian consumers. Our investigation of insect subsidies demonstrates how introduced species can indirectly affect food webs and provides insight into the plasticity of riparian consumer responses.},
}
@article {pmid30481181,
year = {2018},
author = {Bbole, I and Zhao, JL and Tang, SJ and Katongo, C},
title = {Mitochondrial genome annotation and phylogenetic placement of Oreochromis andersonii and O. macrochir among the cichlids of southern Africa.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0203095},
pmid = {30481181},
issn = {1932-6203},
abstract = {Genetic characterization of southern African cichlids has not received much attention. Here, we describe the mitogenome sequences and phylogenetic positioning of Oreochromis andersonii and O. macrochir among the African cichlids. The complete mitochondrial DNA sequences were determined for O. andersonii and O. macrochir, two important aquaculture and fisheries species endemic to southern Africa. The complete mitogenome sequence lengths were 16642 bp and 16644 bp for O. andersonii and O. macrochir respectively. The general structural organization follows that of other teleost species with 13 protein-coding genes, 2 rRNAs, 22 tRNAs and a non-coding control region. Phylogenetic placement of the two species among other African cichlids was performed using Maximum Likelihood (ML) and Bayesian Markov-Chain-Monte-Carlo (MCMC). The consensus trees confirmed the relative positions of the two cichlid species with O. andersonii being very closely related to O. mossambicus and O. macrochir showing a close relation to both species. Among the 13 mitochondrial DNA protein coding genes ND6 may have evolved more rapidly and COIII was the most conserved. There are signs that ND6 may have been subjected to positive selection in order for these cichlid lineages to diversify and adapt to new environments. More work is needed to characterize the southern Africa cichlids as they are important species for capture fisheries, aquaculture development and understanding biogeographic history of African cichlids. Bio-conservation of some endangered cichlids is also essential due to the threat by invasive species.},
}
@article {pmid30481174,
year = {2018},
author = {Butikofer, L and Jones, B and Sacchi, R and Mangiacotti, M and Ji, W},
title = {A new method for modelling biological invasions from early spread data accounting for anthropogenic dispersal.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0205591},
pmid = {30481174},
issn = {1932-6203},
abstract = {Biological invasions are one of the major causes of biodiversity loss worldwide. In spite of human aided (anthropogenic) dispersal being the key element in the spread of invasive species, no framework published so far accounts for its peculiar characteristics, such as very rapid dispersal and independence from the existing species distribution. We present a new method for modelling biological invasions using historical spatio-temporal records. This method first discriminates between data points of anthropogenic origin and those originating from natural dispersal, then estimates the natural dispersal kernel. We use the expectation-maximisation algorithm for the first step; we then use Ripley's K-function as a spatial similarity metric to estimate the dispersal kernel. This is done accounting for habitat suitability and providing estimates of the inference precision. Tests on simulated data show good accuracy and precision for this method, even in the presence of challenging, but realistic, limitations of data in the invasion time series, such as gaps in the survey times and low number of records. We also provide a real case application of our method using the case of Litoria frogs in New Zealand. This method is widely applicable across the field of biological invasions, epidemics and climate change induced range shifts and provides a valuable contribution to the management of such issues. Functions to implement this methodology are made available as the R package Biolinv (https://cran.r-project.org/package=Biolinv).},
}
@article {pmid30478871,
year = {2019},
author = {Reznick, DN and Losos, J and Travis, J},
title = {From low to high gear: there has been a paradigm shift in our understanding of evolution.},
journal = {Ecology letters},
volume = {22},
number = {2},
pages = {233-244},
doi = {10.1111/ele.13189},
pmid = {30478871},
issn = {1461-0248},
support = {//Guggenheim Foundation/ ; //Wadham College/ ; DEB-1556884//National Science Foundation of the United States/ ; },
abstract = {Experimental studies of evolution performed in nature and the associated demonstration of rapid evolution, observable on a time scale of months to years, were an acclaimed novelty in the 1980-1990s. Contemporary evolution is now considered ordinary and is an integrated feature of many areas of research. This shift from extraordinary to ordinary reflects a change in the perception of evolution. It was formerly thought of as a historical process, perceived through the footprints left in the fossil record or living organisms. It is now seen as a contemporary process that acts in real time. Here we review how this shift occurred and its consequences for fields as diverse as wildlife management, conservation biology, and ecosystems ecology. Incorporating contemporary evolution in these fields has caused old questions to be recast, changed the answers, caused new and previously inconceivable questions to be addressed, and inspired the development of new subdisciplines. We argue further that the potential of contemporary evolution has yet to be fulfilled. Incorporating evolutionary dynamics in any research program can provide a better assessment of how and why organisms and communities came to be as they are than is attainable without an explicit treatment of these dynamics.},
}
@article {pmid30478602,
year = {2019},
author = {Dang, W and Hu, YC and Geng, J and Wang, J and Lu, HL},
title = {Thermal physiological performance of two freshwater turtles acclimated to different temperatures.},
journal = {Journal of comparative physiology. B, Biochemical, systemic, and environmental physiology},
volume = {189},
number = {1},
pages = {121-130},
doi = {10.1007/s00360-018-1194-x},
pmid = {30478602},
issn = {1432-136X},
support = {LY15C030006//National Science Foundation of Zhejiang Province/ ; 20150432B04//Agricultural Research and Development Program of Hangzhou/ ; },
abstract = {The thermal physiological performance of invasive species may play a crucial role in determining their invasion success. In this study, we acclimated two cohorts of hatchlings of freshwater turtles (native Mauremys reevesii and invasive Trachemys scripta elegans) from low and high-latitude collection sites, respectively, to different thermal conditions (20 and 30 °C) for 4 weeks, and then compared their thermal tolerance and locomotor performance. T. scripta elegans hatchlings could swim faster (but righted themselves more slowly), and tolerate a higher temperature and wider temperature range than M. reevesii hatchlings. Similarly, T. scripta elegans hatchlings had a greater maximal performance (Pmax) value for swimming speed (but a lower Pmax value for righting time) than M. reevesii hatchlings. Temperature acclimation had a significant impact on the thermal tolerance and locomotor ability of turtles, but the acclimation effect did not differ between the two species. T. scripta elegans hatchlings seemed to have a greater thermal plasticity than M. reevesii hatchlings. High-latitude individuals showed a greater low-temperature tolerance, but lower locomotor ability (longer righting time) than low-latitude ones. However, the thermal plasticity did not differ between latitudinal cohorts. Our results indicated that T. scripta elegans performed better than M. reevesii, which might contribute to its range expansion and invasive success.},
}
@article {pmid30477155,
year = {2018},
author = {Ellison, AM and Orwig, DA and Fitzpatrick, MC and Preisser, EL},
title = {The Past, Present, and Future of the Hemlock Woolly Adelgid (Adelges tsugae) and Its Ecological Interactions with Eastern Hemlock (Tsuga canadensis) Forests.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040172},
pmid = {30477155},
issn = {2075-4450},
support = {0236897, 062043, 0715504, 10003938, 1237491, 1224437, 1459519//National Science Foundation/ ; NIFA 2011-67013-30142//U.S. Department of Agriculture/ ; },
abstract = {The nonnative hemlock woolly adelgid is steadily killing eastern hemlock trees in many parts of eastern North America. We summarize impacts of the adelgid on these forest foundation species; review previous models and analyses of adelgid spread dynamics; and examine how previous forecasts of adelgid spread and ecosystem dynamics compare with current conditions. The adelgid has reset successional sequences, homogenized biological diversity at landscape scales, altered hydrological dynamics, and changed forest stands from carbon sinks into carbon sources. A new model better predicts spread of the adelgid in the south and west of the range of hemlock, but still under-predicts its spread in the north and east. Whether these underpredictions result from inadequately modeling accelerating climate change or accounting for people inadvertently moving the adelgid into new locales needs further study. Ecosystem models of adelgid-driven hemlock dynamics have consistently forecast that forest carbon stocks will be little affected by the shift from hemlock to early-successional mixed hardwood stands, but these forecasts have assumed that the intermediate stages will remain carbon sinks. New forecasting models of adelgid-driven hemlock decline should account for observed abrupt changes in carbon flux and ongoing and accelerating human-driven land-use and climatic changes.},
}
@article {pmid30474264,
year = {2019},
author = {Nengovhela, A and Braga, J and Denys, C and de Beer, F and Tenailleau, C and Taylor, PJ},
title = {Associated tympanic bullar and cochlear hypertrophy define adaptations to true deserts in African gerbils and laminate-toothed rats (Muridae: Gerbillinae and Murinae).},
journal = {Journal of anatomy},
volume = {234},
number = {2},
pages = {179-192},
doi = {10.1111/joa.12906},
pmid = {30474264},
issn = {1469-7580},
support = {//Erasmus Mundus Programme (AESOP+ project)/ ; //National Research Foundation of South Africa (NRF)/ ; //Department of Science and Technology (DST) of South Africa/ ; },
abstract = {Hearing capabilities in desert rodents such as gerbils and heteromyids have been inferred from both anatomical and ecological aspects and tested with experiments and theoretical models. However, very few studies have focused on other desert-adapted species. In this study, a refined three-dimensional morphometric approach was used on three African rodent tribes (Otomyini, Taterillini and Gerbillini) to describe the cochlear and tympanic bullar morphology, and to explore the role of phylogeny, allometry and ecology to better understand the underlying mechanism of any observed trends of hypertrophy in the bulla and associated changes in the cochlea. As a result, desert-adapted species could be distinguished from mesic and semi-arid taxa by the gross cochlear dimensions, particularly the oval window, which is larger in desert species. Bullar and cochlear modifications between species could be explained by environment (bulla and oval window), phylogeny (cochlear curvature gradient) and/or allometry (cochlear relative length, oval window and bulla) with some exceptions. Based on their ear anatomy, we predict that Desmodillus auricularis and Parotomys brantsii should be sensitive to low-frequency sounds, with D. auricularis sensitive to high-frequency sounds, too. This study concludes that in both arid and semi-arid adapted laminate-toothed rats and gerbils there is bulla and associated cochlea hypertrophy, particularly in true desert species. Gerbils also show tightly coiled cochlea but the significance of this is debatable and may have nothing to do with adaptations to any specific acoustics in the desert environment.},
}
@article {pmid30467644,
year = {2018},
author = {Rouifed, S and Cottet, M and de Battista, M and Le Lay, YF and Piola, F and Rateau, P and Rivière-Honegger, A},
title = {Landscape perceptions and social representations of Fallopia spp. in France.},
journal = {Die Naturwissenschaften},
volume = {105},
number = {11-12},
pages = {67},
pmid = {30467644},
issn = {1432-1904},
mesh = {*Conservation of Natural Resources ; Ecosystem ; Fallopia/*physiology ; France ; Health Knowledge, Attitudes, Practice ; Humans ; *Introduced Species ; },
abstract = {Choices have to be made to manage invasive species because eradication often is not possible. Both ecological and social factors have to be considered to improve the efficiency of management plans. We conducted a social study on Fallopia spp., a major invasive plant taxon in Europe, including (1) a survey on the perception of a landscape containing Fallopia spp. using a photoquestionnaire and (2) an analysis of the social representations of Fallopia spp. of managers and users in one highly invaded area and one less invaded area. The respondents to the photoquestionnaire survey appreciated the esthetics of the landscapes less when tall Fallopia spp. were present. Few people were able to identify and name the plant, and this knowledge negatively affected the appreciation of the photos containing Fallopia spp. The central core of the social representation of Fallopia spp. was composed of the invasive status of the plant, its density, and its ecological impacts. The peripheral elements of the representation depended on the people surveyed. The users highlighted the natural aspect whereas the managers identified the need for control. In the invaded area, the managers qualified the species as &quot;unmanageable,&quot; whereas the species was qualified as &quot;foreign&quot; in the less invaded area. Those results provide insights that have to be included when objectives of management plans of these species are selected.},
}
@article {pmid30467400,
year = {2018},
author = {Yan, Y and Finnigan, GC},
title = {Development of a multi-locus CRISPR gene drive system in budding yeast.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {17277},
pmid = {30467400},
issn = {2045-2322},
support = {P20 GM103418/GM/NIGMS NIH HHS/United States ; P20 GM103418//U.S. Department of Health &amp; Human Services | NIH | National Institute of General Medical Sciences (NIGMS)/ ; Hatch Project 1013520//USDA | National Institute of Food and Agriculture (NIFA)/ ; },
abstract = {The discovery of CRISPR/Cas gene editing has allowed for major advances in many biomedical disciplines and basic research. One arrangement of this biotechnology, a nuclease-based gene drive, can rapidly deliver a genetic element through a given population and studies in fungi and metazoans have demonstrated the success of such a system. This methodology has the potential to control biological populations and contribute to eradication of insect-borne diseases, agricultural pests, and invasive species. However, there remain challenges in the design, optimization, and implementation of gene drives including concerns regarding biosafety, containment, and control/inhibition. Given the numerous gene drive arrangements possible, there is a growing need for more advanced designs. In this study, we use budding yeast to develop an artificial multi-locus gene drive system. Our minimal setup requires only a single copy of S. pyogenes Cas9 and three guide RNAs to propagate three gene drives. We demonstrate how this system could be used for targeted allele replacement of native genes and to suppress NHEJ repair systems by modifying DNA Ligase IV. A multi-locus gene drive configuration provides an expanded suite of options for complex attributes including pathway redundancy, combatting evolved resistance, and safeguards for control, inhibition, or reversal of drive action.},
}
@article {pmid30465742,
year = {2019},
author = {Shiokawa, K and Llanes, A and Hindoyan, A and Cruz-Martinez, L and Welcome, S and Rajeev, S},
title = {Peridomestic small Indian mongoose: An invasive species posing as potential zoonotic risk for leptospirosis in the Caribbean.},
journal = {Acta tropica},
volume = {190},
number = {},
pages = {166-170},
doi = {10.1016/j.actatropica.2018.11.019},
pmid = {30465742},
issn = {1873-6254},
abstract = {In this study, we investigated Leptospira infection and exposure in small Indian mongoose (Herpestes auropunctatus), an invasive animal species, in two different sites in the Caribbean island of Saint Kitts. Overall a low seroprevalence (12/148; 8.1%: 95%CI: 3.7-12.5) was observed. Agglutinating antibodies to serovars Mankarso (3.4%), Copenhageni (2.7%), Icterohemorrhagiae (1.4%), Bratislava (1.4%), Canicola (1.4%), Autumnalis (0.7%), Alexi (0.7%), Pomona (0.7%) and Grippotyphosa (0.7%) was observed on the microscopic agglutination test. The seroprevalence observed in mongooses trapped from peridomestic sites was significantly higher compared to the arid and less inhabited site (p = 0.0268). The real time PCR targeting lipL32 gene was positive for 9 out of 146 mongooses. Bacterial culture of kidneys resulted in two Leptospira isolates. Whole genome sequencing and analysis suggested that these isolates are closely related to L. interrogans serovar Copenhageni. We observed mild to severe chronic renal lesions in 20.2% of mongooses in the absence of an antibody response or active infection. Our findings emphasize the need to investigate other infectious etiologies or atypical outcomes and potential chronic long-term impact of Leptospira infection in animals and people living in an endemic area. In addition, our data reinforces the need for including locally prevalent Leptospira isolates rather than representative members of a serogroup in the microscopic agglutination test panel in epidemiologic and diagnostic investigations. In conclusion, mongoose inhabiting the island are exposed to and harbor pathogenic Leptospira and hence may play a role in the transmission. The invasive nature of the species highlights their presence as a potential risk factor for this widespread zoonotic disease.},
}
@article {pmid30463257,
year = {2018},
author = {Yang, H and Zhang, JE and Xia, J and Yang, J and Guo, J and Deng, Z and Luo, M},
title = {Comparative Characterization of the Complete Mitochondrial Genomes of the Three Apple Snails (Gastropoda: Ampullariidae) and the Phylogenetic Analyses.},
journal = {International journal of molecular sciences},
volume = {19},
number = {11},
pages = {},
pmid = {30463257},
issn = {1422-0067},
support = {No. U1131006, No. 30770403, No. 30900187, No. 31502144, No. 31870525//National Natural Science Foundation of China/ ; (No.〔2018〕118//Provincial Projects with Special Funds for Promoting Economic Development of Marine and Fisheries Department of Guangdong/ ; No. 2015A030313409//Natural Science Foundation of Guangdong Province/ ; No.2015B090903077, No.2017A090905030//Guangdong Science and Technology Program/ ; No.201604020062//the Science and Technology Project of Guangzhou/ ; },
abstract = {The apple snails Pomacea canaliculata, Pomacea diffusa and Pomacea maculate (Gastropoda: Caenogastropoda: Ampullariidae) are invasive pests causing massive economic losses and ecological damage. We sequenced and characterized the complete mitochondrial genomes of these snails to conduct phylogenetic analyses based on comparisons with the mitochondrial protein coding sequences of 47 Caenogastropoda species. The gene arrangements, distribution and content were canonically identical and consistent with typical Mollusca except for the tRNA-Gln absent in P. diffusa. An identifiable control region (d-loop) was absent. Bayesian phylogenetic analysis indicated that all the Ampullariidae species clustered on the same branch. The genus Pomacea clustered together and then with the genus Marisa. The orders Architaenioglossa and Sorbeoconcha clustered together and then with the order Hypsogastropoda. Furthermore, the intergenic and interspecific taxonomic positions were defined. Unexpectedly, Ceraesignum maximum, Dendropoma gregarium, Eualetes tulipa and Thylacodes squamigerus, traditionally classified in order Hypsogastropoda, were isolated from the order Hypsogastropoda in the most external branch of the Bayesian inference tree. The divergence times of the Caenogastropoda indicated that their evolutionary process covered four geological epochs that included the Quaternary, Neogene, Paleogene and Cretaceous periods. This study will facilitate further investigation of species identification to aid in the implementation of effective management and control strategies of these invasive species.},
}
@article {pmid30460917,
year = {2018},
author = {Brannelly, LA and Martin, G and Llewelyn, J and Skerratt, LF and Berger, L},
title = {Age- and size-dependent resistance to chytridiomycosis in the invasive cane toad Rhinella marina.},
journal = {Diseases of aquatic organisms},
volume = {131},
number = {2},
pages = {107-120},
doi = {10.3354/dao03278},
pmid = {30460917},
issn = {0177-5103},
abstract = {In Australia, the cane toad Rhinella marina and chytrid fungus Batrachochytrium dendrobatidis (Bd) are examples of invasive species that have had dramatic impacts on native fauna. However, little is known about the interaction between Bd and cane toads. We aimed to explore the interaction of these 2 species in 3 parts. First, we collated data from the literature on Bd infection in wild cane toads. Second, we tested the susceptibility of recently metamorphosed cane toads to Bd infection. Finally, we modelled the distribution of the 2 species in Australia to identify where they overlap and, therefore, might interact. Through our data collation, we found that adult cane toads are infrequently infected and do not carry high infection burdens; however, our infection experiment showed that metamorphs are highly susceptible to infection and disease, but resistance appears to increase with increasing toad size. Niche modelling revealed overlapping distributions and the potential for cane toads to be affected by chytridiomycosis in the wild. While Bd can cause mortality in small juveniles in the laboratory, warm microhabitats used by wild toads likely prevent infection, and furthermore, high mortality of juveniles is unlikely to affect the adult populations because they are highly fecund. However, to demonstrate the impact of Bd on wild cane toad populations, targeted field studies are required to assess (1) the overall impact of chytridiomycosis on recruitment especially in cooler areas more favourable for Bd and (2) whether cane toad juveniles can amplify Bd exposure of native amphibian species in these areas.},
}
@article {pmid30460409,
year = {2018},
author = {Wan, JZ and Zhang, ZX and Wang, CJ},
title = {Identifying potential distributions of 10 invasive alien trees: implications for conservation management of protected areas.},
journal = {Environmental monitoring and assessment},
volume = {190},
number = {12},
pages = {739},
pmid = {30460409},
issn = {1573-2959},
support = {31800464//National Natural Science Foundation of China/ ; 31800449//Young Scientists Fund/ ; 3180028//Fondecyt/ ; },
mesh = {Africa ; Asia, Southeastern ; Australia ; Biodiversity ; *Climate Change ; Conservation of Natural Resources/*methods ; Ecosystem ; Environmental Monitoring/*methods ; Europe ; *Introduced Species ; Latin America ; New Zealand ; Trees/*classification ; Weather ; },
abstract = {Tree invasion has the potential to negatively affect biodiversity and ecosystems, with invasive alien trees (IATs) expanding widely in protected areas (PAs) across different habitats. Thus, the effectiveness of PAs might be reduced. Investigation of the distributions of IAT is urgently required to improve the effective conservation management of PAs. We projected the potential distributions of 10 IATs, which included Acacia mearnsii, Ardisia elliptica, Cecropia peltata, Cinchona pubescens, Leucaena leucocephala, Melaleuca quinquenervia, Miconia calvescens, Morella faya, Prosopis glandulosa, and Spathodea campanulata, that have a serious influence on global biodiversity and assessed the distribution possibilities of these IATs in PAs based on the PA categories of the International Union for Conservation of Nature (IUCN). The overall potential distributions of these 10 IATs included Latin America, central and southern Africa, southeastern Asia, eastern Australia and New Zealand, and western Europe. Annual mean temperature, temperature seasonality, annual precipitation, and soil bulk density were found to be important environmental variables for the potential distributions of these IATs. Overall, A. mearnsii, A. elliptica, C. peltata, L. leucocephala, M. quinquenervia, M. calvescens, and S. campanulata were distributed mainly in the IUCN PA categories of national parks and PAs with sustainable use of natural resources. We proposed the following for conservation management of PAs: (1) completion of species inventories for PAs, (2) better understanding of factors driving invasions in PAs, (3) assessment of the efficiency of management within particular PAs, and (4) evaluation of changes in trends regarding plant invasions in PAs under climate change conditions.},
}
@article {pmid30459842,
year = {2018},
author = {Konečný, A and Popa, OP and Bartáková, V and Douda, K and Bryja, J and Smith, C and Popa, LO and Reichard, M},
title = {Modelling the invasion history of Sinanodonta woodiana in Europe: Tracking the routes of a sedentary aquatic invader with mobile parasitic larvae.},
journal = {Evolutionary applications},
volume = {11},
number = {10},
pages = {1975-1989},
pmid = {30459842},
issn = {1752-4571},
abstract = {Understanding the invasive potential of species outside their native range is one of the most pressing questions in applied evolutionary and ecological research. Admixture of genotypes of invasive species from multiple sources has been implicated in successful invasions, by generating novel genetic combinations that facilitate rapid adaptation to new environments. Alternatively, adaptive evolution on standing genetic variation, exposed by phenotypic plasticity and selected by genetic accommodation, can facilitate invasion success. We investigated the population genetic structure of an Asian freshwater mussel with a parasitic dispersal stage, Sinanodonta woodiana, which has been present in Europe since 1979 but which has expanded rapidly in the last decade. Data from a mitochondrial marker and nuclear microsatellites have suggested that all European populations of S. woodiana originate from the River Yangtze basin in China. Only a single haplotype was detected in Europe, in contrast to substantial mitochondrial diversity in native Asian populations. Analysis of microsatellite markers indicated intensive gene flow and confirmed a lower genetic diversity of European populations compared to those from the Yangtze basin, though that difference was not large. Using an Approximate Bayesian Modelling approach, we identified two areas as the probable source of the spread of S. woodiana in Europe, which matched historical records for its establishment. Their populations originated from a single colonization event. Our data do not support alternative explanations for the rapid recent spread of S. woodiana; recent arrival of a novel (cold-tolerant) genotype or continuous propagule pressure. Instead, in situ adaptation, facilitated by repeated admixture, appears to drive the ongoing expansion of S. woodiana. We discuss management consequences of our results.},
}
@article {pmid30455210,
year = {2018},
author = {Andrew, C and Diez, J and James, TY and Kauserud, H},
title = {Fungarium specimens: a largely untapped source in global change biology and beyond.},
journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences},
volume = {374},
number = {1763},
pages = {},
pmid = {30455210},
issn = {1471-2970},
abstract = {For several hundred years, millions of fungal sporocarps have been collected and deposited in worldwide collections (fungaria) to support fungal taxonomy. Owing to large-scale digitization programs, metadata associated with the records are now becoming publicly available, including information on taxonomy, sampling location, collection date and habitat/substrate information. This metadata, as well as data extracted from the physical fungarium specimens themselves, such as DNA sequences and biochemical characteristics, provide a rich source of information not only for taxonomy but also for other lines of biological inquiry. Here, we highlight and discuss how this information can be used to investigate emerging topics in fungal global change biology and beyond. Fungarium data are a prime source of knowledge on fungal distributions and richness patterns, and for assessing red-listed and invasive species. Information on collection dates has been used to investigate shifts in fungal distributions as well as phenology of sporocarp emergence in response to climate change. In addition to providing material for taxonomy and systematics, DNA sequences derived from the physical specimens provide information about fungal demography, dispersal patterns, and are emerging as a source of genomic data. As DNA analysis technologies develop further, the importance of fungarium specimens as easily accessible sources of information will likely continue to grow.This article is part of the theme issue 'Biological collections for understanding biodiversity in the Anthropocene'.},
}
@article {pmid30453540,
year = {2018},
author = {Turner, AD and Fenwick, D and Powell, A and Dhanji-Rapkova, M and Ford, C and Hatfield, RG and Santos, A and Martinez-Urtaza, J and Bean, TP and Baker-Austin, C and Stebbing, P},
title = {New Invasive Nemertean Species (Cephalothrix Simula) in England with High Levels of Tetrodotoxin and a Microbiome Linked to Toxin Metabolism.},
journal = {Marine drugs},
volume = {16},
number = {11},
pages = {},
pmid = {30453540},
issn = {1660-3397},
support = {AlertoxNet//Interreg/ ; Seedcorn//Cefas/ ; 2017-21171392//CONICYT-Doctorado Nacional/ ; CD-FRO1204.//Universidad de La Frontera/ ; },
mesh = {Animals ; Aquatic Organisms/metabolism/*microbiology ; Chromatography, High Pressure Liquid ; DNA, Bacterial/isolation &amp; purification ; England ; *Introduced Species ; Invertebrates/metabolism/*microbiology ; Microbiota ; Pseudomonas/genetics/isolation &amp; purification/*metabolism ; RNA, Ribosomal, 16S/genetics ; Sequence Analysis, DNA ; Tandem Mass Spectrometry ; Tetrodotoxin/isolation &amp; purification/*metabolism ; Vibrio alginolyticus/genetics/isolation &amp; purification/*metabolism ; },
abstract = {The marine nemertean Cephalothrix simula originates from the Pacific Ocean but in recent years has been discovered in northern Europe. The species has been associated with high levels of the marine neurotoxin Tetrodotoxin, traditionally associated with Pufferfish Poisoning. This study reports the first discovery of two organisms of C. simula in the UK, showing the geographical extent of this species is wider than originally described. Species identification was initially conducted morphologically, with confirmation by Cox 1 DNA sequencing. 16S gene sequencing enabled the taxonomic assignment of the microbiome, showing the prevalence of a large number of bacterial genera previously associated with TTX production including Alteromonas, Vibrio and Pseudomonas. LC-MS/MS analysis of the nemertean tissue revealed the presence of multiple analogues of TTX, dominated by the parent TTX, with a total toxin concentration quantified at 54 µg TTX per g of tissue. Pseudomonas luteola isolated from C. simula, together with Vibrio alginolyticus from the native nemertean Tubulanus annulatus, were cultured at low temperature and both found to contain TTX. Overall, this paper confirms the high toxicity of a newly discovered invasive nemertean species with links to toxin-producing marine bacteria and the potential risk to human safety. Further work is required to assess the geographical extent and toxicity range of C. simula along the UK coast in order to properly gauge the potential impacts on the environment and human safety.},
}
@article {pmid30452957,
year = {2019},
author = {Dragicevic, AZ},
title = {Comparing forest governance models against invasive biological threats.},
journal = {Journal of theoretical biology},
volume = {462},
number = {},
pages = {270-282},
doi = {10.1016/j.jtbi.2018.11.014},
pmid = {30452957},
issn = {1095-8541},
abstract = {In order to take account of the negative effects of invasive species and pathogens on networked forest areas, we study the dynamics of stochastic closed-loop input-output systems faced with the risk of external random perturbations. The extension of previous works on robustness is carried out by introducing a negative feedback mechanism, such that the output from an element contained in the system behaves as a negative input toward elements to which it is connected. Through the study of an overall network divided into compartments barely connected to one another, we first consider the pathway pertaining to monofunctional zoning. By looking at a single aggregated structure, we then move our focus to the pathway proper to multifunctionality. Our results show that, at significant time scales, the monofunctional-zoning mode of forest governance, generally applied in Australasia, performs robustly against invasive biological threats at all levels of outbreak probability. The multifunctional mode of forest governance, further practiced in Western Europe, is mainly sturdy when the probability of invasion verges into certainty. Should this not be the case, robustness is ensured would disturbers and perturbations be uncorrelated. Accordingly, the monofunctional pathway can afford adopting control strategies for outbreak avoidance, which is only acceptable in case the expected invasion can be halted. For the sake of maintaining low likelihood of invasion, the multifunctional pathway is compelled to applying preventive strategies.},
}
@article {pmid30449302,
year = {2019},
author = {Bach, TM and Kull, CA and Rangan, H},
title = {From killing lists to healthy country: Aboriginal approaches to weed control in the Kimberley, Western Australia.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {182-192},
doi = {10.1016/j.jenvman.2018.06.050},
pmid = {30449302},
issn = {1095-8630},
abstract = {The Australian Government's funding of land management by Aboriginal communities aims to enable them to manage natural and cultural resources according to their values and aspirations. But this approach is countered in the case of weed management, where the emphasis is on killing plants that are identified on invasive alien species lists prepared by government agencies. Based on field research with Bardi-Jawi, Bunuba, Ngurrara, Nyikina Mangala and Wunggurr land managers in the Kimberley region of Western Australia, we observed that 27 of 35 weed control projects followed the government agency weed lists for species-led control. Of these 27 projects, only two were considered successful in meeting Aboriginal cultural aspirations. In most of the other cases, the list-based approach generated frustration among Aboriginal rangers who felt they were engaged in purposeless killing. In contrast, we found that elders and rangers preferred site-based approaches that considered landscape and vegetation management from their culturally specific and highly contextual geographies of 'healthy country'. We outline instances where ranger groups have adopted site-based management that has been informed by geographies of healthy country and argue that such an approach offers a better alternative to current list-based weed control and produces positive outcomes for Aboriginal communities.},
}
@article {pmid30449301,
year = {2019},
author = {Cole, E and Keller, RP and Garbach, K},
title = {Risk of invasive species spread by recreational boaters remains high despite widespread adoption of conservation behaviors.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {112-119},
doi = {10.1016/j.jenvman.2018.06.078},
pmid = {30449301},
issn = {1095-8630},
abstract = {The spread of non-native aquatic species among waterbodies has become a major social, environmental, and economic concern. An important mechanism of this spread is the inadvertent transport of organisms on recreational boats as they are moved among waterbodies. Organisms can survive on the exterior of the boat, the interior, attached to fishing tackle, and can be intentionally moved by boaters. In response, local, state, and federal U.S. agencies have invested in outreach campaigns to educate boaters about the impacts of invasive aquatic species and the ways that boaters can reduce the risk of spread. We surveyed boaters in the U.S. state of Illinois to determine their travel patterns and how frequently they clean different parts of their boats. A majority of boaters reported that they always take recommended actions to clean their boat exterior (72% of respondents), boat interior (78%), and fishing tackle (55%), and only 4% reported that they intentionally move organisms. We used network methods to analyze the movement of recreational boaters and found strong connections among 28 highly visited waterbodies. When we removed the 38% of respondents who Always take recommended actions to reduce risk of species spread by all four mechanisms this network was minimally altered and still contained all 28 waterbodies. This indicates that despite high adoption of conservation behaviors there is a continuing risk of non-native species transport among all waterbodies. This work shows that further action is necessary if the impacts of invasive aquatic species are to be reduced in the future.},
}
@article {pmid30448947,
year = {2019},
author = {Engeman, RM and Wilson, BE and Beckerman, SF and Fischer, JW and Dufford, D and Cobban, JB},
title = {Locating and eliminating feral swine from a large area of fragmented mixed forest and agriculture habitats in north-central USA.},
journal = {Environmental science and pollution research international},
volume = {26},
number = {2},
pages = {1654-1660},
doi = {10.1007/s11356-018-3702-7},
pmid = {30448947},
issn = {1614-7499},
abstract = {Illinois is one of the US states where elimination of feral swine (Sus scrofa) was determined practical, as only a few isolated populations were established. A particularly important step towards feral swine elimination from Illinois was to eliminate the population in Fulton County. We describe the approaches applied to systematically detect, locate, and eliminate feral swine in a successful county-wide elimination. Detecting and locating feral swine was facilitated by extensive outreach activities, aerial surveys to locate crop damage, and use of camera traps placed over bait in areas where reports, sign, or crop damage occurred. The population was eliminated after 376 feral swine were removed from 2009 to 2016 by trapping, sharpshooting over bait, and aerial shooting. Aerial surveys efficiently located feral swine activity over wide areas during times of the crop cycle when damage would occur and would be most distinguishable from other damage sources. Two applications of aerial shooting in 2014 were particularly efficient for rapidly eliminating most remaining feral swine after they had become difficult to locate and remove. Persistent efforts thereafter led to the successful elimination of feral swine in Fulton County by 2016. We believe this is the first documentation of a widespread feral swine elimination in mixed agriculture and forest habitats.},
}
@article {pmid30447096,
year = {2018},
author = {Marianelli, L and Paoli, F and Sabbatini Peverieri, G and Benvenuti, C and Barzanti, GP and Bosio, G and Venanzio, D and Giacometto, E and Roversi, PF},
title = {Long-lasting insecticide-treated nets: A new integrated pest management approach for Popillia japonica (Coleoptera: Scarabaeidae).},
journal = {Integrated environmental assessment and management},
volume = {},
number = {},
pages = {},
doi = {10.1002/ieam.4107},
pmid = {30447096},
issn = {1551-3793},
abstract = {The Japanese beetle Popillia japonica Newman is a US and EU quarantine insect pest that has recently invaded northern Italy. Its ability to rapidly spread in new areas makes this insect a threat to agriculture. In the last decades, several trials on biological control of the Japanese beetle by entomopathogenic nematodes and fungi have been carried out with variable efficacy. However, the necessity of an integrated pest management approach to improve control has arisen. Long-lasting insecticide-treated nets (LLINs) have been used to control other agricultural pests with an attract-and-kill strategy. Here, we present results from laboratory evaluation of 2 LLINs, Storanet® (BASF™) and ZeroFly® (Vestergaard™), against P. japonica adults. Both were effective in killing the beetles; however, some differences emerged if different exposure times were compared: ZeroFly® always gave 100% mortality in tests from 5-s to 30-min exposure; Storanet® showed 100% mortality only with 30-min exposure and going down to 89%-99% mortality for 5-s to 15-min exposure. A description of the paralysis process occurring at 5-s exposure is given. Possible field application of LLINs within programs of integrated pest management is discussed. Integr Environ Assess Manag 2019;00:000-000. © 2018 SETAC.},
}
@article {pmid30447068,
year = {2019},
author = {Reizenberg, JL and Bloy, LE and Weyl, OLF and Shelton, JM and Dallas, HF},
title = {Variation in thermal tolerances of native freshwater fishes in South Africa's Cape Fold Ecoregion: examining the east-west gradient in species' sensitivity to climate warming.},
journal = {Journal of fish biology},
volume = {94},
number = {1},
pages = {103-112},
doi = {10.1111/jfb.13866},
pmid = {30447068},
issn = {1095-8649},
support = {//Water Research Commission (WRC) of South Africa (Project K5/2337) for funding this research, which was awarded to the Freshwater Research Centre./ ; //The National Research Foundation (NRF) South Africa and the University of Cape Town are acknowledged for student funding./ ; },
abstract = {The Cape Fold Ecoregion (CFE) is a biodiversity hotspot with high levels of endemism in its freshwater fish fauna. This study examined inter and intra-specific variation in critical thermal maxima (TCmax) for eight native species of freshwater fish from the CFE. Cape galaxias Galaxias zebratus, Breede River redfin Pseudobarbus burchelli, Berg River redfin Pseudobarbus burgi, Clanwilliam redfin Pseudobarbus calidus and fiery redfin Pseudobarbus phlegethon were the most thermally sensitive (TCmax = 29.8-32.8°C). Clanwilliam rock-catfish Austroglanis gilli, Eastern Cape redfin Pseudobarbus afer and Cape kurper Sandelia capensis were moderately sensitive (TCmax = 33.0-36.8°C). An increase in intra-specific thermal sensitivity of S. capensis was observed from east to west. The results were related to in situ water temperature, which influenced TCmax for all species, suggesting that thermal history is a major driver of variation in thermal tolerance amongst populations. These thermal tolerance data for freshwater fishes in the CFE demonstrate that resilience to climate warming follows a geographical cline and that the more sensitive western species and regions are conservation priorities.},
}
@article {pmid30443805,
year = {2019},
author = {Urcelay, C and Longo, S and Geml, J and Tecco, PA},
title = {Can arbuscular mycorrhizal fungi from non-invaded montane ecosystems facilitate the growth of alien trees?.},
journal = {Mycorrhiza},
volume = {29},
number = {1},
pages = {39-49},
doi = {10.1007/s00572-018-0874-4},
pmid = {30443805},
issn = {1432-1890},
support = {30720150101048CB//Secretaria de Ciencia y Tecnica, Universidad de Buenos Aires (AR)/ ; -//Naturalis Research Initiative grant/ ; },
mesh = {Anacardiaceae/growth &amp; development/microbiology ; Argentina ; *Ecosystem ; Gleditsia/growth &amp; development/microbiology ; Introduced Species ; Ligustrum/growth &amp; development/microbiology ; Mycorrhizae/*physiology ; Pyracantha/growth &amp; development/microbiology ; Trees/*growth &amp; development/*microbiology ; },
abstract = {It is generally assumed that recruitment and expansion of alien species along elevation gradients are constrained by climate. But, if plants are not fully constrained by climate, their expansion could be facilitated or hindered by other factors such as biotic interactions. Here, we assessed the composition of arbuscular mycorrhizal fungi (AMF) in soils along an elevation gradient (i.e. 900 m, 1600 m, 2200 m and 2700 m a.s.l.) through a fungal DNA meta-barcoding approach. In addition, we studied in the greenhouse the effects of AMF on growth and phosphorous (P) nutrition of seedlings of the alien trees Gleditsia triacanthos, Ligustrum lucidum and Pyracantha angustifolia cultivated in soils from those elevations, spanning the elevation at which they already form monospecific stands (below 1450 m a.s.l.) and higher elevations, above their current range of distribution in montane ecosystems of Central Argentina. For comparison, we also included in the experiment the dominant native tree Lithraea molleoides that historically occurs below 1300 m a.s.l. Arbuscular mycorrhizal fungal community composition showed strong community turnover with increasing elevation. The effects of these AMF communities on plant growth and nutrition differed among native and alien trees. While P nutrition in alien species' seedlings was generally enhanced by AMF along the whole gradient, the native species benefited only from AMF that occur in soils from the elevation corresponding to its current altitudinal range of distribution. These results suggest that AMF might foster upper range expansion of these invasive trees over non-invaded higher elevations.},
}
@article {pmid30442898,
year = {2018},
author = {Lopes, ML and Rodrigues, JP and Crespo, D and Dolbeth, M and Calado, R and Lillebø, AI},
title = {Functional traits of a native and an invasive clam of the genus Ruditapes occurring in sympatry in a coastal lagoon.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16901},
pmid = {30442898},
issn = {2045-2322},
abstract = {The main objective of this study was to evaluate the functional traits regarding bioturbation activity and its influence in the nutrient cycling of the native clam species Ruditapes decussatus and the invasive species Ruditapes philippinarum in Ria de Aveiro lagoon. Presently, these species live in sympatry and the impact of the invasive species was evaluated under controlled microcosmos setting, through combined/manipulated ratios of both species, including monospecific scenarios and a control without bivalves. Bioturbation intensity was measured by maximum, median and mean mix depth of particle redistribution, as well as by Surface Boundary Roughness (SBR), using time-lapse fluorescent sediment profile imaging (f-SPI) analysis, through the use of luminophores. Water nutrient concentrations (NH4-N, NOx-N and PO4-P) were also evaluated. This study showed that there were no significant differences in the maximum, median and mean mix depth of particle redistribution, SBR and water nutrient concentrations between the different ratios of clam species tested. Significant differences were only recorded between the control treatment (no bivalves) and those with bivalves. Thus, according to the present work, in a scenario of potential replacement of the native species by the invasive species, no significant differences are anticipated in short- and long-term regarding the tested functional traits.},
}
@article {pmid30430363,
year = {2018},
author = {Buellesbach, J and Whyte, BA and Cash, E and Gibson, JD and Scheckel, KJ and Sandidge, R and Tsutsui, ND},
title = {Desiccation Resistance and Micro-Climate Adaptation: Cuticular Hydrocarbon Signatures of Different Argentine Ant Supercolonies Across California.},
journal = {Journal of chemical ecology},
volume = {44},
number = {12},
pages = {1101-1114},
pmid = {30430363},
issn = {1573-1561},
support = {IOS-1557934/1557961//National Science Foundation/ ; 2016-67013-24749//National Institute of Food and Agriculture/ ; CA-B-INS-0087-H//USDA Hatch Project/ ; },
mesh = {*Adaptation, Physiological ; Alkanes/analysis/isolation &amp; purification/metabolism ; Animals ; Ants/*physiology ; Argentina ; Biodiversity ; California ; Climate ; Gas Chromatography-Mass Spectrometry ; Hydrocarbons/analysis/isolation &amp; purification/*metabolism ; Introduced Species ; Liquid-Liquid Extraction ; },
abstract = {Cuticular hydrocarbons (CHCs), the dominant fraction of the insects' epicuticle and the primary barrier to desiccation, form the basis for a wide range of chemical signaling systems. In eusocial insects, CHCs are key mediators of nestmate recognition, and colony identity appears to be maintained through a uniform CHC profile. In the unicolonial Argentine ant Linepithema humile, an unparalleled invasive expansion has led to vast supercolonies whose nestmates can still recognize each other across thousands of miles. CHC profiles are expected to display considerable variation as they adapt to fundamentally differing environmental conditions across the Argentine ant's expanded range, yet this variation would largely conflict with the vastly extended nestmate recognition based on CHC uniformity. To shed light on these seemingly contradictory selective pressures, we attempt to decipher which CHC classes enable adaptation to such a wide array of environmental conditions and contrast them with the overall CHC profile uniformity postulated to maintain nestmate recognition. n-Alkanes and n-alkenes showed the largest adaptability to environmental conditions most closely associated with desiccation, pointing at their function for water-proofing. Trimethyl alkanes, on the other hand, were reduced in environments associated with higher desiccation stress. However, CHC patterns correlated with environmental conditions were largely overriden when taking overall CHC variation across the expanded range of L. humile into account, resulting in conserved colony-specific CHC signatures. This delivers intriguing insights into the hierarchy of CHC functionality integrating both adaptation to a wide array of different climatic conditions and the maintenance of a universally accepted chemical profile.},
}
@article {pmid30429260,
year = {2018},
author = {Landi, P and Vonesh, JR and Hui, C},
title = {Variability in life-history switch points across and within populations explained by Adaptive Dynamics.},
journal = {Journal of the Royal Society, Interface},
volume = {15},
number = {148},
pages = {},
doi = {10.1098/rsif.2018.0371},
pmid = {30429260},
issn = {1742-5662},
abstract = {Understanding the factors that shape the timing of life-history switch points (SPs; e.g. hatching, metamorphosis and maturation) is a fundamental question in evolutionary ecology. Previous studies examining this question from a fitness optimization perspective have advanced our understanding of why the timing of life-history transitions may vary across populations and environments. However, in nature we also often observe variability among individuals within populations. Optimization theory, which typically predicts a single optimal SP under physiological and environmental constraints for a given environment, cannot explain this variability. Here, we re-examine the evolution of a single life-history SP between juvenile and adult stages from an Adaptive Dynamics (AD) perspective, which explicitly considers the feedback between the dynamics of population and the evolution of life-history strategy. The AD model, although simple in structure, exhibits a diverse range of evolutionary scenarios depending upon demographic and environmental conditions, including the loss of the juvenile stage, a single optimal SP, alternative optimal SPs depending on the initial phenotype, and sympatric coexistence of two SP phenotypes under disruptive selection. Such predictions are consistent with previous optimization approaches in predicting life-history SP variability across environments and between populations, and in addition they also explain within-population variability by sympatric disruptive selection. Thus, our model can be used as a theoretical tool for understanding life-history variability across environments and, especially, within species in the same environment.},
}
@article {pmid30428556,
year = {2018},
author = {Schoebel, CN and Prospero, S and Gross, A and Rigling, D},
title = {Detection of a Conspecific Mycovirus in Two Closely Related Native and Introduced Fungal Hosts and Evidence for Interspecific Virus Transmission.},
journal = {Viruses},
volume = {10},
number = {11},
pages = {},
pmid = {30428556},
issn = {1999-4915},
support = {CH-3-SMM-01/12//Lithuanian-Swiss cooperation program to reduce economic and social disparities within the enlarged European Union/International ; },
mesh = {Ascomycota/*virology ; Europe ; Fraxinus/microbiology ; Fungal Viruses/*classification/genetics/*isolation &amp; purification ; Open Reading Frames ; Plant Diseases/microbiology ; Sequence Homology ; },
abstract = {Hymenoscyphus albidus is a native fungus in Europe where it behaves as a harmless decomposer of leaves of common ash. Its close relative Hymenoscyphus fraxineus was introduced into Europe from Asia and currently threatens ash (Fraxinus sp.) stands all across the continent causing ash dieback. H. fraxineus isolates from Europe were previously shown to harbor a mycovirus named Hymenoscyphus fraxineus Mitovirus 1 (HfMV1). In the present study, we describe a conspecific mycovirus that we detected in H. albidus. HfMV1 was consistently identified in H. albidus isolates (mean prevalence: 49.3%) which were collected in the sampling areas before the arrival of ash dieback. HfMV1 strains in both fungal hosts contain a single ORF of identical length (717 AA) for which a mean pairwise identity of 94.5% was revealed. The occurrence of a conspecific mitovirus in H. albidus and H. fraxineus is most likely the result of parallel virus evolution in the two fungal hosts. HfMV1 sequences from H. albidus showed a higher nucleotide diversity and a higher number of mutations compared to those from H. fraxineus, probably due to a bottleneck caused by the introduction of H. fraxineus in Europe. Our data also points to multiple interspecific virus transfers from H. albidus to H. fraxineus, which could have contributed to the intraspecific virus diversity found in H. fraxineus.},
}
@article {pmid30428498,
year = {2018},
author = {West, AM and Jarnevich, CS and Young, NE and Fuller, PL},
title = {Evaluating Potential Distribution of High-Risk Aquatic Invasive Species in the Water Garden and Aquarium Trade at a Global Scale Based on Current Established Populations.},
journal = {Risk analysis : an official publication of the Society for Risk Analysis},
volume = {},
number = {},
pages = {},
doi = {10.1111/risa.13230},
pmid = {30428498},
issn = {1539-6924},
support = {//U.S. Geological Survey Invasive Species Program/ ; },
abstract = {Aquatic non-native invasive species are commonly traded in the worldwide water garden and aquarium markets, and some of these species pose major threats to the economy, the environment, and human health. Understanding the potential suitable habitat for these species at a global scale and at regional scales can inform risk assessments and predict future potential establishment. Typically, global habitat suitability models are fit for freshwater species with only climate variables, which provides little information about suitable terrestrial conditions for aquatic species. Remotely sensed data including topography and land cover data have the potential to improve our understanding of suitable habitat for aquatic species. In this study, we fit species distribution models using five different model algorithms for three non-native aquatic invasive species with bioclimatic, topographic, and remotely sensed covariates to evaluate potential suitable habitat beyond simple climate matches. The species examined included a frog (Xenopus laevis), toad (Bombina orientalis), and snail (Pomacea spp.). Using a unique modeling approach for each species including background point selection based on known established populations resulted in robust ensemble habitat suitability models. All models for all species had test area under the receiver operating characteristic curve values greater than 0.70 and percent correctly classified values greater than 0.65. Importantly, we employed multivariate environmental similarity surface maps to evaluate potential extrapolation beyond observed conditions when applying models globally. These global models provide necessary forecasts of where these aquatic invasive species have the potential for establishment outside their native range, a key component in risk analyses.},
}
@article {pmid30427840,
year = {2018},
author = {Mahmood, AH and Florentine, S and Graz, FP and Turville, C and Palmer, G and Sillitoe, J and McLaren, D},
title = {Comparison of techniques to control the aggressive environmental invasive species Galenia pubescens in a degraded grassland reserve, Victoria, Australia.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0203653},
pmid = {30427840},
issn = {1932-6203},
abstract = {Across many southern regions of Australia, native grasslands have become seriously threatened by human activity, with only a fraction of the original areas remaining undisturbed. In particular, the introduction and establishment of exotic invasive weeds has caused significant degradation to the ecosystems in these areas by contributing to a decrease in native plant density and diversity, and this has ultimately led to major changes to the ecosystem structure and function. One such example is Galenia pubescens. Our objective of this study was to assess the effectiveness of four different attempts to control G. pubescens: herbicide control with glyphosate; organic herbicide control with pine oil; the application of mulch; and the addition of seeds of native species to the seedbank. Results shows that any one single control strategy is insufficient to control G. pubescens, and, in addition, it has shown that regeneration of native vegetation is limited unless direct seeding is applied. There was a strong indication that a combined strategy employing more than two of the aforementioned techniques is likely to be the most effective approach, at least in the short term. Underscoring the complexity of this task, our analysis on foliage cover of G. pubescens shows that the interaction of pine oil and glyphosate treatments appeared to be very effective after six months, but were not so effective after 18 months. By contrast, seeding with native seeds was not particularly effective at six months, but its longer-term contribution appears to be effective at 18 months. Further, our results obtained from the seedbank abundance study indicate that time alone was not a significant factor in restoration of the grasslands (p = 0.165); however there were interactions with time, shown by time*glyphosate (p = 0.008) and time*seeding (p = 0.016). Both interactions indicated that the applications of glyphosate and seeding were more beneficial after 18 months compared to six months. However, full regeneration of invaded native grasslands may not be possible unless further restoration programs are re-implemented after the first cycle of G. pubescens' treatments have been completed.},
}
@article {pmid30425889,
year = {2018},
author = {Carril, OM and Griswold, T and Haefner, J and Wilson, JS},
title = {Wild bees of Grand Staircase-Escalante National Monument: richness, abundance, and spatio-temporal beta-diversity.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5867},
pmid = {30425889},
issn = {2167-8359},
abstract = {Interest in bees has grown dramatically in recent years in light of several studies that have reported widespread declines in bees and other pollinators. Investigating declines in wild bees can be difficult, however, due to the lack of faunal surveys that provide baseline data of bee richness and diversity. Protected lands such as national monuments and national parks can provide unique opportunities to learn about and monitor bee populations dynamics in a natural setting because the opportunity for large-scale changes to the landscape are reduced compared to unprotected lands. Here we report on a 4-year study of bees in Grand Staircase-Escalante National Monument (GSENM), found in southern Utah, USA. Using opportunistic collecting and a series of standardized plots, we collected bees throughout the six-month flowering season for four consecutive years. In total, 660 bee species are now known from the area, across 55 genera, and including 49 new species. Two genera not previously known to occur in the state of Utah were discovered, as well as 16 new species records for the state. Bees include ground-nesters, cavity- and twig-nesters, cleptoparasites, narrow specialists, generalists, solitary, and social species. The bee fauna reached peak diversity each spring, but also experienced a second peak in diversity in late summer, following monsoonal rains. The majority of GSENM's bees are highly localized, occurring in only a few locations throughout the monument, and often in low abundance, but consistently across the four years. Only a few species are widespread and super-abundant. Certain flowering plants appear to be inordinately attractive to the bees in GSENM, including several invasive species. GSENM protects one of the richest bee faunas in the west; the large elevational gradient, incredible number of flowering plants, and the mosaic of habitats are all likely contributors to this rich assemblage of bees.},
}
@article {pmid30425887,
year = {2018},
author = {van Wilgen, NJ and Gillespie, MS and Richardson, DM and Measey, J},
title = {A taxonomically and geographically constrained information base limits non-native reptile and amphibian risk assessment: a systematic review.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5850},
pmid = {30425887},
issn = {2167-8359},
abstract = {For many taxa, new records of non-native introductions globally occur at a near exponential rate. We undertook a systematic review of peer-reviewed publications on non-native herpetofauna, to assess the information base available for assessing risks of future invasions, resulting in 836 relevant papers. The taxonomic and geographic scope of the literature was also compared to a published database of all known invasions globally. We found 1,116 species of herpetofauna, 95% of which were present in fewer than 12 studies. Nearly all literature on the invasion ecology of herpetofauna has appeared since 2000, with a strong focus on frogs (58%), particularly cane toads (Rhinella marina) and their impacts in Australia. While fewer papers have been published on turtles and snakes, proportionately more species from both these groups have been studied than for frogs. Within each herpetofaunal group, there are a handful of well-studied species: R. marina, Lithobates catesbeianus, Xenopus laevis, Trachemys scripta, Boiga irregularis and Anolis sagrei. Most research (416 papers; 50%) has addressed impacts, with far fewer studies on aspects like trade (2%). Besides Australia (213 studies), most countries have little location-specific peer-reviewed literature on non-native herpetofauna (on average 1.1 papers per established species). Other exceptions were Guam, the UK, China, California and France, but even their publication coverage across established species was not even. New methods for assessing and prioritizing invasive species such as the Environmental Impact Classification for Alien Taxa provide useful frameworks for risk assessment, but require robust species-level studies. Global initiatives, similar to the Global Amphibian Assessment, using the species and taxonomic groups identified here, are needed to derive the level of information across broad geographic ranges required to apply these frameworks. Expansive studies on model species can be used to indicate productive research foci for understudied taxa.},
}
@article {pmid30424500,
year = {2018},
author = {Schindler, S and Rabitsch, W and Essl, F and Wallner, P and Lemmerer, K and Follak, S and Hutter, HP},
title = {Alien Species and Human Health: Austrian Stakeholder Perspective on Challenges and Solutions.},
journal = {International journal of environmental research and public health},
volume = {15},
number = {11},
pages = {},
pmid = {30424500},
issn = {1660-4601},
abstract = {No saturation in the introduction, acceleration of spread and the increasing impacts of alien species are a characteristic feature of the Anthropocene. Concomitantly, alien species affecting human health are supposed to increase, mainly due to increasing global trade and climate change. In this study, we assess challenges and solutions posed by such species to the public health sector in Austria over the next few decades. We did so using an online questionnaire circulated to 131 experts and stakeholders working on human health and biological invasions, supplemented by in-depth interviews with eleven selected experts. Results from the online survey and in-depth interviews largely support and complement each other. Experts and stakeholders suggest that (i) the allergenic Ambrosia artemisiifolia (common ragweed), the photodermatoxic Heracleum mantegazzianum (giant hogweed), and vectors of diseases such as Aedes albopictus (Asian tiger mosquito) are considered the alien species posing the most severe challenges; (ii) challenges are expected to increase in the next few decades and awareness in the public health sector is not sufficient; (iii) effective and efficient solutions are mainly related to prevention. Specific solutions include pathway management of introduction and spread by monitoring and controlling established populations of ragweed, hogweed and mosquitos.},
}
@article {pmid30422976,
year = {2018},
author = {Pauchard, A and Meyerson, LA and Bacher, S and Blackburn, TM and Brundu, G and Cadotte, MW and Courchamp, F and Essl, F and Genovesi, P and Haider, S and Holmes, ND and Hulme, PE and Jeschke, JM and Lockwood, JL and Novoa, A and Nuñez, MA and Peltzer, DA and Pyšek, P and Richardson, DM and Simberloff, D and Smith, K and van Wilgen, BW and Vilà, M and Wilson, JRU and Winter, M and Zenni, RD},
title = {Biodiversity assessments: Origin matters.},
journal = {PLoS biology},
volume = {16},
number = {11},
pages = {e2006686},
pmid = {30422976},
issn = {1545-7885},
}
@article {pmid30421153,
year = {2019},
author = {Awaydul, A and Zhu, W and Yuan, Y and Xiao, J and Hu, H and Chen, X and Koide, RT and Cheng, L},
title = {Common mycorrhizal networks influence the distribution of mineral nutrients between an invasive plant, Solidago canadensis, and a native plant, Kummerowa striata.},
journal = {Mycorrhiza},
volume = {29},
number = {1},
pages = {29-38},
doi = {10.1007/s00572-018-0873-5},
pmid = {30421153},
issn = {1432-1890},
support = {31422010//National Natural Science Foundation of China/ ; 31500416//National Natural Science Foundation of China/ ; 31670501//National Natural Science Foundation of China/ ; 2016YFC0502704//National Key Research and Development Program of China/ ; },
mesh = {Fabaceae/*metabolism/microbiology ; Introduced Species ; Minerals/*metabolism ; Mycorrhizae/*physiology ; Nutrients/*metabolism ; Solidago/*metabolism/microbiology ; },
abstract = {Invasive species often reduce ecosystem services and lead to a serious threat to native biodiversity. Roots of invasive plants are often linked to roots of native plants by common mycorrhizal networks (CMNs) of arbuscular mycorrhizal (AM) fungi, but whether and how CMNs mediate interactions between invasive and native plant species remains largely uninvestigated. We conducted two microcosm experiments, one in which we amended the soil with mineral N and another in which we amended the soil with mineral P. In each experiment, we grew a pair of test plants consisting of Kummerowia striata (native to our research site) and Solidago canadensis (an invasive species). CMNs were established between the plants, and these were either left intact or severed. Intact CMNs increased growth and nutrient acquisition by S. canadensis while they decreased nutrient acquisition by K. striata in comparison with severed CMNs. 15N and P analyses indicated that compared to severed CMNs, intact CMNs preferentially transferred mineral nutrients to S. canadensis. CMNs produced by different species of AM fungi had slightly different effects on the interaction between these two plant species. These results highlight the role of CMNs in the understanding of interactions between the invasive species S. canadensis and its native neighbor.},
}
@article {pmid30416712,
year = {2018},
author = {Tobin, PC},
title = {Managing invasive species.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
pmid = {30416712},
issn = {2046-1402},
abstract = {Invasive species pose considerable harm to native ecosystems and biodiversity and frustrate and at times fascinate the invasive species management and scientific communities. Of the numerous non-native species established around the world, only a minority of them are invasive and noxious, whereas the majority are either benign or in fact beneficial. Agriculture in North America, for example, would look dramatically different if only native plants were grown as food crops and without the services of the European honey bee as a pollinator. Yet the minority of species that are invasive negatively alter ecosystems and reduce the services they provide, costing governments, industries, and private citizens billions of dollars annually. In this review, I briefly review the consequences of invasive species and the importance of remaining vigilant in the battle against them. I then focus on their management in an increasingly connected global community.},
}
@article {pmid30416586,
year = {2018},
author = {Zurell, D and Graham, CH and Gallien, L and Thuiller, W and Zimmermann, NE},
title = {Long-distance migratory birds threatened by multiple independent risks from global change.},
journal = {Nature climate change},
volume = {8},
number = {11},
pages = {992-996},
pmid = {30416586},
issn = {1758-678X},
support = {149508//Swiss National Science Foundation/Switzerland ; 168136//Swiss National Science Foundation/Switzerland ; 170059//Swiss National Science Foundation/Switzerland ; 173342//Swiss National Science Foundation/Switzerland ; },
abstract = {Many species migrate long distances annually between their breeding and wintering areas1. While global change affects both ranges, impact assessments have generally focused on breeding ranges and ignore how environmental changes influence migrants across geographic regions and the annual cycle2,3. Using range maps and species distribution models, we quantified the risk of summer and winter range loss and migration distance increase from future climate and land cover changes on long-distance migratory birds of the Holarctic (n=715). Risk estimates are largely independent of each other and magnitudes vary geographically. If seasonal range losses and increased migration distances are not considered, we strongly underestimate the number of threatened species by 18-49% and the overall magnitude of risk for 17-50% species. Many of the analysed species facing multiple global change risks are not listed by IUCN as threatened or near threatened. Neglecting seasonal migration in impact assessments could thus seriously misguide species' conservation.},
}
@article {pmid30415475,
year = {2018},
author = {Norbury, G and van Overmeire, W},
title = {Low structural complexity of nonnative grassland habitat exposes prey to higher predation.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {},
number = {},
pages = {},
doi = {10.1002/eap.1830},
pmid = {30415475},
issn = {1051-0761},
abstract = {The structural complexity of vegetation can have profound effects on the hunting efficiency of predators, thereby affecting their intake rate of prey. While studies have shown that vegetation complexity can play an important role in managing unwanted impacts of predators, it is less clear how structural complexity of invasive vegetation affects the vulnerability of terrestrial prey. Short nonnative pasture species bred for agricultural production, for example, are highly invasive and pervade grassland ecosystems worldwide. They generally have low structural complexity compared with taller native vegetation they often displace. We conducted controlled experiments to test whether nonnative pastures expose fauna to greater predation risk. Survival of invertebrates (tethered locusts) subject to predation by invasive mammalian insectivores (European hedgehogs) in nonnative pasture (0.10 per 24 h; 95% CI, 0.08-0.13) was less than one-half that in structurally complex native perennial tussock (bunch) grass (0.24; 95% binomial CI, 0.18-0.31). A significant positive relationship was apparent between structural complexity (grass dry stem density) surrounding each locust and their survival. In a second experiment, survival of locusts placed solely in tussock increased with decreasing locust density in tussock, presumably reflecting fewer resource-rich patches on which predators could focus. These results demonstrate that invasion by structurally simple nonnative vegetation exposes prey to greater risk of predation. This is concerning from a global nature conservation perspective given that conversion of nearly one-half of the world's temperate grasslands to agriculture includes a range of invasive, structurally simple, nonnative, plant species. Minimizing invasion and maintaining and restoring complex habitat structure may be a useful conservation option for reducing unwanted predation.},
}
@article {pmid30413748,
year = {2018},
author = {Balestri, E and Vallerini, F and Menicagli, V and Barnaba, S and Lardicci, C},
title = {Biotic resistance and vegetative propagule pressure co-regulate the invasion success of a marine clonal macrophyte.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16621},
pmid = {30413748},
issn = {2045-2322},
support = {FA//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; Pra//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; FA//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; Pra//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; FA//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; Pra//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; Fa//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; Pra//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; FA//Universit&amp;#x00E0; di Pisa (University of Pisa)/ ; },
abstract = {Propagule pressure is considered a major driver of plant invasion success. Great propagule pressure would enable invasive species to colonize new areas overcoming the resistance of native species. Many highly invasive aquatic macrophytes regenerate from vegetative propagules, but few studies have experimentally investigated the importance of propagule pressure and biotic resistance, and their interaction, in determining invasion success. By manipulating both recipient habitat and the input of vegetative propagules of the invasive seaweed Caulerpa cylindracea in mesocosm, we examined whether higher propagule pressure would overcome the resistance of a native congeneric (Caulerpa prolifera) and influence its performance. With the native, C. cylindracea population frond number decreased irrespectively of pressure level. High propagule pressure did not increase stolon length and single plant size decreased due to the effects of intra- and interspecific competition. Native biomass decreased with increasing C. cylindracea propagule pressure. These results indicate that higher propagule pressure may fail in enhancing C. cylindracea invasion success in habitats colonized by the native species, and they suggest that biotic resistance and propagule pressure co-regulate the invasion process. These findings emphasize the need to preserve/restore native seaweed populations and may help to design effective management actions to prevent further C. cylindracea spread.},
}
@article {pmid30412868,
year = {2019},
author = {Gao, GF and Li, PF and Zhong, JX and Shen, ZJ and Chen, J and Li, YT and Isabwe, A and Zhu, XY and Ding, QS and Zhang, S and Gao, CH and Zheng, HL},
title = {Spartina alterniflora invasion alters soil bacterial communities and enhances soil N2O emissions by stimulating soil denitrification in mangrove wetland.},
journal = {The Science of the total environment},
volume = {653},
number = {},
pages = {231-240},
doi = {10.1016/j.scitotenv.2018.10.277},
pmid = {30412868},
issn = {1879-1026},
abstract = {Chinese mangrove, an important ecosystem in coastal wetlands, is sensitive to the invasive alien species Spartina alterniflora. However, the effects of the S. alterniflora invasion on mangrove soil N2O emissions and the underlying mechanisms by which emissions are affected have not been well studied. In this study, the N2O emitted from soils dominated by two typical native mangroves (i.e. Kandelia obovata: KO; Avicennia marina: AM), one invaded by S. alterniflora (SA), and one bare mudflat (Mud) were monitored at Zhangjiang Mangrove Estuary (where S. alterniflora is exotic). Together with soil biogeochemical properties, the potential denitrification rate and the composition of soil bacterial communities were determined simultaneously by 15NO3- tracer and high-throughput sequencing techniques, respectively. Our results showed that S. alterniflora invasion significantly (p < 0.05) increases soil N2O emissions by 15-28-fold. In addition, isotope results revealed that the soil potential denitrification rate was significantly (p < 0.05) enhanced after S. alterniflora invasion. Moreover, the S. alterniflora invasion significantly (p < 0.05) decreased soil bacterial α-diversity and strongly modified soil bacterial communities. Indicator groups strongly associated with S. alterniflora were Chloroflexia, Alphaproteobacteria, and Bacilli, each of which was abundant and acts as connector in the co-occurrence network. FAPROTAX analysis implied that the S. alterniflora invasion stimulated soil denitrification and nitrification while depressing anaerobic ammonium oxidation (anammox) and dissimilatory nitrate reduction to ammonium (DNRA). Redundancy analysis (RDA) found that soil organic matter (SOM) and pH were the most important environmental factors in altering soil bacterial communities. Taken together, our results imply that the S. alterniflora invasion in mangrove wetlands significantly stimulates soil denitrification and N2O emissions, thereby contributing N2O to the atmosphere and contributing to global climate change.},
}
@article {pmid30411189,
year = {2018},
author = {Dror, H and Novak, L and Evans, JS and López-Legentil, S and Shenkar, N},
title = {Core and Dynamic Microbial Communities of Two Invasive Ascidians: Can Host-Symbiont Dynamics Plasticity Affect Invasion Capacity?.},
journal = {Microbial ecology},
volume = {},
number = {},
pages = {},
doi = {10.1007/s00248-018-1276-z},
pmid = {30411189},
issn = {1432-184X},
support = {2014025//United States - Israel Binational Science Foundation/ ; 2014025//United States - Israel Binational Science Foundation/ ; },
abstract = {Ascidians (Chordata, Ascidiacea) are considered to be prominent marine invaders, able to tolerate highly polluted environments and fluctuations in salinity and temperature. Here, we examined the seasonal and spatial dynamics of the microbial communities in the inner-tunic of two invasive ascidians, Styela plicata (Lesueur 1823) and Herdmania momus (Savigny 1816), in order to investigate the changes that occur in the microbiome of non-indigenous ascidians in different environments. Microbial communities were characterized using next-generation sequencing of partial (V4) 16S rRNA gene sequences. A clear differentiation between the ascidian-associated microbiome and bacterioplankton was observed, and two distinct sets of operational taxonomic units (OTUs), one core and the other dynamic, were recovered from both species. The relative abundance of the dynamic OTUs in H. momus was higher than in S. plicata, for which core OTU structure was maintained independently of location. Ten and seventeen core OTUs were identified in S. plicata and H. momus, respectively, including taxa with reported capabilities of carbon fixing, ammonia oxidization, denitrification, and heavy-metal processing. The ascidian-sourced dynamic OTUs clustered in response to site and season but significantly differed from the bacterioplankton community structure. These findings suggest that the associations between invasive ascidians and their symbionts may enhance host functionality while maintaining host adaptability to changing environmental conditions.},
}
@article {pmid30408300,
year = {2018},
author = {Turnipseed, RK and Moran, PJ and Allan, SA},
title = {Behavioral responses of gravid Culex quinquefasciatus, Aedes aegypti, and Anopheles quadrimaculatus mosquitoes to aquatic macrophyte volatiles.},
journal = {Journal of vector ecology : journal of the Society for Vector Ecology},
volume = {43},
number = {2},
pages = {252-260},
doi = {10.1111/jvec.12309},
pmid = {30408300},
issn = {1948-7134},
abstract = {Mosquitoes use many cues to assess whether a habitat is conducive for reproduction, possibly including the presence of stimuli from aquatic macrophytes. The effect of water infusions of water hyacinth (Eichhornia crassipes), water lettuce (Pista stratioles), parrotfeather (Myriophyllum aquaticum), and water pennywort (Hydrocotyle umbellata) on mosquito oviposition and attraction was investigated. Gravid Culex quinquefasciatus deposited significantly more egg rafts in water hyacinth, water lettuce, or Bermuda hay (positive control) infusions compared to water, while water pennywort and parrotfeather infusions did not differ from water. In-flight attraction responses of Cx. quinquefasciatus, Aedes aegypti, and Anopheles quadrimaculatus were evaluated. The strongest attraction of gravid Cx. quinquefasciatus and Ae. aegypti occurred in the presence of volatiles from infusions of water hyacinth and water lettuce, which were equal in attractiveness to hay infusion. Water pennywort and parrotfeather infusions were not attractive. Gravid An. quadrimaculatus were not attracted to aquatic plant volatiles. The results suggest that water hyacinth and water lettuce emit volatile chemicals that attract two of three mosquito species tested and stimulate oviposition by Cx. quinquefasciatus, demonstrating that the level of attraction of aquatic plant volatiles varies among species in ways that may have relevance to bait-based detection and control methods.},
}
@article {pmid30405311,
year = {2018},
author = {Sammet, K and Ivask, M and Kurina, O},
title = {A synopsis of Estonian myriapod fauna (Myriapoda: Chilopoda, Diplopoda, Symphyla and Pauropoda).},
journal = {ZooKeys},
volume = {},
number = {793},
pages = {63-96},
pmid = {30405311},
issn = {1313-2989},
abstract = {The data on Estonian Myriapoda are scattered in various publications and there has been no overview of the fauna up to the present. A critical summary of the previous information on Estonian Myriapoda is given, supplemented by new records and distribution maps. Altogether, 5784 specimens from 276 collecting sites were studied. To the hitherto recorded 14 centipede species are added Lithobiusmelanops, L.microps, Geophiluscarpophagus, G.flavus, Strigamiatranssilvanica and Stenotaenialinearis, a probably introduced species. Of the 27 published Estonian millipede species, the data on two species proved erroneous, and two new species were recorded (Craspedosomaraulinsii and Cylindroiulusbritannicus). Two previously recorded millipede species - Brachyiuluspusillus and Mastigophorophyllonsaxonicum - were not found in the recent samples, the latter may have become more rare or extinct. Pauropoda and Symphyla lack previous reliable records. Combined with published data, the number of myriapod species known from Estonia is now set at 52. Some changes in species distribution and frequencies were detected comparing the published data with new records. Some data about habitat preferences of the more common species are also given. The majority of species have a western Palaearctic distribution, while six species are at the northern limit of their ranges.},
}
@article {pmid30403696,
year = {2018},
author = {Bieberich, J and Lauerer, M and Drachsler, M and Heinrichs, J and Müller, S and Feldhaar, H},
title = {Species- and developmental stage-specific effects of allelopathy and competition of invasive Impatiens glandulifera on co-occurring plants.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0205843},
pmid = {30403696},
issn = {1932-6203},
abstract = {BACKGROUND: Impacts of invasive species on native communities are often difficult to assess, because they depend on a range of factors, such as species identity and traits. Such context-dependencies are poorly understood yet, but knowledge is required to predict the impact of invasions.<br><br>MATERIALS AND METHODS: We assessed species- and developmental stage-specificity of competitive and allelopathic effects of the invasive plant Impatiens glandulifera on different developmental stages of four native plant species. While some studies have shown a reduction in plant growth caused by I. glandulifera, the magnitude of its impact is ambiguous. For our study we used seedlings and juveniles of I. glandulifera and the native target species Geum urbanum, Filipendula ulmaria, Urtica dioica, and Salix fragilis (seedlings only of the latter), which often co-occur with I. glandulifera in different habitats. Plants were grown in competition with I. glandulifera or treated with I. glandulifera leaf material, or 2-metoxy-1,4-naphtoquinone (2-MNQ), its supposedly main allelochemical.<br><br>RESULTS AND CONCLUSIONS: Overall I. glandulifera had a negative effect on the growth of all target species depending on the species and on the plant's developmental stage. F. ulmaria was the least affected and U. dioica the most, and seedlings were less affected than juveniles. The species-specific response to I. glandulifera may lead to an altered community composition in the field, while growth reduction of seedlings and juveniles should give I. glandulifera an advantage in cases where plant recruitment is crucial. 2-MNQ led to minor reductions in plant growth, suggesting that it may not be the only allelopathic substance of I. glandulifera. Surprisingly, I. glandulifera was not fully tolerant to 2-MNQ. This autotoxicity could contribute to I. glandulifera population dynamics. We conclude that I. glandulifera reduces the growth of native vegetation and alters early successional stages without fully hindering it.},
}
@article {pmid30403690,
year = {2018},
author = {Poché, RM and Poché, D and Franckowiak, G and Somers, DJ and Briley, LN and Tseveenjav, B and Polyakova, L},
title = {Field evaluation of low-dose warfarin baits to control wild pigs (Sus scrofa) in North Texas.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0206070},
pmid = {30403690},
issn = {1932-6203},
abstract = {Wild pigs (Sus scrofa) are a highly detrimental invasive species that occupy a rapidly expanding range within the United States. In Australia, field trials evaluating baits containing 0.09% warfarin resulted in wild pig population reduction >95%. The objective of this study was to conduct an EPA-approved field trial to evaluate the use of bait containing low-dose warfarin (0.01% and 0.005%) in reducing wild pig numbers in Texas. An 8-week field test was conducted in the panhandle ~100 km southeast of Amarillo. Two ~8 km2 treatment plots were selected and each presented with either 0.01% or 0.005% warfarin baits. One control plot (~8 km2) was presented placebo. The baits were delivered using 30 species-specific feeders per plot (n = 90) that kept wildlife from accessing the toxicant. Pig movements and feed consumption were monitored during pre-treatment, treatment, and post-treatment periods. All pigs with VHF transmitters within the 0.005% warfarin-treated plot (n = 14) succumbed to the warfarin (100% mortality). Overall, 35 wild pigs were found dead from warfarin toxicosis, within both treatment plots. Total feed consumption by wild pigs was reduced by ~97.8% and ~96.2% for the 0.005% and 0.01% warfarin baited plots, respectively, indicating the absence of pigs was a result of toxic bait consumption. Results of 97 systematic searches of the treatment plots indicated no warfarin-induced non-target wildlife fatalities. Warfarin residues in wild pig livers averaged 3.69 mg/kg (n = 13) and 2.89 mg/kg (n = 9) for pigs recovered within the 0.005% plot and 0.01% warfarin plot, respectively. This study is the first efficacy field evaluation of a wild pig toxicant conducted in the US. The results suggest low-dose warfarin bait, presented in species-specific feeders, can effectively reduce wild pig numbers and pose minimal risk to non-target wildlife and domestic animals. A product containing warfarin may provide another management tool in reducing wild pig problems.},
}
@article {pmid30402758,
year = {2018},
author = {Monakhov, VG},
title = {The Results of Sable (Martes zibellina) Reintroduction Demonstrate the Founder Effect.},
journal = {Doklady biological sciences : proceedings of the Academy of Sciences of the USSR, Biological sciences sections},
volume = {482},
number = {1},
pages = {194-197},
pmid = {30402758},
issn = {1608-3105},
mesh = {Animals ; *Endangered Species ; *Founder Effect ; *Introduced Species ; Mustelidae/anatomy &amp; histology/*genetics/physiology ; Phenotype ; },
abstract = {The relative abundance of intrapopulation groups with different parameters of skull size, coat color, and expression of an epigenetic cranial trait was compared in autochthonous, reintroduced, and donor populations of sable. Recovery of the species resources and broad variability of the phenotypic trait complex in the newly fomned populations were observed. A large proportion of the animals had the phenotype that included large size, dark coat color, and pronounced expression of a specific phene trait (foramen in the condylar fossa) and was not characteristic of the neighboring autochthonous populations. It is reasonable to attribute the presence of individuals with an unusual morphology in the newly formed populations of animals to a manifestation of the founder principle, because the effect of this principle was promoted by spatial isolation of the primary foci of translocated animals.},
}
@article {pmid30401848,
year = {2018},
author = {Wild, S},
title = {South Africa's invasive species guzzle precious water and cost US$450 million a year.},
journal = {Nature},
volume = {563},
number = {7730},
pages = {164-165},
doi = {10.1038/d41586-018-07286-0},
pmid = {30401848},
issn = {1476-4687},
}
@article {pmid30401825,
year = {2018},
author = {Divíšek, J and Chytrý, M and Beckage, B and Gotelli, NJ and Lososová, Z and Pyšek, P and Richardson, DM and Molofsky, J},
title = {Similarity of introduced plant species to native ones facilitates naturalization, but differences enhance invasion success.},
journal = {Nature communications},
volume = {9},
number = {1},
pages = {4631},
pmid = {30401825},
issn = {2041-1723},
abstract = {The search for traits associated with plant invasiveness has yielded contradictory results, in part because most previous studies have failed to recognize that different traits are important at different stages along the introduction-naturalization-invasion continuum. Here we show that across six different habitat types in temperate Central Europe, naturalized non-invasive species are functionally similar to native species occurring in the same habitat type, but invasive species are different as they occupy the edge of the plant functional trait space represented in each habitat. This pattern was driven mainly by the greater average height of invasive species. These results suggest that the primary determinant of successful establishment of alien species in resident plant communities is environmental filtering, which is expressed in similar trait distributions. However, to become invasive, established alien species need to be different enough to occupy novel niche space, i.e. the edge of trait space.},
}
@article {pmid30400299,
year = {2018},
author = {Vitale, RM and D'Aniello, E and Gorbi, S and Martella, A and Silvestri, C and Giuliani, ME and Fellous, T and Gentile, A and Carbone, M and Cutignano, A and Grauso, L and Magliozzi, L and Polese, G and D'Aniello, B and Defranoux, F and Felline, S and Terlizzi, A and Calignano, A and Regoli, F and Di Marzo, V and Amodeo, P and Mollo, E},
title = {Fishing for Targets of Alien Metabolites: A Novel Peroxisome Proliferator-Activated Receptor (PPAR) Agonist from a Marine Pest.},
journal = {Marine drugs},
volume = {16},
number = {11},
pages = {},
pmid = {30400299},
issn = {1660-3397},
support = {PRIN 2012, CAULERFISH project//Ministero dell'Istruzione, dell'Università e della Ricerca/ ; PRIN 2012, CAULERFISH project//Ministero dell'Istruzione, dell'Università e della Ricerca/ ; },
abstract = {Although the chemical warfare between invasive and native species has become a central problem in invasion biology, the molecular mechanisms by which bioactive metabolites from invasive pests influence local communities remain poorly characterized. This study demonstrates that the alkaloid caulerpin (CAU)-a bioactive component of the green alga Caulerpa cylindracea that has invaded the entire Mediterranean basin-is an agonist of peroxisome proliferator-activated receptors (PPARs). Our interdisciplinary study started with the in silico prediction of the ligand-protein interaction, which was then validated by in vivo, ex vivo and in vitro assays. On the basis of these results, we candidate CAU as a causal factor of the metabolic and behavioural disorders observed in Diplodus sargus, a native edible fish of high ecological and commercial relevance, feeding on C. cylindracea. Moreover, given the considerable interest in PPAR activators for the treatment of relevant human diseases, our findings are also discussed in terms of a possible nutraceutical/pharmacological valorisation of the invasive algal biomasses, supporting an innovative strategy for conserving biodiversity as an alternative to unrealistic campaigns for the eradication of invasive pests.},
}
@article {pmid30399179,
year = {2018},
author = {González-Gallina, A and Hidalgo-Mihart, MG and Castelazo-Calva, V},
title = {Conservation implications for jaguars and other neotropical mammals using highway underpasses.},
journal = {PloS one},
volume = {13},
number = {11},
pages = {e0206614},
pmid = {30399179},
issn = {1932-6203},
abstract = {The Nuevo Xcan-Playa del Carmen highway in Quintana Roo, bisects the vegetation corridor connecting two Jaguar Conservation Units (JCUs): Yum Balaam (north) and Sian Ka´an (south). The project´s main goal was to describe differential use of available crossing structures (wildlife underpasses and culverts) by mammals present along this highway. We set 28 camera traps along the 54km stretch of the highway covering wildlife underpasses (10), and culverts such as box culverts (9) and pipes (9) from September 2016 until March 2017. A total of 24 jaguar crossings have been recorded exclusively using wildlife underpasses, including four males and two females. At least 18 other mammal species including five of the target priority species (protected by Mexican law) were documented, all of which were native except for two invasive species. In terms of species using the crossing structures, we identified 13 species using wildlife underpasses, nine using concrete box culverts and 10 using concrete pipes. Wildlife underpasses show higher diversity values (Shannon´s exponential index = 5.8 and Inverse Simpson´s index = 4.66) compared to culverts because they allow bigger species to cross. We recommend more highways along the jaguar´s distribution should develop mitigation measures to allow for wildlife connectivity. Wildlife underpasses, along with retrofitted culverts, could help secure not only the permanence of this species by facilitating the functional connectivity between populations but have positive impacts on other neotropical mammalian fauna as well.},
}
@article {pmid30398478,
year = {2018},
author = {Singh, SP and Inderjit, and Singh, JS and Majumdar, S and Moyano, J and Nuñez, MA and Richardson, DM},
title = {Insights on the persistence of pines (Pinus species) in the Late Cretaceous and their increasing dominance in the Anthropocene.},
journal = {Ecology and evolution},
volume = {8},
number = {20},
pages = {10345-10359},
pmid = {30398478},
issn = {2045-7758},
abstract = {Although gymnosperms were nearly swept away by the rise of the angiosperms in the Late Cretaceous, conifers, and pines (Pinus species) in particular, survived and regained their dominance in some habitats. Diversification of pines into fire-avoiding (subgenus Haploxylon) and fire-adapted (subgenus Diploxylon) species occurred in response to abiotic and biotic factors in the Late Cretaceous such as competition with emerging angiosperms and changing fire regimes. Adaptations/traits that evolved in response to angiosperm-fuelled fire regimes and stressful environments in the Late Cretaceous were key to pine success and are also contributing to a new &quot;pine rise&quot; in some areas in the Anthropocene. Human-mediated activities exert both positive and negative impacts of range size and expansion and invasions of pines. Large-scale afforestation with pines, human-mediated changes to fire regimes, and other ecosystem processes are other contributing factors. We discuss traits that evolved in response to angiosperm-mediated fires and stressful environments in the Cretaceous and that continue to contribute to pine persistence and dominance and the numerous ways in which human activities favor pines.},
}
@article {pmid30397538,
year = {2018},
author = {Falcón, W and Tremblay, RL},
title = {From the cage to the wild: introductions of Psittaciformes to Puerto Rico.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5669},
pmid = {30397538},
issn = {2167-8359},
abstract = {Introduced psittacine birds can become highly invasive. In this study, we assessed invasions of Psittaciformes in Puerto Rico. We reviewed the literature, public databases, citizen science records, and performed in situ population surveys across the island to determine the historical and current status and distribution of psittacine species. We used count data from Ebird to determine population trends. For species whose populations were increasing, we modelled their potential distribution using niche modeling techniques. We found 46 Psittaciformes in Puerto Rico, of which 26% are only present as pets, at least 29 species have been reported in the wild, and of those, there is evidence that at least 12 species are breeding. Our results indicate that most introduced species which have been detected as established still persist, although mostly in localized areas and small populations. Clear evidence of invasiveness was found for Brotogeris versicolurus and Myiopsitta monachus, which have greatly expanded their range in recent years. Psittacara erythrogenys and Eupsittacula canicularis also showed population increases, although to a lesser degree. The niche models predicted suitable areas for the four species, and also indicate the potential for range expansion. We discuss the factors leading to invasion success, assess the potential impacts, and we discuss possible management strategies and research prospects.},
}
@article {pmid30397465,
year = {2018},
author = {Ni, P and Li, S and Lin, Y and Xiong, W and Huang, X and Zhan, A},
title = {Methylation divergence of invasive Ciona ascidians: Significant population structure and local environmental influence.},
journal = {Ecology and evolution},
volume = {8},
number = {20},
pages = {10272-10287},
pmid = {30397465},
issn = {2045-7758},
abstract = {The geographical expansion of invasive species usually leads to temporary and/or permanent changes at multiple levels (genetics, epigenetics, gene expression, etc.) to acclimatize to abiotic and/or biotic stresses in novel environments. Epigenetic variation such as DNA methylation is often involved in response to diverse local environments, thus representing one crucial mechanism to promote invasion success. However, evidence is scant on the potential role of DNA methylation variation in rapid environmental response and invasion success during biological invasions. In particular, DNA methylation patterns and possible contributions of varied environmental factors to methylation differentiation have been largely unknown in many invaders, especially for invasive species in marine systems where extremely complex interactions exist between species and surrounding environments. Using the methylation-sensitive amplification polymorphism (MSAP) technique, here we investigated population methylation structure at the genome level in two highly invasive model ascidians, Ciona robusta and C. intestinalis, collected from habitats with varied environmental factors such as temperature and salinity. We found high intrapopulation methylation diversity and significant population methylation differentiation in both species. Multiple analyses, such as variation partitioning analysis, showed that both genetic variation and environmental factors contributed to the observed DNA methylation variation. Further analyses found that 24 and 20 subepiloci were associated with temperature and/or salinity in C. robusta and C. intestinalis, respectively. All these results clearly showed significant methylation divergence among populations of both invasive ascidians, and varied local environmental factors, as well as genetic variation, were responsible for the observed DNA methylation patterns. The consistent findings in both species here suggest that DNA methylation, coupled with genetic variation, may facilitate local environmental adaptation during biological invasions, and DNA methylation variation molded by local environments may contribute to invasion success.},
}
@article {pmid30397446,
year = {2018},
author = {Doherty-Bone, TM and Dunn, AM and Brittain, J and Brown, LE},
title = {Invasive alien shredders clear up invasive alien leaf litter.},
journal = {Ecology and evolution},
volume = {8},
number = {20},
pages = {10049-10056},
pmid = {30397446},
issn = {2045-7758},
abstract = {Biological invasions have the potential to alter ecosystem processes profoundly, but invaders are rarely found alone. Interactions between different invasive alien species, and their cumulative impact on ecosystem functioning, have led to hypotheses of invasion meltdown whereby effects become additive leading to further ecosystem stress. Invasive riparian plants (e.g., Rhododendron ponticum) deposit leaf litter in freshwaters, which may be unconsumed by indigenous species, potentially affecting habitat heterogeneity and flow of energy to the food web. However, invasive alien decapod crustaceans are effective consumers of leaf litter, and it was hypothesized that they would also consume inputs of invasive riparian leaf litter. This study shows that invasive alien signal crayfish (Pacifastacus leniusculus) and Chinese mitten crab (Eriocheir sinensis) effectively break down different types of leaf litter, including invasive alien R. ponticum, at higher rates than indigenous white-clawed crayfish. Secondary products were more varied, with more fine particulate organic matter generated for the less palatable alien leaf litter species. Leaf species caused different changes in body mass of decapods but effects were heterogeneous by leaf and decapod: P. leniusculus showed lower mass loss when consuming R. ponticum while E. sinensis lost mass when consuming A. pseudoplatanus. Impacts of riparian invasions on detritus accumulation in freshwaters are thus potentially buffered by invasive alien decapods, illustrating a need for a more detailed consideration of both positive and negative interspecific feedbacks during biological invasions.},
}
@article {pmid30393297,
year = {2018},
author = {Maw, MM and Pan, X and Peng, Z and Wang, Y and Zhao, L and Dai, B and Wang, J},
title = {A Changeable Lab-on-a-Chip Detector for Marine Nonindigenous Microorganisms in Ship's Ballast Water.},
journal = {Micromachines},
volume = {9},
number = {1},
pages = {},
pmid = {30393297},
issn = {2072-666X},
support = {2017YFC1404603,2017YFC1404606//National Key Research and Development Program of China/ ; 51779027//National Natural Science Foundation of China/ ; 2014025017//Liaoning Provincial Natural Science Foundation of China/ ; 3132017076, 3132016325//Fundamental Research Funds for the Central Universities/ ; },
abstract = {The spread and invasion of many nonindigenous species in the ship's ballast water around the world has been a hazard and threat to ecology, economy, and human health. The rapid and accurate detection of marine invasive species in ship's ballast water is essential. This article is aimed at analysing ballast water quality by means of a changeable microfluidic chip detector thus comply with the D-2 standard of ship's ballast water management and sediment convention. The detection system was designed through the integration of microfluidic chip technology, the impedance pulse sensing and LED light induced chlorophyll fluorescence (LED-LICF) detection. This system can measure the number, size, shape, and volume of targeted microorganisms, and it can also determine the chlorophyll fluorescence intensity, which is an important factor in analysing the activity of phytoplankton. The targeted samples were Chlorella volutis, Dunaliella salina, Platymonas subcordiformis, Chrysophytes, Escherichia coli, and Enterococci. The whole detection or operation can be accomplished through online detection in a few minutes with using micron volume of the sample solution. The valid data outputs are simultaneously displayed in terms of both impedance pulse amplitudes and fluorescent intensity signals. The detection system is designed for multi-sizes real time detection through changing the microchannel sizes on the microfluidic chip. Because it can successfully detect the label-free microorganisms, the system can be applicable to in-situ detections with some modifications to the system.},
}
@article {pmid30392172,
year = {2019},
author = {Bai, X and Acharya, K},
title = {Uptake of endocrine-disrupting chemicals by quagga mussels (Dreissena bugensis) in an urban-impacted aquatic ecosystem.},
journal = {Environmental science and pollution research international},
volume = {26},
number = {1},
pages = {250-258},
doi = {10.1007/s11356-018-3320-4},
pmid = {30392172},
issn = {1614-7499},
mesh = {Animals ; Benzhydryl Compounds ; Bivalvia/metabolism ; Dreissena/*metabolism ; *Ecosystem ; Endocrine Disruptors/*metabolism ; Fresh Water ; Introduced Species ; Phenols ; Seafood ; Water Pollutants, Chemical/analysis/*metabolism ; Water Quality ; },
abstract = {Untreated organic contaminants in municipal wastewater, such as endocrine-disrupting chemicals (EDCs), have become a significant issue in aquatic ecosystems, particularly in freshwater bodies that receive wastewater discharge. This has raised concerns about the accumulation of EDCs in aquatic species via continuous exposure. This study evaluated the uptake of EDCs by quagga mussels (Dreissena bugensis), an invasive species in a water supply reservoir. The field sampling results showed that steroid hormones were not detected in the water samples, and only pharmaceuticals and personal care products were present (0.49 to 36 ng/L). Additionally, testosterone was the most abundant steroid in the mussel tissue (6.3 to 20 ng/g dry weight), and other synthetic chemicals (i.e., bisphenol A, triclosan, and salicylic acid) were also detected in the mussel tissue (24 to 47 ng/g dry weight). After being exposed to exogenous EDCs for 7, 21, and 42 days under controlled laboratory conditions, testosterone was not detected in the mussel anymore, but bisphenol A, triclosan, and salicylic acid were found at relatively high levels in the mussel tissue, although the concentrations did not increase over time. Overall, the study demonstrated the uptake of EDCs in quagga mussels, which suggests that this species can be used to reflect water quality deterioration in aquatic ecosystems.},
}
@article {pmid30386704,
year = {2018},
author = {Thorp, CJ and Alexander, ME and Vonesh, JR and Measey, J},
title = {Size-dependent functional response of Xenopus laevis feeding on mosquito larvae.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5813},
pmid = {30386704},
issn = {2167-8359},
abstract = {Predators can play an important role in regulating prey abundance and diversity, determining food web structure and function, and contributing to important ecosystem services, including the regulation of agricultural pests and disease vectors. Thus, the ability to predict predator impact on prey is an important goal in ecology. Often, predators of the same species are assumed to be functionally equivalent, despite considerable individual variation in predator traits known to be important for shaping predator-prey interactions, like body size. This assumption may greatly oversimplify our understanding of within-species functional diversity and undermine our ability to predict predator effects on prey. Here, we examine the degree to which predator-prey interactions are functionally homogenous across a natural range of predator body sizes. Specifically, we quantify the size-dependence of the functional response of African clawed frogs (Xenopus laevis) preying on mosquito larvae (Culex pipiens). Three size classes of predators, small (15-30 mm snout-vent length), medium (50-60 mm) and large (105-120 mm), were presented with five densities of prey to determine functional response type and to estimate search efficiency and handling time parameters generated from the models. The results of mesocosm experiments showed that type of functional response of X. laevis changed with size: small predators exhibited a Type II response, while medium and large predators exhibited Type III responses. Functional response data showed an inversely proportional relationship between predator attack rate and predator size. Small and medium predators had highest and lowest handling time, respectively. The change in functional response with the size of predator suggests that predators with overlapping cohorts may have a dynamic impact on prey populations. Therefore, predicting the functional response of a single size-matched predator in an experiment may misrepresent the predator's potential impact on a prey population.},
}
@article {pmid30386357,
year = {2018},
author = {Ximénez-Embún, MG and González-Guzmán, M and Arbona, V and Gómez-Cadenas, A and Ortego, F and Castañera, P},
title = {Plant-Mediated Effects of Water Deficit on the Performance of Tetranychus evansi on Tomato Drought-Adapted Accessions.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1490},
pmid = {30386357},
issn = {1664-462X},
abstract = {Climate change is expected to increase drought periods and the performance and dispersal of some invasive species such as Tetranychus evansi, which has been reported to take advantage of the nutritional changes induced by water-shortage on the tomato cultivar Moneymaker (MM). We have examined the implications for mite's biology of four accessions of the drought-adapted tomatoes, &quot;Tomàtiga de Ramellet&quot; (TR), under moderate drought stress. Mite performance was enhanced by drought in two accessions (TR61 and TR154), but not in the other two accessions (TR58 and TR126). We selected one accession of each outcome (i.e., TR154 and TR126) to further analyze plant nutritional parameters. We found that free sugars and most essential amino acids for mites were induced by drought and/or mite infestation on MM and TR154 plants, whereas sugars were not altered and a reduced number of essential amino acids were induced by drought in TR126. Remarkably, mite performance was enhanced by leaf infiltration of free sugars, essential amino acids mixture, and L-proline on well-watered MM and by free sugars on drought-stressed TR126 plants. These results indicate a positive link between the induction of soluble carbohydrates and amino acids used by the plant for osmotic adjustment and mite performance. The effects of drought and/or mite infestation on the defense response of plants was analyzed at three levels: phytohormone accumulation, the transcript levels of marker genes linked to jasmonates (JAs), salicylic acid (SA), and abscisic acid (ABA) pathways, and the activity of defense proteins. The ability of T. evansi to downregulate the accumulation of defense-related phytohormones was noted on MM and the two TR accessions analyzed (TR126 and TR154), though differences in the induction of protein defense genes and activities by drought and/or mite infestation were observed among them. These results emphasize the importance of studying plant biotic and abiotic stress factors in combination and provides an experimental framework for screening drought-tolerant tomato accessions that will be also resistant to herbivore mites.},
}
@article {pmid30385482,
year = {2018},
author = {Page, H and Sweeney, A and Pilko, A and Pinter-Wollman, N},
title = {Underlying mechanisms and ecological context of variation in exploratory behavior of the Argentine ant, Linepithema humile.},
journal = {The Journal of experimental biology},
volume = {221},
number = {Pt 24},
pages = {},
doi = {10.1242/jeb.188722},
pmid = {30385482},
issn = {1477-9145},
abstract = {Uncovering how and why animals explore their environment is fundamental for understanding population dynamics, the spread of invasive species, species interactions, etc. In social animals, individuals within a group can vary in their exploratory behavior, and the behavioral composition of the group can determine its collective success. Workers of the invasive Argentine ant (Linepithema humile) exhibit individual variation in exploratory behavior, which affects the colony's collective nest selection behavior. Here, we examine the mechanisms underlying this behavioral variation in exploratory behavior and determine its implications for the ecology of this species. We first establish that individual variation in exploratory behavior is repeatable and consistent across situations. We then show a relationship between exploratory behavior and the expression of genes that have been previously linked with other behaviors in social insects. Specifically, we found a negative relationship between exploratory behavior and the expression of the foraging (Lhfor) gene. Finally, we determine how colonies allocate exploratory individuals in natural conditions. We found that ants from inside the nest are the least exploratory individuals, whereas workers on newly formed foraging trails are the most exploratory individuals. Furthermore, we found temporal differences throughout the year: in early-mid spring, when new resources emerge, workers are more exploratory than at the end of winter, potentially allowing the colony to find and exploit new resources. These findings reveal the importance of individual variation in behavior for the ecology of social animals.},
}
@article {pmid30383249,
year = {2019},
author = {Ferronato, P and Woch, AL and Soares, PL and Bernardi, D and Botton, M and Andreazza, F and Oliveira, EE and Corrêa, AS},
title = {A Phylogeographic Approach to the Drosophila suzukii (Diptera: Drosophilidae) Invasion in Brazil.},
journal = {Journal of economic entomology},
volume = {112},
number = {1},
pages = {425-433},
doi = {10.1093/jee/toy321},
pmid = {30383249},
issn = {1938-291X},
abstract = {Biological invasions have reached large parts of the globe, due to human actions across the planet. Drosophila suzukii (Matsumura, 1931) is a globally invasive species, always associated with enormous and costly damage to agricultural crops. Native to Southeast Asia, D. suzukii recently (i.e., 2013) invaded and is dispersing through South America. Here, we used a phylogeographic approach based on the cytochrome c oxidase subunit I gene fragment to explore the invasion dynamics of D. suzukii populations in Brazil. We identified five haplotypes and moderate genetic diversity in Brazilian populations, which are undergoing demographic and spatial expansion. The analyses of molecular variance indicated a high genetic structure among the populations, which is partially explained by their morphoclimatic origin and invasion history. Drosophila suzukii expanded from southern to southeastern Brazil, aided by human-mediated transport of fruits from region to region. The sharing of haplotypes among Brazilian and other invaded regions of the world suggests a single invasion event of D. suzukii in Brazil, originating from previously invaded areas (e.g., North America and Europe). The rapid geographic dispersal and wide variety of fruits attacked by of D. suzukii require immediate implementation of control strategies (legal and phytosanitary) to manage this pest in Brazil.},
}
@article {pmid30382151,
year = {2018},
author = {Rosso, F and Tagliapietra, V and Albanese, D and Pindo, M and Baldacchino, F and Arnoldi, D and Donati, C and Rizzoli, A},
title = {Reduced diversity of gut microbiota in two Aedes mosquitoes species in areas of recent invasion.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16091},
pmid = {30382151},
issn = {2045-2322},
abstract = {Aedes mosquitoes are considered highly successful global invasive species and vectors of several pathogens of relevance for public health. Their midgut's microbiota can play an important role in affecting not only their vectorial competence but also their fitness, physiology, food digestion, metabolism, immunity and adaptation to new environmental conditions. Using high-throughput sequencing we compared the microbiota of Aedes albopictus collected in Italy with those reported in populations from France and Vietnam. We also analysed Aedes koreicus gut microbiota for the first time. We found remarkable individual difference along with common bacterial taxa in both species. Ae. albopictus collected in Italy had a lower richness and a different composition of microbiota in respect to specimens collected in France and Vietnam. It also showed a core microbiota formed mainly of bacteria of the genus Pseudomonas. Overall, the two Aedes species (Ae. albopictus and Ae. koreicus) collected in Italy, showed a large core microbiota with 75.98% of the identified Operational Taxonomic Units. Furthermore, Ae. albopictus had 2.5% prevalence of Wolbachia and 0.07% of Asaia spp, while Ae. koreicus had 14.42% of Asaia spp. and no Wolbachia. This study provides new informations on the spatial variation of the midgut bacterial communities in mosquitoes of medical relevance within areas of recent invasion and provide the basis for further studies aimed at assessing the effects of such variation on vectorial capacity for a range of pathogens.},
}
@article {pmid30380769,
year = {2018},
author = {Savadova, K and Mazur-Marzec, H and Karosienė, J and Kasperovičienė, J and Vitonytė, I and Toruńska-Sitarz, A and Koreivienė, J},
title = {Effect of Increased Temperature on Native and Alien Nuisance Cyanobacteria from Temperate Lakes: An Experimental Approach.},
journal = {Toxins},
volume = {10},
number = {11},
pages = {},
pmid = {30380769},
issn = {2072-6651},
abstract = {In response to global warming, an increase in cyanobacterial blooms is expected. In this work, the response of two native species of Planktothrix agardhii and Aphanizomenon gracile, as well as the response of two species alien to Europe-Chrysosporum bergii and Sphaerospermopsis aphanizomenoides-to gradual temperature increase was tested. The northernmost point of alien species distribution in the European continent was recorded. The tested strains of native species were favoured at 20⁻28 °C. Alien species acted differently along temperature gradient and their growth rate was higher than native species. Temperature range of optimal growth rate for S. aphanizomenoides was similar to native species, while C. bergii was favoured at 26⁻30 °C but sensitive at 18⁻20 °C. Under all tested temperatures, non-toxic strains of the native cyanobacteria species prevailed over the toxic ones. In P. agardhii, the decrease in concentration of microcystins and other oligopeptides with the increasing temperature was related to higher growth rate. However, changes in saxitoxin concentration in A. gracile under different temperatures were not detected. Accommodating climate change perspectives, the current work showed a high necessity of further studies of temperature effect on distribution and toxicity of both native and alien cyanobacterial species.},
}
@article {pmid30377510,
year = {2018},
author = {Doenz, CJ and Bittner, D and Vonlanthen, P and Wagner, CE and Seehausen, O},
title = {Rapid buildup of sympatric species diversity in Alpine whitefish.},
journal = {Ecology and evolution},
volume = {8},
number = {18},
pages = {9398-9412},
pmid = {30377510},
issn = {2045-7758},
abstract = {Adaptive radiations in postglacial fish offer excellent settings to study the evolutionary mechanisms involved in the rapid buildup of sympatric species diversity from a single lineage. Here, we address this by exploring the genetic and ecological structure of the largest Alpine whitefish radiation known, that of Lakes Brienz and Thun, using microsatellite data of more than 2000 whitefish caught during extensive species-targeted and habitat-randomized fishing campaigns. We find six strongly genetically and ecologically differentiated species, four of which occur in both lakes, and one of which was previously unknown. These four exhibit clines of genetic differentiation that are paralleled in clines of eco-morphological and reproductive niche differentiation, consistent with models of sympatric ecological speciation along environmental gradients. In Lake Thun, we find two additional species, a profundal specialist and a species introduced in the 1930s from another Alpine whitefish radiation. Strong genetic differentiation between this introduced species and all native species of Lake Thun suggests that reproductive isolation can evolve among allopatric whitefish species within 15,000 years and persist in secondary sympatry. Consistent with speciation theory, we find stronger correlations between genetic and ecological differentiation for sympatrically than for allopatrically evolved species.},
}
@article {pmid30377498,
year = {2018},
author = {Thibault, M and Masse, F and Pujapujane, A and Lannuzel, G and Bordez, L and Potter, MA and Fogliani, B and Vidal, É and Brescia, F},
title = {&quot;Liaisons dangereuses&quot;: The invasive red-vented bulbul (Pycnonotus cafer), a disperser of exotic plant species in New Caledonia.},
journal = {Ecology and evolution},
volume = {8},
number = {18},
pages = {9259-9269},
pmid = {30377498},
issn = {2045-7758},
abstract = {The biodiversity hotspot of New Caledonia hosts high levels of endemism (74% of flora) that is threatened increasingly by climate change, habitat reduction, and invasive species. The fruit-eating red-vented bulbul (Pycnonotus cafer) is currently invading the main island of the archipelago, and its recent dispersal out of urbanized habitats raises questions about its potential to disperse noxious plant seeds along urban corridors and beyond. Indeed, the red-vented bulbul is considered a vector of several introduced plant species in its alien range including Miconia calvescens, Lantana camara, and Schinus terebinthifolius. We conducted a quantitative assessment of the bulbul's fruits consumption by analyzing the gut contents of shot birds. We estimated gut passage times for four species of fruit found in gut contents (S. terebinthifolius, Myrtastrum rufopunctatum, Passiflora suberosa, and Ficus prolixa) and tested the effects of bird digestion on seed germination rates for two species. Finally, we monitored the movements of individual VHF radio-tagged red-vented bulbuls. All of the consumed fruit species we identified here have red fleshy diaspore, including fruit of the shrub M. rufopunctatum that occurred frequently (9.6%) in bulbul gut samples. Median gut passage times were short (15-41 min), corresponding to short-distance seed transportation (77-92 m). The effect of gut passage was positive for the germination of the invasive S. terebinthifolius and negative for the endemic M. rufopunctatum, suggesting a potential bias in the contribution to the dispersal toward alien species. This study provides the first integrated assessment of mechanisms involved in the seed dispersal effectiveness of this high-concern invasive bird species that is expected to face similar plant communities in most of its alien range in tropical islands. More generally, our results enhance knowledge of synergies between non-native frugivores and plant species dispersal.},
}
@article {pmid30377493,
year = {2018},
author = {Robinson, CV and Garcia de Leaniz, C and James, J and Cable, J and Orozco-terWengel, P and Consuegra, S},
title = {Genetic diversity and parasite facilitated establishment of the invasive signal crayfish (Pacifastacus leniusculus) in Great Britain.},
journal = {Ecology and evolution},
volume = {8},
number = {18},
pages = {9181-9191},
pmid = {30377493},
issn = {2045-7758},
abstract = {Successful establishment of non-native species is strongly influenced, among other factors, by the genetic variation of founding populations, which can be enhanced by multiple introductions through admixture. Coexisting pathogens can also facilitate the establishment of non-native species by detrimentally impacting on the native fauna acting as novel weapons. The signal crayfish (Pacifastacus leniusculus) is a highly invasive species, which has caused mass declines of native crayfish in Europe through displacement and transmission of the oomycete Aphanomyces astaci (crayfish plague), which is typically lethal to native European crayfish. However, whether Aphanomyces astaci may have facilitated the invasion of the signal crayfish is not known. We estimated the genetic diversity at microsatellite DNA loci, effective population size, and potential origins of seven infected and noninfected signal crayfish populations in Europe and one founder population in North America. Approximate Bayesian computation analysis and population structuring suggested multiple host introductions from diverse source populations, as well as higher heterozygosity among infected than uninfected populations, which could reflect a fitness advantage. Low effective population size, moderate heterozygosity, and lack of isolation by distance suggest that some invasive signal crayfish populations may not be fully established or that their genetic diversity may have been reduced by eradication attempts.},
}
@article {pmid30377487,
year = {2018},
author = {Gallego-Tévar, B and Rubio-Casal, AE and de Cires, A and Figueroa, E and Grewell, BJ and Castillo, JM},
title = {Phenotypic plasticity of polyploid plant species promotes transgressive behaviour in their hybrids.},
journal = {AoB PLANTS},
volume = {10},
number = {5},
pages = {ply055},
pmid = {30377487},
issn = {2041-2851},
abstract = {Hybridization is a frequent process that leads to relevant evolutionary consequences, but there is a lack of studies regarding the relationships of the variability of the response of parental plant species to environmental gradients and the responses of their hybrids at a phenotypic level. We designed an experiment in which we exposed two reciprocal cordgrass hybrids, Spartina maritima × densiflora and S. densiflora × maritima, and their parental species to four salinity concentrations for 30 days. The main objectives were to compare the performance of the hybrids with that of their parents, to distinguish the phenotypic inheritance operating in the hybrids and to analyse the relationships between the variability in the responses of the parents and the responses of their hybrids to salinity. We characterized the responses and the degree of variability for 37 foliar traits. Both hybrids presented greater salinity tolerance than their parents, showing their highest percentage of transgressive traits at both extremes of the salinity gradient. When the parental plants themselves showed a more plastic response for a given trait, there was a greater chance that their hybrid developed a transgressive behaviour for this trait. This finding supports a new focus to be applied for the artificial development of vigorous hybrid crops.},
}
@article {pmid30376564,
year = {2018},
author = {Richter, A and Gándara, AM and Silva, F and Brante, A},
title = {The alien slipper limpet Crepipatella dilatata (Lamarck, 1819) in northern Spain: A multidisciplinary approach to its taxonomic identification and invasive biology.},
journal = {PloS one},
volume = {13},
number = {10},
pages = {e0205739},
pmid = {30376564},
issn = {1932-6203},
abstract = {The slipper limpet Crepipatella dilatata, native to Chile and Argentina, was introduced in Spain in 2005. The species was thought to inhabit the region of Rias Bajas, yet recently, putative C. dilatata populations have been documented on the coast of north-central Spain and in the Ebro Delta of the Spanish Mediterranean. Here we undertook a multidisciplinary approach to study the invasion biology of this species. Specifically, two geographically distant populations, one being a successfully established population from O Grove and the other a declining population from Gijon, were studied over the course of four years. Analyses of morphological and developmental traits as well as genetic information confirmed the presence of C. dilatata in these sites. The results revealed polymorphism in anatomical traits and shell shape. Shell shape polymorphism was unevenly distributed among sites and among sexes. Males were monomorphic, while females were polymorphic. Of the female morphotypes encountered, one was absent in the declining population from Gijón. Size at first female maturation and female size were greater in the declining population than in the established population. Reproductive success varied seasonally but not spatially among populations. In the established population, gregariousness was significantly greater; the size when sex changes was found to be plastic and socially controlled. The sex ratio of the declining population was female biased while in the established population the sex ratio changed during the study period from being balanced to being female biased. This change in sex ratio was probably due to higher male mortality. Molecular analyses pointed to the localities of Corral Bay in southern Chile and Puerto Madryn in southern Argentina as potential population sources. The intercontinental import of fresh mussels cultivated in Chilean farms is a likely source of this mussel in Spain. Comparison with available data of native populations of C. dilatata strongly indicate that ecophenotypic plasticity, socially controlled sex change, high gregariousness, increased nurse egg supply to viable larvae during the encapsulated developmental period, later maturation and larger female sizes altogether enhance establishment success of this non-indigenous species. Human-mediated factors like the intraregional mussel trade and transplantation are also likely secondary dispersal mechanisms favouring the spread of this organism.},
}
@article {pmid30375415,
year = {2018},
author = {Cao, Y and Xiao, Y and Zhang, S and Hu, W},
title = {Simulated warming enhances biological invasion of Solidago canadensis and Bidens frondosa by increasing reproductive investment and altering flowering phenology pattern.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {16073},
pmid = {30375415},
issn = {2045-2322},
support = {41561012//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31360099//National Natural Science Foundation of China (National Science Foundation of China)/ ; 31360138//National Natural Science Foundation of China (National Science Foundation of China)/ ; },
abstract = {Phenological and reproductive shifts of plants due to climate change may have important influences on population dynamics. Climate change may also affect invasive species by changing their phenology and reproduction, but few studies have explored this possibility. Here, we investigated the impact of climate change on the phenology, reproduction and invasion potential of two alien Solidago canadensis and Bidens frondosa and one native weed, Pterocypsela laciniata, all of which are in the Asteraceae family. The three species responded to simulated climate change by increasing reproductive investments and root/leaf ratio, prolonging flowering duration, and while the two alien species also displayed a mass-flowering pattern. Moreover, our experimental results indicated that the alien invasive species may have greater phenological plasticity in response to simulated warming than that of the native species (P. laciniata). As such, climate change may enhance the invasion and accelerate the invasive process of these alien plant species.},
}
@article {pmid30373820,
year = {2018},
author = {Hedges, SB and Cohen, WB and Timyan, J and Yang, Z},
title = {Haiti's biodiversity threatened by nearly complete loss of primary forest.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {46},
pages = {11850-11855},
pmid = {30373820},
issn = {1091-6490},
mesh = {Amphibians ; Animal Distribution/physiology ; Animals ; Biodiversity ; Climate Change ; Conservation of Natural Resources/economics/*statistics &amp; numerical data ; Ecosystem ; *Extinction, Biological ; *Forests ; Haiti ; Humans ; Reptiles ; Tropical Climate ; },
abstract = {Tropical forests hold most of Earth's biodiversity. Their continued loss through deforestation and agriculture is the main threat to species globally, more than disease, invasive species, and climate change. However, not all tropical forests have the same ability to sustain biodiversity. Those that have been disturbed by humans, including forests previously cleared and regrown (secondary growth), have lower levels of species richness compared with undisturbed (primary) forests. The difference is even greater considering extinctions that will later emanate from the disturbance (extinction debt). Here, we find that Haiti has less than 1% of its original primary forest and is therefore among the most deforested countries. Primary forest has declined over three decades inside national parks, and 42 of the 50 highest and largest mountains have lost all primary forest. Our surveys of vertebrate diversity (especially amphibians and reptiles) on mountaintops indicates that endemic species have been lost along with the loss of forest. At the current rate, Haiti will lose essentially all of its primary forest during the next two decades and is already undergoing a mass extinction of its biodiversity because of deforestation. These findings point to the need, in general, for better reporting of forest cover data of relevance to biodiversity, instead of &quot;total forest&quot; as defined by the United Nation's Food and Agricultural Organization. Expanded detection and monitoring of primary forest globally will improve the efficiency of conservation measures, inside and outside of protected areas.},
}
@article {pmid30372159,
year = {2019},
author = {Brewer, MJ and Peairs, FB and Elliott, NC},
title = {Invasive Cereal Aphids of North America: Ecology and Pest Management.},
journal = {Annual review of entomology},
volume = {64},
number = {},
pages = {73-93},
doi = {10.1146/annurev-ento-011118-111838},
pmid = {30372159},
issn = {1545-4487},
abstract = {Aphid invasions of North American cereal crops generally have started with colonization of a new region or crop, followed by range expansion and outbreaks that vary in frequency and scale owing to geographically variable influences. To improve understanding of this process and management, we compare the invasion ecology of and management response to three cereal aphids: sugarcane aphid, Russian wheat aphid, and greenbug. The region exploited is determined primarily by climate and host plant availability. Once an area is permanently or annually colonized, outbreak intensity is also affected by natural enemies and managed inputs, such as aphid-resistant cultivars and insecticides. Over time, increases in natural enemy abundance and diversity, improved compatibility among management tactics, and limited threshold-based insecticide use have likely increased resilience of aphid regulation. Application of pest management foundational practices followed by a focus on compatible strategies are relevant worldwide. Area-wide pest management is most appropriate to large-scale cereal production systems, as exemplified in the Great Plains of North America.},
}
@article {pmid30369624,
year = {2018},
author = {Kujawska, M and Zamudio, F and Montti, L and Piriz Carrillo, V},
title = {Effects of Landscape Structure on Medicinal Plant Richness in Home Gardens: Evidence for the Environmental Scarcity Compensation Hypothesis.},
journal = {Economic botany},
volume = {72},
number = {2},
pages = {150-165},
pmid = {30369624},
issn = {0013-0001},
abstract = {Our research involves of how Paraguayan migrants who are living in Misiones, Argentina, manage medicinal plants in home gardens, and how this practice can be related to the landscape. We examine the relationship between the richness of home garden medicinal plants and landscape variables (e.g., distance to the forest) by applying PLS analysis, which combines principal component analysis with linear regression. We surveyed 60 home gardens localized in a rural area, and we characterized the surrounding landscape with geospatial tools. Paraguayans' home gardens are extremely diverse sites (total of 136 medicinal species), where both native (82) and introduced species (50) are managed. People who live close to the native forest or mixed use areas (e.g., farms, secondary vegetation) tend to possess less native plants in their gardens because they are available nearby. While gardeners, who live in proximity to tree crops (e.g., pine plantations), have reduced access to wild medicinal resources; therefore, their effort is concentrated on maintaining native plants. These results reflect a relationship between accessibility to medicinal plants in the landscape and the management practices in the home gardens, a neglected driver in explaining the richness and composition of the medicinal plants in home gardens so far. Thus, we contributed evidence in support of the environmental scarcity compensation hypothesis. Finally, our study supports the idea that home gardens appear to function as a springboard for plant domestication.},
}
@article {pmid30368959,
year = {2018},
author = {Eyer, PA and Matsuura, K and Vargo, EL and Kobayashi, K and Yashiro, T and Suehiro, W and Himuro, C and Yokoi, T and Guénard, B and Dunn, RR and Tsuji, K},
title = {Inbreeding tolerance as a pre-adapted trait for invasion success in the invasive ant Brachyponera chinensis.},
journal = {Molecular ecology},
volume = {27},
number = {23},
pages = {4711-4724},
doi = {10.1111/mec.14910},
pmid = {30368959},
issn = {1365-294X},
support = {21247006//KAKENHI/ ; 23405011//KAKENHI/ ; 15H02652//KAKENHI/ ; 15H04425//KAKENHI/ ; 25221206//Japan Society for the Promotion of Science/ ; //Texas A&amp;M Endowment in Urban Entomology/ ; },
abstract = {Identifying traits that facilitate species introductions and successful invasions of ecosystems represents a key issue in ecology. Following their establishment into new environments, many non-native species exhibit phenotypic plasticity with post-introduction changes in behaviour, morphology or life history traits that allow them to overcome the presumed loss of genetic diversity resulting in inbreeding and reduced adaptive potential. Here, we present a unique strategy in the invasive ant Brachyponera chinensis (Emery), in which inbreeding tolerance is a pre-adapted trait for invasion success, allowing this ant to cope with genetic depletion following a genetic bottleneck. We report for the first time that inbreeding is not a consequence of the founder effect following introduction, but it is due to mating between sister queens and their brothers that pre-exists in native populations which may have helped it circumvent the cost of invasion. We show that a genetic bottleneck does not affect the genetic diversity or the level of heterozygosity within colonies and suggest that generations of sib-mating in native populations may have reduced inbreeding depression through purifying selection of deleterious alleles. This work highlights how a unique life history may pre-adapt some species for biological invasions.},
}
@article {pmid30368794,
year = {2018},
author = {Haram, LE and Kinney, KA and Sotka, EE and Byers, JE},
title = {Mixed effects of an introduced ecosystem engineer on the foraging behavior and habitat selection of predators.},
journal = {Ecology},
volume = {99},
number = {12},
pages = {2751-2762},
doi = {10.1002/ecy.2495},
pmid = {30368794},
issn = {0012-9658},
support = {OCE-1057707//NSF/ ; OCE-1057713//NSF/ ; OCE-1357386//NSF/ ; NA12NOS4200089//NOAA National Estuarine Research Reserve/ ; },
abstract = {Invasive ecosystem engineers both positively and negatively affect their recipient ecosystems by generating novel habitats. Many studies have focused on alterations to ecosystem properties and to native species diversity and abundance caused by invasive engineers. However, relatively few studies have documented the extent to which behaviors of native species are affected. The red seaweed Gracilaria vermiculophylla (Rhodophyta) invaded estuaries of the southeastern United States within the last few decades and now provides abundant aboveground vegetative cover on intertidal mudflats that were historically devoid of seaweeds. We hypothesized that G. vermiculophylla would affect the foraging behavior of native shorebirds positively for birds that target seaweed-associated invertebrates or negatively for birds that target prey on or within the sediment now covered with seaweed. Visual surveys of mudflats >1 ha in size revealed that more shorebirds occurred on mudflats with G. vermiculophylla relative to mudflats without G. vermiculophylla. This increased density was consistent across 7 of 8 species, with the one exception being the semipalmated plover Charadrius semipalmatus. A regression-based analysis indicated that while algal presence predicted shorebird density, densities of some bird species depended on sediment composition and infaunal invertebrate densities. At smaller spatial scales (200 m2 and <1 m2), experimental removals and additions of G. vermiculophylla and focal observations showed strong variation in behavioral response to G. vermiculophylla among bird species. Birds preferentially foraged in bare mud (e.g., C. semipalmatus), in G. vermiculophylla (e.g., Arenaria interpres), or displayed no preference for either habitat (e.g., Tringa semipalmata). Thus, while the presence of the invasive ecosystem engineer on a mudflat appeared to attract greater numbers of these predators, shorebird species differed in their behavioral responses at the smaller spatial scales that affect their foraging. Our research illuminates the need to account for species identity, individual behavior, and scale when predicting the impacts of invasive species on native communities.},
}
@article {pmid30367870,
year = {2018},
author = {Rueckert, S and Glasinovich, N and Diez, ME and Cremonte, F and Vázquez, N},
title = {Morphology and molecular systematic of marine gregarines (Apicomplexa) from Southwestern Atlantic spionid polychaetes.},
journal = {Journal of invertebrate pathology},
volume = {159},
number = {},
pages = {49-60},
doi = {10.1016/j.jip.2018.10.010},
pmid = {30367870},
issn = {1096-0805},
abstract = {Gregarines are a common group of parasites that infect the intestines of marine invertebrates, and particularly polychaetes. Here, we describe for the first time four gregarine species that inhabit the intestines of three spionid species: Dipolydora cf. flava, Spio quadrisetosa and Boccardia proboscidea from the Patagonian coast, Argentina, using light and scanning electron microscopy and molecular phylogenetic analyses of small subunit (SSU) rDNA sequences. Even though the spionid species thrive in the same environments, our results showed a high host specificity of the gregarine species. Selenidium cf. axiferens and Polyrhabdina aff. polydorae were both identified from the intestine of D. cf. flava. The new species, Polyrhabdina madrynense sp. n. and Selenidium patagonica sp. n., were described from the intestines of S. quadrisetosa and the invasive species B. proboscidea, respectively. All specimens of D. cf. flava and S. quadrisetosa were infected by gregarines (P = 100%), recording the highest mean intensity values of infection (MI = 80; 60 respectively), in contrast to B. proboscidea (P = 60%; MI = 38). We associated this finding with the recent invasion of this host. It is expected that in the future, an increase of its population density might favour a rising intensity of this gregarine infection.},
}
@article {pmid30367580,
year = {2018},
author = {Wang, S and Wang, C and Wang, S and Ma, L},
title = {Big data analysis for evaluating bioinvasion risk.},
journal = {BMC bioinformatics},
volume = {19},
number = {Suppl 9},
pages = {287},
doi = {10.1186/s12859-018-2272-5},
pmid = {30367580},
issn = {1471-2105},
mesh = {Animals ; Aquatic Organisms ; Data Mining/*methods ; *Ecosystem ; *Introduced Species ; *Models, Theoretical ; Oceans and Seas ; Ships ; *Transportation ; *Waste Disposal, Fluid ; },
abstract = {BACKGROUND: Global maritime trade plays an important role in the modern transportation industry. It brings significant economic profit along with bioinvasion risk. Species translocate and establish in a non-native area through ballast water and biofouling. Aiming at aquatic bioinvasion issue, people proposed various suggestions for bioinvasion management. Nonetheless, these suggestions only focus on the chance of a port been affected but ignore the port's ability to further spread the invaded species.<br><br>RESULTS: To tackle the issues of the existing work, we propose a biosecurity triggering mechanism, where the bioinvasion risk of a port is estimated according to both the invaded risk of a port and its power of being a stepping-stone. To compute the invaded risk, we utilize the automatic identification system data, the ballast water data and marine environmental data. According to the invaded risk of ports, we construct a species invasion network (SIN). The incoming bioinvasion risk is derived from invaded risk data while the invasion risk spreading capability of each port is evaluated by s-core decomposition of SIN.<br><br>CONCLUSIONS: We illustrate 100 ports in the world that have the highest bioinvasion risk when the invaded risk and stepping-stone bioinvasion risk are equally treated. There are two bioinvasion risk intensive regions, namely the Western Europe (including the Western European margin and the Mediterranean) and the Asia-Pacific, which are just the region with a high growth rate of non-indigenous species and the area that has been identified as a source for many of non-indigenous species discovered elsewhere (especially the Asian clam, which is assumed to be the most invasive species worldwide).},
}
@article {pmid30367244,
year = {2018},
author = {Freedman, MG and Miller, RH and Rogers, HS},
title = {Landscape-level bird loss increases the prevalence of honeydew-producing insects and non-native ants.},
journal = {Oecologia},
volume = {188},
number = {4},
pages = {1263-1272},
pmid = {30367244},
issn = {1432-1939},
support = {DEB-1258148//National Science Foundation/ ; },
abstract = {Bird exclusion experiments consistently show that birds exhibit strong top-down control of arthropods, including ants and the honeydew-producing insects (HPIs) that they tend. However, it remains unclear whether the results of these small-scale bird exclosure experiments can be extrapolated to larger spatial scales. In this study, we use a natural bird removal experiment to compare the prevalence of ants and HPIs between Guam, an island whose bird community has been extirpated since the 1980s due to the introduction of the brown tree snake, and two nearby islands (Rota and Saipan) that have more intact bird assemblages. Consistent with smaller-scale bird exclosure experiments, we show that (1) forest trees from Guam are significantly more likely to host HPIs than trees from Saipan and (2) ants are nearly four times as abundant on Guam than on both Saipan and Rota. The prevalence of HPIs varied slightly based on tree species identity, although these effects were not as strong as island-level effects associated with bird loss. Ant community composition differed between Guam and the other two islands. These results corroborate past observational studies showing increased spider densities on Guam and suggest that trophic changes associated with landscape-level bird extirpation may also involve alterations in the abundance of ants and HPIs. This study also provides a clear example of the strong indirect effects that invasive species can have on natural food webs.},
}
@article {pmid30366333,
year = {2019},
author = {Lago, M and Boteler, B and Rouillard, J and Abhold, K and Jähnig, SC and Iglesias-Campos, A and Delacámara, G and Piet, GJ and Hein, T and Nogueira, AJA and Lillebø, AI and Strosser, P and Robinson, LA and De Wever, A and O'Higgins, T and Schlüter, M and Török, L and Reichert, P and van Ham, C and Villa, F and Hugh, M},
title = {Introducing the H2020 AQUACROSS project: Knowledge, Assessment, and Management for AQUAtic Biodiversity and Ecosystem Services aCROSS EU policies.},
journal = {The Science of the total environment},
volume = {652},
number = {},
pages = {320-329},
doi = {10.1016/j.scitotenv.2018.10.076},
pmid = {30366333},
issn = {1879-1026},
mesh = {*Biodiversity ; Conservation of Natural Resources/*methods ; *Ecosystem ; *Environmental Monitoring ; *Environmental Policy ; Europe ; Eutrophication ; Fisheries ; Fresh Water ; },
abstract = {The AQUACROSS project was an unprecedented effort to unify policy concepts, knowledge, and management of freshwater, coastal, and marine ecosystems to support the cost-effective achievement of the targets set by the EU Biodiversity Strategy to 2020. AQUACROSS aimed to support EU efforts to enhance the resilience and stop the loss of biodiversity of aquatic ecosystems as well as to ensure the ongoing and future provision of aquatic ecosystem services. The project focused on advancing the knowledge base and application of Ecosystem-Based Management. Through elaboration of eight diverse case studies in freshwater and marine and estuarine aquatic ecosystem across Europe covering a range of environmental management problems including, eutrophication, sustainable fisheries as well as invasive alien species AQUACROSS demonstrated the application of a common framework to establish cost-effective measures and integrated Ecosystem-Based Management practices. AQUACROSS analysed the EU policy framework (i.e. goals, concepts, time frames) for aquatic ecosystems and built on knowledge stemming from different sources (i.e. WISE, BISE, Member State reporting within different policy processes, modelling) to develop innovative management tools, concepts, and business models (i.e. indicators, maps, ecosystem assessments, participatory approaches, mechanisms for promoting the delivery of ecosystem services) for aquatic ecosystems at various scales of space and time and relevant to different ecosystem types.},
}
@article {pmid30364550,
year = {2018},
author = {Wyckhuys, KAG and Wongtiem, P and Rauf, A and Thancharoen, A and Heimpel, GE and Le, NTT and Fanani, MZ and Gurr, GM and Lundgren, JG and Burra, DD and Palao, LK and Hyman, G and Graziosi, I and Le, VX and Cock, MJW and Tscharntke, T and Wratten, SD and Nguyen, LV and You, M and Lu, Y and Ketelaar, JW and Goergen, G and Neuenschwander, P},
title = {Continental-scale suppression of an invasive pest by a host-specific parasitoid underlines both environmental and economic benefits of arthropod biological control.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5796},
pmid = {30364550},
issn = {2167-8359},
abstract = {Biological control, a globally-important ecosystem service, can provide long-term and broad-scale suppression of invasive pests, weeds and pathogens in natural, urban and agricultural environments. Following (few) historic cases that led to sizeable environmental up-sets, the discipline of arthropod biological control has-over the past decades-evolved and matured. Now, by deliberately taking into account the ecological risks associated with the planned introduction of insect natural enemies, immense environmental and societal benefits can be gained. In this study, we document and analyze a successful case of biological control against the cassava mealybug, Phenacoccus manihoti (Hemiptera: Pseudococcidae) which invaded Southeast Asia in 2008, where it caused substantial crop losses and triggered two- to three-fold surges in agricultural commodity prices. In 2009, the host-specific parasitoid Anagyrus lopezi (Hymenoptera: Encyrtidae) was released in Thailand and subsequently introduced into neighboring Asian countries. Drawing upon continental-scale insect surveys, multi-year population studies and (field-level) experimental assays, we show how A. lopezi attained intermediate to high parasitism rates across diverse agro-ecological contexts. Driving mealybug populations below non-damaging levels over a broad geographical area, A. lopezi allowed yield recoveries up to 10.0 t/ha and provided biological control services worth several hundred dollars per ha (at local farm-gate prices) in Asia's four-million ha cassava crop. Our work provides lessons to invasion science and crop protection worldwide. Furthermore, it accentuates the importance of scientifically-guided biological control for insect pest management, and highlights its potentially large socio-economic benefits to agricultural sustainability in the face of a debilitating invasive pest. In times of unrelenting insect invasions, surging pesticide use and accelerating biodiversity loss across the globe, this study demonstrates how biological control-as a pure public good endeavor-constitutes a powerful, cost-effective and environmentally-responsible solution for invasive species mitigation.},
}
@article {pmid30364057,
year = {2018},
author = {Duffy, L and De Wilde, L and Spellman, K and Dunlap, K and Dainowski, B and McCullough, S and Luick, B and van Muelken, M},
title = {Resilience and Adaptation: Yukon River Watershed Contaminant Risk Indicators.},
journal = {Scientifica},
volume = {2018},
number = {},
pages = {8421513},
pmid = {30364057},
issn = {2090-908X},
abstract = {River watersheds are among the most complex terrestrial features in Alaska, performing valuable ecosystem functions and providing services for human society. Rivers are vital to both estuarine and aquatic biota and play important roles in biogeochemical cycles and physical processes. The functions of watersheds have been used as vulnerability indicators for ecosystem and socioeconomic resilience. Despite a long history of human activity, the Yukon River has not received the holistic and interdisciplinary attention given to the other great American river systems. By using hypothesis-based monitoring of key watershed functions, we can gain insight to regime-shifting stresses such as fire, toxins, and invasive species development. Coupling adaptive risk management practices involving stakeholders with place-based education, especially contaminants and nutrition related, can maintain resilience within communities. The Yukon watershed provides a broadscale opportunity for communities to monitor the environment, manage resources, and contribute to stewardship policy formation. Monitoring keystone species and community activities, such as citizen science, are critical first steps to following changes to resiliency throughout the Yukon watershed. Creating a policy environment that encourages local experimentation and innovation contributes to resilience maintenance during development-imposed stress.},
}
@article {pmid30363773,
year = {2018},
author = {Shechonge, A and Ngatunga, BP and Tamatamah, R and Bradbeer, SJ and Harrington, J and Ford, AGP and Turner, GF and Genner, MJ},
title = {Losing cichlid fish biodiversity: genetic and morphological homogenization of tilapia following colonization by introduced species.},
journal = {Conservation genetics (Print)},
volume = {19},
number = {5},
pages = {1199-1209},
pmid = {30363773},
issn = {1566-0621},
abstract = {Among the many negative impacts of invasive species, hybridization with indigenous species has increasingly become recognized as a major issue. However, relatively few studies have characterized the phenotypic outcomes of hybridization following biological invasions. Here we investigate the genetic and morphological consequences of stocking invasive tilapia species in two water bodies in central Tanzania. We sampled individuals from the Mindu Reservoir on the Ruvu river system, and at Kidatu on the Great Ruaha-Rufiji river system. We screened individuals at 16 microsatellite loci, and quantified morphology using geometric morphometrics and linear measurements. In both the Mindu and Kidatu systems, we identified evidence of hybridization between indigenous Wami tilapia (Oreochromis urolepis) and the introduced Nile tilapia (Oreochromis niloticus) or blue-spotted tilapia (Oreochromis leucostictus). At both sites, purebred individuals could largely be separated using geometric morphometric variables, with hybrids occupying a broad morphospace among the parental species. Our data demonstrate that the gene pools and phenotypic identity of the indigenous O. urolepis have been severely impacted by the stocking of the invasive species. Given the lack of evidence for clear commercial benefits from stocking invasive tilapia species in waters already populated by indigenous congenerics, we suggest further spread of introduced species should be undertaken with considerable caution.},
}
@article {pmid30361763,
year = {2018},
author = {Timóteo, S and O'Connor, CJ and López-Núñez, FA and Costa, JM and Gouveia, AC and Heleno, RH},
title = {Pollination networks from natural and anthropogenic-novel communities show high structural similarity.},
journal = {Oecologia},
volume = {188},
number = {4},
pages = {1155-1165},
pmid = {30361763},
issn = {1432-1939},
support = {IF/00441/2013//Fundação para a Ciência e a Tecnologia/ ; SFRH/BD/130942/2017//Fundação para a Ciência e a Tecnologia/ ; SFRH/BD/96292/2013//Fundação para a Ciência e a Tecnologia/ ; },
abstract = {The Anthropocene is marked by an unprecedented homogenisation of the world's biota, confronting species that never co-occurred during their evolutionary histories. Interactions established in these novel communities may affect ecosystem functioning; however, most research has focused on the impacts of a minority of aggressive invasive species, while changes inflicted by a less conspicuous majority of non-invasive alien species on community structure are still poorly understood. This information is critical to guide conservation strategies, and instrumental to advance ecological theory, particularly to understand how non-native species integrate in recipient communities and affect the interactions of native species. We evaluated how the structure of 50 published pollination networks changes with the proportion of alien plant species and found that network structure is largely unaffected. Although some communities were heavily invaded, the proportion of alien plant species was relatively low (mean = 10%; max. = 38%). We further characterized the pollination network in a botanic garden with a plant community dominated by non-invasive alien species (85%). We show that the structure of this novel community is also not markedly different from native-dominated communities. Plant-pollinator interactions revealed no obvious differences regarding plant origin (native vs. alien) or the native bioregion of the introduced plants. This overall similarity between native and alien plants is likely driven by the contrasting patterns of invasive plants (promoting generalism), and non-invasive aliens, suggested here to promote specialization.},
}
@article {pmid30360500,
year = {2018},
author = {Qazi, SS and Lombardo, DA and Abou-Zaid, MM},
title = {A Metabolomic and HPLC-MS/MS Analysis of the Foliar Phenolics, Flavonoids and Coumarins of the Fraxinus Species Resistant and Susceptible to Emerald Ash Borer.},
journal = {Molecules (Basel, Switzerland)},
volume = {23},
number = {11},
pages = {},
pmid = {30360500},
issn = {1420-3049},
support = {N.A//Natural Resources Canada/ ; },
mesh = {Animals ; *Chromatography, High Pressure Liquid ; Coleoptera ; Coumarins/*chemistry ; Flavonoids/*chemistry ; Fraxinus/*chemistry/*parasitology ; Metabolome ; *Metabolomics ; Molecular Structure ; Phenols/*chemistry ; *Tandem Mass Spectrometry ; },
abstract = {The Emerald Ash Borer (EAB), Agrilus planipennis, Fairmaire, an Asian invasive alien buprestid has devastated tens of millions of ash trees (Fraxinus spp.) in North America. Foliar phytochemicals of the genus Fraxinus (Oleaceae): Fraxinus pennsylvanica (Green ash), F. americana (White ash), F. profunda (Bush) Bush. (Pumpkin ash), F. quadrangulata Michx. (Blue ash), F. nigra Marsh. (Black ash) and F. mandshurica (Manchurian ash) were investigated using HPLC-MS/MS and untargeted metabolomics. HPLC-MS/MS help identified 26 compounds, including phenolics, flavonoids and coumarins in varying amounts. Hydroxycoumarins, esculetin, esculin, fraxetin, fraxin, fraxidin and scopoletin were isolated from blue, black and Manchurian ashes. High-throughput metabolomics revealed 35 metabolites, including terpenes, secoiridoids and lignans. Metabolomic profiling indicated several upregulated putative compounds from Manchurian ash, especially fraxinol, ligstroside, oleuropin, matairesinol, pinoresinol glucoside, 8-hydroxypinoresinol-4-glucoside, verbenalin, hydroxytyrosol-1-O-glucoside, totarol and ar-artemisene. Further, dicyclomine, aphidicolin, parthenolide, famciclovir, ar-turmerone and myriocin were identified upregulated in blue ash. Principal component analysis demonstrated a clear separation between Manchurian and blue ashes from black, green, white and pumpkin ashes. The presence of defensive compounds upregulated in Manchurian ash, suggests their potential role in providing constitutive resistance to EAB, and reflects its co-evolutionary history with A. planipennis, where they appear to coexist in their native habitats.},
}
@article {pmid30359392,
year = {2018},
author = {Kading, RC and Golnar, AJ and Hamer, SA and Hamer, GL},
title = {Advanced surveillance and preparedness to meet a new era of invasive vectors and emerging vector-borne diseases.},
journal = {PLoS neglected tropical diseases},
volume = {12},
number = {10},
pages = {e0006761},
pmid = {30359392},
issn = {1935-2735},
mesh = {Animals ; Communicable Diseases, Emerging/*epidemiology/*veterinary ; *Epidemiological Monitoring ; Humans ; Insect Vectors/*growth &amp; development ; *Introduced Species ; },
}
@article {pmid30356269,
year = {2018},
author = {Caruso, N and Valenzuela, AEJ and Burdett, CL and Luengos Vidal, EM and Birochio, D and Casanave, EB},
title = {Summer habitat use and activity patterns of wild boar Sus scrofa in rangelands of central Argentina.},
journal = {PloS one},
volume = {13},
number = {10},
pages = {e0206513},
pmid = {30356269},
issn = {1932-6203},
abstract = {Biological invasions are one of the main components of human-caused global change and their negative impact on invaded ecosystems have long been recognized. Invasive mammals, in particular, can threaten native biodiversity and cause economic impacts in the region where they are introduced, often through a wide range of conflicts with humans. Although the wild boar, Sus scrofa, is considered by the IUCN as one of the 100 invasive species most damaging to biodiversity in the world, in Argentina there have only been a few studies focused on its ecology with most of them conducted in protected areas. In this study, we evaluated the effect of several factors related with human disturbance, landscape composition, degree of fragmentation and the presence of a potential competitor and a predator on the habitat use of wild boar using data from camera traps and site-occupancy modeling. Additionally, we described the daily activity pattern of the species and we studied the level of overlap with both a potential competitor and a predator. The sampling effort totaled 7,054 camera trap days. Farm density, proportion of shrubland and proportion of grassland with bushes were the detection variables included in the most supported model whereas proportion of grassland and capture rate of the Pampas fox Lycalopex gymnocercus were the occupancy variables included in the most supported model. However, the proportion of grassland was the only variable that showed statistically significant support in the averaged model, indicating that habitat use of wild boar in this area was significantly negatively affected by the level of grass cover. Wild boars were mostly nocturnal, with more activity between 21:00 and 3:00 and a peak around midnight. Wild boars showed a high level of overlap with the activity pattern of the Pampas fox and a low overlap with the activity pattern of the puma Puma concolor. Despite wild boar being introduced in Argentina a few decades ago, this study is the first landscape-scale research carried out in an agricultural landscape in Argentina and the first one based on camera-trapping data. Our study contributes valuable information that could be used to design strategies to reduce wild boar population or to minimize the damage caused by this invasive species in Argentina.},
}
@article {pmid30352227,
year = {2019},
author = {Ma, L and Cao, LJ and Gong, YJ and Hoffmann, AA and Zeng, AP and Wei, SJ and Zhou, ZS},
title = {Development of novel microsatellites for population genetic analysis of Phenacoccus solenopsis Tinsley (Hemipeta: Pseudoccoccidae) based on genomic analysis.},
journal = {International journal of biological macromolecules},
volume = {121},
number = {},
pages = {1135-1144},
doi = {10.1016/j.ijbiomac.2018.10.143},
pmid = {30352227},
issn = {1879-0003},
mesh = {Animals ; Genetics, Population ; *Genomics ; Hemiptera/*genetics ; Introduced Species ; Microsatellite Repeats/*genetics ; Sequence Analysis, DNA ; },
abstract = {The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemipeta: Pseudoccoccidae), is an aggressively invasive pest causing huge economic losses of crops around the world. In this study, we developed genome-wide microsatellites for population genetic analysis of P. solenopsis. We obtained a random genome of P. solenopsis with a size of 267.07 Mb and scaffold N50 of 14.12 Kb. In total 115,639 microsatellites were isolated from the genome, of which those with trinucleotide motifs were the most abundant. Forty-two polymorphic loci were selected for primer validation based on three populations. Allele numbers varied from 2 to 5 with an average value of 2.5 per locus, and allelic richness ranged from 1.00 to 4.48. The observed heterozygosity (H0) and expected heterozygosity (HE) ranged from 0.00 to 0.92 and 0.00 to 0.73, respectively. Population genetic structure analysis based on the developed markers revealed strong differentiation between three populations of P. solenopsis collected from its invasive range in China. The microsatellites developed in our study should provide efficient genetic markers for population level studies of P. solenopsis to reveal invasion history and patterns of dispersal.},
}
@article {pmid30351361,
year = {2019},
author = {Cui, J and Zhu, SY and Gao, Y and Bi, R and Xu, Z and Shi, SS},
title = {Comparative Transcriptome Analysis of Megacopta cribraria (Hemiptera: Plataspidae) in Response to High-Temperature Stress.},
journal = {Journal of economic entomology},
volume = {112},
number = {1},
pages = {407-415},
doi = {10.1093/jee/toy330},
pmid = {30351361},
issn = {1938-291X},
abstract = {Kudzu bug, Megacopta cribraria (Fabricius), is mainly distributed in southern China and has been considered an invasive species in the southeastern United States. Megacopta cribraria is a soybean pest with high-temperature resistance, but the molecular mechanisms underlying its thermal adaptation are largely unknown. Here, we performed comparative transcriptome analysis to unravel the molecular response of M. cribraria toward high-temperature stress. Following RNA-seq, we identified 93,959 assembled unigenes, 14,073 of which were annotated in M. cribraria transcriptome libraries. In addition, 127 differentially expressed unigenes (DEGs) were detected, 88 of them were significantly upregulated, whereas the remaining 39 genes were significantly downregulated. Functional classification revealed that the pathways of metabolic process, cellular processes, and single-organism processes were considered to be significantly enriched. In the COG classification, DEGs were mainly localized into O: post-translational modification, protein turnover, chaperone. Moreover, protein processing in endoplasmic reticulum and linoleic acid metabolism were significantly enriched among the 38 KEGG pathways. Further gene annotation analysis indicated that nine heat shock protein-related genes were significantly upregulated. Finally, five HSP DEGs were selected for real-time quantitative polymerase chain reaction validation and demonstrated a similar upregulation trend with RNA-seq expression profiles. Taken altogether, these findings provide new insights into the molecular mechanisms of thermal adaptation in M. cribraria.},
}
@article {pmid30351305,
year = {2018},
author = {Brown, PMJ and Roy, DB and Harrower, C and Dean, HJ and Rorke, SL and Roy, HE},
title = {Spread of a model invasive alien species, the harlequin ladybird Harmonia axyridis in Britain and Ireland.},
journal = {Scientific data},
volume = {5},
number = {},
pages = {180239},
pmid = {30351305},
issn = {2052-4463},
abstract = {Invasive alien species are widely recognized as one of the main threats to global biodiversity. Rapid flow of information on the occurrence of invasive alien species is critical to underpin effective action. Citizen science, i.e. the involvement of volunteers in science, provides an opportunity to improve the information available on invasive alien species. Here we describe the dataset created via a citizen science approach to track the spread of a well-studied invasive alien species, the harlequin ladybird Harmonia axyridis (Coleoptera: Coccinellidae) in Britain and Ireland. This dataset comprises 48 510 verified and validated spatio-temporal records of the occurrence of H. axyridis in Britain and Ireland, from first arrival in 2003, to the end of 2016. A clear and rapid spread of the species within Britain and Ireland is evident. A major reuse value of the dataset is in modelling the spread of an invasive species and applying this to other potential invasive alien species in order to predict and prevent their further spread.},
}
@article {pmid30351223,
year = {2018},
author = {Hu, L and Wu, X and Li, H and Zhao, Q and Wang, Y and Ye, JR},
title = {An effector, BxSapB1, induces cell death and contributes to virulence in the pine wood nematode Bursaphelenchus xylophilus.},
journal = {Molecular plant-microbe interactions : MPMI},
volume = {},
number = {},
pages = {},
doi = {10.1094/MPMI-10-18-0275-R},
pmid = {30351223},
issn = {0894-0282},
abstract = {The pine wood nematode (PWN) Bursaphelenchus xylophilus has caused serious damage to pine forests in China. Effectors secreted by phytonematodes play a role in host infection. We identified and characterized an effector, BxSapB1, based on the B. xylophilus transcriptome at the early stages of infection and the transient expression of proteins in Nicotiana benthamiana. BxSapB1 triggered cell death in N. benthamiana when secreted into the apoplast, and this effect was independent of N. benthamiana brassinosteroid-insensitive 1-associated kinase 1 (NbBAK1) and suppressor of BIR1-1 (NbSOBIR1). The signal peptide of BxSapB1 was proven to be functional in yeast using the yeast signal sequence trap system, and BxSapB1 was strongly expressed in the subventral gland cells of B. xylophilus, as revealed by in situ hybridization. In addition, based on local BLAST analysis, the BxSapB1 showed 100% identity to BUX.s00139.62, which was identified from the B. xylophilus secretome during Pinus thunbergii infection. BxSapB1 was upregulated in a highly virulent strain and downregulated in a weakly virulent strain of PWN at the early stages of infection. RNA interference assays showed that silencing BxSapB1 resulted in decreased expression of pathogenesis related genes (PtPR-1b, PtPR-3 and PtPR-5), as well as delayed onset of symptoms in P. thunbergii infected by B. xylophilus. The combined data suggest that BxSapB1 can trigger cell death in N. benthamiana, and that it contributes to the virulence in B. xylophilus during parasitic interaction.},
}
@article {pmid30348909,
year = {2018},
author = {James Harris, D and Halajian, A and Santos, JL and Swanepoel, LH and Taylor, PJ and Xavier, R},
title = {Diversity of haemoprotozoan parasites infecting the wildlife of South Africa.},
journal = {Folia parasitologica},
volume = {65},
number = {},
pages = {},
doi = {10.14411/fp.2018.015},
pmid = {30348909},
issn = {0015-5683},
abstract = {Tissue samples from wildlife from South Africa were opportunistically collected and screened for haemoprotozoan parasites using nonspecific PCR primers. Samples of 127 individuals were tested, comprising over 50 different species. Haemogregarines were the most commonly identified parasites, but sarcocystids and piroplasmids were also detected. Phylogenetic analyses estimated from the 18S rDNA marker highlighted the occurrence of several novel parasite forms and the detection of parasites in novel hosts. Phylogenetic relationships, which have been recently reviewed, appear to be much more complex than previously considered. Our study highlights the high diversity of parasites circulating in wildlife in this biodiverse region, and the need for further studies to resolve taxonomic issues.},
}
@article {pmid30348875,
year = {2018},
author = {Derham, TT and Duncan, RP and Johnson, CN and Jones, ME},
title = {Hope and caution: rewilding to mitigate the impacts of biological invasions.},
journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences},
volume = {373},
number = {1761},
pages = {},
pmid = {30348875},
issn = {1471-2970},
abstract = {Rewilding is a novel approach to ecological restoration. Trophic rewilding in particular aims to reinstate ecological functions, especially trophic interactions, through the introduction of animals. We consider the potential for trophic rewilding to address biological invasions. In this broad review, we note some of the important conceptual and ethical foundations of rewilding, including a focus on ecosystem function rather than composition, reliance on animal agency, and an appeal to an ethic of coexistence. Second, we use theory from invasion biology to highlight pathways by which rewilding might prevent or mitigate the impacts of an invasion, including increasing biotic resistance. Third, we use a series of case studies to illustrate how reintroductions can mitigate the impacts of invasions. These include reintroductions and positive management of carnivores and herbivores including European pine martens (Martes martes), Eurasian otters (Lutra lutra), dingoes (Canis dingo), Tasmanian devils (Sarcophilus harrisii) and tule elk (Cervus canadensis nannodes). Fourth, we consider the risk that rewilding may enable a biological invasion or aggravate its impacts. Lastly, we highlight lessons that rewilding science might take from invasion biology.This article is part of the theme issue 'Trophic rewilding: consequences for ecosystems under global change'.},
}
@article {pmid30348872,
year = {2018},
author = {Tanentzap, AJ and Smith, BR},
title = {Unintentional rewilding: lessons for trophic rewilding from other forms of species introductions.},
journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences},
volume = {373},
number = {1761},
pages = {},
pmid = {30348872},
issn = {1471-2970},
abstract = {Trophic rewilding involves adding species into ecosystems to restore extinct, top-down interactions, but limited quantitative data have prevented a systematic attempt to quantify its outcomes. Here, we exploit species introductions that have occurred for purposes other than restoration to inform trophic rewilding. We compiled 51 studies with 158 different responses of lower trophic levels to a species introduction that restored an extinct interaction, whether it intended to do so or not. Unintentional introductions were compared with checklists of extinct animals to identify potential analogues. Using the latest meta-analysis techniques, we found that the few cases of intentional rewilding had similar effects to unintentional rewilding, though there were large taxonomic and geographical biases. We also tested predictions from studies on trophic cascades about the factors that should influence rewilding. Unintentional rewilding was stronger where introduced consumers were non-invasive, but there was no effect of time that compared sites differed in introduction status, latitude or coevolution of responses with a taxonomically related analogue. Our study now shows that rewilding can reinstate extinct trophic interactions and highlights remaining data gaps that need closure to restore ecosystems across larger scales than has been previously possible.This article is part of the theme issue 'Trophic rewilding: consequences for ecosystems under global change'.},
}
@article {pmid30347172,
year = {2018},
author = {Yessoufou, K and Bezeng, BS and Gaoue, OG and Bengu, T and van der Bank, M},
title = {Phylogenetically diverse native systems are more resistant to invasive plant species on Robben Island, South Africa 1.},
journal = {Genome},
volume = {},
number = {},
pages = {1-12},
doi = {10.1139/gen-2018-0039},
pmid = {30347172},
issn = {1480-3321},
abstract = {Alien invasive species are problematic both economically and ecologically, particularly on islands. As such, understanding how they interact with their environment is necessary to inform invasive species management. Here, we ask the following questions: What are the main functional traits that correlate with invasion success of alien plants on Robben Island? How does phylogenetic structure shape biotic interactions on the island? Using multiple approaches to explore these questions, we found that alien invasive species flower later during the year and for longer period, although flowering phenology was sensitive to alternative starting date. Additionally, we observed that alien invasive species are mostly abiotically pollinated and are generally hermaphroditic whilst their native counterparts rely on biotic pollinators, flower earlier, and are generally dioecious, suggesting that alien invasive and native species use different ecological niches. Furthermore, we found a facilitative interaction between an alien invasive legume and other invasive plants as predicted by the invasional meltdown hypothesis, but this does not influence the phylogenetic structure of plant communities. Finally, phylogenetically diverse set of native species are less receptive to alien invasive species. Collectively, our findings reveal how biotic interactions and phylogenetic relatedness structure alien invasive - native co-existence.},
}
@article {pmid30346545,
year = {2019},
author = {Hallman, GJ and Wang, L and Demirbas Uzel, G and Cancio-Martinez, E and Cáceres-Barrios, CE and Myers, SW and Vreysen, MJB},
title = {Comparison of Populations of Ceratitis capitata (Diptera: Tephritidae) from Three Continents for Susceptibility to Cold Phytosanitary Treatment and Implications for Generic Cold Treatments.},
journal = {Journal of economic entomology},
volume = {112},
number = {1},
pages = {127-133},
doi = {10.1093/jee/toy331},
pmid = {30346545},
issn = {1938-291X},
abstract = {The Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), is arguably the most significant and studied quarantine pest of fresh fruits. There is well over a century of research observations on its response to cold, first as it pertains to shipment of fruits using cold temperatures to preserve fruit quality and how that may aid the survival and distribution of the pest, and then the use of colder temperatures to kill the pest in fruit shipments. Cold tolerance at 1.1°C in three populations of C. capitata generally increased as the insect developed; therefore, the third instar is the most tolerant of the stages that are found in fruit. The three populations did not differ in cold tolerance, indicating that cold phytosanitary treatments against this pest can be harmonized regardless of country of origin of marketed fruit hosts. This study facilitated the approval of some cold treatment schedules for the International Plant Protection Convention treatment manual that were being held up by concerns of possible differences in cold tolerance among C. capitata populations from different countries and points toward the possibility of generic, broadly applicable phytosanitary cold treatments. Most larvae found alive after 9 d of cold treatment did not pupariate and fewer still emerged as adults, indicating that acute larval mortality need not always be the objective of a cold phytosanitary treatment to be efficacious in preventing the establishment of invasive species.},
}
@article {pmid30344634,
year = {2018},
author = {Lehnert, SJ and DiBacco, C and Jeffery, NW and Blakeslee, AMH and Isaksson, J and Roman, J and Wringe, BF and Stanley, RRE and Matheson, K and McKenzie, CH and Hamilton, LC and Bradbury, IR},
title = {Temporal dynamics of genetic clines of invasive European green crab (Carcinus maenas) in eastern North America.},
journal = {Evolutionary applications},
volume = {11},
number = {9},
pages = {1656-1670},
pmid = {30344634},
issn = {1752-4571},
abstract = {Two genetically distinct lineages of European green crabs (Carcinus maenas) were independently introduced to eastern North America, the first in the early 19th century and the second in the late 20th century. These lineages first came into secondary contact in southeastern Nova Scotia, Canada (NS), where they hybridized, producing latitudinal genetic clines. Previous studies have documented a persistent southward shift in the clines of different marker types, consistent with existing dispersal and recruitment pathways. We evaluated current clinal structure by quantifying the distribution of lineages and fine-scale hybridization patterns across the eastern North American range (25 locations, ~39 to 49°N) using informative single nucleotide polymorphisms (SNPs; n = 96). In addition, temporal changes in the genetic clines were evaluated using mitochondrial DNA and microsatellite loci (n = 9-11) over a 15-year period (2000-2015). Clinal structure was consistent with prior work demonstrating the existence of both northern and southern lineages with a hybrid zone occurring between southern New Brunswick (NB) and southern NS. Extensive later generation hybrids were detected in this region and in southeastern Newfoundland. Temporal genetic analysis confirmed the southward progression of clines over time; however, the rate of this progression was slower than predicted by forecasting models, and current clines for all marker types deviated significantly from these predictions. Our results suggest that neutral and selective processes contribute to cline dynamics, and ultimately, highlight how selection, hybridization, and dispersal can collectively influence invasion success.},
}
@article {pmid30344631,
year = {2018},
author = {Diedericks, G and Henriques, R and von der Heyden, S and Weyl, OLF and Hui, C},
title = {The ghost of introduction past: Spatial and temporal variability in the genetic diversity of invasive smallmouth bass.},
journal = {Evolutionary applications},
volume = {11},
number = {9},
pages = {1609-1629},
pmid = {30344631},
issn = {1752-4571},
abstract = {Understanding the demographic history of introduced populations is essential for unravelling their invasive potential and adaptability to a novel environment. To this end, levels of genetic diversity within the native and invasive range of a species are often compared. Most studies, however, focus solely on contemporary samples, relying heavily on the premise that the historic population structure within the native range has been maintained over time. Here, we assess this assumption by conducting a three-way comparison of the genetic diversity of native (historic and contemporary) and invasive (contemporary) smallmouth bass (Micropterus dolomieu) populations. Analyses of a total of 572 M. dolomieu samples, representing the contemporary invasive South African range, contemporary and historical native USA range (dating back to the 1930s when these fish were first introduced into South Africa), revealed that the historical native range had higher genetic diversity levels when compared to both contemporary native and invasive ranges. These results suggest that both contemporary populations experienced a recent genetic bottleneck. Furthermore, the invasive range displayed significant population structure, whereas both historical and contemporary native US populations revealed higher levels of admixture. Comparison of contemporary and historical samples showed both a historic introduction of M. dolomieu and a more recent introduction, thereby demonstrating that undocumented introductions of this species have occurred. Although multiple introductions might have contributed to the high levels of genetic diversity in the invaded range, we discuss alternative factors that may have been responsible for the elevated levels of genetic diversity and highlight the importance of incorporating historic specimens into demographic analyses.},
}
@article {pmid30344630,
year = {2018},
author = {Tang, Q and Low, GW and Lim, JY and Gwee, CY and Rheindt, FE},
title = {Human activities and landscape features interact to closely define the distribution and dispersal of an urban commensal.},
journal = {Evolutionary applications},
volume = {11},
number = {9},
pages = {1598-1608},
pmid = {30344630},
issn = {1752-4571},
abstract = {The rock pigeon, Columba livia, is a cosmopolitan human commensal, domesticated thousands of years ago. However, the human-mediated factors governing its distribution and dispersal are not well understood. In this study, we performed (a) hierarchical distance sampling on ~400 island-wide point transects, (b) a population genomic inquiry based on ~7,000 SNPs from almost 150 individuals, and (c) landscape genomic analyses on the basis of extensive ecological and socio-economic databases to characterize the distribution and dispersal patterns of rock pigeons across Singapore. Our distance sampling results indicated that the volume of intentional &quot;mercy feeding&quot; and availability of high-rise buildings are the most reliable predictors of high pigeon densities in Singapore. Genomic analyses demonstrated that rock pigeons in Singapore form a single population possibly derived from rapid expansion from a genetically homogenous group of founder individuals. In specific, rock pigeons in Singapore lack sex-biased dispersal and are clustered with a genetic patch size of ~3 km. Landscape genomic analyses of great precision pointed to the presence of dense trees as agents of resistance to dispersal, whereas a high road density reduces this resistance. By pinpointing a range of ecological and socio-economic variables determining the distribution and dispersal of pigeons, our study provides urban planners with the tools for optimal management of this human commensal, such as a curtailment of the practice of mercy feeding and modifications to the urban landscape to reduce pigeon density and to lower the likelihood of repopulation by dispersal.},
}
@article {pmid30344629,
year = {2018},
author = {Guzinski, J and Ballenghien, M and Daguin-Thiébaut, C and Lévêque, L and Viard, F},
title = {Population genomics of the introduced and cultivated Pacific kelp Undaria pinnatifida: Marinas-not farms-drive regional connectivity and establishment in natural rocky reefs.},
journal = {Evolutionary applications},
volume = {11},
number = {9},
pages = {1582-1597},
pmid = {30344629},
issn = {1752-4571},
abstract = {Ports and farms are well-known primary introduction hot spots for marine non-indigenous species (NIS). The extent to which these anthropogenic habitats are sustainable sources of propagules and influence the evolution of NIS in natural habitats was examined in the edible seaweed Undaria pinnatifida, native to Asia and introduced to Europe in the 1970s. Following its deliberate introduction 40 years ago along the French coast of the English Channel, this kelp is now found in three contrasting habitat types: farms, marinas and natural rocky reefs. In the light of the continuous spread of this NIS, it is imperative to better understand the processes behind its sustainable establishment in the wild. In addition, developing effective management plans to curtail the spread of U. pinnatifida requires determining how the three types of populations interact with one another. In addition to an analysis using microsatellite markers, we developed, for the first time in a kelp, a ddRAD-sequencing technique to genotype 738 individuals sampled in 11 rocky reefs, 12 marinas, and two farms located along ca. 1,000 km of coastline. As expected, the RAD-seq panel showed more power than the microsatellite panel for identifying fine-grained patterns. However, both panels demonstrated habitat-specific properties of the study populations. In particular, farms displayed very low genetic diversity and no inbreeding conversely to populations in marinas and natural rocky reefs. In addition, strong, but chaotic regional genetic structure, was revealed, consistent with human-mediated dispersal (e.g., leisure boating). We also uncovered a tight relationship between populations in rocky reefs and those in nearby marinas, but not with nearby farms, suggesting spillover from marinas into the wild. At last, a temporal survey spanning 20 generations showed that wild populations are now self-sustaining, albeit there was no evidence for local adaptation to any of the three habitats. These findings highlight that limiting the spread of U. pinnatifida requires efficient management policies that also target marinas.},
}
@article {pmid30343371,
year = {2018},
author = {Li, J and Lai, Y and Xie, R and Ding, X and Wu, C},
title = {Sediment phosphorus speciation and retention process affected by invasion time of Spartina alterniflora in a subtropical coastal wetland of China.},
journal = {Environmental science and pollution research international},
volume = {25},
number = {35},
pages = {35365-35375},
pmid = {30343371},
issn = {1614-7499},
support = {2016J05096//Fujian Provincial Department of Science and Technology/ ; JK2017011//Department of Education, Fujian Province/ ; 2016R1032-1//Special Research Project of Public Institutes of Fujian Province/ ; 201810394065//Provincial College Students' Innovation and Entrepreneurship Training Program/ ; },
mesh = {Carbon/analysis ; China ; Ecosystem ; Estuaries ; Eutrophication ; Geologic Sediments/*chemistry ; Introduced Species/*trends ; Nitrogen/analysis ; Phosphorus/*analysis ; Poaceae/*growth &amp; development ; Water Pollutants, Chemical/*analysis ; *Wetlands ; },
abstract = {In coastal wetland ecosystems, most phosphorus (P) accumulates in the sediments and becomes a major pollutant causing eutrophication by recycling to the water column in estuary areas, especially exotic plant invasions will change the nutrient cycling. In this study, a large wetland invaded by exotic species Spartina alterniflora for over 15 years was selected to study the sediment P fractionation and its retention for different plant invasion periods. The samples were collected from east to west in September and the sediment P was fractionated into total P (TP), inorganic P (IP), iron/aluminum-bound P (Fe/Al-P), calcium-bound P (Ca-P), and organic P (OP). Additionally, the effect of the invasion period on the wetland P fractionation based on space-time reciprocal principle was investigated. For different S. alterniflora invasion periods, the average TP concentration was 675.37 mg kg-1 with a range of 160.33-1071 mg kg-1. The IP concentration was in the range of 107.33-813.33 mg kg-1 (accounting for 54.4-79.5% of TP), of which Fe/Al-P and Ca-P represented up to 99.4%. In addition, the P retention (RP) was within 41.67-329.67 mg kg-1. We also found that TP, IP, Fe/Al-P, Ca-P, OP, and RP in sediments were negatively correlated with pH (p < 0.05), and were also significantly positively correlated (p < 0.01) with water content and electrical conductivity. There were positive correlations between the various forms of P in the sediments (p < 0.01). However, the most important finding was that invasion time of S. alterniflora had a direct effect on the P speciation and three stages were determined. In the first stage, S. alterniflora mainly consumed the OP of the sediment. In the second stage, S. alterniflora showed great vitality and biological immobilization led to the transforming of IP to OP. In the third stage, all P fractions greatly decreased to values even lower than for the bare beach which indicated that S. alterniflora growth had begun to degenerate. These three stages well explained the P seemingly contradictory increases and decreases apparent in previous studies and provide important information for understanding the effect of S. alterniflora invasion.},
}
@article {pmid30340347,
year = {2018},
author = {Del Coco, L and Felline, S and Girelli, CR and Angilè, F and Magliozzi, L and Almada, F and D'Aniello, B and Mollo, E and Terlizzi, A and Fanizzi, FP},
title = {¹H NMR Spectroscopy and MVA to Evaluate the Effects of Caulerpin-Based Diet on Diplodus sargus Lipid Profiles.},
journal = {Marine drugs},
volume = {16},
number = {10},
pages = {},
pmid = {30340347},
issn = {1660-3397},
mesh = {Animals ; Caulerpa/*chemistry ; Chlorophyta/*toxicity ; Fatty Acids, Omega-3/analysis/metabolism ; Food Chain ; Indoles/*toxicity ; Introduced Species ; Lipid Metabolism/*drug effects ; Mediterranean Sea ; Metabolomics/methods ; Multivariate Analysis ; Proton Magnetic Resonance Spectroscopy ; Sea Bream/*metabolism ; },
abstract = {The biological invasion of the green algae Caulerpa cylindracea represents a serious scientific and public issue in the Mediterranean Sea, essentially due to strong modifications both to habitat structure and native benthic communities. Although alterations in health status and changes in flesh quality of some marine species (dietary exposed to C. cylindracea) have been observed, no studies on cause-effect relationships have been carried out. Here, for the first time, through a controlled feeding experiment followed by ¹H NMR Spectroscopy and multivariate analysis (PCA, OPLS-DA), we showed that caulerpin taken with diet is directly responsible of changes observed in metabolic profile of fish flesh, including alteration of lipid metabolism, in particular with a reduction of ω3 PUFA content. The potential of caulerpin to directly modulate lipid metabolism opens up new questions about causal mechanism triggered by algal metabolite also in view of a possible exploitation in the nutraceutical/medical field.},
}
@article {pmid30339544,
year = {2018},
author = {Rebelo, AJ and Emsens, WJ and Esler, KJ and Meire, P},
title = {Quantification of water purification in South African palmiet wetlands.},
journal = {Water science and technology : a journal of the International Association on Water Pollution Research},
volume = {78},
number = {5-6},
pages = {1199-1207},
doi = {10.2166/wst.2018.389},
pmid = {30339544},
issn = {0273-1223},
abstract = {Despite the importance of water purification to society, it is one of the more difficult wetland ecosystem services to quantify. It remains an issue in ecosystem service assessments where rapid estimates are needed, and poor-quality indicators are overused. We attempted to quantify the water purification service of South African palmiet wetlands (valley-bottom peatlands highly threatened by agriculture). First, we used an instantaneous catchment-scale mass balance sampling approach, which compared the fate of various water quality parameters over degraded and pristine sections of palmiet wetlands. We found that pristine palmiet wetlands acted as a sink for water, major cations, anions, dissolved silicon and nutrients, though there was relatively high variation in these trends. There are important limitations to this catchment-scale approach, including the fact that at this large scale there are multiple mechanisms (internal wetland processes as well as external inputs) at work that are impossible to untangle with limited data. Therefore, secondly, we performed a small field-scale field survey of a wetland fragment to corroborate the catchment-scale results. There was a reasonable level of agreement between the results of the two techniques. We conclude that it appears possible to estimate the water purification function of these valley-bottom wetlands using this catchment-scale approach.},
}
@article {pmid30333265,
year = {2018},
author = {Damas-Moreira, I and Oliveira, D and Santos, JL and Riley, JL and Harris, DJ and Whiting, MJ},
title = {Learning from others: an invasive lizard uses social information from both conspecifics and heterospecifics.},
journal = {Biology letters},
volume = {14},
number = {10},
pages = {},
pmid = {30333265},
issn = {1744-957X},
abstract = {Species that are able to solve novel problems through social learning from either a conspecific or a heterospecific may gain a significant advantage in new environments. We tested the ability of a highly successful invasive species, the Italian wall lizard Podarcis sicula, to solve a novel foraging task when social information was available from both a conspecific and an unfamiliar heterospecific (Podarcis bocagei). We found that Italian wall lizards that had access to social information made fewer errors, regardless of whether the demonstrator was a conspecific or a heterospecific, compared to Italian wall lizards that individually learnt the same task. We suggest that social learning could be a previously underappreciated, advantageous mechanism facilitating invasions.},
}
@article {pmid30326641,
year = {2018},
author = {Manley, M and Melzer, MJ and Spafford, H},
title = {Oviposition Preferences and Behavior of Wild-Caught and Laboratory-Reared Coconut Rhinoceros Beetle, Oryctes rhinoceros (Coleoptera: Scarabaeidae), in Relation to Substrate Particle Size.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040141},
pmid = {30326641},
issn = {2075-4450},
abstract = {The coconut rhinoceros beetle (CRB), Oryctes rhinoceros (L.) (Coleoptera: Scarabaeidae), has become one of the most important coconut and oil palm pests. This species was detected attacking coconut palms on O'ahu, Hawai'i in December 2013, and an eradication program was initiated. One of the major challenges for eradication has been the identification of new breeding sites. Information on the factors influencing oviposition is needed to aid in finding sites likely to host the immature stages of this insect. In this study, a series of choice tests were conducted to assess the oviposition preferences of both laboratory-reared and wild-caught CRB. Mated females, of both lab-reared and wild-caught beetles, were offered for oviposition a choice between sand and two mulch substrates, one with small and one with large particle sizes. Both types of CRB laid eggs preferentially in substrate of small particle size rather than large and none laid eggs in sand. Lab-reared and wild-caught CRB differed in their oviposition behavior and size. These results can be used to aid in the identification of breeding sites for management programs and eradication efforts.},
}
@article {pmid30326333,
year = {2019},
author = {Dommanget, F and Evette, A and Breton, V and Daumergue, N and Forestier, O and Poupart, P and Martin, FM and Navas, ML},
title = {Fast-growing willows significantly reduce invasive knotweed spread.},
journal = {Journal of environmental management},
volume = {231},
number = {},
pages = {1-9},
doi = {10.1016/j.jenvman.2018.10.004},
pmid = {30326333},
issn = {1095-8630},
abstract = {Competitive interactions seem to play a major role in invasive plant success. However, they have mostly been addressed through the invader impacts on other species of the plant community and rarely through the way plant communities can contain alien species. Understanding such mechanisms would help in designing restoration projects using plant community competitive properties to control invasive populations. In this study, we looked at the role of competitive interactions in the success of Fallopia japonica (Houtt.) Ronse Decraene using a native willow frequently used in bioengineering techniques: Salix viminalis L. S. viminalis has a high growth rate and is, as such, a potential candidate to compete with F. japonica in restoration projects of invaded areas. Both species were grown in semi-controlled conditions in mesocosms (truck dumpsters), alone or in competition. Morphological traits (plant height, specific leaf area) as well as biomass (aboveground and underground) were measured on each species during two growing seasons. We also quantified spatial expansion of F. japonica. Even under a dense canopy of S. viminalis, F. japonica was able to survive and grow. However, its performance was significantly reduced compared to monocultures and its spatial colonization was less extended. Although S. viminalis biomass was affected by F. japonica, F. japonica expressed competitive stress through a modification of ramet density and height. There was no significant effect of F. japonica on S. viminalis height, enabling this species to dominate. Synthesis and applications: We conclude that S. viminalis succeeded in reducing F. japonica growth by developing a competitive canopy. Bioengineering techniques aiming at restoring a competitive neighborhood can control F. japonica. However, F. japonica's broad underground extension should be taken into account in any management strategy in order to successfully limit its development and spatial spread.},
}
@article {pmid30326286,
year = {2018},
author = {Silva-Luz, CLD and Pirani, JR and Mitchell, JD and Daly, D and Capelli, NDV and Demarco, D and Pell, SK and Plunkett, GM},
title = {Phylogeny of Schinus L. (Anacardiaceae) with a new infrageneric classification and insights into evolution of spinescence and floral traits.},
journal = {Molecular phylogenetics and evolution},
volume = {133},
number = {},
pages = {302-351},
doi = {10.1016/j.ympev.2018.10.013},
pmid = {30326286},
issn = {1095-9513},
abstract = {Schinus, best known by its few cultivated and invasive species, is the largest genus of Anacardiaceae in southern South America. It is remarkably diverse compared to closely related genera, with approximately 42 species, most of which occur in several arid vegetation types and extend into Andean and Atlantic moist forests. The most comprehensive taxonomic revision of the genus dates to 1957, recognizing S. subg. Schinus and S. subg. Duvaua, the latter of which were further divided into two sections. Subsequent studies have highlighted morphological inconsistencies in this infrageneric classification, and species delimitation remains a challenge. Schinus has been poorly sampled in previous phylogenetic studies of Anacardiaceae, and thus any assumptions about its monophyly and relationships remain untested. We investigated the phylogenetic relationships of 44 Schinus taxa and sampled 122 specimens, including the outgroup, using nine nuclear and two plastid DNA sequence regions, most of them developed recently for Commiphora (Burseraceae, sister to Anacardiaceae). We used maximum parsimony, maximum likelihood, and Bayesian inference to infer relationships among species. We also constructed a morphological dataset, including vegetative anatomical features, and compared these characters to hypotheses based on molecular evidence in order to achieve a better understanding of the relationships among the species of Schinus and to related genera, aiming also to identify morphological characters and putative synapomorphies for major clades, and to discuss hypotheses regarding the evolution of structural traits in the genus. Our analyses strongly support the monophyly of Schinus, but also indicate that S. subg. Schinus and the sections of S. subg. Duvaua are polyphyletic. The phylogenetic relationships that emerged from our analyses include eight relatively well-supported lineages, but relationships among closely related species remain unclear in some clades. Ancestral state reconstructions demonstrate that several morphological and leaf-anatomical characters are valuable in characterizing some lineages. By contrast, most of the traits that have traditionally been used to circumscribe groups in Schinus show high levels of homoplasy. In light of these results, we present a novel sectional classification of Schinus based on a combination of character states associated with geographic distribution, corresponding to lineages that are mostly allopatric or at least ecologically distinct.},
}
@article {pmid30325569,
year = {2018},
author = {Helliwell, EE and Faber-Hammond, J and Lopez, ZC and Garoutte, A and von Wettberg, E and Friesen, ML and Porter, SS},
title = {Rapid establishment of a flowering cline in Medicago polymorpha after invasion of North America.},
journal = {Molecular ecology},
volume = {27},
number = {23},
pages = {4758-4774},
doi = {10.1111/mec.14898},
pmid = {30325569},
issn = {1365-294X},
support = {DEB-1354878//National Science Foundation/ ; DEB-1355216//National Science Foundation/ ; },
abstract = {To establish and spread in a new location, an invasive species must be able to carry out its life cycle in novel environmental conditions. A key trait underlying fitness is the shift from vegetative to reproductive growth through floral development. In this study, we used a common garden experiment and genotyping-by-sequencing to test whether the latitudinal flowering cline of the North American invasive plant Medicago polymorpha was translocated from its European native range through multiple introductions, or whether the cline rapidly established due to evolution following a genetic bottleneck. Analysis of flowering time in 736 common garden plants showed a latitudinal flowering time cline in both the native and invaded ranges where genotypes from lower latitudes flowered earlier. Genotyping-by-sequencing of 9,658 SNPs in 446 individuals revealed two major subpopulations of M. polymorpha in the native range, only one of which is present in the invaded range. Additionally, native range populations have higher genetic diversity than invaded range populations, suggesting that a genetic bottleneck occurred during invasion. All invaded range individuals are closely related to plants collected from native range populations in Portugal and southern Spain, and population assignment tests assigned invaded range individuals to this same narrow source region. Taken together, our results suggest that latitudinal clinal variation in flowering time has rapidly evolved across the invaded range despite a genetic bottleneck following introduction.},
}
@article {pmid30325174,
year = {2018},
author = {Xie, BH and Han, GX},
title = {Control of invasive Spartina alterniflora: A review.},
journal = {Ying yong sheng tai xue bao = The journal of applied ecology},
volume = {29},
number = {10},
pages = {3464-3476},
doi = {10.13287/j.1001-9332.201810.006},
pmid = {30325174},
issn = {1001-9332},
mesh = {Ecosystem ; Introduced Species ; *Poaceae ; },
abstract = {Spartina alterniflora has important ecological functions in its original place, such as bank protection and land reclamation, but often has negative impacts on the local ecosystem after it is introduced into new areas. This species is often considered as an invasive one. The invasion and control of S. alterniflora have caused a great concern. We reviewed the latest research progresses in the prevention and control of S. alterniflora from six different perspectives, including physical control, chemical control, biological control, biological substitution control, integrated control, and control strategies. The theoretical basis, technical details, control effect and environmental impact of the six kinds of control technologies were analyzed. We pointed out the shortcomings of existing control technologies and proposed some suggestions such as targeted control of different ecological risk zones.},
}
@article {pmid30325075,
year = {2019},
author = {Giakoumi, S and Pey, A and Di Franco, A and Francour, P and Kizilkaya, Z and Arda, Y and Raybaud, V and Guidetti, P},
title = {Exploring the relationships between marine protected areas and invasive fish in the world's most invaded sea.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {29},
number = {1},
pages = {e01809},
doi = {10.1002/eap.1809},
pmid = {30325075},
issn = {1051-0761},
abstract = {Marine Protected Areas (MPAs) are an essential tool for marine biodiversity conservation. Yet, their effectiveness in protecting marine ecosystems from global stressors is debated. Biological invasions are a major driver of global change, causing biodiversity loss and altering ecosystem functioning. Here, we explored the relationships between MPAs and alien/native range-expanding fishes in the Mediterranean Sea, the world's most invaded sea. We surveyed fish and benthic communities in nine MPAs and adjacent unprotected areas across six countries. In the South and Eastern Mediterranean MPAs, the biomass of alien and native range-expanding fishes often exceeded 50% of the total fish biomass. Conversely, in the North and Western Mediterranean, alien fishes were absent. A negative relationship was found between native and alien species richness. Average and minimum sea surface temperature (SST) over six consecutive years were positively correlated with the total biomass of alien species; no alien fishes were recorded below 20.5°C average SST and 13.8°C minimum SST. We also found a negative relationship between alien fishes' biomass and the distance from the Suez Canal, which is the main pathway for the introduction of alien fish in the Mediterranean Sea. The biomass of alien and native range-expanding fishes was found to be higher in the South and Eastern Mediterranean MPAs than in adjacent unprotected areas. The association of barrens (rocky reefs deprived of vegetation) and invasive herbivores was observed at all eastern sites, regardless of protection status. Currently, the level of fishing pressure exerted on alien and native range-expanding fishes seems to be the most influential factor determining the lower biomass of invasive fishes at unprotected sites compared to MPAs. Our findings suggest that complementary management actions, such as species-targeted removals, should be taken in MPAs to effectively control invasive fish populations.},
}
@article {pmid30324686,
year = {2018},
author = {Yang, Q and Liu, S and He, C and Cowie, RH and Yu, X and Hayes, KA},
title = {Invisible apple snail invasions: importance of continued vigilance and rigorous taxonomic assessments.},
journal = {Pest management science},
volume = {},
number = {},
pages = {},
doi = {10.1002/ps.5241},
pmid = {30324686},
issn = {1526-4998},
support = {2017YFF0210200, 2018YFC0809200//China National Key Research and Development Program/ ; 31800462//The National Natural Science Foundation of China/ ; DEB 0949061//US National Science Foundation/ ; OISE-1130694//US National Science Foundation/ ; 2017YCGC006//Yucai Project of the Zhejiang Association for Science and Technology Foundation/ ; },
abstract = {BACKGROUND: Due to the similarities of overall shell morphology among apple snail species and considerable variability within species, substantial taxonomic confusion has plagued the accurate identification of Pomacea species. Many invasive apple snails have been mistakenly identified as P. canaliculata since their introduction to Asia around 1980. In 2008, three other introduced species in addition to P. canaliculata were recognized. In 2013, a fifth, previously unrecognized lineage was reported from China, indicating that despite the taxonomic clarity brought by previous work, continued surveys and taxonomic research are necessary to prevent additional introductions and continued spread, as well as to develop effective management strategies.<br><br>RESULTS: Phylogenetic analysis of mitochondrial COI sequences confirmed the presence of a widespread unidentified Pomacea lineage in China. All sequences from samples of this newly documented lineage were recovered in a monophyletic clade delineated from closely related species; however, different DNA barcoding methods yielded inconsistent species boundaries. Additionally, nuclear EF1α sequences indicated incomplete lineage sorting or recent hybridization of the unidentified lineage with the other two established species.<br><br>CONCLUSION: Barcoding is a valuable tool for species discovery, and a powerful approach for delineating introduced species. However, determining the identity of the newly discovered invasive lineage in China will require an integrated taxonomic approach incorporating individuals from the native range, and examination of natural history collections at museums around the world. To manage and prevent additional spread of already established species, and to stop the introduction of new taxa, continued monitoring and rigorous taxonomic assessments must be undertaken. © 2018 Society of Chemical Industry.},
}
@article {pmid30323835,
year = {2018},
author = {Weterings, R and Vetter, KC},
title = {Invasive house geckos (hemidactylus spp.): their current, potential and future distribution.},
journal = {Current zoology},
volume = {64},
number = {5},
pages = {559-573},
pmid = {30323835},
issn = {1674-5507},
abstract = {In this study, we identified the current distribution of five globally distributed invasive Hemidactylus species and predicted their potential and future distribution using species distribution models based on climate and elevation data. These species included H. brookii, H. frenatus, H. garnotii, H. mabouia, and H. turcicus. We show that many regions with tropical and Mediterranean climates are suitable for most of these species. However, their current and potential distributions suggest that climate is not the only limiting factor. We hypothesize that climatic conditions may affect competition and other interactions resulting in a segregated distribution of the studied Hemidactylus species. As an effect of global climate change it is likely that H. brookii will expand its range to areas that are currently colonized by H. mabouia and/or H. frenatus, while H. turcicus is likely to expand its range to areas that are not yet invaded by any Hemidactylus species. The role of species interactions in the range expansion of these five Hemidactylus species still remains poorly understood, but could be of major importance in understanding and managing these invasive species.},
}
@article {pmid30321722,
year = {2019},
author = {Robinson, LA and Blincow, HL and Culhane, FE and O'Higgins, T},
title = {Identifying barriers, conflict and opportunity in managing aquatic ecosystems.},
journal = {The Science of the total environment},
volume = {651},
number = {Pt 2},
pages = {1992-2002},
doi = {10.1016/j.scitotenv.2018.10.020},
pmid = {30321722},
issn = {1879-1026},
mesh = {*Biodiversity ; Conservation of Natural Resources/*methods ; *Ecosystem ; *Human Activities ; *Lakes ; Northern Ireland ; Socioeconomic Factors ; },
abstract = {Inland aquatic ecosystems play an important part in the delivery and support of ecosystem services. However, these ecosystems are subject to stressors associated with human activities such as invasive species introduction and landscape alteration. There is a delicate balance between maintaining good status of the ecosystem whilst meeting the needs of those stakeholders dependent on the ecosystem services it supplies, and where there are many different stakeholders, each with different aspirations and dependencies on the ecosystem, it can be difficult to strike a balance on suitable management measures to put in place. A better understanding of the interactions between the human and ecological functions of the ecosystem (a socio-ecological systems (SES) approach) can enable an effective dialogue to be opened to secure management solutions of best fit. In this study we took a SES approach to explore the dependencies and interactions in the Lough Erne catchment with a range of stakeholders representing the use of the Lough. In particular, we explored how individual stakeholder goals were perceived to be affected by both the biodiversity and activities found in the catchment. Results suggest there are distinct components deemed integral to the success of stakeholder goals in this system, including 'key habitat components' and 'policy relevant species', as well as activities associated with 'conservation and recreation' and 'scientific research'. Those components which were seen to limit the potential achievement of most goals included invasive species, and in particular, more recently introduced invasives, as well as extractive industries. Consideration of the similarity in goals based on their perceived interactions with the activities and biodiversity of the system indicated that there were shared dependencies between some stakeholders, but also differences that highlight the potential for conflict. Future management scenarios should take consideration of the key limiting and enabling factors identified here.},
}
@article {pmid30317388,
year = {2018},
author = {Brzeziński, M and Chibowski, P and Gornia, J and Górecki, G and Zalewski, A},
title = {Spatio-temporal variation in nesting success of colonial waterbirds under the impact of a non-native invasive predator.},
journal = {Oecologia},
volume = {188},
number = {4},
pages = {1037-1047},
pmid = {30317388},
issn = {1432-1939},
abstract = {Colonial breeding in birds provides protection from predators and may be particularly important when birds have to cope with an invasive predator. The probability of nest predation in a colony can vary depending on several factors, such as the nest's location in the colony and the level of aggregation of nests. We studied the nesting success of colonial great crested grebes and monitored the occurrence of the non-native invasive American mink in the colony. From among 92 grebe nests, 54.3% were successful. The daily survival rate (DSR) of grebe nests was positively affected by the increasing distance between the nest and lake shoreline, and negatively affected by the increasing distance between the nest and the five nearest grebe nests. The probability of mink occurrence in the colony increased with consecutive days of the breeding season and decreased with increasing distance from the lake shoreline. The DSR of grebe nests decreased with the increasing probability of mink occurrence along the shoreline distance gradient and the day of the breeding season. The results of the study confirm the impact of the American mink on waterbirds during the breeding season but also indicate that large breeding colonies are partially safe from mink predation, and that nest accessibility and the dilution effect influence the probability of nest survival. Our data suggest that the limited access to safe breeding sites on large lakes that can supply adult grebes and their chicks with food may affect bird productivity and population numbers at the landscape level.},
}
@article {pmid30315517,
year = {2018},
author = {Zhong, L and Wang, M and Li, D and Tang, S and Zhang, T and Bian, W and Chen, X},
title = {Complete mitochondrial genome of freshwater goby Rhinogobius cliffordpopei (Perciformes, Gobiidae): genome characterization and phylogenetic analysis.},
journal = {Genes &amp; genomics},
volume = {40},
number = {11},
pages = {1137-1148},
pmid = {30315517},
issn = {2092-9293},
support = {CARS-46//China Agriculture Research System/International ; 2014-NY-008//Human Resources and Social Security of Jiangsu Province/International ; ZYHB16-3//Major project of hydrobios resources in Jiangsu province/International ; 2015-2016//Inland Water Fishery Resources Monitoring Program of Jiangsu Province/International ; },
mesh = {Animals ; Fish Proteins/genetics ; Genes, rRNA ; *Genome, Mitochondrial ; Perciformes/classification/*genetics ; Phylogeny ; RNA, Transfer/genetics ; },
abstract = {Freshwater gobies Rhinogobius cliffordpopei and R. giurinus are invasive species with particular concern because they have become dominant and were fierce competitors in the invaded areas in Yunnan-Guizhou Plateau (southwest of China). Information about genetic characteristics of R. giurinus have been published, but there were still no relevant reports about R. cliffordpopei. In present study, the complete mitochondrial genome of R. cliffordpopei was determined, which was 16,511 bp in length with A + T content of 51.1%, consisting of 13 protein-coding genes, 22 tRNAs, 2 ribosomal RNAs, and a control region. The gene composition and the structural arrangement of the R. cliffordpopei complete mtDNA were identical to most of other teleosts. Phylogenetic analyses placed R. cliffordpopei in a well-supported monophyletic cluster with other Rhinogobius fish. But the phylogenetic relationship between genus Rhinogobius and Tridentiger remained to be resolved.},
}
@article {pmid30314792,
year = {2018},
author = {d'Ovidio, D and Pirrone, F},
title = {A cross-sectional survey to evaluate the pet squirrel population and ownership profiles.},
journal = {Preventive veterinary medicine},
volume = {159},
number = {},
pages = {65-71},
doi = {10.1016/j.prevetmed.2018.08.018},
pmid = {30314792},
issn = {1873-1716},
mesh = {Animal Welfare/*statistics &amp; numerical data ; Animals ; Cross-Sectional Studies ; Europe ; Humans ; Introduced Species ; Ownership/*statistics &amp; numerical data ; *Pets ; Sciuridae ; },
abstract = {While the presence of squirrels in households is growing, little data is published on their status in captivity. A web-based questionnaire for owners was devised eliciting information about them, their squirrels and their squirrels' husbandry and health. One hundred owners answered the survey, with most respondents being located in Europe (n = 81). Only data from these respondents were analysed. Twenty-five percents of the owners housed an invasive non-native species of European Union concern (S. carolinensis and T. sibiricus), some of which were younger than three years of age and all but one were sexually intact. This is of particular concern, as the acquisition of these invasive species is illegal since 2015 (European Union Regulation 1143/2014), due to the severe threats they pose to biodiversity. Moreover, escapes derived from improper keeping of intact specimens may augment feral populations or establish new colonies. Among 81 cases, only 5% were neutered, mostly for health reasons. Sixty-three percents of the squirrels had health problems, particularly dermatologic (52%) and intestinal disorders (34%). Most owners reported to visit the veterinarian only if their pet was ill rather than for preventive care. This is the first survey on pet squirrel ownership reported to date. Information that emerges from this study will be useful in implementing rational veterinary strategies for managing pet squirrels properly and, in parallel, meeting the challenges arising from private keeping of alien species.},
}
@article {pmid30314636,
year = {2018},
author = {Wright, JT and Holmes, ZC and Byers, JE},
title = {Stronger positive association between an invasive crab and a native intertidal ecosystem engineer with increasing wave exposure.},
journal = {Marine environmental research},
volume = {142},
number = {},
pages = {124-129},
doi = {10.1016/j.marenvres.2018.09.025},
pmid = {30314636},
issn = {1879-0291},
abstract = {Ecosystem engineers are predicted to have stronger facilitative effects when environmental stress is higher. Here we examined whether facilitation of the invasive porcelain crab Petrolisthes elongatus by the ecosystem engineering serpulid tube worm Galeolaria caespitosa increased with wave exposure. Petrolisthes occurs beneath intertidal boulders which often have a high cover of Galeolaria on their underside. Surveys across nine sites demonstrated Petrolisthes abundance beneath boulders increased with wave exposure and Galeolaria cover, although only when the habitat matrix beneath boulders was rock or mixed rock and sand. Moreover, as wave exposure increased, the strength of relationship between Petrolisthes abundance and the surface area of Galeolaria also increased. Experimentally, the presence of Galeolaria on the underside of boulders increased Petrolisthes abundance by 50% compared to boulders lacking Galeolaria. Our findings suggest the facilitative role of Galeolaria is stronger at more wave-exposed sites, which appears to contribute to a higher abundance of invasive Petrolisthes.},
}
@article {pmid30314367,
year = {2018},
author = {Powell, JR},
title = {Genetic Variation in Insect Vectors: Death of Typology?.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040139},
pmid = {30314367},
issn = {2075-4450},
support = {U01 AI115595/AI/NIAID NIH HHS/United States ; USAID//National Institutes of Health/ ; },
abstract = {The issue of typological versus population thinking in biology is briefly introduced and defined. It is then emphasized how population thinking is most relevant and useful in vector biology. Three points are made: (1) Vectors, as they exist in nature, are genetically very heterogeneous. (2) Four examples of how this is relevant in vector biology research are presented: Understanding variation in vector competence, GWAS, identifying the origin of new introductions of invasive species, and resistance to inbreeding. (3) The existence of high levels of vector genetic heterogeneity can lead to failure of some approaches to vector control, e.g., use of insecticides and release of sterile males (SIT). On the other hand, vector genetic heterogeneity can be harnessed in a vector control program based on selection for refractoriness.},
}
@article {pmid30313792,
year = {2018},
author = {Bick, A and Bastrop, R and Kotta, J and Meißner, K and Meyer, M and Syomin, V},
title = {Description of a new species of Sabellidae (Polychaeta, Annelida) from fresh and brackish waters in Europe, with some remarks on the branchial crown of Laonome.},
journal = {Zootaxa},
volume = {4483},
number = {2},
pages = {349-364},
doi = {10.11646/zootaxa.4483.2.7},
pmid = {30313792},
issn = {1175-5334},
mesh = {Animals ; *Annelida ; Australia ; Europe ; Netherlands ; *Polychaeta ; Prospective Studies ; Saline Waters ; },
abstract = {In 2009, a hitherto unknown Laonome species was found in the Canal Ghent-Terneuzen in the Netherlands and subsequently in other Dutch rivers, canals and estuaries. A few years later, more unknown Laonome specimens were found in the eastern part of the Baltic Sea and in the Don River estuary, Sea of Azov. Initially, it was assumed that these specimens could represent Laonome calida Capa, 2007, originally described from Australia. In the present study we examine all these unknown European Laonome specimens and compare these specimens with the type material of L. calida from Australia. This lead to two main results: First, all specimens from Europe have the same diagnostic characters and therefore belong to one species. This finding was also supported by the results of a correspondence analysis, and genetic analyses using four different DNA sequences (COI, 16S, 28S). Second, it turned out that the type material of L. calida contains two morphologically distinct groups of specimens. The holotype and 7 paratypes are similar to each other but differ significantly from the other also similar 16 paratypes, and from all European specimens. On the basis of these observations, the Laonome specimens from European waters are described here as L. xeprovala sp. nov. We also provide the characters of the branchial crown of three Laonome species for a prospective revision of this genus.},
}
@article {pmid30313651,
year = {2018},
author = {Bronstein, O and Kroh, A},
title = {Needle in a haystack-genetic evidence confirms the expansion of the alien echinoid Diadema setosum (Echinoidea: Diadematidae) to the Mediterranean coast of Israel.},
journal = {Zootaxa},
volume = {4497},
number = {4},
pages = {593-599},
doi = {10.11646/zootaxa.4497.4.9},
pmid = {30313651},
issn = {1175-5334},
mesh = {Animals ; Israel ; Lebanon ; Mediterranean Sea ; *Sea Urchins ; Turkey ; },
abstract = {Diadema setosum (Leske, 1778), a widespread tropical echinoid and key herbivore in shallow water environments is currently expanding in the Mediterranean Sea. It was introduced by unknown means and first observed in southern Turkey in 2006. From there it spread eastwards to Lebanon (2009) and westwards to the Aegean Sea (2014). Since late 2016 sporadic sightings of black, long-spined sea urchins were reported by recreational divers from rock reefs off the Israeli coast. Numerous attempts to verify these records failed; neither did the BioBlitz Israel task force encounter any D. setosum in their campaigns. Finally, a single adult specimen was observed on June 17, 2017 in a deep rock crevice at 3.5 m depth at Gordon Beach, Tel Aviv. Although the specimen could not be recovered, spine fragments sampled were enough to genetically verify the visual underwater identification based on morphology. Sequences of COI, ATP8-Lysine, and the mitochondrial Control Region of the Israel specimen are identical to those of the specimen collected in 2006 in Turkey, unambiguously assigning the specimen to D. setosum clade b. This lends support to the hypothesis of a single introduction event and fits well with the habitat suitability and distribution model for D. setosum published recently. The more rapid and larger range extension along a south-eastern, counter-current trajectory may reflect a strong habitat preference for D. setosum in this area of the Levantine Basin as predicted by the model.},
}
@article {pmid30313620,
year = {2018},
author = {Broadley, A and Kauschke, E and Mohrig, W},
title = {Black fungus gnats (Diptera: Sciaridae) found in association with cultivated plants and mushrooms in Australia, with notes on cosmopolitan pest species and biosecurity interceptions.},
journal = {Zootaxa},
volume = {4415},
number = {2},
pages = {201-242},
doi = {10.11646/zootaxa.4415.2.1},
pmid = {30313620},
issn = {1175-5334},
mesh = {*Agaricales ; Animals ; Australia ; Canada ; China ; Commerce ; *Diptera ; *Introduced Species ; Male ; New South Wales ; Tasmania ; },
abstract = {Male sciarids collected in Australia from inside post-entry quarantine and domestic greenhouses and from vegetable gardens and various plants, were slide mounted and identified. Specimens intercepted during on-arrival biosecurity inspections of imported nursery stock plants were also examined, and the New South Wales Department of Primary Industries collection of slide-mounted Sciaridae was reviewed. Plant and mushroom pest species that are present in Australia are Bradysia impatiens (Johannsen), B. ocellaris (Comstock), Lycoriella agraria (Felt), L. ingenua (Dufour) = Sciara womersleyi Séguy, 1940 syn. n., L. sativae (Johannsen) = Sciara auberti Séguy, 1940 syn. n., Sciara jeanneli Séguy, 1940 syn. n., Sciara solispina Hardy, 1956 syn. n., and Cosmosciara hartii (Johannsen, 1912) comb. n. = Plastosciara perniciosa Edwards, 1922 syn. n. The last species is a new record for Australia. Bradysia tilicola (Loew) and Pnyxia scabiei (Hopkins) are potential pest species, but they have not been reported yet from Australia. An identification key to enable separation of the pest species is provided. Species with uncertain connections to plant and mushroom cultures are B. pallipes (Fabricius), B. strenua (Winnertz, 1867) = B. watsoni Colless, 1962 syn. n., Corynoptera concinna (Winnertz), (all three species are new records for the Australian mainland) and Hyperlasion aliens Mohrig (a new record for Tasmania). Bradysia spatitergum (Hardy) and Scatopsciara atomaria (Zetterstedt) were intercepted during the on-arrival biosecurity inspections of live plants imported from China and Canada respectively. Both species are widespread overseas but are not known to occur in Australia.},
}
@article {pmid30313367,
year = {2018},
author = {BieŃkowski, AO},
title = {Key for identification of the ladybirds (Coleoptera: Coccinellidae) of European Russia and the Russian Caucasus (native and alien species).},
journal = {Zootaxa},
volume = {4472},
number = {2},
pages = {233-260},
doi = {10.11646/zootaxa.4472.2.2},
pmid = {30313367},
issn = {1175-5334},
mesh = {Animals ; *Coleoptera ; Ecology ; *Introduced Species ; Russia ; },
abstract = {Although ladybirds of European Russia and the Caucasus have been the subject of numerous ecological and faunistic investigations, there is an evident lack of appropriate identification keys. New, original keys to subfamilies, tribes, genera, and species of ladybirds (Coccinellidae) of European Russia and the Russian Caucasus are presented here. The keys include all native species recorded in the region and all introduced alien species. Some species from adjacent regions are added. In total, 113 species are treated and illustrated with line drawings. Photographs of rare and endemic species are provided. Information on the distribution of species within the region under consideration is provided. Chilocorus kuwanae Silvestri, 1909 is recognized as a subjective junior synonym (syn. nov.) of Ch. renipustulatus (Scriba, 1791).},
}
@article {pmid30313250,
year = {2018},
author = {Serejo, CS and Siqueira, SGL},
title = {Catalogue of the Order Amphipoda from Brazil (Crustacea, Peracarida): Suborders Amphilochidea, Senticaudata and Order Ingolfiellida.},
journal = {Zootaxa},
volume = {4431},
number = {1},
pages = {1-139},
doi = {10.11646/zootaxa.4431.1.1},
pmid = {30313250},
issn = {1175-5334},
mesh = {*Amphipoda ; Animals ; Brazil ; *Caves ; Ecosystem ; Records ; },
abstract = {This catalog documents 303 species within 142 genera and 56 families distributed in the suborders Amphilochidea, Senticaudata and order Ingolfiellida that have been described or reported for the Brazilian coast and continent. Data for these species such as type material, type locality, geographic and bathymetric distribution, ecological notes and remarks, when pertinent, was given. From these, 268 species (~ 90%) are benthonic, marine and/or estuarine occurring from a diverse type of substrates as sediment, algae, sponges, cnidarians, ascideans, mangrove roots, fouling habitats, coral rubble, rodolith banks, etc. In terms of bathymetry, there are 214 species (~ 80%) reported for the Brazilian continental shelf (0-200 m) and 60 (~20%) for the deep sea zone (> 200 m, 50% from the Campos Basin area). There are 35 non-marine amphipods reported from Brazil. Hyalella is the restricted and dominant epigean group and is represented by 22 species, including some hypogean and cave species. Cave dwellers includes 15 species within 6 genera as: Hyalella (5); Megagidiella (1); Potiberaba (1); Spelaeogammarus (7), and Seborgia (1). Among the Bogidiellidae, Bogidiella neotropica Ruffo, 1952 and Marigidiella brasiliensis (Siewing, 1953) are hypogean, but not from caves. The former is the only amphipod species recorded from the Brazilian Amazon Biome, within the Tapajós River, Pará and the latter are found in marine coastal groundwater of Bahia and São Paulo. Considering the landhoppers (truly terrestrial), only two introduced species, Talitroides alluaudi (Chevreux, 1896) and Talitroides topitotum (Burt, 1934) have been found in the Atlantic forest biome, urban parks and sylviculture plantations from the southeast and south of Brazil. Moreover, several amphipod records for Brazil were noticed to be dubious or misidentifications and are listed in a table with pertinent literature.},
}
@article {pmid30312506,
year = {2019},
author = {Latham, MC and Anderson, DP and Norbury, G and Price, CJ and Banks, PB and Latham, ADM},
title = {Modeling habituation of introduced predators to unrewarding bird odors for conservation of ground-nesting shorebirds.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {29},
number = {1},
pages = {e01814},
doi = {10.1002/eap.1814},
pmid = {30312506},
issn = {1051-0761},
support = {//Ministry of Business, Innovation and Employment, New Zealand/ ; },
abstract = {Foraging mammalian predators face a myriad of odors from potential prey. To be efficient, they must focus on rewarding odors while ignoring consistently unrewarding ones. This may be exploited as a nonlethal conservation tool if predators can be deceived into ignoring odors of vulnerable secondary prey. To explore critical design components and assess the potential gains to prey survival of this technique, we created an individual-based model that simulated the hunting behavior of three introduced mammalian predators on one of their secondary prey (a migratory shorebird) in the South Island of New Zealand. Within this model, we heuristically assessed the outcome of habituating the predators to human-deployed unrewarding bird odors before the bird's arrival at their breeding grounds, i.e., the predators were &quot;primed.&quot; Using known home range sizes and probabilities of predators interacting with food lures, our model suggests that wide-ranging predators should encounter a relatively large number of odor points (between 10 and 115) during 27 d of priming when odor is deployed within high-resolution grids (100-150 m). Using this information, we then modeled the effect of different habituation curves (exponential and sigmoidal) on the probability of predators depredating shorebird nests. Our results show that important gains in nest survival can be achieved regardless of the shape of the habituation curve, but particularly if predators are fast olfactory learners (exponential curve), and even if some level of dishabituation occurs after prey become available. Predictions from our model can inform the amount and pattern in which olfactory stimuli need to be deployed in the field to optimize encounters by predators, and the relative gains that can be expected from reduced predation pressure on secondary prey under different scenarios of predator learning. Habituating predators to odors of threatened secondary prey may have particular efficacy as a conservation tool in areas where lethal predator control is not possible or ethical, or where even low predator densities can be detrimental to prey survival. Our approach is also relevant for determining interaction probabilities for devices other than odor points, such as bait stations and camera traps.},
}
@article {pmid30310745,
year = {2018},
author = {Mohanty, NP and Measey, J},
title = {What's for dinner? Diet and potential trophic impact of an invasive anuran Hoplobatrachus tigerinus on the Andaman archipelago.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5698},
pmid = {30310745},
issn = {2167-8359},
abstract = {Amphibian invasions have considerable detrimental impacts on recipient ecosystems. However, reliable risk analysis of invasive amphibians still requires research on more non-native amphibian species. An invasive population of the Indian bullfrog, Hoplobatrachus tigerinus, is currently spreading on the Andaman archipelago and may have significant trophic impacts on native anurans through competition and predation. We carried out diet analyses of the invasive H. tigerinus and native anurans, across four habitat types and two seasons; we hypothesized that (i) small vertebrates constitute a majority of the H. tigerinus diet, particularly by volume and (ii) the diet of H. tigerinus significantly overlaps with the diet of native anurans, thereby, leading to potential competition. We assessed the diet of the invasive H. tigerinus (n = 358), and individuals of the genera Limnonectes (n = 375) and Fejervarya (n = 65) and found a significant dietary overlap of H. tigerinus with only Limnonectes. Small vertebrates, including several endemic species, constituted the majority of H. tigerinus, diet by volume, suggesting potential impact by predation. Prey consumption and electivity of the three anurans indicated a positive relationship between predator-prey body sizes. Individuals of H. tigerinus and Fejervarya chose evasive prey, suggesting that these two taxa are mostly ambush predators; individuals of Limnonectes chose a mixture of sedentary and evasive prey indicating that the species employs a combination of 'active search' and 'sit and wait' foraging strategies. All three species of anurans mostly consumed terrestrial prey. This intensive study on a genus of newly invasive amphibian contributes to knowledge of the impact of amphibian invasions, and elucidates the feeding ecology of H. tigerinus, and species of the genera Limnonectes and Fejervarya. We also stress the necessity to evaluate prey availability and volume in future studies for meaningful insights into diet of amphibians.},
}
@article {pmid30310238,
year = {2018},
author = {Pliszko, A and Kostrakiewicz-Gierałt, K},
title = {Effect of cold stratification on seed germination in Solidago × niederederi (Asteraceae) and its parental species.},
journal = {Biologia},
volume = {73},
number = {10},
pages = {945-950},
pmid = {30310238},
issn = {0006-3088},
abstract = {In this study, we investigated the influence of cold stratification on seed germination in S. × niederederi, a hybrid between the North American S. canadensis and the European S. virgaurea, using fruit samples collected in 2016 in Poland. We aimed to test the hypothesis that the low temperature exposure decreases the final percentage and speed of seed germination in the hybrid and its parental species. For each species, sets of 100 achenes in three replications were mixed with dry sand and stored in Petri dishes in darkness for 12 weeks, at -18 °C and + 4 °C, and + 25 °C. The seeds were incubated for 21 d at room temperature (+25 °C), under the 12 h photoperiod (630 lx). We showed a lack of significant differences in: (i) the final percentage of germinated seeds of studied species stored at the same conditions, (ii) the final percentage of germinated seeds between the applied stratification conditions in the hybrid and its parental species, and (iii) the mean values of Timson's index, mean germination time, and coefficient of velocity of germination between the stratification conditions in each species. The statistically significant inter-specific differences in the mean germination time parameter after the +25 °C treatment suggest that the seeds of S. × niederederi are able to germinate faster than the seeds of its parental species. However, to improve our knowledge of naturalization and invasion abilities of S. × niederederi by sexual reproduction, the seed germination and seedling survival of the hybrid should be tested in the field.},
}
@article {pmid30310125,
year = {2018},
author = {Salinitro, M and Alessandrini, A and Zappi, A and Melucci, D and Tassoni, A},
title = {Floristic diversity in different urban ecological niches of a southern European city.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {15110},
pmid = {30310125},
issn = {2045-2322},
abstract = {The present paper aimed at studying the vertical and horizontal spatial distribution, species richness and diversity of vascular plants in different urban ecological niches (urban habitats) by means of the case study of Bologna (Italy), a typical densely populated southern European city. A total of 477 species were found in the study area of the historical city centre, 30% of which were alien species. Alien plant species were mainly present among phanerophytes, while native plants were mainly therophytes and hemicryptophytes. The habitats that mostly contributed to the species total richness were semi-natural soils, followed by paved areas, walls, rooftops and manholes. The number of exclusive species decreased according to the selectiveness of the habitat, with manholes and rooftops being the most selective. The presence of hemicryptophytes constant decreased going from 27% of more humid habitats to 5% of more arid habitats, so that they can be considered a water availability biomarker. Urban habitat quality, measured by the number of native species, was directly proportional to the strength of selective factors and inversely proportional to the rate of disturbance, with roofs and semi-natural soils having, respectively, the highest and lowest quality. Finally, a relation between species richness and street characteristics, like width, orientation and type of flooring, was demonstrated.},
}
@article {pmid30308820,
year = {2019},
author = {Budzyńska, A and Rosińska, J and Pełechata, A and Toporowska, M and Napiórkowska-Krzebietke, A and Kozak, A and Messyasz, B and Pęczuła, W and Kokociński, M and Szeląg-Wasielewska, E and Grabowska, M and Mądrecka, B and Niedźwiecki, M and Alcaraz Parraga, P and Pełechaty, M and Karpowicz, M and Pawlik-Skowrońska, B},
title = {Environmental factors driving the occurrence of the invasive cyanobacterium Sphaerospermopsis aphanizomenoides (Nostocales) in temperate lakes.},
journal = {The Science of the total environment},
volume = {650},
number = {Pt 1},
pages = {1338-1347},
doi = {10.1016/j.scitotenv.2018.09.144},
pmid = {30308820},
issn = {1879-1026},
mesh = {Biomass ; Cyanobacteria/*growth &amp; development ; *Environmental Monitoring ; Eutrophication ; Introduced Species ; Lakes/*microbiology ; Phosphorus/analysis ; Phytoplankton ; Seasons ; Water Pollution/analysis ; },
abstract = {Cyanobacterial blooms are an increasing threat worldwide. Invasions of certain cyanobacterial species, mainly towards higher latitudes, add to this concern as they enrich the pool of potential bloom-formers in the invaded region. Among the numerous causes of this escalating process, climate warming is commonly considered the most crucial factor, but empirical studies of this issue are lacking. The aim of our study was to identify physical, chemical and biological factors related to the occurrence of an invasive cyanobacterium at the northern border of its putative current range, and thus enabling its expansion. This study focuses on the relatively little studied species Sphaerospermopsis aphanizomenoides (Nostocales, Cyanobacteria; synonyms: Aphanizomenon aphanizomenoides, Anabaena aphanizomenoides), which is predicted to become one of the main nuisance species of the future. Forty-nine freshwater lakes located between latitudes 51° and 55°N were examined for the presence of S. aphanizomenoides, and environmental factors that could drive its occurrence were studied simultaneously. To identify factors correlated with the presence of the species, principal component analysis (PCA) and Mann-Whitney U test were performed. Water temperature did not differentiate lakes with or without S. aphanizomenoides, however the study was conducted in a particularly hot summer. Total phosphorus concentration was identified as the primary driving factor of the occurrence of S. aphanizomenoides. The species grew in poor light conditions and high phytoplankton biomass, mainly in shallow lakes. As shown by detrended correspondence analysis (DCA), the species accompanied shade tolerant, eutrophic species of native and invasive cyanobacteria as well as eukaryotic algae. Our results indicate that eutrophication may be the primary factor enabling the increasing occurrence of S. aphanizomenoides in temperate environments, and suggest that this process may stimulate expansion of cyanobacterial species towards high latitudes.},
}
@article {pmid30307074,
year = {2018},
author = {Andrew, SC and Jensen, H and Hagen, IJ and Lundregan, S and Griffith, SC},
title = {Signatures of genetic adaptation to extremely varied Australian environments in introduced European house sparrows.},
journal = {Molecular ecology},
volume = {27},
number = {22},
pages = {4542-4555},
doi = {10.1111/mec.14897},
pmid = {30307074},
issn = {1365-294X},
support = {2013077//Macquarie University Research Excellence/ ; FT130101253//Australian Research Council Future/ ; 211956//Research Council of Norway/ ; 223257//Research Council of Norway's Centres of Excellence funding scheme/ ; },
abstract = {Due to its history of multiple introductions to novel environments worldwide, the house sparrow has been used as a model species to study local adaption in invasive avian species. New genomic resources such as a custom 200K SNP array and a house sparrow reference genome provide great prospects for studying rapid local adaptation in this invasive species. Here, we analyse high-density genomewide genetic data collected across an extensive range of temperate, arid and tropical climates, in Australian populations that were introduced from Europe 150 years ago. We used two population differentiation (PD) and two ecological association (EA) methods to identify putative loci subject to selection across these varied climates. A majority of the outlier SNPs were identified through the use of the latent factor mixed models (LFMM) EA method, but the BayeScEnv EA method had the strongest overlap with the outliers from the two PD methods. Out of all the 971 outliers identified across the different methods, 38.3% were physically linked (within 20 kbps) to 575 known protein-coding regions in the house sparrow reference genome. Interestingly, some outlier genes had been previously identified in genome scan studies of broadly distributed species or had strong links to traits that are expected to be important to local adaptation, for example, heat-shock proteins, immune response and HOX genes. However, many outliers still have unknown relevance and some outliers can be false positives. Our results identify an opportunity to use the house sparrow model to further study local adaptation in an invasive species.},
}
@article {pmid30307038,
year = {2018},
author = {Fahey, C and Angelini, C and Flory, SL},
title = {Grass invasion and drought interact to alter the diversity and structure of native plant communities.},
journal = {Ecology},
volume = {99},
number = {12},
pages = {2692-2702},
doi = {10.1002/ecy.2536},
pmid = {30307038},
issn = {0012-9658},
support = {FLA-AGR- 005180//USDA/NIFA McIntire-Stennis program/ ; Contract#21942//Florida Forest Service, Florida Department of Agriculture and Consumer Services/ ; 1546638//National Science Foundation Division of Environmental Biology/ ; //University of Florida, Institute of Food and Agricultural Sciences (UF/IFAS)/ ; },
abstract = {Understanding the interactive effects of species invasions and climate change is essential for predicting future shifts in biodiversity. Because multiple stressors can interact in synergistic or antagonistic ways, it is notoriously difficult to anticipate their combined effects on species assemblages. However, some hypotheses predict that plant invasions will become increasingly problematic as climate change improves conditions for invaders or lowers the biotic resistance of native communities. In a 4-yr field experiment, we quantified the individual and interactive effects of invasion by a globally problematic C4 grass, Imperata cylindrica, and chronic simulated drought imposed by rainout shelters on the whole plant communities of regenerating longleaf pine forest. Invasion both inhibited plant colonization and enhanced plot-level extinctions, resulting in a severe (60%) loss of plant diversity across all functional groups, including perennial grasses and forbs, annual forbs, and woody species and dramatic shifts in community composition. Experimental drought reduced diversity by 20%, and caused a shift in the dominant functional groups, but had no significant effect on cover of the invader. The invader partially ameliorated water stress in the drought treatment such that invaded plots had higher soil moisture than uninvaded plots. Consequently, the combined effects of invasion and drought were lower than expected from an additive model of multiple stressors. These findings, which may have broader implications for how other C4 grass invaders will interact with drought to shift native community dynamics, challenge the perception that climate change will exacerbate invasions. In revealing that invasive species pose a major threat to the diversity and structure of native communities despite their moderating effects on abiotic stress, this work also highlights that management of aggressive invaders may be critical to preserving biodiversity regardless of future climate.},
}
@article {pmid30304394,
year = {2018},
author = {Lee, CC and Wang, J},
title = {Rapid Expansion of a Highly Germline-Expressed Mariner Element Acquired by Horizontal Transfer in the Fire Ant Genome.},
journal = {Genome biology and evolution},
volume = {10},
number = {12},
pages = {3262-3278},
doi = {10.1093/gbe/evy220},
pmid = {30304394},
issn = {1759-6653},
abstract = {Transposable elements (TEs) are present in almost all organisms and affect the host in various ways. TE activity can increase genomic variation and thereby affect host evolution. Currently active TEs are particularly interesting because they are likely generating new genomic diversity. These active TEs have been poorly studied outside of model organisms. In this study, we aimed to identify currently active TEs of a notorious invasive species, the red imported fire ant Solenopsis invicta. Using RNA profiling of male and female germline tissues, we found that the majority of TE-containing transcripts in the fire ant germline belong to the IS630-Tc1-Mariner superfamily. Subsequent genomic characterization of fire ant mariner content, molecular evolution analysis, and population comparisons revealed a highly expressed and highly polymorphic mariner element that is rapidly expanding in the fire ant genome. Additionally, using comparative genomics of multiple insect species we showed that this mariner has undergone several recent horizontal transfer events (<5.1 My). Our results document a rare case of a currently active TE originating from horizontal transfer.},
}
@article {pmid30301240,
year = {2018},
author = {Avanesyan, A},
title = {Should I Eat or Should I Go? Acridid Grasshoppers and Their Novel Host Plants: Potential for Biotic Resistance.},
journal = {Plants (Basel, Switzerland)},
volume = {7},
number = {4},
pages = {},
doi = {10.3390/plants7040083},
pmid = {30301240},
issn = {2223-7747},
abstract = {Novel, non-coevolved associations between introduced plants and native insect herbivores may lead to changes in trophic interactions in native communities, as well as to substantial economic problems. Although some studies in invasion ecology demonstrated that native herbivores can preferentially feed on introduced plants and therefore contribute to the biotic resistance of native communities to plant invasions, the role of acridid grasshoppers as native generalist insect herbivores is largely overlooked. This systematic review aimed to identify patterns of grasshopper feeding preferences for native versus introduced plants and, consequently, a potential of grasshoppers to provide biotic resistance of native communities. The analysis of 63 records of feeding preference trials for 28 North-American grasshopper species (retrieved from 2146 studies published during 1967⁻2017) has demonstrated a preference of grasshoppers for introduced host plants, and identified 12 preferred introduced plants with high or middle invasive ranks. A significant effect of the life stage (p < 0.001), but not the experimental environment, plant material, and measurements, on grasshopper preferences for introduced plants was also detected. Overall, results suggest a potential of acridid grasshoppers to contribute to the biotic resistance of native communities. The review also provides methodological recommendations for future experimental studies on grasshopper-host plant interactions.},
}
@article {pmid30301069,
year = {2018},
author = {Gerhard, WA and Gunsch, CK},
title = {Analyzing trends in ballasting behavior of vessels arriving to the United States from 2004 to 2017.},
journal = {Marine pollution bulletin},
volume = {135},
number = {},
pages = {525-533},
doi = {10.1016/j.marpolbul.2018.07.001},
pmid = {30301069},
issn = {1879-3363},
mesh = {Environmental Health ; Humans ; *Introduced Species ; *Ships ; Time Factors ; United States ; Water ; *Water Purification ; },
abstract = {Maritime shipping transports over 90% of global goods. Ballast water, used to provide vessel stability, has been associated with the introduction of marine invasive species. Thus, understanding ballasting trends is imperative to protecting human and environmental health. This paper examines data from the National Ballast Information Clearinghouse to assess ballasting behavior and shipping trends in the United States. From 2005 to 2017, vessel arrivals have remained relatively constant (annual growth rate of 1.2% per year) while total ballast discharge per vessel has grown at an annual rate of 7.6%. Furthermore, from 2014 to 2016, alternative ballast water management methods have been on the rise, and these treatment options are likely to continue increasing in response to the International Maritime Organization Ballast Water Management Convention that entered into force in September 2017. It is critical that the shipping industry monitors potential cascading impacts on other ballasting behaviors stemming from this shift.},
}
@article {pmid30301006,
year = {2018},
author = {Lundgreen, K and Holbech, H and Pedersen, KL and Petersen, GI and Andreasen, RR and George, C and Drillet, G and Andersen, M},
title = {UV fluences required for compliance with ballast water discharge standards using two approved methods for algal viability assessment.},
journal = {Marine pollution bulletin},
volume = {135},
number = {},
pages = {1090-1100},
doi = {10.1016/j.marpolbul.2018.08.043},
pmid = {30301006},
issn = {1879-3363},
mesh = {Dinoflagellida/radiation effects ; Phytoplankton/*radiation effects ; Pressure ; Seawater ; *Ships ; Tropical Climate ; *Ultraviolet Rays ; Water Purification/instrumentation/*methods ; },
abstract = {This study investigates the extra UV fluence needed to meet the International Maritime Organisation's ballast water discharge standards for the 10-50 μm size-class using the approved vital stain (VS) method compared to the Most Probable Number (MPN) method for organism viability assessment. Low- and medium pressure UV collimated beam treatments were applied to natural algae collected in temperate and tropical water environments and analysed using both methods. About 10 times higher UV fluence was required to meet discharge standards when using VS compared to MPN. Implementing a dark-hold period after UV treatments decreased algal viability. Length of dark-hold period to meet discharge standards decreased with increasing UV fluence. No significant differences between temperate and tropical samples were observed. The results showed that UV treated algae assessed using the VS method could meet discharge standards by increasing fluence and/or introducing a dark-hold period.},
}
@article {pmid30301002,
year = {2018},
author = {Hoxha, T and Crookes, S and Lejeusne, C and Dick, JTA and Chang, X and Bouchemousse, S and Cuthbert, RN and MacIsaac, HJ},
title = {Comparative feeding rates of native and invasive ascidians.},
journal = {Marine pollution bulletin},
volume = {135},
number = {},
pages = {1067-1071},
doi = {10.1016/j.marpolbul.2018.08.039},
pmid = {30301002},
issn = {1879-3363},
mesh = {Animals ; Ciona/*physiology ; Ciona intestinalis/physiology ; Feeding Behavior/*physiology ; France ; *Introduced Species ; Species Specificity ; },
abstract = {Ascidians have a recent history of species introductions globally, often with strong ecological impacts. Comparisons of per capita effects of invaders and comparable natives are useful to assess such impacts. Here, we explore ingestion rates (IR) and clearance rates (CR) of Ciona intestinalis and Ciona robusta, co-occurring native and non-native ascidians, respectively, from Brittany, France. IR was positively related to food concentration, with the invader responding more strongly to increasing food concentration. CR also differed by species, with the invader demonstrating higher values. C. robusta exhibited a higher functional response (Type I) than did C. intestinalis (Type II). Relative impact measured using seasonal abundance and IR revealed that C. robusta has a much greater impact than C. intestinalis at all food concentrations tested, though the former has a constrained distribution which limits its regional impact. Nevertheless, when abundant, we expect C. robusta to exert a greater impact on algal foods.},
}
@article {pmid30300935,
year = {2018},
author = {Trotta, LB and Baiser, B and Possley, J and Li, D and Lange, J and Martin, S and Sessa, EB},
title = {Community phylogeny of the globally critically imperiled pine rockland ecosystem.},
journal = {American journal of botany},
volume = {105},
number = {10},
pages = {1735-1747},
doi = {10.1002/ajb2.1168},
pmid = {30300935},
issn = {1537-2197},
abstract = {PREMISE OF THE STUDY: Community phylogenetic methods incorporate information on evolutionary relationships into studies of organismal assemblages. We used a community phylogenetic framework to investigate relationships and biogeographic affinities and to calculate phylogenetic signal of endemism and invasiveness for the flora of the pine rocklands-a globally critically imperiled ecosystem with a significant portion of its distribution in South Florida, United States.<br><br>METHODS: We reconstructed phylogenetic relationships of 538 vascular plant taxa, which represent 92.28% of the vascular flora of the pine rocklands. We estimated phylogenetic signal for endemism and invasiveness using phylogenetic generalized linear mixed models. We determined the native range for each species in the data set and calculated the total number of species sourced from each region and all possible combinations of these regions.<br><br>KEY RESULTS: The pine rockland flora includes representatives of all major vascular plant lineages, and most species have native ranges in the New World. There was strong phylogenetic signal for endemism, but not for invasiveness.<br><br>CONCLUSIONS: Community phylogenetics has high potential value for conservation planning, particularly for fragmented and endangered ecosystems like the pine rockland. Strong phylogenetic signal for endemic species in our data set, which also tend to be threatened or endangered, can help to identify species at risk, as well as fragments where those species occur, highlighting conservation priorities. Our results indicate, at least in the pine rockland ecosystem, no phylogenetic signal for invasive species, and thus other information must be used to predict the potential for invasiveness.},
}
@article {pmid30297403,
year = {2018},
author = {García, FC and Bestion, E and Warfield, R and Yvon-Durocher, G},
title = {Changes in temperature alter the relationship between biodiversity and ecosystem functioning.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {43},
pages = {10989-10994},
pmid = {30297403},
issn = {1091-6490},
mesh = {*Biodiversity ; Biomass ; *Ecosystem ; Introduced Species ; Models, Biological ; Temperature ; },
abstract = {Global warming and the loss of biodiversity through human activities (e.g., land-use change, pollution, invasive species) are two of the most profound threats to the functional integrity of the Earth's ecosystems. These factors are, however, most frequently investigated separately, ignoring the potential for synergistic effects of biodiversity loss and environmental warming on ecosystem functioning. Here we use high-throughput experiments with microbial communities to investigate how changes in temperature affect the relationship between biodiversity and ecosystem functioning. We found that changes in temperature systematically altered the relationship between biodiversity and ecosystem functioning. As temperatures departed from ambient conditions the exponent of the diversity-functioning relationship increased, meaning that more species were required to maintain ecosystem functioning under thermal stress. This key result was driven by two processes linked to variability in the thermal tolerance curves of taxa. First, more diverse communities had a greater chance of including species with thermal traits that enabled them to maintain productivity as temperatures shifted from ambient conditions. Second, we found a pronounced increase in the contribution of complementarity to the net biodiversity effect at high and low temperatures, indicating that changes in species interactions played a critical role in mediating the impacts of temperature change on the relationship between biodiversity and ecosystem functioning. Our results highlight that if biodiversity loss occurs independently of species' thermal tolerance traits, then the additional impacts of environmental warming will result in sharp declines in ecosystem function.},
}
@article {pmid30296859,
year = {2019},
author = {Jones, CM and Parry, H and Tay, WT and Reynolds, DR and Chapman, JW},
title = {Movement Ecology of Pest Helicoverpa: Implications for Ongoing Spread.},
journal = {Annual review of entomology},
volume = {64},
number = {},
pages = {277-295},
doi = {10.1146/annurev-ento-011118-111959},
pmid = {30296859},
issn = {1545-4487},
abstract = {The recent introduction and spread of Helicoverpa armigera throughout South America highlight the invasiveness and adaptability of moths in the Helicoverpa genus. Long-range movement in three key members, H. armigera, H. zea, and H. punctigera, occurs by migration and international trade. These movements facilitate high population admixture and genetic diversity, with important economic, biosecurity, and control implications in today's agricultural landscape. This is particularly true for the spread of resistance alleles to transgenic crops expressing Bacillus thuringiensis (Bt) toxins that are planted over vast areas to suppress Helicoverpa spp. The ability to track long-distance movement through radar technology, population genetic markers, and/or long-distance dispersal modeling has advanced in recent years, yet we still know relatively little about the population trajectories or migratory routes in Helicoverpa spp. Here, we consider how experimental and theoretical approaches can be integrated to fill key knowledge gaps and assist management practices.},
}
@article {pmid30295388,
year = {2019},
author = {Chan, FT and Stanislawczyk, K and Sneekes, AC and Dvoretsky, A and Gollasch, S and Minchin, D and David, M and Jelmert, A and Albretsen, J and Bailey, SA},
title = {Climate change opens new frontiers for marine species in the Arctic: Current trends and future invasion risks.},
journal = {Global change biology},
volume = {25},
number = {1},
pages = {25-38},
doi = {10.1111/gcb.14469},
pmid = {30295388},
issn = {1365-2486},
abstract = {Climate change and increased anthropogenic activities are expected to elevate the potential of introducing nonindigenous species (NIS) into the Arctic. Yet, the knowledge base needed to identify gaps and priorities for NIS research and management is limited. Here, we reviewed primary introduction events to each ecoregion of the marine Arctic realm to identify temporal and spatial patterns, likely source regions of NIS, and the putative introduction pathways. We included 54 introduction events representing 34 unique NIS. The rate of NIS discovery ranged from zero to four species per year between 1960 and 2015. The Iceland Shelf had the greatest number of introduction events (n = 14), followed by the Barents Sea (n = 11), and the Norwegian Sea (n = 11). Sixteen of the 54 introduction records had no known origins. The majority of those with known source regions were attributed to the Northeast Atlantic and the Northwest Pacific, 19 and 14 records, respectively. Some introduction events were attributed to multiple possible pathways. For these introductions, vessels transferred the greatest number of aquatic NIS (39%) to the Arctic, followed by natural spread (30%) and aquaculture activities (25%). Similar trends were found for introductions attributed to a single pathway. The phyla Arthropoda and Ochrophyta had the highest number of recorded introduction events, with 19 and 12 records, respectively. Recommendations including vector management, horizon scanning, early detection, rapid response, and a pan-Arctic biodiversity inventory are considered in this paper. Our study provides a comprehensive record of primary introductions of NIS for marine environments in the circumpolar Arctic and identifies knowledge gaps and opportunities for NIS research and management. Ecosystems worldwide will face dramatic changes in the coming decades due to global change. Our findings contribute to the knowledge base needed to address two aspects of global change-invasive species and climate change.},
}
@article {pmid30294541,
year = {2018},
author = {Doi, K and Kato, T and Hayama, SI},
title = {Infestation of introduced raccoons (Procyon lotor) with indigenous ixodid ticks on the Miura Peninsula, Kanagawa Prefecture, Japan.},
journal = {International journal for parasitology. Parasites and wildlife},
volume = {7},
number = {3},
pages = {355-359},
pmid = {30294541},
issn = {2213-2244},
abstract = {Since the raccoon (Procyon lotor) was introduced to Japan, studies have established that they are infested with native Japanese tick species. However, the quantity of ticks infesting raccoons is unknown. We conducted a survey of ticks on invasive raccoons captured on the Miura Peninsula, Kanagawa Prefecture, Japan, from April 2015 through June 2016 to determine the species of ticks and to quantify the intensity of tick infestation in order to obtain basal information related to the ecology of host-parasite relationships among indigenous tick species and an alien mammalian species. We collected and identified 15,931 ticks of two genera and six species, namely, Haemaphysalis flava, H. megaspinosa, H. longicornis, H. japonica, Ixodes ovatus, and I. tanuki, from 100 out of 115 raccoons. The dominant tick species was H. flava (96.8%) and individuals were mainly adults. Seasonal patterns of infestation intensity of adults and nymphs peaked in the autumn and winter and decreasing in the late spring and summer, May to August, while larvae peaked in August. Our results indicated that host-parasite relationships between invasive raccoons and Japanese tick species, especially H. flava, were established in Kanagawa Prefecture. The ticks infest invasive raccoons for their blood-meal and also for overwintering. The results of this study extend our understanding of the ecology of tick-borne diseases.},
}
@article {pmid30294333,
year = {2018},
author = {Gentili, R and Ambrosini, R and Montagnani, C and Caronni, S and Citterio, S},
title = {Effect of Soil pH on the Growth, Reproductive Investment and Pollen Allergenicity of Ambrosia artemisiifolia L.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1335},
pmid = {30294333},
issn = {1664-462X},
abstract = {Despite the importance of soil reaction for alien plant establishment, few and incomplete studies have included this key factor so far. In this study, we investigated the effects of soil pH on the germination, growth (plant height, width, dry weight, etc.) and reproductive investment (inflorescence size and n° of flowers) of Ambrosia artemisiifolia (common ragweed), an allergenic species that is highly invasive and alien in Europe, through a replicated experiment in controlled conditions. In addition, we determined if soil pH has an effect on the total pollen allergenicity of the species. After preliminary germination tests on agar at different pH (from pH4 to pH8), plants were grown in natural soils with pH values of 5 (acid), 6 (sub-acid) and 7 (neutral) obtained by modifying a natural soil by liming methods (calcium hydroxide solution). Results showed that plants grown at pH7 were shorter and developed leaves at a slower rate than those grown at pH5 and pH6; plants grown at pH7 did not produce flowers and pollen. We also observed that, at pH5 and pH6, larger plants (as assessed by the dry weight of the aerial biomass) had both larger and more numerous inflorescences and emitted pollen earlier. Finally, the IgE-binding signal was higher in pollen samples collected from plants grown at pH5 (Integrated Optical Density, IOD, range: 1.12-1.25) than in those grown at pH6 (IOD range: 0.86 -1.03). Although we acknowledge the limitations of only testing the effects of pH in controlled conditions, this study suggests that soil pH greatly affects the growth and development of A. artemisiifolia and indicates that it may have a role in limiting the distribution and hazardousness of this plant. Future field tests should therefore assess the effectiveness of liming in the management and control of ragweed and other alien species.},
}
@article {pmid30291808,
year = {2019},
author = {Erbilgin, N},
title = {Phytochemicals as mediators for host range expansion of a native invasive forest insect herbivore.},
journal = {The New phytologist},
volume = {221},
number = {3},
pages = {1268-1278},
doi = {10.1111/nph.15467},
pmid = {30291808},
issn = {1469-8137},
support = {//Canada Research Chair Program/ ; //Genome Alberta, Genome British Columbia, and Genome Canada in support of the TRIA projects/ ; //Alberta Innovates-New Faculty Award/ ; //fRI Research-Mountain Pine Beetle Ecology Program/ ; //NSERC-Discovery Award/ ; //NSERC-Strategic Partnership Grant/ ; //Canada Foundation of Innovation/ ; },
abstract = {Mountain pine beetle (MPB) has recently invaded jack pine forests in western Canada. This invasion signifies a climate change-induced range expansion by a native insect. The mechanism underlying this invasion is unknown, but likely involves phytochemicals that play critical roles in MPB biology. Thus far, studies have investigated the compatibility of jack pine chemistry with beetles and their microbial symbionts. I have identified three phytochemical mechanisms that have likely facilitated the host range expansion of MPB. First, jack pine chemistry is overall similar to that of the historical hosts of MPB. In particular, jack pine chemistry is compatible with beetle pheromone production, aggregation on host trees and larval development. Furthermore, the compatibility of jack pine chemistry maintains beneficial interactions between MPB and its microbial symbionts. Second, compared with historical hosts, the novel host not only has lower concentrations of toxic and repellent defense chemicals, but also contains large concentrations of chemicals promoting host colonization by MPB. These patterns are especially pronounced when comparing novel hosts with well-defended historical hosts. Finally, before MPBs arrived in jack pine forests, they invaded a zone of hybrids of novel and historical hosts that likely improved beetle success on jack pine, as hybrids show chemical characteristics of both hosts. In conclusion, the phytochemistry of jack pine has likely facilitated the biological invasion of this novel host by MPB.},
}
@article {pmid30289888,
year = {2018},
author = {Feiner, ZS and Foley, CJ and Bootsma, HA and Czesny, SJ and Janssen, J and Rinchard, J and Höök, TO},
title = {Species identity matters when interpreting trophic markers in aquatic food webs.},
journal = {PloS one},
volume = {13},
number = {10},
pages = {e0204767},
pmid = {30289888},
issn = {1932-6203},
abstract = {In aquatic systems, food web linkages are often assessed using diet contents, stable isotope ratios, and, increasingly, fatty acid composition of organisms. Some correlations between different trophic metrics are assumed to be well-supported; for example, particular stable isotope ratios and fatty acids seem to reflect reliance on benthic or pelagic energy pathways. However, understanding whether the assumed correlations between different trophic metrics are coherent and consistent across species represents a key step toward their effective use in food web studies. To assess links among trophic markers, we compared relationships between major diet components, fatty acids, and stable isotope ratios in three fishes: yellow perch (Perca flavescens), round goby (Neogobius melanostomus), and spottail shiner (Notropis hudsonius) collected from nearshore Lake Michigan. Yellow perch and spottail shiner are native in this system, while round goby are a relatively recent invader. We found some evidence for agreement between different trophic metrics, especially between diet components, n-3:n-6 fatty acid ratios, and stable isotope ratios (δ13C and δ15N). However, we also observed significant variation in observed relationships among markers and species, potentially due to taxonomic variation in the specific diet items consumed (e.g., chydorid microcrustaceans and Dreissena mussels) and species-specific biochemical processes. In many of these latter cases, the invasive species differed from the native species. Understanding the effects of taxonomic variation on prey and predator signatures could significantly improve the usefulness of fatty acids in food web studies, whereas diet contents and stable isotopes appear to be reliable indicators of trophic niche in aquatic food webs.},
}
@article {pmid30289566,
year = {2018},
author = {Latombe, G and Richardson, DM and Pyšek, P and Kučera, T and Hui, C},
title = {Drivers of species turnover vary with species commonness for native and alien plants with different residence times.},
journal = {Ecology},
volume = {99},
number = {12},
pages = {2763-2775},
doi = {10.1002/ecy.2528},
pmid = {30289566},
issn = {0012-9658},
support = {109683//National Research Foundation/ ; 89967//National Research Foundation/ ; 67985939//Stellenbosch University Subcommittee B/ ; DP150103017//Australian Research Council/ ; 85417//DST-NRF Centre of Excellence for Invasion Biology/ ; 14-36079G//Centre of Excellence PLADIAS/ ; 67985939//Czech Academy of Sciences/ ; },
abstract = {Communities comprising alien species with different residence times are natural experiments allowing the assessment of drivers of community assembly over time. Stochastic processes (such as dispersal and fluctuating environments) should be the dominant factors structuring communities of exotic species with short residence times. In contrast, communities should become more similar, or systematically diverge, if they contain exotics with increasing resident times, due to the increasing importance of deterministic processes (such as environmental filtering). We use zeta diversity (the number of species shared by multiple assemblages) to explore the relationship between the turnover of native species and two categories of alien species with different residence times (archaeophytes [introduced between 4000 BC and 1500 AD] and neophytes [introduced after 1500 AD]) in a network of nature reserves in central Europe. By considering multiple assemblages simultaneously, zeta diversity allows us to determine the contribution of rare and widespread species to turnover. Specifically, we explore the relative effects of assembly processes representing isolation by distance, environmental filtering, and environmental stochasticity (fluctuating environments) on zeta diversity using Multi-Site Generalized Dissimilarity Modelling (MS-GDM). Four clusters of results emerged. First, stochastic processes for structuring plant assemblages decreased in importance with increasing residence time. Environmental stochasticity only affected species composition for neophytes, offering possibilities to predict the spread debt of recent invasions. Second, native species turnover was well explained by environmental filtering and isolation by distance, although these factors did not explain the turnover of archaeophytes and neophytes. Third, native and alien species compositions were only correlated for rare species, whereas turnover in widespread alien species was surprisingly unrelated to the composition of widespread native species. Site-specific approaches would therefore be more appropriate for the monitoring and management of rare alien species, whereas species-specific approaches would suit widespread species. Finally, the size difference of nature reserves influences not only native species richness, but also their richness-independent turnover. A network of reserves must therefore be designed and managed using a variety of approaches to enhance native diversity, while controlling alien species with different residence times and degrees of commonness.},
}
@article {pmid30289505,
year = {2019},
author = {Bin, S and Pu, X and Shu, B and Kang, C and Luo, S and Tang, Y and Wu, Z and Lin, J},
title = {Selection of Reference Genes for Optimal Normalization of Quantitative Real-Time Polymerase Chain Reaction Results for Diaphorina citri Adults.},
journal = {Journal of economic entomology},
volume = {112},
number = {1},
pages = {355-363},
doi = {10.1093/jee/toy297},
pmid = {30289505},
issn = {1938-291X},
abstract = {The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), can cause direct damage to citrus trees and is the main vector for the devastating disease, citrus greening disease or huanglongbing. Most molecular studies on this important insect pest use real-time reverse-transcription quantitative polymerase chain reaction (RT-qPCR) to quantify gene expression, including analyzing molecular basis for insecticide resistance in field populations. One critical factor to cause inaccuracy in RT-qPCR results is the lack of appropriate internal reference genes for optimal data normalization. In this study, the expression levels of 10 selected reference genes were evaluated in different tissue samples of psyllid adults and in the insects treated with different temperatures and insecticides. Data were analyzed using different computational algorithms, including Delta Ct, BestKeeper, NormFinder, geNorm, and RefFinder. According to our results, at least two reference genes should be used for the normalization of RT-qPCR data in this insect. The best choices of reference genes for different samples are as follows: ACT1 and Ferritin for different tissue samples, RPS20 and Ferritin for samples treated with different temperatures, TBP and EF1α for samples treated with imidacloprid, and Ferritin and TBP for samples treated with beta-cypermethrin. The reference genes identified in this study should be useful for future studies to analyze the expression patterns of target genes, especially for genes linked with temperature adaptability and insecticide resistance in this insect species in the future.},
}
@article {pmid30287274,
year = {2018},
author = {Thomas, JR and Fisher, J and Cable, J and Griffiths, SW},
title = {Terrestrial dispersal of invasive signal crayfish during vulnerable life stages.},
journal = {Behavioural processes},
volume = {157},
number = {},
pages = {204-207},
doi = {10.1016/j.beproc.2018.09.014},
pmid = {30287274},
issn = {1872-8308},
mesh = {Animal Distribution ; *Animal Migration ; Animals ; Astacoidea/*growth &amp; development ; Ecosystem ; Female ; *Introduced Species ; },
abstract = {1. Aquatic invertebrates commonly disperse between waterbodies by flight, though some decapods can emigrate from the water and walk overland. 2. The signal crayfish (Pacifastacus leniusculus, Dana) is a highly invasive species that can survive for days to weeks out of water, though it is unclear to what extent vulnerable life stages, such as ovigerous females or juvenile crayfish, terrestrially emigrate. Understanding this behaviour is important to consider during the management of crayfish stocks, since a single ovigerous female could potentially introduce hundreds of hatchlings to a new waterbody, which could themselves disperse overland. 3. Here, in a laboratory study, we examined the terrestrial emigration tendency of juvenile crayfish and compared the terrestrial emigration behaviour and overland walking speed of ovigerous and non-ovigerous females. 4. Size had a significant influence on juvenile crayfish terrestrial emigration tendency, where only those larger than 16.6 mm (carapace length) left the water. Ovigerous and non-ovigerous female signal crayfish showed no significant difference in terrestrial emigration tendency nor overland walking speed. 5. This is the first study to directly examine the terrestrial emigration behaviour of crayfish during these different life stages. These findings highlight the importance of considering animal behaviour during management strategies.},
}
@article {pmid30286406,
year = {2018},
author = {Zagorchev, L and Albanova, I and Tosheva, A and Li, J and Teofanova, D},
title = {Salinity effect on Cuscuta campestris Yunck. Parasitism on Arabidopsis thaliana L.},
journal = {Plant physiology and biochemistry : PPB},
volume = {132},
number = {},
pages = {408-414},
doi = {10.1016/j.plaphy.2018.09.037},
pmid = {30286406},
issn = {1873-2690},
mesh = {Analysis of Variance ; Antioxidants/pharmacology ; Arabidopsis/drug effects/enzymology/growth &amp; development/*parasitology ; Catalase/metabolism ; Cuscuta/drug effects/growth &amp; development/*physiology ; Host-Parasite Interactions/physiology ; Peroxidase/metabolism ; Proline/metabolism ; *Salinity ; Sodium Chloride/pharmacology ; Superoxide Dismutase/metabolism ; },
abstract = {Stem holoparasitic flowering plants of the genus Cuscuta are globally distributed invasive species and agricultural pests. The present research represents the combined effect of salt stress (e.g. abiotic stress) and Cuscuta campestris infection (e.g. biotic stress) on the model host plant Arabidopsis thaliana and the response of the parasite to salinity. The response of these parasites to abiotic stress conditions including salinity is poorly studied. Arabidopsis plants were continuously irrigated with 0, 50 and 150 mM NaCl and subjected to C. campestris infection. The influence of both abiotic and biotic stresses on the major osmoprotectant L-proline and three antioxidant enzymes - catalase, superoxide dismutase and guaiacol peroxidase, was assessed in both the parasite and the host plant. All four biochemical markers were differentially affected by stress, showing that the influence of C. campestris parasitism and its interaction with salinity is mostly in the site of infection (direct response) and also in roots (indirect vertical response) rather than on non-infected leaves of infected plants (indirect horizontal response). Despite its absence of soil contact, C. campestris was also significantly affected by salinity (indirect response). The mutual adaptation of the parasite-host pair to salinity slightly altered the regular response to abiotic stress of A. thaliana, but no detrimental additive effect of biotic and abiotic stress was observed.},
}
@article {pmid30286358,
year = {2019},
author = {Anastácio, PM and Ribeiro, F and Capinha, C and Banha, F and Gama, M and Filipe, AF and Rebelo, R and Sousa, R},
title = {Non-native freshwater fauna in Portugal: A review.},
journal = {The Science of the total environment},
volume = {650},
number = {Pt 2},
pages = {1923-1934},
doi = {10.1016/j.scitotenv.2018.09.251},
pmid = {30286358},
issn = {1879-1026},
mesh = {*Animal Distribution ; Animals ; Aquatic Organisms ; Fresh Water ; *Introduced Species ; *Invertebrates ; Portugal ; *Vertebrates ; },
abstract = {We present the most updated list of non-native freshwater fauna established in Portugal, including the Azores and Madeira archipelagos. This list includes 67 species at national level but corresponds to 84 species records, of which 53 are in the mainland, 23 in the Azores and 8 in Madeira archipelagos. We also discuss the progression of the cumulative number of introductions since 1800 and identify the most probable vectors of introduction, main taxonomic groups and their regions of origin. Furthermore, we review the existing knowledge about ecological and economic impacts, invasion risk and potential distribution of invaders, under present and future climatic conditions, and the applied management actions, including the production of legislation. Along the 20th century the number of successful introductions increased at an approximate rate of two new species per decade until the beginning of 1970s. Since then, this rate increased to about 14 new species per decade. These introductions were mainly a result of fisheries, as contaminants or for ornamental purposes. Fish and mollusks are the taxonomic groups with more established species, representing more than half of the total. Most species (>70%) are native from other regions of Europe and North America. Studies about ecological or socioeconomic impacts are more common for fish, crustaceans and mollusks. Impacts for most amphibians, reptiles and mammals are not thoroughly studied. A few studies on the impacts and management actions of health-threatening mosquitoes are also available. The potential distribution in the Portuguese territory was modelled for 26 species. Only a minority of these models provides projections of distributions under scenarios of future climate change. A comparison of the Portuguese and EU legislation shows large discrepancies in the invasive species lists. Using the EU list and a ranking procedure for the national context, we identify freshwater species of high national concern for which actions are urgently needed.},
}
@article {pmid30286346,
year = {2019},
author = {Peters, K and Sink, KJ and Robinson, TB},
title = {Sampling methods and approaches to inform standardized detection of marine alien fouling species on recreational vessels.},
journal = {Journal of environmental management},
volume = {230},
number = {},
pages = {159-167},
doi = {10.1016/j.jenvman.2018.09.063},
pmid = {30286346},
issn = {1095-8630},
abstract = {Recreational vessels are important contributors to the spread of marine alien species, particularly in relation to secondary spread within novel regions. As such, these vessels should be considered a monitoring priority. The aim of this study was to identify a preferred method for monitoring recreational vessels for alien species, while simultaneously developing a framework that enables managers to objectively choose the most effective sampling approach given their financial constraints. Divers and a remotely operated vehicle (ROV) were considered in relation to four sampling approaches i.e. meanders, transects, inspection of niche areas and the collection of quadrats. Each was applied to the same 53 vessels which represented a spectrum of hull fouling cover. The most effective methods were diver scrape quadrats (Range of alien species numbers per quadrat: 0-9, Total alien species: 20) and inspections of niche areas (Range of alien species numbers: 0-5, Total alien species: 9). All methods employed using an ROV had low efficacy and incurred high costs. While scrape samples were one of the most expensive methods, this was offset by the lowest cost per species detected. Thus, it is recommended that monitoring programmes utilize scrape samples and niche area inspections, but when faced with financial constraints, diver meanders and niche inspections offer sound alternatives for detecting alien species.},
}
@article {pmid30286323,
year = {2018},
author = {Fenollosa, E and Gámez, A and Munné-Bosch, S},
title = {Plasticity in the hormonal response to cold stress in the invasive plant Carpobrotus edulis.},
journal = {Journal of plant physiology},
volume = {231},
number = {},
pages = {202-209},
doi = {10.1016/j.jplph.2018.09.009},
pmid = {30286323},
issn = {1618-1328},
mesh = {Aizoaceae/*metabolism/physiology ; Chlorophyll/metabolism ; Cold Temperature ; Cold-Shock Response ; Introduced Species ; Lipid Peroxidation ; Melatonin/metabolism/physiology ; Plant Growth Regulators/*metabolism/physiology ; Plant Leaves/metabolism ; },
abstract = {Cold stress response is mediated by multiple signaling pathways with complex interactions, among which phytohormones may play a role. We explored changes in the contents of phytohormones, including abscisic acid, jasmonic acid, salicylic acid, auxin, cytokinins, gibberellins and melatonin, along with stress tolerance markers in an invasive halophyte, Carpobrotus edulis in response to chilling. In a first experiment, plants were exposed to mean daily temperatures from 10 °C to 5 °C during a cold wave in an experimental garden. In a second experiment, plants were subject to slowly decreasing temperatures, from 20 to 5 °C, in a climatic chamber. Although the cold response in both experiments was associated with a similar extent of leaf desiccation, hormonal variations differed. Cold stress reduced melatonin contents, while it increased salicylic acid contents in the experimental garden. Rather, transient increases in the contents of melatonin occurred in parallel with sustained increases in the contents of abscisic acid and cytokinins in the climatic chamber. In both experiments, plants were able to prevent cold-induced increases in lipid peroxidation and any eventual damage to the photosynthetic apparatus. We conclude that (i) the hormonal response to chilling in C. edulis is strongly dependent on time exposure to low temperatures, severity of stress, as well as other environmental conditions, (ii) the hormonal response of this plant species to low temperatures is very plastic, thus underlining its great capacity for cold acclimation.},
}
@article {pmid30285713,
year = {2018},
author = {Omokhua, AG and Abdalla, MA and Van Staden, J and McGaw, LJ},
title = {A comprehensive study of the potential phytomedicinal use and toxicity of invasive Tithonia species in South Africa.},
journal = {BMC complementary and alternative medicine},
volume = {18},
number = {1},
pages = {272},
pmid = {30285713},
issn = {1472-6882},
mesh = {Animals ; Anti-Infective Agents/*chemistry/*pharmacology/toxicity ; Asteraceae/*chemistry ; Bacteria/drug effects ; Cell Survival/drug effects ; Cercopithecus aethiops ; Chromatography, High Pressure Liquid ; Fungi/drug effects/growth &amp; development ; Introduced Species ; Mass Spectrometry ; Molecular Structure ; Plant Extracts/*chemistry/*pharmacology/toxicity ; South Africa ; Vero Cells ; },
abstract = {BACKGROUND: Tithonia diversifolia and T. rotundifolia belong to the Asteraceae family and are native to Mexico and Central America. These plants have become invasive in parts of tropical Africa and Asia where they have become an ecological, agricultural and economic burden. Tithonia diversifolia is exploited by locals in its native and most parts of its invasive range as a source of medicines; however, T. rotundifolia is only used for medicinal purposes in one country in the native range (Venezuela) and none in the invasive range. Although T. diversifolia has been studied for different biological activities, little or no attention has been given to T. rotundifolia. This study compared the antimicrobial activity, phytochemistry, identification of bioactive compound(s) and toxicity levels of different leaf extracts and fractions of T. diversifolia and T. rotundifolia.<br><br>METHODS: Antimicrobial activity was evaluated against seven pathogenic bacteria, four non-pathogenic Mycobacterium species and three fungal species using serial microdilution assays. Phytochemical contents were determined through standard methods of analysis. UPLC/MS was used to analyse the fractions to identify possible bioactive compounds that may be responsible for bioactivity, while toxicity tests were carried out using the colorimetric MTT assay and the Ames test.<br><br>RESULTS: Both species had a range of antimicrobial activity against bacterial, mycobacterial and fungal species. However, T. rotundifolia displayed better activity against most of the strains tested with minimum inhibitory concentration values ranging between 0.01 and 0.07 mg/ml. Both species were rich in phenolics, flavonoids and tannins. Tagitinin A was identified as the main compound present in both species, and this compound may be responsible for the antimicrobial activity displayed. Toxicity tests showed that T. diversifolia was cytotoxic at concentrations used in this study, while T. rotundifolia was not. Both species did not show any mutagenic/genotoxic effects.<br><br>CONCLUSION: The above results suggest that both species may be further developed as a source of antimicrobials for the treatment of infections caused by opportunistic pathogens. They may also serve as alternatives to highly exploited plant species with the same medicinal properties. However, T. diversifolia should be used with caution as it may be toxic.},
}
@article {pmid30285491,
year = {2019},
author = {Athanassiou, CG and Phillips, TW and Wakil, W},
title = {Biology and Control of the Khapra Beetle, Trogoderma granarium, a Major Quarantine Threat to Global Food Security.},
journal = {Annual review of entomology},
volume = {64},
number = {},
pages = {131-148},
doi = {10.1146/annurev-ento-011118-111804},
pmid = {30285491},
issn = {1545-4487},
abstract = {The khapra beetle, Trogoderma granarium, is a voracious feeder of stored products and is considered one of the most important quarantine pests globally. Its ability to survive for long periods under extreme conditions facilitates its spread through international commerce, which has led to invasions of new geographic regions. The khapra beetle is an important quarantine pest for many countries, including the major wheat-producing countries the United States, Canada, Russia, and Australia, and has been classified as one of the 100 worst invasive species worldwide. This species cannot always be controlled by insecticides and other nonchemical methods that are usually effective against other pests of stored products, particularly owing to its diapausing late larval stage. It can rapidly develop at elevated temperatures and under dry conditions, which are not favorable for many major stored-product insects. We synthesize key published work to draw attention to advances in biology, detection and control of the khapra beetle, and directions to consider for future research.},
}
@article {pmid30285303,
year = {2018},
author = {Gobin, J and Lester, NP and Fox, MG and Dunlop, ES},
title = {Ecological change alters the evolutionary response to harvest in a freshwater fish.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {28},
number = {8},
pages = {2175-2186},
doi = {10.1002/eap.1805},
pmid = {30285303},
issn = {1051-0761},
support = {//Great Lakes Fishery Commission/ ; },
abstract = {Harvesting can induce rapid evolution in animal populations, yet the role of ecological change in buffering or enhancing that response is poorly understood. Here, we developed an eco-genetic model to examine how ecological changes brought about by two notorious invasive species, zebra and quagga mussels, influence harvest-induced evolution and resilience in a freshwater fish. Our study focused on lake whitefish (Coregonus clupeaformis) in the Laurentian Great Lakes, where the species supports valuable commercial and subsistence fisheries, and where the invasion of dreissenid (zebra and quagga) mussels caused drastic shifts in ecosystem productivity. Using our model system, we predicted faster rates of evolution of maturation reaction norms in lake whitefish under pre-invasion ecosystem conditions when growth and recruitment of young to the population were high. Slower growth rates that occurred under post-invasion conditions delayed when fish became vulnerable to the fishery, thus decreasing selection pressure and lessening the evolutionary response to harvest. Fishing with gill nets and traps nets generally selected for early maturation at small sizes, except when fishing at low levels with small mesh gill nets under pre-invasion conditions; in this latter case, evolution of delayed maturation was predicted. Overall, the invasion of dreissenid mussels lessened the evolutionary response to harvest, while also reducing the productivity and commercial yield potential of the stock. These results demonstrate how ecological conditions shape evolutionary outcomes and how invasive species can have a direct effect on evolutionary responses to harvest and sustainability.},
}
@article {pmid30284151,
year = {2019},
author = {Giorgini, M and Guerrieri, E and Cascone, P and Gontijo, L},
title = {Current Strategies and Future Outlook for Managing the Neotropical Tomato Pest Tuta absoluta (Meyrick) in the Mediterranean Basin.},
journal = {Neotropical entomology},
volume = {48},
number = {1},
pages = {1-17},
doi = {10.1007/s13744-018-0636-1},
pmid = {30284151},
issn = {1678-8052},
support = {PIRSES-GA-2012-318246//FP7 People: Marie-Curie Actions/ ; FAMEPIG//Fundação de Amparo à Pesquisa do Estado de Minas Gerais(BR)/ ; },
abstract = {The invasion of new regions by exotic pests has been more than ever a critical issue that warrants coordinated international actions to manage established populations and prevent further spreading. Invasive insects can undermine the ecological equilibrium of both natural and agricultural ecosystems. Moreover, increasing temperatures due to climatic change exacerbate this problem by allowing pests to further reach regions previously considered unsuitable. The tomato pinworm Tuta absoluta (Meyrick) (Lepidoptera) is an exotic pest native to Peru that has spread beyond Neotropical America. In Europe, its occurrence was reported in Spain in 2006, and thereafter, it has spread throughout the Mediterranean Basin and further into Africa and part of Asia. While T. absoluta can cause losses to tomato production all over the globe, the differences in each invaded region (e.g., climate, vegetation) may affect its population dynamics and, consequently, management protocols. Therefore, the main intent of this forum paper is to explore how European growers and researchers are dealing with T. absoluta in the Mediterranean area. As for many other invasive pests, the best approach has been the adoption of integrated pest management (IPM). Specifically, the integration of biological control agents (e.g., mirid predators and egg parasitoids), microbial insecticides (i.e., Bacillus thuringiensis), selective chemical insecticides, and sex pheromone-based control has proven adequate, especially in tomato greenhouses. Nonetheless, some of the challenges ahead include the development of resistant tomato cultivars, the management of wild vegetation and companion plants to optimize the conservation of natural enemies and their effectiveness at the crop level, the management of insecticide resistance, and the improvement of sex pheromone-based tactics.},
}
@article {pmid30283654,
year = {2017},
author = {Mandeville, EG and Parchman, TL and Thompson, KG and Compton, RI and Gelwicks, KR and Song, SJ and Buerkle, CA},
title = {Inconsistent reproductive isolation revealed by interactions between Catostomus fish species.},
journal = {Evolution letters},
volume = {1},
number = {5},
pages = {255-268},
pmid = {30283654},
issn = {2056-3744},
abstract = {Interactions between species are central to evolution and ecology, but we do not know enough about how outcomes of interactions between species vary across geographic locations, in heterogeneous environments, or over time. Ecological dimensions of interactions between species are known to vary, but evolutionary interactions such as the establishment and maintenance of reproductive isolation are often assumed to be consistent across instances of an interaction between species. Hybridization among Catostomus fish species occurs over a large and heterogeneous geographic area and across taxa with distinct evolutionary histories, which allows us to assess consistency in species interactions. We analyzed hybridization among six Catostomus species across the Upper Colorado River basin (US mountain west) and found extreme variation in hybridization across locations. Different hybrid crosses were present in different locations, despite similar species assemblages. Within hybrid crosses, hybridization varied from only first generation hybrids to extensive hybridization with backcrossing. Variation in hybridization outcomes might result from uneven fitness of hybrids across locations, polymorphism in genetic incompatibilities, chance, unidentified historical contingencies, or some combination thereof. Our results suggest caution in assuming that one or a few instances of hybridization represent all interactions between the focal species, as species interactions vary substantially across locations.},
}
@article {pmid30280038,
year = {2018},
author = {Egly, RM and Larson, ER},
title = {Distribution, habitat associations, and conservation status updates for the pilose crayfish Pacifastacus gambelii (Girard, 1852) and Snake River pilose crayfish Pacifastacus connectens (Faxon, 1914) of the western United States.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5668},
pmid = {30280038},
issn = {2167-8359},
abstract = {Our study evaluates the distribution, habitat associations, and current conservation status of the Snake River pilose crayfish Pacifastacus connectens (Faxon, 1914) and pilose crayfish Pacifastacus gambelii (Girard, 1852), two little-studied and data-deficient species endemic to the western United States. We first developed a species distribution model (SDM) for the pilose crayfishes based on their historical occurrence records using boosted regression trees and freshwater GIS data layers. We then sampled 163 sites in the summers of 2016 and 2017 within the distribution of these crayfishes, including 50 where these species were observed historically. We next compared our field results to modeled predictions of suitable habitat from the SDM. Our SDM predicted 73 sites (45%) we sampled as suitable for the pilose crayfishes, with a moderate AUC value of 0.824. The pilose crayfishes were generally predicted to occur in larger streams and rivers with less extreme upstream temperature and precipitation seasonality. We found the pilose crayfishes at only 20 (12%) of the 163 total sites we sampled, 14 (20%) of the 73 sites predicted as suitable for them by our SDM, and 12 (24%) of 50 historical sites that we sampled. We found the invasive virile crayfish Faxonius virilis (Hagen, 1870) at 22 sites total and 12 (24%) historical sites for the pilose crayfishes, and we found the &quot;native invader&quot; signal crayfish Pacifastacus leniusculus (Dana, 1852) at 29 sites total and 6 (12%) historical sites for the pilose crayfishes. We subsequently used a single classification tree to identify factors associated with our high rate of false positives for contemporary pilose crayfish distributions relative to our SDM. This classification tree identified the presence of invasive crayfishes, impairment of the benthic community, and sampling method as some of the factors differentiating false positives relative to true positives for the pilose crayfishes. Our study identified the historical distribution and habitat associations for P. connectens and P. gambelii using an SDM and contrasted this prediction to results of contemporary field sampling. We found that the pilose crayfishes have seemingly experienced substantial range declines, attributable to apparent displacement by invasive crayfishes and impairment or change to stream communities and habitat. We recommend increased conservation and management attention to P. connectens and P. gambelii in response to these findings.},
}
@article {pmid30280022,
year = {2018},
author = {Howard, BR and Barrios-O'Neill, D and Alexander, ME and Dick, JTA and Therriault, TW and Robinson, TB and Côté, IM},
title = {Functional responses of a cosmopolitan invader demonstrate intraspecific variability in consumer-resource dynamics.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5634},
pmid = {30280022},
issn = {2167-8359},
abstract = {Background: Variability in the ecological impacts of invasive species across their geographical ranges may decrease the accuracy of risk assessments. Comparative functional response analysis can be used to estimate invasive consumer-resource dynamics, explain impact variability, and thus potentially inform impact predictions. The European green crab (Carcinus maenas) has been introduced on multiple continents beyond its native range, although its ecological impacts appear to vary among populations and regions. Our aim was to test whether consumer-resource dynamics under standardized conditions are similarly variable across the current geographic distribution of green crab, and to identify correlated morphological features.<br><br>Methods: Crabs were collected from multiple populations within both native (Northern Ireland) and invasive regions (South Africa and Canada). Their functional responses to local mussels (Mytilus spp.) were tested. Attack rates and handling times were compared among green crab populations within each region, and among regions (Pacific Canada, Atlantic Canada, South Africa, and Northern Ireland). The effect of predator and prey morphology on prey consumption was investigated.<br><br>Results: Across regions, green crabs consumed prey according to a Type II (hyperbolic) functional response curve. Attack rates (i.e., the rate at which a predator finds and attacks prey), handling times and maximum feeding rates differed among regions. There was a trend toward higher attack rates in invasive than in native populations. Green crabs from Canada had lower handling times and thus higher maximum feeding rates than those from South Africa and Northern Ireland. Canadian and Northern Ireland crabs had significantly larger claws than South African crabs. Claw size was a more important predictor of the proportion of mussels killed than prey shell strength.<br><br>Discussion: The differences in functional response between regions reflect observed impacts of green crabs in the wild. This suggests that an understanding of consumer-resource dynamics (e.g., the per capita measure of predation), derived from simple, standardized experiments, might yield useful predictions of invader impacts across geographical ranges.},
}
@article {pmid30279632,
year = {2018},
author = {van Nieukerken, EJ and Gilrein, DO and Eiseman, CS},
title = {Stigmellamultispicata Rociene. &amp; Stonis, an Asian leafminer on Siberian elm, now widespread in eastern North America (Lepidoptera, Nepticulidae).},
journal = {ZooKeys},
volume = {},
number = {784},
pages = {95-125},
pmid = {30279632},
issn = {1313-2989},
abstract = {Stigmellamultispicata Rocienė &amp; Stonis, 2014, previously known from the single male holotype from Primorye, Russia, is reported as a new invasive species mining leaves of Siberian elm, Ulmuspumila L., in eastern North America. Both adults and leafmines have been reported from many sites as unidentified Nepticulidae since 2010. Crucial for the identification was a match of the DNA barcode of a single larva collected on Ulmuspumila in Beijing with adults from North America. The single larva constitutes a new record for China. Stigmellamultispicata is closely related to the European S.ulmivora (Fologne, 1860), feeding likewise on Ulmus, but differs in details of external morphology and genitalia, particularly in the female, where S.multispicata has a remarkable elongated narrow ovipositor, suitable for oviposition in underside hairy leaf vein axils, where all mines start. In North America S.multispicata is the only Ulmus-feeding nepticulid with green larvae. Currently the species is known from USA: Illinois, Indiana, Iowa, Maryland, Massachusetts, Minnesota, New York, Ohio, Tennessee, Wisconsin, and Canada: Ontario and Québec. In Sagaponack, on Long Island, New York, larvae have been reported to occur en masse on Siberian elms from at least two sites. The current distribution could be reconstructed thanks also to many online photographs from observation websites. The species is redescribed, with the first descriptions of female, larva, and leafmine, and compared with S.ulmivora, which is fully redescribed. The two native North American nepticulid Ulmus leafminers, S.apicialbella (Chambers, 1873) and Ectoedemiaulmella (Braun, 1912), are diagnosed and new provincial and state records are provided. A key to linear mines on Ulmus in North America is provided. We suspect that trade of live plants through nurseries played a role in the sudden spread of this invasive species.},
}
@article {pmid30279325,
year = {2018},
author = {Mills, NJ},
title = {An Alternative Perspective for the Theory of Biological Control.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040131},
pmid = {30279325},
issn = {2075-4450},
abstract = {Importation biological control represents the planned introduction of a specialist natural enemy from the region of origin of an invasive pest or weed. For this study, the author considered why attempts to develop a predictive theory for biological control have been misguided and what future directions might be more promising and effective. Despite considerable interest in the theory of consumer⁻resource population dynamics, such theory has contributed little to improvements in the success of biological control due to a focus on persistence and equilibrium dynamics rather than establishment and impact. A broader consideration of invasion biology in addition to population ecology offers new opportunities for a more inclusive theory of biological control that incorporates the demographic and genetic processes that more specifically address the establishment and impact of introduced natural enemies. The importance of propagule size and genetic variance for successful establishment, and of contributions to host population growth, relative population growth rates, interaction strength, and coevolution for suppression of host abundance are discussed as promising future directions for a theory of biological control.},
}
@article {pmid30278148,
year = {2018},
author = {Wood, SA and Pochon, X and Ming, W and von Ammon, U and Woods, C and Carter, M and Smith, M and Inglis, G and Zaiko, A},
title = {Considerations for incorporating real-time PCR assays into routine marine biosecurity surveillance programmes: a case study targeting the Mediterranean fanworm (Sabella spallanzanii) and club tunicate (Styela clava).},
journal = {Genome},
volume = {},
number = {},
pages = {1-10},
doi = {10.1139/gen-2018-0021},
pmid = {30278148},
issn = {1480-3321},
abstract = {Molecular techniques may provide effective tools to enhance marine biosecurity surveillance. Prior to routine implementation, evidence-based consideration of their benefits and limitations is needed. In this study, we assessed the efficiency and practicality of visual diver surveys and real-time PCR assays (targeting DNA and RNA) for detecting two marine invasive species whose infestation levels varied between species and location: Sabella spallanzanii and Styela clava. Filtered water samples (n = 171) were collected in parallel with dive surveys at two locations as part of the New Zealand Marine High Risk Site Surveillance programme: Nelson Harbour (27 sites) and Waitemata Harbour (30 sites). Diver surveys resulted in a greater number of detections compared to real-time PCR: S. clava - 21 versus 5 sites in Nelson, 6 versus 1 in Auckland; S. spallanzanii - 18 versus 10 in Auckland, no detections in Nelson. Occupancy modelling derived detection probabilities for the real-time PCR for S. clava were low (14%), compared to S. spallanzanii (66%). This could be related to abundances, or species-specific differences in DNA shedding. Only one RNA sample was positive, suggesting that most detections were from extracellular DNA or non-viable fragments. While molecular methods cannot yet replace visual observations, this study shows they provide useful complementary information.},
}
@article {pmid30275487,
year = {2018},
author = {de Moraes, LA and Muller, C and Bueno, RCOF and Santos, A and Bello, VH and De Marchi, BR and Watanabe, LFM and Marubayashi, JM and Santos, BR and Yuki, VA and Takada, HM and de Barros, DR and Neves, CG and da Silva, FN and Gonçalves, MJ and Ghanim, M and Boykin, L and Pavan, MA and Krause-Sakate, R},
title = {Distribution and phylogenetics of whiteflies and their endosymbiont relationships after the Mediterranean species invasion in Brazil.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {14589},
pmid = {30275487},
issn = {2045-2322},
abstract = {The Bemisia tabaci is a polyphagous insect and a successful vector of plant viruses. B. tabaci is a species complex and in Brazil native species from the New World (NW) group, as well as the invasive species, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) were reported. For better understanding the distribution of the different species four years after the Mediterranean species invasion in Brazil, whiteflies were collected from 237 locations throughout the country between the years of 2013 and 2017, species were identified and the facultative endosymbionts detected. The survey revealed that MEAM1 was the prevalent species found on major crops across Brazil. It is the only species present in North, Northwestern and Central Brazil and was associated with virus-infected plants. MED was found in five States from Southeast to South regions, infesting mainly ornamental plants and was not associated with virus-infected plants. The prevalent endosymbionts identified in MEAM1 were Hamiltonella and Rickettsia; and the mtCOI analysis revealed low genetic diversity for MEAM1. In contrast, several different endosymbionts were identified in MED including Hamiltonella, Rickettsia, Wolbachia and Arsenophonus; and two distinct genetic groups were found based on the mtCOI analysis. Monitoring the distribution of the whiteflies species in Brazil is essential for proper management of this pest.},
}
@article {pmid30274268,
year = {2018},
author = {Medlock, JM and Hansford, KM and Vaux, AGC and Cull, B and Gillingham, E and Leach, S},
title = {Assessment of the Public Health Threats Posed by Vector-Borne Disease in the United Kingdom (UK).},
journal = {International journal of environmental research and public health},
volume = {15},
number = {10},
pages = {},
pmid = {30274268},
issn = {1660-4601},
mesh = {Animals ; Communicable Diseases, Emerging/epidemiology/*transmission ; Dengue/*transmission ; Humans ; Insect Vectors/*virology ; Mosquito Vectors/*virology ; Population Surveillance ; Risk Factors ; Ticks/*virology ; United Kingdom/epidemiology ; },
abstract = {In recent years, the known distribution of vector-borne diseases in Europe has changed, with much new information also available now on the status of vectors in the United Kingdom (UK). For example, in 2016, the UK reported their first detection of the non-native mosquito Aedes albopictus, which is a known vector for dengue and chikungunya virus. In 2010, Culex modestus, a principal mosquito vector for West Nile virus was detected in large numbers in the Thames estuary. For tick-borne diseases, data on the changing distribution of the Lyme borreliosis tick vector, Ixodes ricinus, has recently been published, at a time when there has been an increase in the numbers of reported human cases of Lyme disease. This paper brings together the latest surveillance data and pertinent research on vector-borne disease in the UK, and its relevance to public health. It highlights the need for continued vector surveillance systems to monitor our native mosquito and tick fauna, as well as the need to expand surveillance for invasive species. It illustrates the importance of maintaining surveillance capacity that is sufficient to ensure accurate and timely disease risk assessment to help mitigate the UK's changing emerging infectious disease risks, especially in a time of climatic and environmental change and increasing global connectivity.},
}
@article {pmid30272116,
year = {2018},
author = {Banahene, N and Salem, SK and Faske, TM and Byrne, HM and Glackin, M and Agosta, SJ and Eckert, AJ and Grayson, KL and Thompson, LM},
title = {Thermal Sensitivity of Gypsy Moth (Lepidoptera: Erebidae) During Larval and Pupal Development.},
journal = {Environmental entomology},
volume = {47},
number = {6},
pages = {1623-1631},
doi = {10.1093/ee/nvy149},
pmid = {30272116},
issn = {1938-2936},
mesh = {Animals ; Female ; *Hot Temperature ; Larva/growth &amp; development ; Male ; Mortality ; Moths/*growth &amp; development ; Pupa/growth &amp; development ; },
abstract = {As global temperatures rise, thermal limits play an increasingly important role in determining the persistence and spread of invasive species. Gypsy moth (Lymantria dispar L. Lepidoptera: Erebidae) in North America provides an ideal system for studying the effect of high temperatures on invasive species performance. Here, we used fluctuating temperature regimes and exposed gypsy moth at specific points in development (first-fourth instar, pupa) to cycles of favorable (22-28°C) or high-temperature treatments (30-36°C, 32-38°C, 34-40°C) for either 2 or 7 d. We measured survival, growth, and prolonged effects of exposure on development time and pupal mass. Survival generally decreased as the experimental temperature treatment and duration of exposure increased for all instars and pupae, with a narrow threshold for lethal effects. In response to increasing temperature and magnified by longer exposure times, growth abruptly declined for third instars and development time increased for pupae. For those surviving the 2-d exposure treatment, development time to pupation increased for all instars, but we did not find consistent effects on final pupal mass. These negative effects of high temperature provide important data on the susceptibility of gypsy moth to heat at different points in development. This work improves our understanding of thermal limits to growth and development in gypsy moth and can aid in determining invasion potential under current and future climates.},
}
@article {pmid30271564,
year = {2018},
author = {Hunter, ME and Johnson, NA and Smith, BJ and Davis, MC and Butterfield, JSS and Snow, RW and Hart, KM},
title = {Cytonuclear discordance in the Florida Everglades invasive Burmese python (Python bivittatus) population reveals possible hybridization with the Indian python (P. molurus).},
journal = {Ecology and evolution},
volume = {8},
number = {17},
pages = {9034-9047},
pmid = {30271564},
issn = {2045-7758},
abstract = {The invasive Burmese python (Python bivittatus) has been reproducing in the Florida Everglades since the 1980s. These giant constrictor snakes have caused a precipitous decline in small mammal populations in southern Florida following escapes or releases from the commercial pet trade. To better understand the invasion pathway and genetic composition of the population, two mitochondrial (mtDNA) loci across 1,398 base pairs were sequenced on 426 snakes and 22 microsatellites were assessed on 389 snakes. Concatenated mtDNA sequences produced six haplotypes with an average nucleotide and haplotype diversity of π = 0.002 and h = 0.097, respectively. Samples collected in Florida from morphologically identified P. bivittatus snakes were similar to published cytochrome oxidase 1 and cytochrome b sequences from both P. bivittatus and Python molurus and were highly divergent (genetic distances of 5.4% and 4.3%, respectively). The average number of microsatellite alleles and expected heterozygosity were NA = 5.50 and HE = 0.60, respectively. Nuclear Bayesian assignment tests supported two genetically distinct groups and an admixed group, not geographically differentiated. The effective population size (NE = 315.1) was lower than expected for a population this large, but reflected the low genetic diversity overall. The patterns of genetic diversity between mtDNA and microsatellites were disparate, indicating nuclear introgression of separate mtDNA lineages corresponding to cytonuclear discordance. The introgression likely occurred prior to the invasion, but genetic information on the native range and commercial trade is needed for verification. Our finding that the Florida python population is comprised of distinct lineages suggests greater standing variation for adaptation and the potential for broader areas of suitable habitat in the invaded range.},
}
@article {pmid30270555,
year = {2018},
author = {Davidson, IC and Cott, GM and Devaney, JL and Simkanin, C},
title = {Differential effects of biological invasions on coastal blue carbon: A global review and meta-analysis.},
journal = {Global change biology},
volume = {24},
number = {11},
pages = {5218-5230},
doi = {10.1111/gcb.14426},
pmid = {30270555},
issn = {1365-2486},
mesh = {Animals ; Biodiversity ; Biomass ; *Carbon ; *Carbon Cycle ; Carbon Sequestration ; *Ecosystem ; Humans ; *Introduced Species ; Plants ; Poaceae ; Soil ; Wetlands ; },
abstract = {Human-caused shifts in carbon (C) cycling and biotic exchange are defining characteristics of the Anthropocene. In marine systems, saltmarsh, seagrass, and mangrove habitats-collectively known as &quot;blue carbon&quot; and coastal vegetated habitats (CVHs)-are a leading sequester of global C and increasingly impacted by exotic species invasions. There is growing interest in the effect of invasion by a diverse pool of exotic species on C storage and the implications for ecosystem-based management of these systems. In a global meta-analysis, we synthesized data from 104 papers that provided 345 comparisons of habitat-level response (plant and soil C storage) from paired invaded and uninvaded sites. We found an overall net effect of significantly higher C pools in invaded CVHs amounting to 40% (±16%) higher C storage than uninvaded habitat, but effects differed among types of invaders. Elevated C storage was driven by blue C-forming plant invaders (saltmarsh grasses, seagrasses, and mangrove trees) that intensify biomass per unit area, extend and elevate coastal wetlands, and convert coastal mudflats into C-rich vegetated habitat. Introduced animal and structurally distinct primary producers had significant negative effects on C pools, driven by herbivory, trampling, and native species displacement. The role of invasion manifested differently among habitat types, with significant C storage increases in saltmarshes, decreases in seagrass, and no significant effect in mangroves. There were also counter-directional effects by the same species in different systems or locations, which underscores the importance of combining data mining with analyses of mean effect sizes in meta-analyses. Our study provides a quantitative basis for understanding differential effects of invasion on blue C habitats and will inform conservation strategies that need to balance management decisions involving invasion, C storage, and a range of other marine biodiversity and habitat functions in these coastal systems.},
}
@article {pmid30269692,
year = {2018},
author = {Martinez-Sañudo, I and Mazzon, L and Simonato, M and Avtzis, D and Pujade-Villar, J and Faccoli, M},
title = {Tracking the origin and dispersal of the Asian chestnut gall wasp Dryocosmus kuriphilus Yasumatsu (Hymenoptera, Cynipidae) in Europe with molecular markers.},
journal = {Bulletin of entomological research},
volume = {},
number = {},
pages = {1-9},
doi = {10.1017/S000748531800069X},
pmid = {30269692},
issn = {1475-2670},
abstract = {The Asian chestnut gall wasp, Dryocosmus kuriphilus, is an invasive pest causing significant damage to chestnut trees (Castanea spp., Fagaceae). Originating from China, it has recently invaded a wide range of regions in Europe and North America. Understanding the population genetic structure of important invasive pests is very useful for improving the knowledge concerning routes of expansion and colonizing capacity. Despite its economic importance, limited attention has been given to D. kuriphilus origin and spread, or to its genetic structure. In this study, D. kuriphilus populations sampled in eight European countries were screened using both mitochondrial (cytochrome c oxidase subunit 1; COI) and nuclear (internal transcribed spacer 2; ITS2) sequences, and Amplified Fragment Length Polymorphism (AFLP) markers. The molecular markers COI and ITS2 highlighted the presence of a single haplotype in all the studied populations. The recorded mitochondrial haplotype was identical to one of the most widespread haplotypes occurring in the native area (China). AFLP results indicated that D. kuriphilus individuals belong to two genetically distinct clusters without any further geographic clustering. These results suggest that D. kuriphilus populations in Europe could be the result of a single introduction of a Chinese founder population characterized by two genetically distinct lineages that subsequently spread rapidly across Europe. However, the possibility that populations originated from multiple introductions of the same Chinese mitochondrial haplotype cannot be excluded. The reported results provide useful information concerning this invasive species, potentially facilitating integrated pest management.},
}
@article {pmid30269397,
year = {2018},
author = {Card, DC and Perry, BW and Adams, RH and Schield, DR and Young, AS and Andrew, AL and Jezkova, T and Pasquesi, GIM and Hales, NR and Walsh, MR and Rochford, MR and Mazzotti, FJ and Hart, KM and Hunter, ME and Castoe, TA},
title = {Novel ecological and climatic conditions drive rapid adaptation in invasive Florida Burmese pythons.},
journal = {Molecular ecology},
volume = {27},
number = {23},
pages = {4744-4757},
doi = {10.1111/mec.14885},
pmid = {30269397},
issn = {1365-294X},
support = {//Society for the Study of Evolution/ ; DEB-1501747//National Science Foundation/ ; },
abstract = {Invasive species provide powerful in situ experimental systems for studying evolution in response to selective pressures in novel habitats. While research has shown that phenotypic evolution can occur rapidly in nature, few examples exist of genomewide adaptation on short &quot;ecological&quot; timescales. Burmese pythons (Python molurus bivittatus) have become a successful and impactful invasive species in Florida over the last 30 years despite major freeze events that caused high python mortality. We sampled Florida Burmese pythons before and after a major freeze event in 2010 and found evidence for directional selection in genomic regions enriched for genes associated with thermosensation, behaviour and physiology. Several of these genes are linked to regenerative organ growth, an adaptive response that modulates organ size and function with feeding and fasting in pythons. Independent histological and functional genomic data sets provide additional layers of support for a contemporary shift in invasive Burmese python physiology. In the Florida population, a shift towards maintaining an active digestive system may be driven by the fitness benefits of maintaining higher metabolic rates and body temperature during freeze events. Our results suggest that a synergistic interaction between ecological and climatic selection pressures has driven adaptation in Florida Burmese pythons, demonstrating the often-overlooked potential of rapid adaptation to influence the success of invasive species.},
}
@article {pmid30267221,
year = {2019},
author = {van Riper, CJ and Browning, MHEM and Becker, D and Stewart, W and Suski, CD and Browning, L and Golebie, E},
title = {Human-Nature Relationships and Normative Beliefs Influence Behaviors that Reduce the Spread of Aquatic Invasive Species.},
journal = {Environmental management},
volume = {63},
number = {1},
pages = {69-79},
doi = {10.1007/s00267-018-1111-9},
pmid = {30267221},
issn = {1432-1009},
support = {1012211//National Institute of Food and Agriculture/ ; NGRREC-IP2016-25//National Great Rivers Research &amp; Education Center/ ; NGRREC-IP2016-2//National Great Rivers Research and Education Center/ ; },
abstract = {Human behaviors that contribute to the spread of aquatic invasive species are influenced by myriad social psychological factors that vary across contexts and populations. Understanding such behavior is crucial for forming successful management strategies that minimize environmental impacts while generating support and cooperation among stakeholders. We identify several reasons why recreational anglers and boaters make decisions that benefit the environment. Specifically, our study addresses the following objectives: (1) examine reported behaviors that minimize the spread of aquatic invasive species, (2) test the effects of social normative beliefs on reported behaviors, and (3) determine the role of human-nature relationships in explaining behavioral patterns. Drawing on a path model of the decisions made by respondents who completed an on-site survey at two nature-based case study sites in Illinois, we observed that reported behavior was positively influenced by normative beliefs about those behaviors and human-nature relationships. Specifically, the Participant in Nature and Partner with Nature orientations were positively and negatively correlated with norms, respectively. In turn, norms positively predicted reported stewardship behaviors. These findings advance research on the human dimensions of aquatic invasive species by providing insights on the role of stable psychological processes that shape behavior, while informing management decisions aimed at minimizing biological invasions in freshwater ecosystems.},
}
@article {pmid30262689,
year = {2018},
author = {Song, H and Zhang, YX and Yang, MJ and Sun, JC and Zhang, T and Wang, HY},
title = {Genome survey on invasive veined rapa whelk (Rapana venosa) and development of microsatellite loci on large scale.},
journal = {Journal of genetics},
volume = {97},
number = {4},
pages = {e79-e86},
pmid = {30262689},
issn = {0973-7731},
mesh = {Animals ; China ; Computational Biology ; Gastropoda/*genetics ; Genetic Variation ; Genome/*genetics ; *Genomics ; High-Throughput Nucleotide Sequencing ; Microsatellite Repeats/*genetics ; Polymorphism, Genetic ; Sequence Analysis, DNA ; },
abstract = {The veined rapa whelk (Rapana venosa) is an economically important gastropod in China, but is considered as an invasive species globally. Only a few studies have examined the R. venosa genome, a genomewide survey is necessary for improving our understanding of the genome structure and size of this organism. Microsatellite markers are powerful tools for characterizing germplasms, genetic diversity and kinship among individuals. The resultant data are applicable to breeding efforts in commercial aquaculture or for understanding invasion mechanisms. Here, we investigated the genome structure of R. venosa on an Illumina Hi-seq platform with ∼92× sequencing depth. We performed a K-mer analysis to estimate genome size, repeat sequences and heterozygosity. Clean reads were de novo assembled for the identification of simple-sequence repeat (SSR) loci that are suitable as markers. The estimated genome size of R. venosa was 2200.07 Mb, with a 1.41% heterozygosity rate and 67.04% repeats. We detected 5,477,450 simple-sequence repeats (SSRs), with 3,400,602 loci present as pure tandem repeats and 2,076,848 as compound motifs. We further selected and characterized 28 polymorphic markers in 78 individuals from Dandong, Laizhou, Weihai and Zhoushan in China. The range of alleles was 2-28 and the observed heterozygosity was 0.2857-0.8676. The data obtained from our genomic survey will aid the design of R. venosa whole-genome sequencing projects and advance the identification of SSR markers. Both these developments are valuable for further studies on ecological, evolutionary and genetic breeding in R. venosa.},
}
@article {pmid30260994,
year = {2018},
author = {Yackel Adams, AA and Lardner, B and Knox, AJ and Reed, RN},
title = {Inferring the absence of an incipient population during a rapid response for an invasive species.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0204302},
pmid = {30260994},
issn = {1932-6203},
abstract = {Successful eradication of invasives is facilitated by early detection and prompt onset of control. However, realizing or verifying that a colonization has occurred is difficult for cryptic species especially at low population densities. Responding to the capture or unconfirmed sighting of a cryptic invasive species, and the associated effort to determine if it indicates an incipient (small, localized) population or merely a lone colonizer, is costly and cannot continue indefinitely. However, insufficient detection effort risks erroneously concluding the species is not present, allowing the population to increase in size and expand its range. Evidence for an incipient population requires detection of ≥1 individual; its absence, on the other hand, must be inferred probabilistically. We use an actual rapid response incident and species-specific detection estimates tied to a known density to calculate the amount of effort (with non-sequential detections) necessary to assert, with a pre-defined confidence, that invasive brown treesnakes are absent from the search area under a wide range of hypothetical population densities. We illustrate that the amount of effort necessary to declare that a species is absent is substantial and increases with decreased individual detection probability, decreased density, and increased level of desired confidence about its absence. Such survey investment would be justified where the cost savings due to early detection are large. Our Poisson-based model application will allow managers to make informed decisions about how long to continue detection efforts, should no additional detections occur, and suggests that effort to do so is significantly higher than previously thought. While our model application informs how long to search to infer absence of an incipient population of brown treesnakes, the approach is sufficiently general to apply to other invasive species if density-dependent detection estimates are known or reliable surrogate estimates are available.},
}
@article {pmid30257421,
year = {2018},
author = {Rijal, J and Gyawaly, S},
title = {Characterizing Brown Marmorated Stink Bug Injury in Almond, a New Host Crop in California.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040126},
pmid = {30257421},
issn = {2075-4450},
support = {2016-51181-25409//U.S. Department of Agriculture/ ; NA//California Cling Peach Board/ ; },
abstract = {The brown marmorated stink bug, Halyomorpha halys (Stål), is an invasive species from Asia. This polyphagous, stink bug species has posed a serious production challenge in several crop species in the areas where established. The insect has spread to all the mainland states in the U.S. in about one and half decades after its first detection in Pennsylvania. The types of crops reported to have been infested by this stink bug have increased with its spread to new geographic locations. In this study, we report the first evidence of H. halys infestation in almond fruit in California. In Stanislaus County, an adult brown marmorated stink bug in an almond orchard was first observed in May 2017. The stink bug feeding on almond fruits caused excessive gumming to the developing fruits, and damage to the kernels along with typical necrotic feeding signs on the shell (endocarp) and hull (exocarp and pericarp) of the fruit at harvest. The infestation and damage by H. halys on almond warrants further research to develop Integrated Pest Management (IPM) strategies for this pest.},
}
@article {pmid30256998,
year = {2018},
author = {Sarles, L and Fassotte, B and Boullis, A and Lognay, G and Verhaeghe, A and Markó, I and Verheggen, FJ},
title = {Improving the Monitoring of the Walnut Husk Fly (Diptera: Tephritidae) Using Male-Produced Lactones.},
journal = {Journal of economic entomology},
volume = {111},
number = {5},
pages = {2032-2037},
doi = {10.1093/jee/toy169},
pmid = {30256998},
issn = {1938-291X},
abstract = {It is important to monitor fruit flies (Diptera: Tephritidae) efficiently to implement sustainable means of control. Attractants are often used to increase the efficiency of sticky traps deployed in orchards to monitor Lepidopterans, but remains to be developed to monitor fruit flies. Rhagoletis completa Cresson (Diptera: Tephritidae) is an invasive species in the walnut orchards of Europe, and is commonly monitored with yellow sticky traps. In this study, we collected the volatile compounds released by male and female R. completa, and identified two lactones released exclusively by males. We then formulated both lactones in long-lasting volatile dispensers, and we quantified their release rate over a 26-d period. Finally, during the entire period when female flies are present in the field, we compared the efficiency of the conventional monitoring method using unbaited yellow sticky traps with yellow sticky traps associated with a dispenser releasing both male-produced lactones. These assays were conducted in 54 walnut orchards in France, in 2017. The number of fruit flies caught with sticky traps associated with lactones dispensers was increased by up to 10 times each week. Lactone-baited traps also allowed earlier detection in the season. These field results are promising for R. completa monitoring. A complete chiral identification of these lactones should be performed along with a clarification of their role in the sexual communication of R. completa.},
}
@article {pmid30256668,
year = {2019},
author = {Lester, PJ and Beggs, JR},
title = {Invasion Success and Management Strategies for Social Vespula Wasps.},
journal = {Annual review of entomology},
volume = {64},
number = {},
pages = {51-71},
doi = {10.1146/annurev-ento-011118-111812},
pmid = {30256668},
issn = {1545-4487},
abstract = {Three species of Vespula have become invasive in Australia, Hawai'i, New Zealand, and North and South America and continue to spread. These social wasp species can achieve high nest densities, and their behavioral plasticity has led to substantial impacts on recipient communities. Ecologically, they affect all trophic levels, restructuring communities and altering resource flows. Economically, their main negative effect is associated with pollination and the apicultural industry. Climate change is likely to exacerbate their impacts in many regions. Introduced Vespula spp. likely experience some degree of enemy release from predators or parasites, although they are exposed to a wide range of microbial pathogens in both their native and introduced range. Toxic baits have been significantly improved over the last decade, enabling effective landscape-level control. Although investigated extensively, no effective biological control agents have yet been found. Emerging technologies such as gene drives are under consideration.},
}
@article {pmid30254612,
year = {2018},
author = {Schmidt, C and Morard, R and Romero, O and Kucera, M},
title = {Diverse Internal Symbiont Community in the Endosymbiotic Foraminifera Pararotalia calcariformata: Implications for Symbiont Shuffling Under Thermal Stress.},
journal = {Frontiers in microbiology},
volume = {9},
number = {},
pages = {2018},
pmid = {30254612},
issn = {1664-302X},
abstract = {Many shallow-water tropical and subtropical foraminifera engage in photosymbiosis with eukaryotic microalgae. Some of these foraminifera appear to harbor a diverse consortium of endosymbiotic algae within a single host. Such apparent ability to contain different symbionts could facilitate change in symbiont community composition (symbiont shuffling) and mediate the ecological success of the group in a changing environment. However, the discovery of the intra-individual symbiont diversity was thus far based on symbiont culturing, which provides strong constraints on the vitality of the identified algae but provides poor constraints on their initial abundance and thus functional relevance to the host. Here we analyze the algal symbiont diversity in Pararotalia calcariformata, a benthic foraminifera sampled at four stations, inside and outside of a thermal plume in the eastern Mediterranean coast of Israel. This species has recently invaded the Mediterranean, is unusually thermally tolerant and was described previously to host at least one different diatom symbiont than other symbiont-bearing foraminifera. Our results using genotyping and isolation of algae in culture medium, confirm multiple associations with different diatom species within the same individual. Both methods revealed spatially consistent symbiont associations and identified the most common symbiont as a pelagic diatom Minutocellus polymorphus. In one case, an alternative dominant symbiont, the diatom Navicula sp., was detected by genotyping. This diatom was the third most abundant species identified using standard algae culturing method. This method further revealed a spatially consistent pattern in symbiont diversity of a total of seventeen identified diatom species, across the studied localities. Collectively, these results indicate that P. calcariformata hosts a diverse consortium of diatom endosymbionts, where different members can become numerically dominant and thus functionally relevant in a changing environment.},
}
@article {pmid30253010,
year = {2019},
author = {Szabó, S and Peeters, ETHM and Várbíró, G and Borics, G and Lukács, BA},
title = {Phenotypic plasticity as a clue for invasion success of the submerged aquatic plant Elodea nuttallii.},
journal = {Plant biology (Stuttgart, Germany)},
volume = {21},
number = {1},
pages = {54-63},
doi = {10.1111/plb.12918},
pmid = {30253010},
issn = {1438-8677},
support = {GINOP-2.3.2-15-2016-00019/// ; PD120775//National Research, Development and Innovation Office - NKFIH, OTKA/ ; KH129520//National Research, Development and Innovation Office - NKFIH, OTKA/ ; FK127939//National Research, Development and Innovation Office - NKFIH, OTKA/ ; //New National Excellence Program of the Ministry of Human Capacities (UNKP Bolyai+)/ ; //Bolyai János Research Scholarship of the Hungarian Academy of Sciences/ ; },
mesh = {*Adaptation, Physiological ; Aquatic Organisms/*growth &amp; development/*physiology ; Hydrocharitaceae/*growth &amp; development/*physiology ; *Introduced Species ; Phenotype ; Plant Roots/anatomy &amp; histology ; Plant Shoots/growth &amp; development ; Principal Component Analysis ; },
abstract = {Two closely related alien submerged aquatic plants were introduced into Europe. The new invader (Elodea nuttallii) gradually displaced E. canadensis even at sites where the latter was well established. The aim of the study was to evaluate the combined effects of environmental factors on several phenotypic characteristics of the two Elodea species, and to relate these phenotypic characteristics to the invasion success of E. nuttallii over E. canadensis. In a factorial design, Elodea plants were grown in aquaria containing five different nitrogen concentrations and incubated at five different light intensities. We used six functional traits (apical shoot RGR), total shoot RGR, relative elongation, root length, lateral spread, branching degree) to measure the environmental response of the species. We calculated plasticity indices to express the phenotypic differences between species. Light and nitrogen jointly triggered the development of phenotypic characteristics that make E. nuttallii a more successful invader in eutrophic waters than E. canadensis. The stronger invader showed a wider range of phenotypic plasticity. The apical elongation was the main difference between the two species, with E. nuttallii being more than two times longer than E. canadensis. E. canadensis formed dense side shoots even under high shade and low nitrogen levels, whereas E. nuttallii required higher light and nitrogen levels. We found that under more eutrophic conditions, E. nuttallii reach the water surface sooner than E. canadensis and through intensive branching outcompetes all other plants including E. canadensis. Our findings support the theory that more successful invaders have wider phenotypic plasticity.},
}
@article {pmid30252975,
year = {2018},
author = {Reil, JB and Doorenweerd, C and San Jose, M and Sim, SB and Geib, SM and Rubinoff, D},
title = {Transpacific coalescent pathways of coconut rhinoceros beetle biotypes: Resistance to biological control catalyses resurgence of an old pest.},
journal = {Molecular ecology},
volume = {27},
number = {22},
pages = {4459-4474},
doi = {10.1111/mec.14879},
pmid = {30252975},
issn = {1365-294X},
support = {FY16 3.0392.03//USDA Farm Bill/ ; FY17 3.0497.01//USDA Farm Bill/ ; //ARCS Foundation/ ; //USDA National Institute of Food and Agriculture/ ; //Agriculture and Food Research Initiative/ ; 2017-67012-26087 (FY17-FY19)//Education and Literacy Initiative/ ; HAW00942-H//University of Hawaii at Manoa College of Tropical Agriculture and Human Resources and USDA Cooperative State Research, Education and Extension/ ; },
abstract = {Biological control agents have several advantages over chemical control for pest management, including the capability to restore ecosystem balance with minimal non-target effects and a lower propensity for targets to develop resistance. These factors are particularly important for invasive species control. The coconut rhinoceros beetle (Oryctes rhinoceros Linnaeus) is a major palm pest that invaded many Pacific islands in the early 20th century through human-mediated dispersal. Application of the Oryctes nudivirus in the 1960s successfully halted the beetle's first invasion wave and made it a textbook example of successful biological control. However, a recently discovered O. rhinoceros biotype that is resistant to the nudivirus appears to be correlated with a new invasion wave. We performed a population genomics analysis of 172 O. rhinoceros from seven regions, including native and invasive populations, to reconstruct invasion pathways and explore correlation between recent invasions and biotypes. With ddRAD sequencing, we generated data sets ranging from 4,000 to 209,000 loci using stacks and ipyrad software pipelines and compared genetic signal in downstream clustering and phylogenetic analyses. Analysis suggests that the O. rhinoceros resurgence is mediated by the nudivirus-resistant biotype. Genomic data have been proven essential to understanding the new O. rhinoceros biotype's invasion patterns and interactions with the original biotype. Such information is crucial to optimization of strategies for quarantine and control of resurgent pests. Our results demonstrate that while invasions are relatively rare events, new introductions can have significant ecological consequences, and quarantine vigilance is required even in previously invaded areas.},
}
@article {pmid30251412,
year = {2018},
author = {Pereira, L and Vasques, A and Maia, P and Pereira, MJR and Fonseca, C and Matos, M},
title = {Native and exotic seed dispersal by the stone marten (Martes foina Erxleben, 1777): implications for the regeneration of a relict climactic forest in central Portugal.},
journal = {Integrative zoology},
volume = {},
number = {},
pages = {},
doi = {10.1111/1749-4877.12362},
pmid = {30251412},
issn = {1749-4877},
abstract = {The stone marten (Martes foina, Erxleben, 1777) is a carnivorous mammal that often consumes fleshy fruits, thus potentially promoting seed dispersion. This study was developed in Bussaco National Forest, central Portugal, and aimed to assess the potential role of the stone marten in dispersing native and exotic plants in different forest landscapes types. Seeds from stone marten scats and fleshy fruits were collected monthly and were thereafter identified and sowed in a nursery, following a randomized experimental setup. Plant emergence was monitored fortnightly. Generalized Linear Models were used to test for differences in time and success of emergence between seeds from scats and fruits of three native species (Rubus ulmifolius, Arbutus unedo, Celtis australis) and one exotic plant species with invasive behaviour (Prunus laurocerasus). Fruit consumption by the stone marten significantly increased and accelerated the germination of the native R. ulmifolius but had no effect on the other two native species or on the invasive species. This suggested that stone martens contribute to gene flow and forest regeneration, by dispersing native plant seeds. However, though the germination was not enhanced in the invasive species, the preference of stone marten for these fruits may potentially contribute to the proliferation of P. laurocerasus. Our study represents a contribution to better understanding the fauna and flora interactions, enabling for a more conscious and effective decision-making in forest management. This article is protected by copyright. All rights reserved.},
}
@article {pmid30251329,
year = {2018},
author = {Buisson, E and Le Stradic, S and Silveira, FAO and Durigan, G and Overbeck, GE and Fidelis, A and Fernandes, GW and Bond, WJ and Hermann, JM and Mahy, G and Alvarado, ST and Zaloumis, NP and Veldman, JW},
title = {Resilience and restoration of tropical and subtropical grasslands, savannas, and grassy woodlands.},
journal = {Biological reviews of the Cambridge Philosophical Society},
volume = {},
number = {},
pages = {},
doi = {10.1111/brv.12470},
pmid = {30251329},
issn = {1469-185X},
support = {//French Embassy / UFMG Chairs 2015/ ; //CNRS PICS 2018-2020 [RESIGRASS]/ ; //Programme de mobilité entrante UAPV (Avignon Univ)/ ; 306170/2015-9, 310022/2015-0, 312292/2016-3, 477618/2013-8//CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico)/ ; //FAPEMIG/ ; #2015/06743-0, #2014/12337-2, #2014/12728-1, #2016/13232-5, #2017/14236-7, #2018/03755-6//FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo)/ ; 0950_20122//Fundação Boticário/ ; },
abstract = {Despite growing recognition of the conservation values of grassy biomes, our understanding of how to maintain and restore biodiverse tropical grasslands (including savannas and open-canopy grassy woodlands) remains limited. To incorporate grasslands into large-scale restoration efforts, we synthesised existing ecological knowledge of tropical grassland resilience and approaches to plant community restoration. Tropical grassland plant communities are resilient to, and often dependent on, the endogenous disturbances with which they evolved - frequent fires and native megafaunal herbivory. In stark contrast, tropical grasslands are extremely vulnerable to human-caused exogenous disturbances, particularly those that alter soils and destroy belowground biomass (e.g. tillage agriculture, surface mining); tropical grassland restoration after severe soil disturbances is expensive and rarely achieves management targets. Where grasslands have been degraded by altered disturbance regimes (e.g. fire exclusion), exotic plant invasions, or afforestation, restoration efforts can recreate vegetation structure (i.e. historical tree density and herbaceous ground cover), but species-diverse plant communities, including endemic species, are slow to recover. Complicating plant-community restoration efforts, many tropical grassland species, particularly those that invest in underground storage organs, are difficult to propagate and re-establish. To guide restoration decisions, we draw on the old-growth grassland concept, the novel ecosystem concept, and theory regarding tree cover along resource gradients in savannas to propose a conceptual framework that classifies tropical grasslands into three broad ecosystem states. These states are: (1) old-growth grasslands (i.e. ancient, biodiverse grassy ecosystems), where management should focus on the maintenance of disturbance regimes; (2) hybrid grasslands, where restoration should emphasise a return towards the old-growth state; and (3) novel ecosystems, where the magnitude of environmental change (i.e. a shift to an alternative ecosystem state) or the socioecological context preclude a return to historical conditions.},
}
@article {pmid30251252,
year = {2018},
author = {Baird, SE and Steel, AE and Cocherell, DE and Cech, JJ and Fangue, NA},
title = {Native Chinook salmon Oncorhynchus tshawytscha and non-native brook trout Salvelinus fontinalis prefer similar water temperatures.},
journal = {Journal of fish biology},
volume = {93},
number = {5},
pages = {1000-1004},
doi = {10.1111/jfb.13810},
pmid = {30251252},
issn = {1095-8649},
support = {2098-H//UC Davis Agricultural Experiment Station/ ; #2098-H to NAF//UC Davis Agricultural Experiment Station/ ; },
mesh = {Animals ; *Behavior, Animal ; California ; *Ecosystem ; Endangered Species ; Introduced Species ; Salmon/*physiology ; *Temperature ; Trout/*physiology ; Water ; },
abstract = {Preferred water temperatures and acute temperature tolerance limits of two salmonids in California were assessed: juvenile Chinook salmon Oncorhynchus tshawytscha, a native anadromous species, and sub-adult brook trout Salvelinus fontinalis, an introduced game species. These two species preferred similar temperatures across an 18 h temperature preference experiment and showed similar critical thermal tolerance limits, suggesting a substantial thermal habitat overlap in the wild.},
}
@article {pmid30250702,
year = {2018},
author = {Kesner, D and Kumschick, S},
title = {Gastropods alien to South Africa cause severe environmental harm in their global alien ranges across habitats.},
journal = {Ecology and evolution},
volume = {8},
number = {16},
pages = {8273-8285},
pmid = {30250702},
issn = {2045-7758},
abstract = {Alien gastropods have caused extensive harm to biodiversity and socioeconomic systems like agriculture and horticulture worldwide. For conservation and management purposes, information on impacts needs to be easily interpretable and comparable, and the factors that determine impacts understood. This study aimed to assess gastropods alien to South Africa to compare impact severity between species and understand how they vary between habitats and mechanisms. Furthermore, we explore the relationship between environmental and socioeconomic impacts, and both impact measures with life-history traits. We used the Environmental Impact Classification for Alien Taxa (EICAT) and Socio-Economic Impact Classification for Alien Taxa (SEICAT) to assess impacts of 34 gastropods alien to South Africa including evidence of impact from their entire alien range. We tested for correlations between environmental and socioeconomic impacts per species, and with fecundity and native latitude range using Kendall's tau tests. Kruskal-Wallis tests were used to compare impact magnitude among mechanisms and habitats, respectively. This study presents the first application of EICAT and SEICAT for invertebrates. There was no correlation between environmental impacts and socioeconomic impacts. Habitats did not differ regarding the severity of impacts recorded, but impacts via disease transmission were lower than other mechanisms. Neither fecundity nor native range latitude was correlated with impact magnitude. Despite gastropods being agricultural and horticultural pests globally, resilience of socioeconomic systems makes high impacts uncommon. Environmental systems may be vulnerable to gastropod impacts across habitats, having experienced multiple local extinctions of wetland island snail fauna. South Africa stands out as the only continental country that follows this trend. The knowledge gained on severity and nature of gastropod impacts is useful in risk assessment, which can aid conservation management. To make impact assessments more realistic, we suggest alternative ways of reporting impacts classified under EICAT and SEICAT.},
}
@article {pmid30250163,
year = {2018},
author = {Cuthbert, RN and Dalu, T and Wasserman, RJ and Dick, JTA and Mofu, L and Callaghan, A and Weyl, OLF},
title = {Intermediate predator naïveté and sex-skewed vulnerability predict the impact of an invasive higher predator.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {14282},
pmid = {30250163},
issn = {2045-2322},
abstract = {The spread of invasive species continues to reduce biodiversity across all regions and habitat types globally. However, invader impact prediction can be nebulous, and approaches often fail to integrate coupled direct and indirect invader effects. Here, we examine the ecological impacts of an invasive higher predator on lower trophic groups, further developing methodologies to more holistically quantify invader impact. We employ functional response (FR, resource use under different densities) and prey switching experiments to examine the trait- and density-mediated impacts of the invasive mosquitofish Gambusia affinis on an endemic intermediate predator Lovenula raynerae (Copepoda). Lovenula raynerae effectively consumed larval mosquitoes, but was naïve to mosquitofish cues, with attack rates and handling times of the intermediate predator unaffected by mosquitofish cue-treated water. Mosquitofish did not switch between male and female prey, consistently displaying a strong preference for female copepods. We thus demonstrate a lack of risk-reduction activity in the presence of invasive fish by L. raynerae and, in turn, high susceptibility of such intermediate trophic groups to invader impact. Further, we show that mosquitofish demonstrate sex-skewed predator selectivity towards intermediate predators of mosquito larvae, which may affect predator population demographics and, perversely, increase disease vector proliferations. We advocate the utility of FRs and prey switching combined to holistically quantify invasive species impact potential on native organisms at multiple trophic levels.},
}
@article {pmid30250047,
year = {2018},
author = {Corrales, X and Coll, M and Ofir, E and Heymans, JJ and Steenbeek, J and Goren, M and Edelist, D and Gal, G},
title = {Future scenarios of marine resources and ecosystem conditions in the Eastern Mediterranean under the impacts of fishing, alien species and sea warming.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {14284},
pmid = {30250047},
issn = {2045-2322},
abstract = {Using a temporal-dynamic calibrated Ecosim food web model, we assess the effects of future changes on marine resources and ecosystem conditions of the Israeli Mediterranean continental shelf. This region has been intensely invaded by Indo-Pacific species. The region is exposed to extreme environmental conditions, is subjected to high rates of climate change and has experienced intense fishing pressure. We test the impacts of a new set of fishing regulations currently being implemented, a continued increase in sea temperatures following IPCC projections, and a continued increase in alien species biomass. We first investigate the impacts of the stressors separately, and then we combine them to evaluate their cumulative effects. Our results show overall potential future benefits of fishing effort reductions, and detrimental impacts of increasing sea temperature and increasing biomass of alien species. Cumulative scenarios suggest that the beneficial effects of fisheries reduction may be dampened by the impact of increasing sea temperature and alien species when acting together. These results illustrate the importance of including stressors other than fisheries, such as climate change and biological invasions, in an ecosystem-based management approach. These results support the need for reducing local and regional stressors, such as fishing and biological invasions, in order to promote resilience to sea warming.},
}
@article {pmid30249994,
year = {2018},
author = {Briem, F and Dominic, AR and Golla, B and Hoffmann, C and Englert, C and Herz, A and Vogt, H},
title = {Explorative Data Analysis of Drosophila suzukii Trap Catches from a Seven-Year Monitoring Program in Southwest Germany.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040125},
pmid = {30249994},
issn = {2075-4450},
support = {OW 1188//Bundesministerium für Ernährung und Landwirtschaft/ ; },
abstract = {Over the last decade, Drosophila suzukii Matsumura, an invasive pest of soft-skinned fruits, gradually established itself in Europe, often resulting in significant economic losses. In 2011, when D. suzukii was first described for Germany, the Julius Kühn Institut (JKI) started a monitoring program in southwest Germany to study the occurrence and activity of the fly. Capture data from late 2011⁻early 2018 from 100 traps were analyzed for the effect of weather and immediate habitat on trap captures at different times of the year. We identified five phases in the annual population development cycle of D. suzukii. We found that the mild winter of 2013/2014 helped the thorough establishment of D. suzukii in Germany. Habitat types in the immediate vicinity of the trap and local weather conditions had a strong influence on trap captures. Forest borders and hedges were found to provide adequate overwintering shelter for the flies. Trap captures in forests and hedges were generally higher than those of vineyards and orchards, even during the fruiting seasons. Summer capture rates were correlated with the number of heat days and precipitation. We also discuss briefly the limitations of using trap captures as representative of fly density in the field.},
}
@article {pmid30248110,
year = {2018},
author = {Wilson Rankin, EE and Knowlton, JL and Gruner, DS and Flaspohler, DJ and Giardina, CP and Leopold, DR and Buckardt, A and Pitt, WC and Fukami, T},
title = {Vertical foraging shifts in Hawaiian forest birds in response to invasive rat removal.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0202869},
pmid = {30248110},
issn = {1932-6203},
abstract = {Worldwide, native species increasingly contend with the interacting stressors of habitat fragmentation and invasive species, yet their combined effects have rarely been examined. Direct negative effects of invasive omnivores are well documented, but the indirect effects of resource competition or those caused by predator avoidance are unknown. Here we isolated and examined the independent and interactive effects of invasive omnivorous Black rats (Rattus rattus) and forest fragment size on the interactions between avian predators and their arthropod prey. Our study examines whether invasive omnivores and ecosystem fragment size impact: 1) the vertical distribution of arthropod species composition and abundance, and 2) the vertical profile of foraging behaviors of five native and two non-native bird species found in our study system. We predicted that the reduced edge effects and greater structural complexity and canopy height of larger fragments would limit the total and proportional habitat space frequented by rats and thus limit their impact on both arthropod biomass and birds' foraging behavior. We experimentally removed invasive omnivorous Black rats across a 100-fold (0.1 to 12 ha) size gradient of forest fragments on Hawai'i Island, and paired foraging observations of forest passerines with arthropod sampling in the 16 rat-removed and 18 control fragments. Rat removal was associated with shifts in the vertical distribution of arthropod biomass, irrespective of fragment size. Bird foraging behavior mirrored this shift, and the impact of rat removal was greater for birds that primarily eat fruit and insects compared with those that consume nectar. Evidence from this model study system indicates that invasive rats indirectly alter the feeding behavior of native birds, and consequently impact multiple trophic levels. This study suggests that native species can modify their foraging behavior in response to invasive species removal and presumably arrival through behavioral plasticity.},
}
@article {pmid30245526,
year = {2018},
author = {Panlasigui, S and Davis, AJS and Mangiante, MJ and Darling, JA},
title = {Assessing threats of non-native species to native freshwater biodiversity: Conservation priorities for the United States.},
journal = {Biological conservation},
volume = {224},
number = {},
pages = {199-208},
pmid = {30245526},
issn = {0006-3207},
support = {EPA999999//Intramural EPA/United States ; },
abstract = {Non-native species pose one of the greatest threats to native biodiversity, and can have severe negative impacts in freshwater ecosystems. Identifying regions of spatial overlap between high freshwater biodiversity and high invasion pressure may thus better inform the prioritization of freshwater conservation efforts. We employ geospatial analysis of species distribution data to investigate the potential threat of non-native species to aquatic animal taxa across the continental United States. We mapped non-native aquatic plant and animal species richness and cumulative invasion pressure to estimate overall negative impact associated with species introductions. These distributions were compared to distributions of native aquatic animal taxa derived from the International Union for the Conservation of Nature (IUCN) database. To identify hotspots of native biodiversity we mapped total species richness, number of threatened and endangered species, and a community index of species rarity calculated at the watershed scale. An overall priority index allowed identification of watersheds experiencing high pressure from non-native species and also exhibiting high native biodiversity conservation value. While priority regions are roughly consistent with previously reported prioritization maps for the US, we also recognize novel priority areas characterized by moderate-to-high native diversity but extremely high invasion pressure. We further compared priority areas with existing conservation protections as well as projected future threats associated with land use change. Our findings suggest that many regions of elevated freshwater biodiversity value are compromised by high invasion pressure, and are poorly safeguarded by existing conservation mechanisms and are likely to experience significant additional stresses in the future.},
}
@article {pmid30244302,
year = {2018},
author = {Wood, JP and Beer, SD and Campbell, TS and Page, RB},
title = {Insights into the introduction history and population genetic dynamics of the Argentine black-and-white tegu (Salvator merianae) in Florida.},
journal = {Genetica},
volume = {146},
number = {6},
pages = {443-459},
pmid = {30244302},
issn = {1573-6857},
mesh = {Animals ; Florida ; *Founder Effect ; *Gene Flow ; *Introduced Species ; Polymorphism, Genetic ; Reptiles/*genetics ; },
abstract = {Invasive species are a major threat to global biodiversity. The US state of Florida is especially susceptible to the spread of exotic reptiles due to its subtropical climate, disturbed habitats, and robust pet trade. The Argentine black-and-white tegu (Salvator merianae) is a large, omnivorous lizard currently established in two different regions of Southern Florida. These two populations pose potential threats to sensitive ground nesting species such as gopher tortoises, American crocodiles, and migratory birds. At present, the introduction histories of these populations and the degree to which they are connected by gene flow are largely unknown. To address these issues, we genotyped S. merianae from Hillsborough and Miami-Dade Counties at ten microsatellite loci to assess intrapopulation genetic diversity, the degree of gene flow between populations, and compare the plausibilities of several potential introduction scenarios. Our results indicate that both populations have low genetic diversity [mean number of effective alleles across loci in both populations = 2.09 and are highly differentiated from each other (GST = 0.170; G″ST = 0.545)]. In addition, our results suggest that these populations underwent a bottleneck event prior to their divergence. We discuss what our results suggest about the histories of Florida's invasive tegu populations, as well as how they inform ongoing management strategies.},
}
@article {pmid30242527,
year = {2018},
author = {Mostert, E and Gaertner, M and Holmes, PM and O'Farrell, PJ and Richardson, DM},
title = {A multi-criterion approach for prioritizing areas in urban ecosystems for active restoration following invasive plant control.},
journal = {Environmental management},
volume = {62},
number = {6},
pages = {1150-1167},
pmid = {30242527},
issn = {1432-1009},
support = {85417//National Research Foundation/ ; },
abstract = {Resources for biodiversity conservation and invasive plant management are limited, and restoring invaded vegetation is labour-intensive and expensive. Managers must prioritize their actions to achieve their goals efficiently and effectively. They must distinguish between areas that require only the removal of invasive alien plants (&quot;passive restoration&quot;) from those that require additional restoration measures (&quot;active restoration&quot;). This study used a multi-criterion approach (Analytical Hierarchical Process) to develop a framework for identifying areas that require active restoration, and then to prioritize these areas for active restoration. The South African city of Cape Town is used as a test case to illustrate the utility of the framework. Framework criteria selected in determining the need for active restoration included: dominant alien species invading the area, density of invasion, duration of invasion, indigenous vegetation cover, adjacent land use, level of disturbance, size of the area, aspect, soil texture, soil depth and erodibility, slope and vegetation type. In deciding which areas to prioritize for active restoration, factors such as vegetation conservation status, selection in a regional conservation plan and connectivity function were assessed. Importance in ecosystem functioning (by providing a diversity of habitats and soil conservation) and the delivery of ecosystem service benefits were also considered. The resulting framework provides an objective tool for prioritizing sites for active restoration.},
}
@article {pmid30241361,
year = {2018},
author = {Bernard, J and Ewing, CP and Messing, RH},
title = {The Structure and Phenology of Non-Native Scolytine Beetle Communities in Coffee Plantations on Kaua'i.},
journal = {Insects},
volume = {9},
number = {4},
pages = {},
doi = {10.3390/insects9040123},
pmid = {30241361},
issn = {2075-4450},
support = {58-5320-3-017//U.S. Department of Agriculture/ ; },
abstract = {Populations and communities are known to respond to abiotic conditions, but the forces determining the distribution of particular insect pests are sometimes overlooked in the process of developing control methods. Bark and ambrosia beetles (Curculionidae: Scolytinae) are important pests of crops, forestry, and ecosystems worldwide, yet the factors that influence their success are unknown for many species. The Hawaiian archipelago is host to over three dozen invasive scolytines, many of which occur on Kaua'i and are pests of agriculture. We analyzed scolytine community dynamics at two coffee estates: a hand-harvested site in a tropical wet forest and a mechanically harvested site in a tropical dry savanna. Our regression analyses show overall scolytine abundance was negatively correlated with rainfall, as were four species: the tropical nut borer (Hypothenemus obscurus), H. brunneus, Cryphalus longipilus, and Xyleborinus andrewesi. These relationships contributed to the compositions of the communities being markedly dissimilar despite having the same species richness. Multivariate analysis found no influence from temperature or harvest method on community dynamics. This information can be valuable for the timing of pest control methods, for predicting the success of possible new scolytine arrivals on Kaua'i, and for forecasting how these species may spread with climate change.},
}
@article {pmid30238029,
year = {2018},
author = {Rebelo, AJ and Somers, B and Esler, KJ and Meire, P},
title = {Plant functional trait data and reflectance spectra for 22 palmiet wetland species.},
journal = {Data in brief},
volume = {20},
number = {},
pages = {1209-1219},
pmid = {30238029},
issn = {2352-3409},
abstract = {We provide reflectance spectra for 22 South African palmiet wetland species collected in spring 2015 from three wetlands throughout the Cape Floristic Region. In addition, we provide summarized plant functional trait data, as well as supporting and meta-data. Reflectance spectra were collected with a portable ASD Fieldspec Pro using standard methods. The 14 plant functional traits were measured on 10 replicates of each species, following standard protocols. We provide tables detailing these standard methods, as well a table with hypotheses on how these 14 continuous traits, as well as an additional 9 categorical traits, may affect ecosystem service provision. In addition, tables are attached which detail which functional and spectral groups these species belong to, according to the data. Finally, we include a photographic plate of the species data are provide for. We make these data available in an effort to assist in research on the understanding of how traits affect ecosystem service provision in wetlands, and particularly of whether remote sensing can be used to map these traits in wetlands.},
}
@article {pmid30236094,
year = {2018},
author = {Polidori, C and Nucifora, M and Sánchez-Fernández, D},
title = {Environmental niche unfilling but limited options for range expansion by active dispersion in an alien cavity-nesting wasp.},
journal = {BMC ecology},
volume = {18},
number = {1},
pages = {36},
pmid = {30236094},
issn = {1472-6785},
support = {SECTI contract//Universidad de Castilla-La Mancha/International ; CGL2017-83046-P//Ministerio de Economía, Industria y Competitividad, Gobierno de España/International ; },
mesh = {*Animal Distribution ; Animals ; *Climate Change ; *Ecosystem ; Europe ; France ; *Introduced Species ; Wasps/*physiology ; },
abstract = {BACKGROUND: Predicting the patterns of range expansion of alien species is central to develop effective strategies for managing potential biological invasions. Here, we present a study on the potential distribution of the American cavity-nesting, Orthoptera-hunting and solitary wasp, Isodontia mexicana (Hymenoptera: Sphecidae), which was first detected as alien species in France in 1960 and now is present in many European countries. After having updated its current distribution, we estimated the environmental space (based on bioclimatic data and altitude) occupied by the species and subsequently predicted its environmental potential distribution under both present and future climatic conditions at global scale.<br><br>RESULTS: The wasp lives in low-altitude areas of the Northern hemisphere with moderate temperatures and precipitation. The environmental space occupied in the invaded area is practically just a subset (42%) of that occupied in the native area, showing a process of environmental niche unfilling (i.e. the species only partially fills its environmental niche in the invaded range). Besides, I. mexicana could also live in other temperate areas, mainly in the Southern hemisphere, particularly close to the coasts. However, geographic (oceans) and/or climatic (tropical areas, mountain chains) barriers would prevent the species to reach these potential areas unless through human trade activity. The species could thus only reach, by active dispersion, the remaining invadable areas of Europe. Estimations for the future (2050 and 2070) predict an expansion through active dispersion towards North in the native range and towards North and East in the invaded range, but future conditions would not break down the current climatic barriers in the Southern hemisphere.<br><br>CONCLUSIONS: Isodontia mexicana has not shifted its environmental niche in the invaded area. It could still occupy some new areas by active dispersion, but confined to Europe. The conspicuous niche unfilling shown by this wasp species could reflect the likely single introduction in Europe just a few decades ago. Furthermore, results stay in line with other studies that found niche unfilling rather than niche expansion in insects.},
}
@article {pmid30233613,
year = {2018},
author = {Michelan, TS and Thomaz, SM and Bando, FM and Bini, LM},
title = {Competitive Effects Hinder the Recolonization of Native Species in Environments Densely Occupied by One Invasive Exotic Species.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1261},
pmid = {30233613},
issn = {1664-462X},
abstract = {The responses of native plants to competition with invasive plants depend mainly on the density of the invasive plants and on the ability of the native plants to compete for resources. In this study, we tested the influence of the invasive exotic Urochloa arrecta (Poaceae) on the early colonization of two native species (Pontederia cordata and Leersia hexandra) of aquatic macrophytes. Our hypotheses were (i) the competitive effects of U. arrecta on the native species P. cordata and L. hexandra are density-dependent and that (ii) these species respond differently to competitive interactions with the invasive species. We conducted the experiments in a greenhouse and in the field, in a tropical reservoir. The biomass of U. arrecta (ranging from 206.2 to 447.1 g) was manipulated in the greenhouse in trays with different densities. After the establishment of the invasive species, we added P. cordata and L. hexandra propagules to each tray. In the field, a propagule of P. cordata was planted in 36 sites with different densities of U. arrecta. The biomass and length of the natives and the biomass of the invasive species were measured in the greenhouse and in the field experiments. The biomass and length of the native plants decreased with increasing biomass of the exotic species in both experiments, showing that the competition between U. arrecta and native species depends on the density of the exotic species. The root:shoot ratio of L. hexandra decreased with increasing U. arrecta biomass, but the opposite occurred for P. cordata. These results indicate that native species exhibit different strategies of biomass allocation when interacting with U. arrecta. The strong competitive effects of U. arrecta and the different responses of the native species help to explain the reduced diversity of native macrophytes observed in sites colonized by U. arrecta. The results also suggest that in a scenario of dominance of exotic species, recolonization by native macrophytes is unlike to occur naturally and without human interventions that reduce the biomass of the exotic species.},
}
@article {pmid30231951,
year = {2018},
author = {Chaisiri, K and Dusitsittipon, S and Panitvong, N and Ketboonlue, T and Nuamtanong, S and Thaenkham, U and Morand, S and Dekumyoy, P},
title = {Distribution of the newly invasive New Guinea flatworm Platydemus manokwari (Platyhelminthes: Geoplanidae) in Thailand and its potential role as a paratenic host carrying Angiostrongylus malaysiensis larvae.},
journal = {Journal of helminthology},
volume = {},
number = {},
pages = {1-9},
doi = {10.1017/S0022149X18000834},
pmid = {30231951},
issn = {1475-2697},
abstract = {Invasive species constitute one of the most serious threats to biodiversity and ecosystems, and they potentially cause economic problems and impact human health. The globally invasive New Guinea flatworm, Platydemus manokwari (Platyhelminthes: Geoplanidae), has been identified as a threat to terrestrial biodiversity, particularly soil-dwelling native species (e.g. molluscs, annelids and other land planarians), and is listed among 100 of the world's worst invasive alien species. We report here, for the first time, P. manokwari occurrences in many locations throughout Thailand, using voluntary digital public participation from the social network portals associated with the Thailand Biodiversity Conservation Group and collections of living flatworm specimens. Mitochondrial cytochrome c oxidase subunit I (COI) sequences confirmed that all collected flatworms were P. manokwari and placed them in the &quot;world haplotype&quot; clade alongside other previously reported specimens from France, Florida (USA), Puerto Rico, Singapore, French Polynesia, New Caledonia, and the Solomon Islands. In addition, infective stage larvae (L3) of the nematode Angiostrongylus malaysiensis were found in the flatworm specimens, with a 12.4% infection rate (15/121 specimens examined). Platydemus manokwari occurrence in Thailand and its capacity to carry L3 of Angiostrongylus should be of concern to biodiversity conservation and human health practitioners, because this invasive flatworm species may be involved in the life cycle of angiostrongylid worms in Thailand.},
}
@article {pmid30231457,
year = {2018},
author = {Khim, JS and Hong, S and Yoon, SJ and Nam, J and Ryu, J and Kang, SG},
title = {A comparative review and analysis of tentative ecological quality objectives (EcoQOs) for protection of marine environments in Korea and China.},
journal = {Environmental pollution (Barking, Essex : 1987)},
volume = {242},
number = {Pt B},
pages = {2027-2039},
doi = {10.1016/j.envpol.2018.06.094},
pmid = {30231457},
issn = {1873-6424},
mesh = {Animals ; Biodiversity ; China ; *Ecosystem ; Environmental Monitoring ; Fisheries ; Republic of Korea ; Water Pollution/*analysis ; },
abstract = {Ecological quality objectives (EcoQOs), as tools for implementing ecosystem approach, have long been acknowledged to protect the marine ecosystems and fisheries in regional seas through joint efforts by surrounding countries over the past decade. The present review analyzed the best available meta-data relating to the five ecosystem elements that were recently proposed by the Northwest Pacific Action Plan to evaluate the current status of coastal ecosystem health in marine environment of the Yellow Sea. We suggested the six tentative EcoQOs among five ecological quality elements including: 1) biological and habitat diversity; 2) invasive species; 3) eutrophication; 4) pollutants; and 5) marine litters. Environmental status was assessed, depending on the EcoQOs targets, by comparison to the world average values, existing environmental standards, or reported values of other regional seas. Results of analysis revealed that among the six tentative EcoQOs, two target objectives to marine biodiversity and concentrations of nutrients (viz., DIN and DIP) were met towards good environmental status. Whilst, three EcoQOs relating to hypoxia and red-tide, pollutants (persistent toxic substances and metals), and marine litters (including microplastics) did not meet and one relating to invasive species could not be judged due to insufficient data sets. The biggest weak point for developing suitable EcoQOs and assessing status of ecosystem health could be insufficient meta-data sets available and/or discrepancy in methodological details cross the data-sets or between the two targeted countries. Thus, the cooperation of neighboring countries, viz., Korea and China for the Yellow Sea, is necessary for the ecosystem based management of our regional sea in the future. Overall, this first time review for the assessment of target tentative EcoQOs in the Yellow Sea region encompassing coasts of Korea and China would provide a better understanding of the current status of environmental pollution and ecosystem health.},
}
@article {pmid30228866,
year = {2018},
author = {Stevens, CJ},
title = {Recent advances in understanding grasslands.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
pmid = {30228866},
issn = {2046-1402},
abstract = {Grasslands are a vitally important ecosystem, supporting a wide range of ecosystem services and high levels of biodiversity. As a consequence, they have long been a focus for ecologists, playing host to some of the world's longest-running ecological experiments and providing the inspiration for many long-standing theories and debates. Because the field of grassland ecology is broad, encompassing many areas of ecology, this article picks some areas of particular debate and development to look at recent advances. The areas include relationships between diversity and productivity, ecosystem stability and ecosystem service provision, global change threats from nutrient addition, invasive species, climate change, and plant soil interactions.},
}
@article {pmid30227300,
year = {2018},
author = {Nogueira, AF and Pereira, JL and Antunes, SC and Gonçalves, FJM and Nunes, B},
title = {Effects of zinc pyrithione on biochemical parameters of the freshwater Asian clam Corbicula fluminea.},
journal = {Aquatic toxicology (Amsterdam, Netherlands)},
volume = {204},
number = {},
pages = {100-106},
doi = {10.1016/j.aquatox.2018.08.021},
pmid = {30227300},
issn = {1879-1514},
mesh = {Acetylcholinesterase/metabolism ; Animals ; Biofouling ; Biomarkers/metabolism ; Catalase/metabolism ; Corbicula/*drug effects/enzymology ; Disinfectants/*toxicity ; *Fresh Water ; Glutathione Transferase/metabolism ; Glycogen/metabolism ; Organometallic Compounds/*toxicity ; Pyridines/*toxicity ; Water Pollutants, Chemical/toxicity ; },
abstract = {Zinc pyrithione (ZnPT) is an organometallic biocide with bactericide, algaecide, and fungicide activity. Considering this biological activity, ZnPT has been used in anti-fouling paints, and also in human therapeutics and cosmetics, in shampoos to treat dandruff and seborrhoea. Despite its potential uses and consequent presence in the aquatic environment, the ecotoxicological effects of ZnPT are poorly understood. This work aims to characterise the effects of ZnPT in biochemical parameters of the Asian clam, one of the most invasive bivalves known for its biofouling action in hydro-dependent industries, using a classical (LC50 determination) and a biomarker-based approach (quantification of the activities of catalase, GSTs, and acetylcholinesterase, and also the muscle glycogen content). The here determined LC50-96 h for zinc pyrithione was 2.17 mg/L. ZnPT caused significant increases in the activity of catalase and of cholinesterases. These findings evidence the pro-oxidative effects caused by the metabolism of ZnPT. Despite the absence of clear effects, it is important to stress that the presence of ZnPT in the wild is usually accompanied by other pyrithiones, whose co-existence can contribute to the exertion of considerable toxic effects.},
}
@article {pmid30227284,
year = {2019},
author = {Piria, M and Simonović, P and Zanella, D and Ćaleta, M and Šprem, N and Paunović, M and Tomljanović, T and Gavrilović, A and Pecina, M and Špelić, I and Matulić, D and Rezić, A and Aničić, I and Safner, R and Treer, T},
title = {Long-term analysis of fish assemblage structure in the middle section of the Sava River - The impact of pollution, flood protection and dam construction.},
journal = {The Science of the total environment},
volume = {651},
number = {Pt 1},
pages = {143-153},
doi = {10.1016/j.scitotenv.2018.09.149},
pmid = {30227284},
issn = {1879-1026},
mesh = {Animals ; Biota ; Croatia ; *Environmental Monitoring ; *Fishes ; Floods/*prevention &amp; control ; Introduced Species ; *Rivers ; Water Movements ; Water Pollution, Chemical/*adverse effects ; Water Quality ; *Water Supply ; },
abstract = {At the beginning of the 20th century, the middle section of the Sava River in Croatia was unaffected by major human activities and rich in ichthyofauna. The Sava River was important for commercial and recreational fishing for the local population, which still remains today. However, the 1920s mining industry was established in Slovenia, which emitted carbon dust into the Sava River. At the same time, the construction of embankments to mitigate flooding started in the middle section. Furthermore, in the 1980s, the Krško nuclear power plant (NPP), and in the 2010s, the Krško hydropower plant (HPP) were built in Slovenia. These activities could have an impact on the composition of fish communities downstream from the major sources of disturbances. Therefore, the main aim of this paper were to analyze the changes in fish assemblages of the Sava River from 1978 to 2017, prior to and after the construction of Krško NPP and HPP at the Medsave site on the Sava River, 20 km downstream from the major construction operations. Collected data were divided into four sampling periods (SP): SP1, from 1978 to 1980; SP2, from 1991 to 1994; SP3, from 2001 to 2006, and SP4 from 2011 to 2017. Besides alien fish species, water quality and hydromorphological modifications were identified as significant stressors. In SP1 and SP2 limnophilic and eurytopic fish groups were predominant, and 26 different fish species were identified, but in SP3 and SP4 rheophilic fish groups become dominant, and the diversity has declined to 21 species. Threatened species blageon, Telestes souffia seems to be missing from the main course of the Sava River in last 20 years. It can be concluded that disturbances in the fish assemblage pattern have coincided with the presence of multiple stressors of human origin.},
}
@article {pmid30225943,
year = {2019},
author = {Gariepy, TD and Bruin, A and Konopka, J and Scott-Dupree, C and Fraser, H and Bon, MC and Talamas, E},
title = {A modified DNA barcode approach to define trophic interactions between native and exotic pentatomids and their parasitoids.},
journal = {Molecular ecology},
volume = {28},
number = {2},
pages = {456-470},
doi = {10.1111/mec.14868},
pmid = {30225943},
issn = {1365-294X},
support = {//Agriculture and Agri-Food Canada/ ; //OMAFRA/University of Guelph Partnership-Emergency Management and Production Systems/ ; },
abstract = {The establishment of invasive Halyomorpha halys (Stål) outside of its native range may impact native species assemblages, including other pentatomids and their scelionid parasitoids. This has generated interest in defining species diversity and host-parasitoid associations in this system to better understand the impact of invasive alien species on trophic interactions in invaded regions. Information on scelionid-pentatomid associations in natural habitats is lacking, and species-level identification of these associations can be tenuous using rearing and dissection techniques. Naturally occurring pentatomid eggs were collected in areas where H. halys has established in Canada and were analysed using a modified DNA barcoding approach to define species-level trophic interactions. Identification was possible for >90% of egg masses. Eleven pentatomid and five scelionid species were identified, and trophic links were established. Approximately 70% of egg masses were parasitized; parasitism and parasitoid species composition were described for each species. Telenomus podisi Ashmead was the dominant parasitoid and was detected in all host species. Trissolcus euschisti Ashmead was detected in several host species, but was significantly more prevalent in Chinavia hilaris (Say) and Brochymena quadripustulata (Fabricius). Trissolcus brochymenae Ashmead and Tr. thyantae Ashmead were recorded sporadically. Parasitism of H. halys was 55%, and this species was significantly less likely to be parasitized than native pentatomids. The scelionid species composition of H. halys consisted of Te. podisi, Tr. euschisti and Tr. thyantae. Although these species cannot develop in fresh H. halys eggs, we demonstrate that parasitoids attempt to exploit this host under field conditions.},
}
@article {pmid30225019,
year = {2018},
author = {Cuthbert, RN and Dickey, JWE and McMorrow, C and Laverty, C and Dick, JTA},
title = {Resistance is futile: lack of predator switching and a preference for native prey predict the success of an invasive prey species.},
journal = {Royal Society open science},
volume = {5},
number = {8},
pages = {180339},
pmid = {30225019},
issn = {2054-5703},
abstract = {Invasive species continue to severely impact biodiversity, yet predicting the success or failure of introduced species has remained elusive. In particular, the relationship between community invasibility and native species diversity remains obscure. Here, we apply two traditional ecological concepts that inform prey population stability and hence invasibility. We first show that the native predatory crustacean Gammarus duebeni celticus exhibited similar type II (destabilizing) functional responses (FRs) towards native mayfly prey and invasive amphipod prey, when these prey species were presented separately. However, when the two prey species were presented simultaneously, the predator did not exhibit prey switching, instead consuming disproportionately more native prey than expected from the relative abundance of native and invasive species. These consumptive propensities foster reductions of native prey, while simultaneously limiting biotic resistance against the invasive species by the native predator. Since our theoretical considerations and laboratory results match known field invasion patterns, we advocate the increased consideration of FR and prey switching studies to understand and predict the success of invasive species.},
}
@article {pmid30224205,
year = {2018},
author = {Visha, A and Gandhi, N and Bhavsar, SP and Arhonditsis, GB},
title = {Assessing mercury contamination patterns of fish communities in the Laurentian Great Lakes: A Bayesian perspective.},
journal = {Environmental pollution (Barking, Essex : 1987)},
volume = {243},
number = {Pt A},
pages = {777-789},
doi = {10.1016/j.envpol.2018.07.070},
pmid = {30224205},
issn = {1873-6424},
mesh = {Animals ; Bayes Theorem ; Canada ; Carps ; *Environmental Monitoring ; Fishes ; Food Chain ; Great Lakes Region ; Lakes/chemistry ; Linear Models ; Mercury/*analysis/*pharmacokinetics ; Perches ; Salmon ; Trout ; Water Pollutants, Chemical/*analysis ; },
abstract = {We examine the spatio-temporal trends of mercury, a well-known global legacy contaminant, in eleven fish species across all of the Canadian Great Lakes. These particular fish species are selected based on their ecological, commercial, and recreational importance to the biodiversity and fishing industry of the Great Lakes. We present a two-pronged Bayesian methodological framework to rigorously assess mercury temporal trends across multiple fish species and locations. In the first part of our analysis, we develop dynamic linear models to delineate the total mercury levels and rates of change, while explicitly accounting for the covariance between fish length and mercury levels in fish tissues. We then use hierarchical modelling to evaluate the spatial variability of mercury contamination between nearshore and offshore locations, as well as to examine the hypothesis that invasive species have induced distinct shifts on fish mercury contamination trends. Our analysis suggests that the general pattern across the Great Lakes was that the elevated mercury concentrations during the 1970s had been subjected to a declining trend throughout the late 1980s/early 1990s, followed by a gradual stabilization after the late 1990s/early 2000s. The declining trend was more pronounced with top fish predators, whereas benthivorous fish species mainly underwent wax-and-wane cycles with a weaker evidence of a long-term declining trend. Historically contaminated regions, designated as Areas of Concern, and bays receiving riverine inputs are still characterized by mercury concentrations that can lead to consumption restrictions. Lake Erie displayed the lowest mercury levels across all the fish species examined. However, several species of commercial importance showed a reversing (increasing) trend in the 2000s, although their current levels do not pose any major concerns for consumption advisories. These recent trend reversals can be linked with systematic shifts in energy trophodynamics along with the food web alterations induced from the introduction of non-native species, and the potentially significant fluxes from the atmosphere.},
}
@article {pmid30220875,
year = {2018},
author = {Lounibos, LP and Juliano, SA},
title = {Where Vectors Collide: The Importance of Mechanisms Shaping the Realized Niche for Modeling Ranges of Invasive Aedes Mosquitoes.},
journal = {Biological invasions},
volume = {20},
number = {8},
pages = {1913-1929},
pmid = {30220875},
issn = {1387-3547},
support = {R15 AI094322/AI/NIAID NIH HHS/United States ; R15 AI124005/AI/NIAID NIH HHS/United States ; R21 AI095780/AI/NIAID NIH HHS/United States ; },
abstract = {The vector mosquitoes Aedes aegypti (L.), native to Africa, and Aedes albopictus (Skuse), native to Asia, are widespread invasives whose spatial distributions frequently overlap. Predictive models of their distributions are typically correlative rather than mechanistic, and based on only abiotic variables describing putative environmental requirements despite extensive evidence of competitive interactions leading to displacements. Here we review putative roles of competition contributing to distribution changes where the two species meet. The strongest evidence for competitive displacements comes from multiple examples of habitat segregation where the two species co-occur and massive reductions in the range and abundance of A. aegypti attributable to A. albopictus invasions in the southeastern U.S.A. and Bermuda (U.K). We summarize evidence to support the primacy of asymmetric reproductive interference, or satyrization, and larval resource competition, both favoring A. albopictus, as displacement mechanisms. Where evidence of satyrization or interspecific resource competition is weak, differences in local environments or alternative ecologies or behaviors of these Aedes spp. may explain local variation in the outcomes of invasions. Predictive distribution modeling for both these major disease vectors needs to incorporate species interactions between them as an important process that is likely to limit their realized niches and future distributions. Experimental tests of satyrization and resource competition are needed across the broad ranges of these species, as are models that incorporate both reproductive interference and resource competition to evaluate interaction strengths and mechanisms. These vectors exemplify how fundamental principles of community ecology may influence distributions of invasive species.},
}
@article {pmid30220757,
year = {2018},
author = {Guiaşu, RC and Tindale, CW},
title = {Logical fallacies and invasion biology.},
journal = {Biology &amp; philosophy},
volume = {33},
number = {5},
pages = {34},
pmid = {30220757},
issn = {0169-3867},
abstract = {Leading invasion biologists sometimes dismiss critics and criticisms of their field by invoking &quot;the straw man&quot; fallacy. Critics of invasion biology are also labelled as a small group of &quot;naysayers&quot; or &quot;contrarians&quot;, who are sometimes engaging in &quot;science denialism&quot;. Such unfortunate labels can be seen as a way to possibly suppress legitimate debates and dismiss or minimize reasonable concerns about some aspects of invasion biology, including the uncertainties about the geographic origins and complex environmental impacts of species, and the control programs against species perceived as &quot;invasive&quot;. In assessing the quality of the debate in this area, we examine the validity of the use of various strategies, including the &quot;straw man&quot; concept, and explore a range of potential logical fallacies present in some recent prominent discussions about invasion biology and so-called &quot;invasive&quot; species. The goal is to add some clarity to the concepts involved, point out some problematic issues, and improve the quality of the debates as the discussions move forward.},
}
@article {pmid30220052,
year = {2018},
author = {Zhang, F and Li, Q and Yerger, EH and Chen, X and Shi, Q and Wan, F},
title = {AM fungi facilitate the competitive growth of two invasive plant species, Ambrosia artemisiifolia and Bidens pilosa.},
journal = {Mycorrhiza},
volume = {28},
number = {8},
pages = {703-715},
pmid = {30220052},
issn = {1432-1890},
support = {31372000//National Natural Science Foundation of China/ ; C2015201021//Hebei National Natural Science Foundation/ ; C2015201241//Hebei National Natural Science Foundation/ ; ZD2016039//Department of Education Project/ ; 31171906//National Natural Science Foundation of China/ ; },
mesh = {Ambrosia/*growth &amp; development/microbiology ; Bidens/*growth &amp; development/microbiology ; China ; Glomeromycota/*physiology ; Introduced Species ; Mycorrhizae/*physiology ; Setaria Plant/*growth &amp; development ; *Soil Microbiology ; },
abstract = {Invasive species often cause enormous economic and ecological damage, and this is especially true for invasive plants in the Asteraceae family. Arbuscular mycorrhizal fungi (AMF) play an important role in the successful invasion by exotic plant species because of their ability to promote growth and influence interspecific competition. However, few studies have evaluated the effects of invasive Asteraceae species on AMF diversity and how feedback mechanisms during competition with native species subsequently affect the accumulation of nutrient resources. Two exotic Asteraceae, Ambrosia artemisiifolia and Bidens pilosa, were monitored during competition with a native grass species, Setaria viridis, which is being replaced by these exotic species in natural areas around the study site. From these species continuously maintained in a field plot for 5 years, we collected the rhizosphere soil and cloned and identified soil AMF. Furthermore, AM fungal spores were isolated from rhizosphere soil of the two invasive species and used as inoculum in greenhouse experiments, to compare growth and nutrient accumulation during competition. The results indicate that although the AMF diversity in the rhizosphere soil of A. artemisiifolia and B. pilosa differed, the three most abundant species (Septoglomus viscosum, Septoglomus constrictum, Glomus perpusillum) were identical. The addition of AMF inoculum changed the competition between the plants, increasing the competitive ability of the invasives and decreasing that of the native. The results show a similar AMF community composition between A. artemisiifolia and B. pilosa, increased AMF root colonization of the invasive species during competition, AMF-enhanced N accumulation, and AMF-facilitated competitive growth of the invasive species.},
}
@article {pmid30219282,
year = {2018},
author = {Wilkins, KE and Prowse, TAA and Cassey, P and Thomas, PQ and Ross, JV},
title = {Pest demography critically determines the viability of synthetic gene drives for population control.},
journal = {Mathematical biosciences},
volume = {305},
number = {},
pages = {160-169},
doi = {10.1016/j.mbs.2018.09.005},
pmid = {30219282},
issn = {1879-3134},
abstract = {Synthetic gene drives offer a novel solution for the control of invasive alien species. CRISPR-based gene drives can positively bias their own inheritance, and comprise a DNA sequence that is replicated by homologous recombination. Since gene drives can be positioned to silence fertility or developmental genes, they could be used for population suppression. However, the production of resistant alleles following self-replication errors threatens the technology's viability for pest eradication in real-world applications. Further, a robust assessment of how pest demography impacts the expected progression of gene drives through populations is currently lacking. We used a deterministic, two-sex, birth-death model to investigate how demographic assumptions affect the efficiency of suppression drives for controlling invasive rodents on islands, for two different gene-drive strategies. We show that mass-action reproduction results in overly optimistic eradication outcomes when compared to the more realistic assumption of polygynous breeding. When polygyny was assumed, both gene-strategies failed due to the evolution of resistance unless a reproductive Allee effect (reduced reproductive rates at low population density) was also included; although model outcomes were highly sensitive to the strength of this effect. Increasing the size of the initial gene-drive introduction (up to 10% of carrying capacity) had little impact on population outcomes. Understanding the demography of a population targeted for eradication is critical before the viability of gene-drive suppression can be adequately assessed.},
}
@article {pmid30218232,
year = {2018},
author = {Abe, T and Tanaka, N and Shimizu, Y},
title = {Plant species diversity, community structure and invasion status in insular primary forests on the Sekimon uplifted limestone (Ogasawara Islands).},
journal = {Journal of plant research},
volume = {131},
number = {6},
pages = {1001-1014},
pmid = {30218232},
issn = {1618-0860},
mesh = {*Biodiversity ; Calcium Carbonate ; Ecosystem ; *Forests ; *Introduced Species ; Micronesia ; Plants ; Polynesia ; Trees ; },
abstract = {Native forests on oceanic islands are among the most threatened ecosystems. The forests formed on Sekimon uplifted limestone in Haha-jima Island (Ogasawara Islands) have not yet been destroyed by human activities and remain as primary forests harboring several narrow endemic endangered plants. In this paper, we described the plant species diversity, community structure, and status of invasion by alien plants in the mesic forests of Sekimon. The Sekimon forest was characterized by low tree diversity (37 species), high stem density (1731 ha-1), and high basal area (63.9 m2 ha-1), comparing with natural forests in world islands. The forests were dominated in the number of stems by the sub-tree Ardisia sieboldii followed by the trees Pisonia umbellifera and Elaeocarpus photiniifolius. The invasive tree Bischofia javanica ranked fourth for basal area and third for the number of stems (DBH ≥ 10 cm), and its distribution expanded, especially near a past plantation site. Surveys of forest floor vegetation revealed that species richness of vascular plants was 109 species and that many alien plants had already invaded the forests. Despite the low species richness of alien (16% for vascular flora and 8% for trees), the high frequency of aliens on the forest floor suggests that they have colonized successfully in the Sekimon forest. Extrapolation analysis based on the rarefaction curves predicted that the vascular plants in the Sekimon (25 ha) accounted for 135 species (29.9% of the vascular flora of the Ogasawara Islands) and endemic plants were 85 species (62.0%). The fact that the 39 vascular species recorded in our plots were listed in Japanese Red List suggests that the Sekimon forest should be conserved as a sanctuary of biodiversity. Because alien plants are invading the forests without apparent anthropogenic disturbance, immediate action to eradicate these invaders is highly needed.},
}
@article {pmid30215802,
year = {2018},
author = {de Souza, FS and Costa, MAPC and de Oliveira, EJF and Ribeiro, MF and Souza, BA and Araújo, ED and Imperatriz-Fonseca, VL and de Carvalho, CAL},
title = {Genetic Variability of Melipona subnitida (Hymenoptera: Apidae) in Introduced and Native Populations.},
journal = {Journal of insect science (Online)},
volume = {18},
number = {5},
pages = {},
pmid = {30215802},
issn = {1536-2442},
mesh = {Animals ; Bees/*genetics ; Brazil ; Electron Transport Complex IV/genetics/metabolism ; *Genetic Variation ; *Haplotypes ; Insect Proteins/*genetics/metabolism ; *Introduced Species ; Islands ; },
abstract = {Melipona subnitida (Hymenoptera: Apidae) is a stingless bee native to Caatinga biome in Brazil, well adapted to hot and dry climate of that region and has been traditionally explored for honey production. Here, we evaluate the genetic structure of 173 colonies of M. subnitida in northeast Brazil by partially sequenced mitochondrial genes cytochrome oxidase I (COI) to compare an introduced population isolated for 30 yr into the Island of Fernando de Noronha (IFN) with the continental populations. We identified high haplotype diversity (0.8220) with 14 haplotypes on the continental populations, being three new ones, compared with the database GenBank. The haplotype H4 was present at the center of network, occurring in four localities on mainland and fixed as a single haplotype on IFN. We propose that the island populations originally introduced carried one haplotype (H4), even though IFN population is suffering pressure by island effect through changes on morphology. Studies on island populations could be a model to understand the dynamics of isolated populations and sustainable management of this biome to preserve M. subnitida.},
}
@article {pmid30213967,
year = {2018},
author = {Paini, DR and Mwebaze, P and Kuhnert, PM and Kriticos, DJ},
title = {Global establishment threat from a major forest pest via international shipping: Lymantria dispar.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {13723},
pmid = {30213967},
issn = {2045-2322},
abstract = {The global shipping network is widely recognised as a pathway for vectoring invasive species. One species of particular concern is Lymantria dispar (gypsy moth). Two subspecies, L. d. asiatica and L. d. japonica (herein referred to as Asian Gypsy Moth - AGM) are of considerable concern as ships arriving to a number of countries have been found carrying AGM egg masses. However, ships carrying AGM eggs can only threaten a country at ports located in a climatically suitable region. We present a CLIMEX model of climate suitability and combine this with international shipping to estimate the global threat from AGM. We find that for the USA more than half of international ships (approximately 18,000 ships) arrive to climatically suitable ports. Other countries with a large number of ships arriving to ports with suitable climates include Canada and Brazil. This is the first global analysis of the invasion threat from AGM, and we recommend countries focus AGM-inspection programs towards ships arriving at ports found within climatically suitable regions.},
}
@article {pmid30212810,
year = {2018},
author = {Cardilini, APA and Micallef, S and Bishop, VR and Sherman, CDH and Meddle, SL and Buchanan, KL},
title = {Environmental Influences on Neuromorphology in the Non-Native Starling Sturnus vulgaris.},
journal = {Brain, behavior and evolution},
volume = {92},
number = {1-2},
pages = {63-70},
doi = {10.1159/000491672},
pmid = {30212810},
issn = {1421-9743},
abstract = {Cognitive traits are predicted to be under intense selection in animals moving into new environments and may determine the success, or otherwise, of dispersal and invasions. In particular, spatial information related to resource distribution is an important determinant of neural development. Spatial information is predicted to vary for invasive species encountering novel environments. However, few studies have tested how cognition or neural development varies intraspecifically within an invasive species. In Australia, the non-native common starling Sturnus vulgaris inhabits a range of habitats that vary in seasonal resource availability and distribution. We aimed to identify variations in the brain mass and hippocampus volume of starlings in Australia related to environmental variation across two substantially different habitat types. Specifically, we predicted variation in brain mass and hippocampal volume in relation to environmental conditions, latitude, and climatic variables. To test this, brain mass and volumes of the hippocampus and two control brain regions (telencephalon and tractus septomesencephalicus) were quantified from starling brains gathered from across the species' range in south eastern Australia. When comparing across an environmental gradient, there was a significant interaction between sex and environment for overall brain mass, with greater sexual dimorphism in brain mass in inland populations compared to those at the coast. There was no significant difference in hippocampal volume in relation to environmental measures (hippocampus volume, n = 17) for either sex. While these data provide no evidence for intraspecific environmental drivers for changes in hippocampus volume in European starlings in Australia, they do suggest that environmental factors contribute to sex differences in brain mass. This study identifies associations between the brain volume of a non-native species and the environment; further work in this area is required to elucidate the mechanisms driving this relationship.},
}
@article {pmid30208545,
year = {2018},
author = {Visha, A and Gandhi, N and Bhavsar, SP and Arhonditsis, GB},
title = {A Bayesian assessment of polychlorinated biphenyl contamination of fish communities in the Laurentian Great Lakes.},
journal = {Chemosphere},
volume = {210},
number = {},
pages = {1193-1206},
doi = {10.1016/j.chemosphere.2018.07.070},
pmid = {30208545},
issn = {1879-1298},
mesh = {Animals ; Bayes Theorem ; Fishes ; Great Lakes Region ; Humans ; Polychlorinated Biphenyls/analysis/*chemistry ; Water Pollutants, Chemical/analysis/*chemistry ; },
abstract = {Polychlorinated biphenyl (PCB) contamination has historically posed constraints on the recreational and commercial fishing industry in the Great Lakes. Empirical evidence suggests that PCB contamination represents a greater health risk from fish consumption than other legacy contaminants. The present study attempts a rigorous assessment of the spatio-temporal PCB trends in multiple species across the Canadian waters of the Great Lakes. We applied a Bayesian modelling framework, whereby we initially used dynamic linear models to delineate PCB levels and rates of change, while accounting for the role of fish length and lipid content as covariates. We then implemented Bayesian hierarchical modelling to evaluate the temporal PCB trends during the dreissenid pre- and post-invasion periods, as well as the variability among and within the water bodies of the Great Lakes system. Our analysis indicates that Lake Ontario is characterized by the highest PCB levels among nearly all of the fish species examined. Historically contaminated local areas, designated as Areas of Concern, and embayments receiving riverine inputs displayed higher concentrations within each of the water bodies examined. The general temporal trend across the Great Lakes was that the high PCB concentrations during the early 1970s followed a declining trajectory throughout the late 1980s/early 1990s, likely as a result of the reductions in industrial emissions and other management actions. Nonetheless, after the late 1990s/early 2000s, our analysis provided evidence of a decline in the rate at which PCB concentrations in fish were dropping, accompanied by a gradual establishment of species-specific, steady-state concentrations, around which there is considerable year-to-year variability. The overall trends indicate that reduced contaminant emissions have brought about distinct beneficial changes in fish PCB concentrations, but past historical contamination along with other external or internal stressors (e.g., invasive species, climate change) continue to modulate the current levels, thereby posing potential risks to humans through fish consumption.},
}
@article {pmid30208525,
year = {2018},
author = {Wei, H and Huang, M and Quan, G and Zhang, J and Liu, Z and Ma, R},
title = {Turn bane into a boon: Application of invasive plant species to remedy soil cadmium contamination.},
journal = {Chemosphere},
volume = {210},
number = {},
pages = {1013-1020},
doi = {10.1016/j.chemosphere.2018.07.129},
pmid = {30208525},
issn = {1879-1298},
mesh = {Asteraceae/drug effects/*metabolism ; *Biodegradation, Environmental ; Cadmium/analysis/*metabolism ; *Introduced Species ; Soil/*chemistry ; Soil Pollutants/analysis/*toxicity ; },
abstract = {Cadmium (Cd) is one of the mostly hazardous soil pollutants and has threatened human health by accumulating in grains of crops. Phytoremediation is a promising technique to remedy soil Cd contamination, but reported Cd hyperaccumulators remain limited. In this study, we explored potential applicability of three invasive plant species (Chromolaena odorata, Bidens pilosa and Praxelis clematidea) to remove soil Cd using greenhouse experiment. Results showed that the three species grew well with Cd treatments compared to the controlled individuals, suggesting that the species had high Cd tolerance by physiological adjustments such as up-regulating the antioxidant enzyme activities. The only exception was that the height of P. clematidea in the 60 mg kg-1 Cd treatment was less than that in the control. Within the tested Cd concentration range, the C. odorata exhibited high bioaccumulation characteristics that meet the recommended standards to identify as a hyperaccumulator (shoot Cd concentration > 100 mg kg-1 with bioconcentration and transfer factors > 1). The other two species had also the shoot bioconcentration factor and transfer factor greater than one, while the shoot Cd concentration was relatively lower. Our results highlight a potential applicability of the invasive species used in this study for remediation of the soil Cd contamination, which turns bane into a boon.},
}
@article {pmid30206349,
year = {2018},
author = {Parm, Ü and Štšepetova, J and Eelmäe, I and Merila, M and Ilmoja, ML and Metsvaht, T and Lutsar, I and Soeorg, H},
title = {Genetic relatedness of Gram-negative bacteria colonizing gut and skin of neonates and mother's own milk.},
journal = {Journal of perinatology : official journal of the California Perinatal Association},
volume = {38},
number = {11},
pages = {1503-1511},
doi = {10.1038/s41372-018-0220-x},
pmid = {30206349},
issn = {1476-5543},
support = {IUT34-24//Eesti Teadusagentuur (Estonian Research Council)/ ; },
abstract = {OBJECTIVE: We described colonization of mother's own milk with Gram-negative bacteria and its relationship with neonatal colonization.<br><br>STUDY DESIGN: Gram-negative bacteria isolated from weekly collected stool, skin and mother's own milk of hospitalized preterm (n = 49) and healthy term neonates (n = 20) were genotyped. Colonization-related factors were determined by logistic regression.<br><br>RESULTS: Gram-negative bacteria were isolated from mother's own milk of 22.4% (n = 11) and 15% (n = 3) of mothers of preterm and term neonates, respectively. According to pulsed-field gel electrophoresis genetically similar strains were present in mother's own milk and gut of 8.2% (n = 4) of mother-preterm neonate, but none of mother-term neonate pairs. In three of four late-onset sepsis caused by Gram-negative bacteria, colonization of gut, but not mother's own milk, with invasive species preceded late-onset sepsis.<br><br>CONCLUSIONS: Colonization of mother's own milk with Gram-negative bacteria is uncommon and transmission to neonatal gut may occur in less than one-tenth of neonate-mother pairs.},
}
@article {pmid30204066,
year = {2018},
author = {Danesi, P and Falcaro, C and Ravagnan, S and Da Rold, G and Porcellato, E and Corrò, M and Iatta, R and Cafarchia, C and Frangipane di Regalbono, A and Meyer, W and Capelli, G},
title = {Real-time PCR assay for screening Pneumocystis in free-living wild squirrels and river rats in Italy.},
journal = {Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc},
volume = {30},
number = {6},
pages = {862-867},
doi = {10.1177/1040638718797379},
pmid = {30204066},
issn = {1943-4936},
mesh = {Animals ; DNA, Fungal/analysis ; *Introduced Species ; Italy/epidemiology ; Lung/microbiology ; Phylogeny ; Pneumocystis/*isolation &amp; purification ; Pneumocystis Infections/epidemiology/microbiology/*veterinary ; Prevalence ; RNA, Ribosomal/analysis ; Real-Time Polymerase Chain Reaction ; Rodent Diseases/*epidemiology/microbiology ; *Rodentia ; Sciuridae ; Sequence Analysis, RNA/veterinary ; },
abstract = {We used a real-time PCR (rtPCR) targeting a 150-bp amplicon of the mitochondrial small subunit of ribosomal RNA (mtSSU rRNA) to screen for Pneumocystis DNA in lungs of wild squirrels (Callosciurus finlaysonii, n = 85) and river rats (Myocastor coypus, n = 43) in Italy. The rtPCR revealed Pneumocystis DNA in 20 of 85 (24%) squirrels and in 35 of 43 (81%) river rats, and was more sensitive than a nested PCR that targets a portion of the mtSSU rRNA and the mitochondrial large subunit of rRNA (mtLSU rRNA). Phylogenetic analysis based on mtSSU rRNA and mtLSU rRNA sequences showed distinct Pneumocystis sequence types in these rodents. The rtPCR assay should be reliable for screening large populations for this potential pathogen, thereby allowing cost-effective monitoring of the disease in wild animals.},
}
@article {pmid30202651,
year = {2018},
author = {Gantchoff, MG and Wilton, CM and Belant, JL},
title = {Factors influencing exotic species richness in Argentina's national parks.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5514},
pmid = {30202651},
issn = {2167-8359},
abstract = {Exotic species introductions are a global phenomenon and protected areas are susceptible to them. Understanding the drivers of exotic species richness is vital for prioritizing natural resource management, particularly in developing countries with limited resources. We analyzed the influence of coarse resolution factors on exotic species richness (plants, mammals, and birds) in Argentina's National Parks System. We collected data on native species richness, year of park formation, park area, region, elevation range, number of rivers crossing area boundaries, roads entering area, mean annual rainfall, mean annual temperature, mean annual number of visitors, and Human Influence Index within and surrounding each park. We compiled 1,688 exotic records in 36 protected areas: 83% plants and 17% animals (9.5% mammals, 5.5% birds, 1.5% fishes, 0% amphibians, 0% reptiles). The five parks with the most exotic species (all taxa combined) were in north Patagonia. Exotic grasses were the most common exotic plants, and within animals, lagomorphs and feral ungulates were remarkably widespread. Exotic plant richness was mostly influenced by temperature and native plant richness, while exotic mammal and bird richness was driven mostly by anthropogenic variables, with models explaining 36-45% of data deviance. Most variables that positively influenced exotic taxa were indirectly related to an increase in spatial heterogeneity (natural or anthropogenic), suggesting greater niche space variability as facilitators of exotic richness increase. Additional data are needed to further investigate the patterns and mechanisms of exotic species richness in protected areas, which will help to prioritize the greatest needs of monitoring and management.},
}
@article {pmid30200427,
year = {2018},
author = {Li, K and Scott, AM and Fissette, SD and Buchinger, TJ and Riedy, JJ and Li, W},
title = {Petromylidenes A⁻C: 2-Alkylidene Bile Salt Derivatives Isolated from Sea Lamprey (Petromyzon marinus).},
journal = {Marine drugs},
volume = {16},
number = {9},
pages = {},
pmid = {30200427},
issn = {1660-3397},
support = {137639//Great Lakes Fishery Commission/ ; },
mesh = {Animals ; Bile Acids and Salts/chemistry/isolation &amp; purification/*pharmacology ; Female ; Limit of Detection ; Magnetic Resonance Spectroscopy ; Male ; Mass Spectrometry ; Molecular Structure ; Olfactory Mucosa/*drug effects ; *Petromyzon ; Sex Attractants/chemistry/isolation &amp; purification/*pharmacology ; Sexual Behavior, Animal/*drug effects ; },
abstract = {Three novel bile acid derivatives, petromylidenes A⁻C (1⁻3), featuring uncommon alkylidene adductive scaffolds, were isolated from water conditioned with sexually mature male sea lampreys (Petromyzon marinus). Their structures were elucidated by mass spectrometry and NMR spectroscopy, and by comparison to spectral data of related structures. The identification of compounds 1⁻3, further illustrates the structural diversity of the 5α bile salt family. Compounds 1⁻3 exhibited notable biological properties as well, including high olfactory potencies in adult sea lampreys and strong behavioral attraction of ovulated female sea lampreys. Electro-olfactogram recordings indicated that the limit of detection for 1 was 10-9 M, 2 was 10-11 M, and 3 was less than 10-13 M. These results suggested 1⁻3 were likely male pheromones, which guide reproductive behaviors in the sea lamprey.},
}
@article {pmid30198171,
year = {2018},
author = {Soeth, M and Adelir-Alves, J and Loose, R and Daros, FA and Spach, HL},
title = {First record of Pomacanthus maculosus (Perciformes, Pomacanthidae) in the south-western Atlantic Ocean.},
journal = {Journal of fish biology},
volume = {93},
number = {5},
pages = {988-991},
doi = {10.1111/jfb.13791},
pmid = {30198171},
issn = {1095-8649},
support = {//CAPES/ ; },
mesh = {Animal Distribution ; Animals ; Atlantic Ocean ; Brazil ; *Introduced Species ; Perciformes/anatomy &amp; histology/classification/*physiology ; },
abstract = {A single Pomacanthus maculosus was filmed during a scuba diving survey on a rocky reef from southern Brazil. The body shape and coloration pattern confirmed the species identification. The biological and ecological characteristics of P. maculosus and the long distance of Brazil from its original distribution strongly suggest of an anthropogenic pathway of dispersion.},
}
@article {pmid30196322,
year = {2018},
author = {Kurucz, K and Kiss, V and Zana, B and Jakab, F and Kemenesi, G},
title = {Filarial nematode (order: Spirurida) surveillance in urban habitats, in the city of Pécs (Hungary).},
journal = {Parasitology research},
volume = {117},
number = {10},
pages = {3355-3360},
pmid = {30196322},
issn = {1432-1955},
mesh = {Aedes/parasitology ; Animals ; Dirofilaria immitis/classification/genetics/isolation &amp; purification/physiology ; Dirofilaria repens/classification/genetics/isolation &amp; purification/physiology ; Dirofilariasis/epidemiology/*parasitology/transmission ; Ecosystem ; Female ; Humans ; Hungary/epidemiology ; Male ; Mosquito Control ; Mosquito Vectors/classification/*parasitology/physiology ; Setaria Nematode/classification/genetics/isolation &amp; purification/physiology ; Spirurida/classification/genetics/*isolation &amp; purification/physiology ; Urban Health ; },
abstract = {As part of the seasonal mosquito control activities in the city of Pécs (Baranya County, Hungary), a total of 1123 adult female mosquitoes belonging to 18 species (including the invasive species Aedes koreicus) were collected from human-inhabited areas, using CO2-baited traps, during two consecutive years. To survey the presence and prevalence of filarial parasites in these mosquitoes, we performed a molecular survey for filarial DNA, attempted by PCR using generic primers (COI), and followed by DNA sequencing. Filaroid nematode DNA was detected in 4% of investigated mosquito pools. Out of 410 pools, 9 pools of mosquitoes were positive for Dirofilaria repens (Aedes vexans, Aedes koreicus, Coquillettidia richiardii), and/or Dirofilaria immitis (Ae. vexans, Cq. richiardii), and further 8 pools were positive for Setaria tundra (Ae. vexans, Cq. richiardii). Our study provides novel insight for prevalence of filaroid nematodes in mosquitoes occurring in close proximity to humans, thereby highlights the possible human and veterinary health importance of these mosquito species, including the recently introduced invasive mosquito Ae. koreicus.},
}
@article {pmid30192838,
year = {2018},
author = {Bieńkowski, AO and Orlova-Bienkowskaja, MJ},
title = {Alien leaf beetles (Coleoptera, Chrysomelidae) of European Russia and some general tendencies of leaf beetle invasions.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0203561},
pmid = {30192838},
issn = {1932-6203},
abstract = {Invasions of leaf beetles can cause tremendous economic consequences because some of these insects become major pests in invaded territories. We present the first inventory of alien Chrysomelidae of European Russia that appeared in the region in the 20th and 21st centuries (9 species) with analysis of the history of their invasions and detailed maps of distribution. This case study revealed some general tendencies of invasions of leaf beetles: (1) Recently, a dramatic increase in the rate of Chrysomelidae invasions is observed, which reflects the increase in international trade of living plants; (2) Alien leaf beetles can spread quickly, occupying almost all of Europe within several decades; (3) When the range of some leaf beetle species is quickly expanding, or when the species has been recorded established somewhere outside the native range, this species should be regarded as a potential invader worldwide. and (4) Alien leaf beetles usually occur on alien or cultivated plants, but some become naturalized in native communities. The specific information was the following. Two species native to the Mediterranean region, Chrysolina americana (feeds on Rosmarinus and Lavandula) and Leptomona erythrocephala (feeds on Lotus corniculatus) were recorded in European Russia for the first time. A polyphagous pest of floriculture Luperomorpha xanthodera native to China and Korea and a pest of soybeans Medythia nigrobilineata native to east Asia have been in the region since 2016. A pest of tobacco Epitrix hirtipennis native to North America has occurred since 2011. A pest of corn Diabrotica virgifera was intercepted at the border of Russia in 2011 but has not established. Three alien species have been in the region since the 20th century: Zygogramma suturalis introduced from North America for control of Ambrosia, Phyllotreta reitteri native to Afghanistan and Tajikistan and feeding on Lepidium latifolium, and the Colorado potato beetle Leptinotarsa decemlineata.},
}
@article {pmid30189395,
year = {2018},
author = {Mehmet, MI and D'Alessandro, S and Pawsey, N and Nayeem, T},
title = {The national, regional and city divide: Social media analysis of stakeholders views regarding biological controls. The public reaction to the carp control herpes virus in Australia.},
journal = {Journal of environmental management},
volume = {227},
number = {},
pages = {181-188},
doi = {10.1016/j.jenvman.2018.08.093},
pmid = {30189395},
issn = {1095-8630},
mesh = {Animals ; Australia ; Biological Control Agents ; Carps/*virology ; Communication ; Herpesvirus 1, Cercopithecine ; *Introduced Species ; Public Opinion ; *Social Media ; },
abstract = {Recent research and practice in environmental management suggest sentiment analysis of social media communication can be a useful tool in stakeholder analysis of environmental policy. This is certainly the case when it comes to the controversial use of biological controls in dealing with invasive species. Current numerical scored approaches of sentiment may not reveal the reasons for support or opposition to environmental policies in this and other areas. In this study, we examine how the use of more in-depth analysis based on what key stakeholders say about this issue in media at a national, city or regional geographic level. The analysis reveals quite different reasons for support and opposition to the biological control of carp in Australia, and that within each stakeholder group it is possible for individuals to hold conflicting views and attitudes on this issue. We find that there are concerns at the national and city level about the impact of the virus and mistrust of government and science and that the carp species may be viewed as a valuable resource. Those responding to regional media expressed hope that the virus may lead to the elimination of the carp problem, however, they were more interested in the possible impact on the local environment. The multi-scaled social media analysis of stakeholder views about the potential biological control of carp in Australia demonstrated how social media comments can be used to explore the nuanced and multidimensional nature of community attitudes and preferences.},
}
@article {pmid30188945,
year = {2018},
author = {Skubel, SA and Dushenkov, V and Graf, BL and Niu, Q and Poulev, A and Kalariya, HM and Foxcroft, LC and Raskin, I},
title = {Rapid, field-deployable method for collecting and preserving plant metabolome for biochemical and functional characterization.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0203569},
pmid = {30188945},
issn = {1932-6203},
abstract = {Study of plant metabolome is a growing field of science that catalogs vast biochemical and functional diversity of phytochemicals. However, collecting and storing samples of plant metabolome, sharing these samples across the scientific community and making them compatible with bioactivity assays presents significant challenges to the advancement of metabolome research. We have developed a RApid Metabolome Extraction and Storage (RAMES) technology that allows efficient, highly compact, field-deployable collection and storage of libraries of plant metabolome. RAMES technology combines rapid extraction with immobilization of extracts on glass microfiber filter discs. Two grams of plant tissue extracted in ethanol, using a specially adapted Dremel® rotary tool, produces 25-35 replicas of 10 mm glass fiber discs impregnated with phytochemicals. These discs can be either eluted with solvents (such as 70% ethanol) to study the metabolomic profiles or used directly in a variety of functional assays. We have developed simple, non-sterile, anti-fungal, anti-bacterial, and anti-oxidant assays formatted for 24-multiwell plates directly compatible with RAMES discs placed inside the wells. Using these methods we confirmed activity in 30 out of 32 randomly selected anti-microbial medicinal plants and spices. Seven species scored the highest activity (total kill) in the anti-bacterial (bacteria from human saliva) and two anti-fungal screens (Fusarium spp. and Saccharomyces cerevisiae), providing functional validation of RAMES technology. RAMES libraries showed limited degradation of compounds after 12 months of storage at -20°C, while others remained stable. Fifty-eight percent of structures characterized in the extracts loaded onto RAMES discs could be eluted from the discs without significant losses. Miniaturized RAMES technology, as described and validated in this manuscript offers a labor, cost, and time-effective alternative to conventional collection of phytochemicals. RAMES technology enables creation of comprehensive metabolomic libraries from various ecosystems and geographical regions in a format compatible with further biochemical and functional studies.},
}
@article {pmid30186690,
year = {2018},
author = {Tang, XT and Cai, L and Shen, Y and Du, YZ},
title = {Diversity and evolution of the endosymbionts of Bemisia tabaci in China.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5516},
pmid = {30186690},
issn = {2167-8359},
abstract = {The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex, including members that are pests of global importance. This study presents a screening of B. tabaci species in China for infection by the primary endosymbiont, Portiera aleyrodidarum, and two secondary endosymbionts, Arsenophonus and Cardinium. The results showed that P. aleyrodidarum was detected in all B. tabaci individuals, while Arsenophonus was abundant in indigenous species of B. tabaci Asia II 1, Asia II 3, and China 1 but absent in the invasive species, Middle East-Asia Minor 1 (MEAM1); Cardinium presented in the Mediterranean (MED), Asia II 1 and Asia II 3 species but was rarely detected in the MEAM1 and China 1 species. Moreover, phylogenetic analyses revealed that the P. aleyrodidarum and mitochondrial cytochrome oxidase 1 (mtCO1) phylograms were similar and corresponding with the five distinct cryptic species clades to some extent, probably indicating an ancient infection followed by vertical transmission and subsequent co-evolutionary diversification. In contrast, the phylogenetic trees of Arsenophonus and Cardinium were incongruent with the mtCO1 phylogram, potentially indicating horizontal transmission in B. tabaci cryptic species complex. Taken together, our study showed the distinct infection status of endosymbionts in invasive and indigenous whiteflies; we also most likely indicated the co-evolution of primary endosymbiont and its host as well as the potential horizontal transfer of secondary endosymbionts.},
}
@article {pmid30185798,
year = {2018},
author = {Doizy, A and Barter, E and Memmott, J and Varnham, K and Gross, T},
title = {Impact of cyber-invasive species on a large ecological network.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {13245},
pmid = {30185798},
issn = {2045-2322},
abstract = {As impacts of introduced species cascade through trophic levels, they can cause indirect and counter-intuitive effects. To investigate the impact of invasive species at the network scale, we use a generalized food web model, capable of propagating changes through networks with a series of ecologically realistic criteria. Using data from a small British offshore island, we quantify the impacts of four virtual invasive species (an insectivore, a herbivore, a carnivore and an omnivore whose diet is based on a rat) and explore which clusters of species react in similar ways. We find that the predictions for the impacts of invasive species are ecologically plausible, even in large networks. Species in the same taxonomic group are similarly impacted by a virtual invasive species. However, interesting differences within a given taxonomic group can occur. The results suggest that some native species may be at risk from a wider range of invasives than previously believed. The implications of these results for ecologists and land managers are discussed.},
}
@article {pmid30184444,
year = {2018},
author = {Lopez-Vaamonde, C and Sire, L and Rasmussen, B and Rougerie, R and Wieser, C and Allaoui, AA and Minet, J and deWaard, JR and Decaëns, T and Lees, DC},
title = {DNA barcodes reveal deeply neglected diversity and numerous invasions of micromoths in Madagascar.},
journal = {Genome},
volume = {},
number = {},
pages = {1-14},
doi = {10.1139/gen-2018-0065},
pmid = {30184444},
issn = {1480-3321},
abstract = {Madagascar is a prime evolutionary hotspot globally, but its unique biodiversity is under threat, essentially from anthropogenic disturbance. There is a race against time to describe and protect the Madagascan endangered biota. Here we present a first molecular characterization of the micromoth fauna of Madagascar. We collected 1572 micromoths mainly using light traps in both natural and anthropogenically disturbed habitats in 24 localities across eastern and northwest Madagascar. We also collected 1384 specimens using a Malaise trap in a primary rain forest at Andasibe, eastern Madagascar. In total, we DNA barcoded 2956 specimens belonging to 1537 Barcode Index Numbers (BINs), 88.4% of which are new to BOLD. Only 1.7% of new BINs were assigned to species. Of 47 different families found, Dryadaulidae, Bucculatricidae, Bedelliidae, Batrachedridae, and Blastobasidae are newly reported for Madagascar and the recently recognized Tonzidae is confirmed. For test faunas of Canada and Australia, 98.9%-99.4% of Macroheterocera BINs exhibited the molecular synapomorphy of a phenylalanine in the 177th complete DNA barcode codon. Non-macroheteroceran BINs could thus be sifted out efficiently in the Malaise sample. The Madagascar micromoth fauna shows highest affinity with the Afrotropics (146 BINs also occur in the African continent). We found 22 recognised pests or invasive species, mostly occurring in disturbed habitats. Malaise trap samples show high temporal turnover and alpha diversity with as many as 507 BINs collected; of these, astonishingly, 499 (98.4%) were novel to BOLD and 292 (57.6%) were singletons. Our results provide a baseline for future surveys across the island.},
}
@article {pmid30184067,
year = {2018},
author = {Gagnaire, PA and Lamy, JB and Cornette, F and Heurtebise, S and Dégremont, L and Flahauw, E and Boudry, P and Bierne, N and Lapègue, S},
title = {Analysis of Genome-Wide Differentiation between Native and Introduced Populations of the Cupped Oysters Crassostrea gigas and Crassostrea angulata.},
journal = {Genome biology and evolution},
volume = {10},
number = {9},
pages = {2518-2534},
pmid = {30184067},
issn = {1759-6653},
mesh = {Animals ; Asia ; *Chromosome Mapping ; Crassostrea/*genetics ; Europe ; Gene Flow ; *Genetic Variation ; Genome ; Genotype ; *Introduced Species ; Polymorphism, Single Nucleotide ; Recombination, Genetic ; Reproductive Isolation ; },
abstract = {The Pacific cupped oyster is genetically subdivided into two sister taxa, Crassostrea gigas and Crassostrea angulata, which are in contact in the north-western Pacific. The nature and origin of their genetic and taxonomic differentiation remains controversial due the lack of known reproductive barriers and the high degree of morphologic similarity. In particular, whether the presence of ecological and/or intrinsic isolating mechanisms contributes to species divergence is unknown. The recent co-introduction of both taxa into Europe offers a unique opportunity to test how genetic differentiation is maintained under new environmental and demographic conditions. We generated a pseudochromosome assembly of the Pacific oyster genome using a combination of BAC-end sequencing and scaffold anchoring to a new high-density linkage map. We characterized genome-wide differentiation between C. angulata and C. gigas in both their native and introduced ranges, and showed that gene flow between species has been facilitated by their recent co-introductions in Europe. Nevertheless, patterns of genomic divergence between species remain highly similar in Asia and Europe, suggesting that the environmental transition caused by the co-introduction of the two species did not affect the genomic architecture of their partial reproductive isolation. Increased genetic differentiation was preferentially found in regions of low recombination. Using historical demographic inference, we show that the heterogeneity of differentiation across the genome is well explained by a scenario whereby recent gene flow has eroded past differentiation at different rates across the genome after a period of geographical isolation. Our results thus support the view that low-recombining regions help in maintaining intrinsic genetic differences between the two species.},
}
@article {pmid30183733,
year = {2018},
author = {Obiakara, MC and Fourcade, Y},
title = {Climatic niche and potential distribution of Tithonia diversifolia (Hemsl.) A. Gray in Africa.},
journal = {PloS one},
volume = {13},
number = {9},
pages = {e0202421},
pmid = {30183733},
issn = {1932-6203},
mesh = {Africa ; Asteraceae/*physiology ; Central America ; *Climate ; Introduced Species ; Models, Statistical ; *Plant Dispersal ; },
abstract = {Mexican sunflower, Tithonia diversifolia (Asteraceae), is an invasive tropical plant species native to Central America. It has spread in more than 70 countries across Asia, Africa and Australia. In Africa, this species is known to disturb native crops and plant communities, but its negative impacts remain underestimated. Moreover, its potential invasion risk has not been investigated so far. A fundamental aspect in the identification and prediction of habitats susceptible to biological invasions lies in the ability of an organism to conserve or change its ecological niche as part of the invasion process. Here, we compared the realised climatic niche of T. diversifolia between its Central American and African ranges. In addition, reciprocal distribution models were calibrated on its native and invaded ranges. Models were combined and projected to current and future climatic conditions in Africa to estimate the potential distribution of this species. Niche overlap given by Schoner's D index was low (0.23), equivalency and similarity tests suggested that the climatic niche of T. diversifolia is not similar in both ranges. However the low expansion (U = 0.09) and very high stability (S = 0.92) indices support climatic niche conservatism for this species in Africa, although it has not filled its entire niche so far. Our combined reciprocal models highlight highly suitable areas for this species in humid regions throughout East, Central and West Africa, then in some parts of South Africa and Madagascar. Future projections indicated that the distribution of climatically suitable habitats will likely remain stable.},
}
@article {pmid30181256,
year = {2018},
author = {Beans, C},
title = {Core Concept: Environmental DNA helps researchers track pythons and other stealthy creatures.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {36},
pages = {8843-8845},
pmid = {30181256},
issn = {1091-6490},
mesh = {Animals ; Boidae/*physiology ; DNA/*analysis ; Florida ; *Introduced Species ; },
}
@article {pmid30179822,
year = {2019},
author = {Meira, A and Lopes-Lima, M and Varandas, S and Teixeira, A and Arenas, F and Sousa, R},
title = {Invasive crayfishes as a threat to freshwater bivalves: Interspecific differences and conservation implications.},
journal = {The Science of the total environment},
volume = {649},
number = {},
pages = {938-948},
doi = {10.1016/j.scitotenv.2018.08.341},
pmid = {30179822},
issn = {1879-1026},
mesh = {Animals ; Astacoidea/*physiology ; Corbicula/*physiology ; *Food Chain ; Fresh Water ; *Introduced Species ; Portugal ; *Rivers ; Unionidae/*physiology ; },
abstract = {Freshwater bivalves have suffered major global declines, being the introduction of invasive alien species (IAS) an important, but not well studied, mechanism of threat. This study assessed the predator-prey relationship between two non-native crayfish species (Procambarus clarkii and Pacifastacus leniusculus) and three native (Anodonta anatina, Potomida littoralis and Unio delphinus) and one non-native (Corbicula fluminea) freshwater bivalve species through experiments in laboratory and validation under natural conditions (Sabor River basin, Portugal). All native bivalve species were preyed both in laboratory and in the field; however, both crayfish species were unable to prey C. fluminea. Predation was dependent on crayfish and bivalve species but was not affected neither by crayfish nor bivalve sizes. In the laboratory, the most preyed species by both crayfishes was A. anatina. On average, this species was preyed at least 12% more than other species, when crayfishes had a choice. Similar results were found in the field. We also found signs of competition between both crayfishes, being P. clarkii more dominant and aggressive as this species, on average, manipulated the bivalves 63.6% more times and 24:33 min longer than P. leniusculus, and initiated 55.8% more agnostic bouts. Our results support the idea that P. clarkii and P. leniusculus can affect native freshwater bivalves, but clear interspecific differences were detected. Both crayfishes may have direct and indirect impacts on bivalve populations by increasing mortality or by reducing their fitness. In addition, since both crayfishes do not prey C. fluminea, they offer this IAS another advantage over native bivalves. Given the widespread distribution of both P. clarkii and P. leniusculus and the threatened status of many freshwater bivalves, the dynamics and impacts of this relationship should be taken in account in the implementation of management measures devoted to the conservation of native freshwater bivalves.},
}
@article {pmid30179229,
year = {2018},
author = {Leihy, RI and Duffy, GA and Nortje, E and Chown, SL},
title = {High resolution temperature data for ecological research and management on the Southern Ocean Islands.},
journal = {Scientific data},
volume = {5},
number = {},
pages = {180177},
pmid = {30179229},
issn = {2052-4463},
abstract = {Southern Ocean Islands are globally significant conservation areas. Predicting how their terrestrial ecosystems will respond to current and forecast climate change is essential for their management and requires high-quality temperature data at fine spatial resolutions. Existing datasets are inadequate for this purpose. Remote-sensed land surface temperature (LST) observations, such as those collected by satellite-mounted spectroradiometers, can provide high-resolution, spatially-continuous data for isolated locations. These methods require a clear sightline to measure surface conditions, however, which can leave large data-gaps in temperature time series. Using a spatio-temporal gap-filling method applied to high-resolution (~1 km) LST observations for 20 Southern Ocean Islands, we compiled a complete monthly temperature dataset for a 15-year period (2001-2015). We validated results using in situ measurements of microclimate temperature. Gap-filled temperature observations described the thermal heterogeneity of the region better than existing climatology datasets, particularly for islands with steep elevational gradients and strong prevailing winds. This dataset will be especially useful for terrestrial ecologists, conservation biologists, and for developing island-specific management and mitigation strategies for environmental change.},
}
@article {pmid30177381,
year = {2018},
author = {Gollasch, S and Hewitt, CL and Bailey, S and David, M},
title = {Introductions and transfers of species by ballast water in the Adriatic Sea.},
journal = {Marine pollution bulletin},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.marpolbul.2018.08.054},
pmid = {30177381},
issn = {1879-3363},
abstract = {Following the Editorial addressing the BALMAS project, we open the ballast water management special issue for the Adriatic Sea by providing background information on non-indigenous species and the mechanisms (vectors) of transport. Problems allocating introduction mechanisms for various species with certainty are described; in general, key introduction mechanisms are shipping, with ballast water and biofouling as dominant vectors, and aquaculture activities. The dominant mechanisms for introduction may differ through time, between regions and across species. We highlight ballast water as the focus of an international convention to prevent future introductions, reviewing management options and suggesting future research needs. This assessment is not restricted in application to the Adriatic Sea, but is applicable to other coastal waters. Results of such future work may contribute to the experience building phase planned by the International Maritime Organization for a harmonised implementation of the Ballast Water Management Convention.},
}
@article {pmid30172420,
year = {2019},
author = {Shackleton, RT and Larson, BMH and Novoa, A and Richardson, DM and Kull, CA},
title = {The human and social dimensions of invasion science and management.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {1-9},
doi = {10.1016/j.jenvman.2018.08.041},
pmid = {30172420},
issn = {1095-8630},
abstract = {Biological invasions are a leading cause of global environmental change given their effects on both humans and biodiversity. Humans introduce invasive alien species and may facilitate their establishment and spread, which can alter ecosystem services, livelihoods, and human well-being. People perceive the benefits and costs of these species through the lens of diverse value systems; these perspectives influence decisions about when and where to manage them. Despite the entanglement of humans with invasive alien species, most research on the topic has focused on their ecological aspects. Only relatively recently have the human and social dimensions of invasions started to receive sustained attention in light of their importance for understanding and governing biological invasions. This editorial draws on contributions to a special issue on the &quot;Human and Social Dimensions of Invasion Science&quot; and other literature to elucidate major trends and current contributions in this research area. We examine the relation between humans and biological invasions in terms of four crosscutting themes: (1) how people cause biological invasions; (2) how people conceptualise and perceive them; (3) how people are affected - both positively and negatively - by them; and (4) how people respond to them. We also highlight several ways in which research on the human and social dimensions of invasion science improves understanding, stakeholder engagement, and management.},
}
@article {pmid30170783,
year = {2018},
author = {Gillings, MR and Westoby, M and Ghaly, TM},
title = {Pollutants That Replicate: Xenogenetic DNAs.},
journal = {Trends in microbiology},
volume = {26},
number = {12},
pages = {975-977},
doi = {10.1016/j.tim.2018.08.003},
pmid = {30170783},
issn = {1878-4380},
abstract = {Pollution is the dissemination of material that has harmful effects. Mobile DNA elements and antibiotic-resistance genes are being disseminated into the environment via human activity, and are increasingly being viewed as serious pollutants. These pollutants differ from conventional contaminants in important ways: they can replicate, and they can evolve.},
}
@article {pmid30168645,
year = {2018},
author = {Rahel, FJ and McLaughlin, RL},
title = {Selective fragmentation and the management of fish movement across anthropogenic barriers.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {28},
number = {8},
pages = {2066-2081},
doi = {10.1002/eap.1795},
pmid = {30168645},
issn = {1051-0761},
support = {//Great Lakes Fishery Commission/ ; },
abstract = {Disruption of movement patterns due to alterations in habitat connectivity is a pervasive effect of humans on animal populations. In many terrestrial and aquatic systems, there is increasing tension between the need to simultaneously allow passage of some species while blocking the passage of other species. We explore the ecological basis for selective fragmentation of riverine systems where the need to restrict movements of invasive species conflicts with the need to allow passage of species of commercial, recreational, or conservation concern. We develop a trait-based framework for selective fish passage based on understanding the types of movements displayed by fishes and the role of ecological filters in determining the spatial distributions of fishes. We then synthesize information on trait-based mechanisms involved with these filters to create a multidimensional niche space based on attributes such as physical capabilities, body morphology, sensory capabilities, behavior, and movement phenology. Following this, we review how these mechanisms have been applied to achieve selective fish passage across anthropogenic barriers. To date, trap-and-sort or capture-translocation efforts provide the best options for movement filters that are completely species selective, but these methods are hampered by the continual, high cost of manual sorting. Other less effective methods of selective passage risk collateral damage in the form of lower or higher than desired levels of passage. Fruitful areas for future work include using combinations of ecological and behavioral traits to passively segregate species; using taxon-specific chemical or auditory cues to direct unwanted species away from passageways and into physical or ecological traps while attracting desirable species to passageways; and developing automated sorting mechanisms based on fish recognition systems. The trait-based approach proposed for fish could serve as a template for selective fragmentation in other ecological systems.},
}
@article {pmid30168641,
year = {2019},
author = {Hill, MP and Binns, M and Umina, PA and Hoffmann, AA and Macfadyen, S},
title = {Climate, human influence and the distribution limits of the invasive European earwig, Forficula auricularia, in Australia.},
journal = {Pest management science},
volume = {75},
number = {1},
pages = {134-143},
doi = {10.1002/ps.5192},
pmid = {30168641},
issn = {1526-4998},
support = {CSE00059//Grains Research &amp; Development Corporation/ ; },
mesh = {*Animal Distribution ; Animals ; Australia ; *Climate ; *Ecosystem ; Insecta/*physiology ; *Introduced Species ; Models, Biological ; },
abstract = {BACKGROUND: By modelling species-environment relationships of pest species, it is possible to understand potential limits to their distributions when they invade new regions, and their likely continued spread. The European earwig, Forficula auricularia, is a non-native invasive species in Australia that has been in the country for over 170 years. However, in the last few decades it has invaded new areas. Unlike in other countries, F. auricularia is a pest species of grain production in Australia. In this study we detail the Australian distribution of this species, adding new samples focused around grain-growing regions. Using this information, we build global species distribution models for F. auricularia to better understand species-environment relationships.<br><br>RESULTS: Our models indicate that the distribution of F. auricularia is strongly associated with temperate through to semi-arid environments, a high winter rainfall and pronounced temperature seasonality. We identified regions that hold suitable, but as yet vacant, niche space for Australian populations, suggesting further potential for range expansion. Beyond climate, an index describing human influence on the landscape was important to understand the distribution limits of this pest. We identified regions where there was suitable climate space, but which F. auricularia has not occupied, probably due to low levels of human impact.<br><br>CONCLUSION: Modelling the global distribution of a non-native pest species aided understanding of the regional distribution limits within Australia and highlighted the usefulness of human impact measures for modelling globally invasive insect species. © 2018 Society of Chemical Industry.},
}
@article {pmid30168152,
year = {2019},
author = {Eastwood, G and Cunningham, AA and Kramer, LD and Goodman, SJ},
title = {The vector ecology of introduced Culex quinquefasciatus populations, and implications for future risk of West Nile virus emergence in the Galápagos archipelago.},
journal = {Medical and veterinary entomology},
volume = {33},
number = {1},
pages = {44-55},
doi = {10.1111/mve.12329},
pmid = {30168152},
issn = {1365-2915},
support = {162-12-17, EIDPO15//Darwin Initiative for the Survival of Species, Department for the Environment, Food and Rural Affairs, U.K. government/ ; 183614//Natural Environment Research Council/ ; },
abstract = {Culex quinquefasciatus Say (Diptera: Culicidae), an important vector of West Nile virus (WNV) in the U.S.A., was first detected on the Galápagos Islands (Ecuador) in the 1980s. However, little is known of its ecology, distribution or capacity for arbovirus transmission in the Galápagos. We characterize details of lifecycle (including gonotrophic period), temporal abundance, spatial distribution, vector competence and host-feeding behaviour. Culex quinquefasciatus was detected on five islands of the Galápagos during 2006-2011. A period of 7-14 days was required for egg-adult emergence; water salinity above 5 ppt was demonstrated to hinder larval development. Blood-meal analysis indicated feeding on reptiles, birds and mammals. Assessment of WNV vector competency of Galápagos C. quinquefasciatus showed a median infectious dose of 7.41 log10 plaque-forming units per millilitre and evidence of vertical transmission (minimal filial infection rate of 3.7 per 1000 progeny). The distribution of C. quinquefasciatus across the archipelago could be limited by salt intolerance, and its abundance constrained by high temperatures. Feeding behaviour indicates potential to act as a bridge vector for transmission of pathogens across multiple taxa. Vertical transmission is a potential persistence mechanism for WNV on Galápagos. Together, our results can be used for epidemiological assessments of WNV and target vector control, should this pathogen reach the Galápagos Islands.},
}
@article {pmid30167793,
year = {2018},
author = {Ancillotto, L and Studer, V and Howard, T and Smith, VS and McAlister, E and Beccaloni, J and Manzia, F and Renzopaoli, F and Bosso, L and Russo, D and Mori, E},
title = {Environmental drivers of parasite load and species richness in introduced parakeets in an urban landscape.},
journal = {Parasitology research},
volume = {117},
number = {11},
pages = {3591-3599},
pmid = {30167793},
issn = {1432-1955},
support = {ES1304 &quot;Parrotnet&quot;//European Cooperation in Science and Technology/ ; ES1304 &quot;Parrotnet//European Cooperation in Science and Technology/ ; },
mesh = {Animals ; Bird Diseases/*parasitology/*transmission ; Ecosystem ; Host Specificity ; *Introduced Species ; Italy ; *Parasite Load ; Parasites/classification/isolation &amp; purification ; Population Density ; Psittacula/*parasitology ; },
abstract = {Introduced species represent a threat to native wildlife worldwide, due to predation, competition, and disease transmission. Concurrent introduction of parasites may also add a new dimension of competition, i.e. parasite-mediated competition, through spillover and spillback dynamics. Urban areas are major hotspots of introduced species, but little is known about the effects of urban habitat structure on the parasite load and diversity of introduced species. Here, we investigated such environmental effects on the ectoparasite load, richness, and occurrence of spillback in two widespread invasive parakeets, Psittacula krameri and Myiopsitta monachus, in the metropolitan area of Rome, central Italy. We tested 231 parakeets and found that in both species parasite load was positively influenced by host abundance at local scale, while environmental features such as the amount of natural or urban habitats, as well as richness of native birds, influenced parasite occurrence, load, and richness differently in the two host species. Therefore, we highlight the importance of host population density and habitat composition in shaping the role of introduced parakeets in the spread of both native and introduced parasites, recommending the monitoring of urban populations of birds and their parasites to assess and manage the potential occurrence of parasite-mediated competition dynamics as well as potential spread of vector-borne diseases.},
}
@article {pmid30167769,
year = {2018},
author = {Potgieter, LJ and Gaertner, M and Irlich, UM and O'Farrell, PJ and Stafford, L and Vogt, H and Richardson, DM},
title = {Correction to: Managing Urban Plant Invasions: a Multi-Criteria Prioritization Approach.},
journal = {Environmental management},
volume = {62},
number = {6},
pages = {1186-1189},
doi = {10.1007/s00267-018-1096-4},
pmid = {30167769},
issn = {1432-1009},
abstract = {The original version of the article unfortunately contained an error with the figure captions. The appropriate captions for Fig. 3-6 are published accordingly. The original article has been corrected.},
}
@article {pmid30167760,
year = {2018},
author = {Carmosini, N and Gillis, R and Ismail, A and Sandland, GJ},
title = {A Pilot Evaluation of the Toxicity of EarthTec® QZ on Invasive (Bithynia tentaculata) and Native (Physa gyrina) Snail Species from the Upper Mississippi River.},
journal = {Bulletin of environmental contamination and toxicology},
volume = {101},
number = {4},
pages = {428-433},
doi = {10.1007/s00128-018-2427-0},
pmid = {30167760},
issn = {1432-0800},
mesh = {Animals ; Copper/*toxicity ; Embryo, Nonmammalian/drug effects ; Embryonic Development/drug effects ; Molluscacides/*toxicity ; Pilot Projects ; Rivers ; Snails/*drug effects/embryology/growth &amp; development ; Species Specificity ; Water Pollutants, Chemical/*toxicity ; },
abstract = {We used a comparative approach to investigate the effects of a copper-based pesticide (EarthTec® QZ) on embryos of an invasive snail (Bithynia tentaculata) and a native snail (Physa gyrina). Embryos were exposed to one of three treatments: control (0 mg/L Cu2+), low-dose (0.1 mg/L Cu2+), or high-dose (0.6 mg/L Cu2+), which reflect manufacturer-recommended low and medium 4-day molluscicide treatment concentrations. Exposure to 0.6 mg/L Cu2+ over 4 days generated 100% mortality in both invasive and native snail embryos; however, reducing the exposure time from 4 to 1 day resulted in 100% mortality in B. tentaculata but some hatching (7%) in P. gyrina. In contrast, embryos of both species exposed to 0.1 mg/L Cu2+ treatment for 4 days showed almost 100% survivorship. Further manipulations of Cu2+ concentrations and exposure times may yield regimes that maximize mortality in B. tentaculata while minimizing negative impacts on native species.},
}
@article {pmid30166625,
year = {2018},
author = {Jiang, D and Chen, S and Hao, M and Fu, J and Ding, F},
title = {Mapping the Potential Global Codling Moth (Cydia pomonella L.) Distribution Based on a Machine Learning Method.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {13093},
pmid = {30166625},
issn = {2045-2322},
abstract = {The spread of invasive species may pose great threats to the economy and ecology of a region. The codling moth (Cydia pomonella L.) is one of the 100 worst invasive alien species in the world and is the most destructive apple pest. The economic losses caused by codling moths are immeasurable. It is essential to understand the potential distribution of codling moths to reduce the risks of codling moth establishment. In this study, we adopted the Maxent (Maximum Entropy Model), a machine learning method to predict the potential global distribution of codling moths with global accessibility data, apple yield data, elevation data and 19 bioclimatic variables, considering the ecological characteristics and the spread channels that cover the processes from growth and survival to the dispersion of the codling moth. The results show that the areas that are suitable for codling moth are mainly distributed in Europe, Asia and North America, and these results strongly conformed with the currently known occurrence regions. In addition, global accessibility, mean temperature of the coldest quarter, precipitation of the driest month, annual mean temperature and apple yield were the most important environmental predictors associated with the global distribution of codling moths.},
}
@article {pmid30166480,
year = {2018},
author = {Gomez-Uchida, D and Sepúlveda, M and Ernst, B and Contador, TA and Neira, S and Harrod, C},
title = {Chile's salmon escape demands action.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6405},
pages = {857-858},
doi = {10.1126/science.aau7973},
pmid = {30166480},
issn = {1095-9203},
mesh = {Animals ; *Aquaculture ; Chile ; *Introduced Species ; *Salmon ; },
}
@article {pmid30161016,
year = {2019},
author = {Urakova, N and Hall, R and Strive, T and Frese, M},
title = {Restricted Host Specificity of Rabbit Hemorrhagic Disease Virus Is Supported by Challenge Experiments in Immune-compromised Mice (Mus musculus).},
journal = {Journal of wildlife diseases},
volume = {55},
number = {1},
pages = {218-222},
doi = {10.7589/2018-03-067},
pmid = {30161016},
issn = {1943-3700},
abstract = {Rabbit hemorrhagic disease virus (RHDV) is a highly contagious calicivirus that causes peracute hemorrhagic fever and frequently kills rabbits before an effective adaptive immune response can be developed. In Australia and New Zealand, RHDV is employed to manage wild European rabbit (Oryctolagus cuniculus) populations. Although there is no evidence that RHDV replicates in animals other than lagomorphs, the detection of RHDV-specific antibodies and RHDV RNA in mice and other species has raised concerns about the host specificity of the virus. To investigate the replication potential of RHDV in mice (Mus musculus), standard laboratory mice and knockout animals that lack a functional interferon type I receptor were challenged with high doses of RHDV. None of the animals developed clinical signs of illness, and temporal quantification of the viral RNA by real-time PCR did not reveal signs of virus amplification. These data suggest that RHDV cannot replicate in mice-not even in animals with a severely compromised innate immune system.},
}
@article {pmid30160314,
year = {2019},
author = {Lang, PLM and Willems, FM and Scheepens, JF and Burbano, HA and Bossdorf, O},
title = {Using herbaria to study global environmental change.},
journal = {The New phytologist},
volume = {221},
number = {1},
pages = {110-122},
doi = {10.1111/nph.15401},
pmid = {30160314},
issn = {1469-8137},
support = {BO 3241/7-1//German Research Foundation/ ; BU 3422/1-1//German Research Foundation/ ; //Presidential Innovation Fund of the Max Planck Society/ ; },
abstract = {During the last centuries, humans have transformed global ecosystems. With their temporal dimension, herbaria provide the otherwise scarce long-term data crucial for tracking ecological and evolutionary changes over this period of intense global change. The sheer size of herbaria, together with their increasing digitization and the possibility of sequencing DNA from the preserved plant material, makes them invaluable resources for understanding ecological and evolutionary species' responses to global environmental change. Following the chronology of global change, we highlight how herbaria can inform about long-term effects on plants of at least four of the main drivers of global change: pollution, habitat change, climate change and invasive species. We summarize how herbarium specimens so far have been used in global change research, discuss future opportunities and challenges posed by the nature of these data, and advocate for an intensified use of these 'windows into the past' for global change research and beyond.},
}
@article {pmid30159631,
year = {2018},
author = {Loureiro, TG and Anastácio, PM and Bueno, SLS and Araujo, PB},
title = {Management of invasive populations of the freshwater crayfish Procambarus clarkii (Decapoda, Cambaridae): test of a population-control method and proposal of a standard monitoring approach.},
journal = {Environmental monitoring and assessment},
volume = {190},
number = {9},
pages = {559},
pmid = {30159631},
issn = {1573-2959},
mesh = {Animals ; Astacoidea/*growth &amp; development ; *Biodiversity ; Brazil ; Environmental Monitoring/*methods ; *Fresh Water ; *Introduced Species ; Population Density ; Population Dynamics ; },
abstract = {Invasive species are one of the main threats to biodiversity. When an alien species is introduced into a new environment, fast identification and definition of management strategies may avoid or minimize impacts. When an invasive species is already established, the most adopted approaches are population control and monitoring. In order to perform such strategies, assessment of characteristics of the invasive population is imperative. This study tested a new method of population size estimation and monitoring in an invasive population of crayfish Procambarus clarkii in a conservation area in the Atlantic Rain Forest (Southeastern Brazil). The population dynamics was studied for 1 year to examine the efficacy of the selected method and to evaluate if the population is stable. Later, the effect of periodical removal of animals on the population size was tested. The method of population estimation used in this study proved to be very effective. We recommend using it to monitor invasive populations of P. clarkii. The population size varied discretely over the year with variable but low growth rate, indicating that the population is already established which introduce a notable threat to native species. The continuous removal of specimens proved to be inefficient since the growth rate was higher after the removal. One intensive removal event might be more effective than a continuous moderate removal as the one applied in this study.},
}
@article {pmid30159528,
year = {2017},
author = {Broadhurst, L and Coates, D},
title = {Plant conservation in Australia: Current directions and future challenges.},
journal = {Plant diversity},
volume = {39},
number = {6},
pages = {348-356},
pmid = {30159528},
issn = {2468-2659},
abstract = {Australia is a large, old and flat island continent that became isolated following the breakup of the Gondwanan super continent. After more than 40-50 M years of independent evolution, approx. 600,000-700,000 species now call Australia home. More than 21,000 of these species are plants, with at least 84% of these being endemic. Plant taxa are protected, conserved and managed under a range of legislation at the State- and Territory-level as well as Federally for matters of national significance. This can create issues of misalignment among threatened species lists but generally there is co-operation among conservation agencies to reduce misalignments and to manage species irrespective of jurisdictional borders. Despite significant investment in programs designed to assist the recovery of Australian biodiversity, threatened plants in particular appear to be continuing to decline. This can be attributed to a range of factors including major threatening processes associated with habitat loss and invasive species, lack of public awareness of the cultural and socio-economic value of plant conservation, and our relatively poor understanding of basic species taxonomy and biology, especially for those species that have specific interactions with pollinators, symbionts and herbivores. A recent shift in Federally-based conservation programs has been to identify 30 key plant species for recovery through the setting of measurable targets, improving the support provided to recovery teams and encouraging industry, business and philanthropy to support conservation actions.},
}
@article {pmid30158167,
year = {2018},
author = {Moser, D and Lenzner, B and Weigelt, P and Dawson, W and Kreft, H and Pergl, J and Pyšek, P and van Kleunen, M and Winter, M and Capinha, C and Cassey, P and Dullinger, S and Economo, EP and García-Díaz, P and Guénard, B and Hofhansl, F and Mang, T and Seebens, H and Essl, F},
title = {Remoteness promotes biological invasions on islands worldwide.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {115},
number = {37},
pages = {9270-9275},
pmid = {30158167},
issn = {1091-6490},
mesh = {*Introduced Species ; *Islands ; *Models, Biological ; *Tropical Climate ; },
abstract = {One of the best-known general patterns in island biogeography is the species-isolation relationship (SIR), a decrease in the number of native species with increasing island isolation that is linked to lower rates of natural dispersal and colonization on remote oceanic islands. However, during recent centuries, the anthropogenic introduction of alien species has increasingly gained importance and altered the composition and richness of island species pools. We analyzed a large dataset for alien and native plants, ants, reptiles, mammals, and birds on 257 (sub) tropical islands, and showed that, except for birds, the number of naturalized alien species increases with isolation for all taxa, a pattern that is opposite to the negative SIR of native species. We argue that the reversal of the SIR for alien species is driven by an increase in island invasibility due to reduced diversity and increased ecological naiveté of native biota on the more remote islands.},
}
@article {pmid30155365,
year = {2018},
author = {Mahon, AR and Horton, DJ and Learman, DR and Nathan, LR and Jerde, CL},
title = {Investigating diversity of pathogenic microbes in commercial bait trade water.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5468},
pmid = {30155365},
issn = {2167-8359},
abstract = {The recreational bait trade is a potential pathway for pathogen introduction and spread when anglers dump bait shop sourced water into aquatic systems. Despite this possibility, and previous recognition of the importance of the bait trade in the spread of aquatic invasive species (AIS), to date there has been no region wide survey documenting pathogens in retail bait shops. In this study, we analyzed 96 environmental DNA samples from retail bait shops around the Great Lakes region to identify pathogens, targeting the V4 hypervariable region of the 16S rRNA gene. Additionally, we used samples from one site in Lake Michigan as a comparison to pathogen diversity and abundance in natural aquatic systems. Our results identified nine different groups of pathogens in the bait shop samples, including those that pose risks to both humans and fish species. Compared to wild sourced samples, the bait shops had higher relative abundance and greater taxonomic diversity. These findings suggest that the bait trade represents a potentially important pathway that could introduce and spread pathogens throughout the Great Lakes region. Improving pathogen screening and angler outreach should be used in combination to aid in preventing the future spread of high risk pathogens.},
}
@article {pmid30152576,
year = {2018},
author = {Fogell, DJ and Martin, RO and Bunbury, N and Lawson, B and Sells, J and McKeand, AM and Tatayah, V and Trung, CT and Groombridge, JJ},
title = {Trade and conservation implications of new beak and feather disease virus detection in native and introduced parrots.},
journal = {Conservation biology : the journal of the Society for Conservation Biology},
volume = {32},
number = {6},
pages = {1325-1335},
doi = {10.1111/cobi.13214},
pmid = {30152576},
issn = {1523-1739},
support = {//Durrell Institute of Conservation and Ecology/ ; },
abstract = {Psittacine beak and feather disease (PBFD), caused by Beak and feather disease virus (BFDV), has spread rapidly around the world, raising concerns for threatened species conservation and biosecurity associated with the global pet bird trade. The virus has been reported in several wild parrot populations, but data are lacking for many taxa and geographical areas with high parrot endemism. We aimed to advance understanding of BFDV distribution in many data-deficient areas and determine phylogenetic and biogeographic associations of the virus in 5 parrot species across Africa, the Indian Ocean islands, Asia, and Europe and focused specifically on the highly traded and invasive Psittacula krameri. Blood, feather, and tissue samples were screened for BFDV through standard polymerase chain reaction. Isolates obtained from positive individuals were then analyzed in a maximum likelihood phylogeny along with all other publically available global BFDV sequences. We detected BFDV in 8 countries where it was not known to occur previously, indicating the virus is more widely distributed than currently recognized. We documented for the first time the presence of BFDV in wild populations of P. krameri within its native range in Asia and Africa. We detected BFDV among introduced P. krameri in Mauritius and the Seychelles, raising concerns for island endemic species in the region. Phylogenetic relationships between viral sequences showed likely pathways of transmission between populations in southern Asia and western Africa. A high degree of phylogenetic relatedness between viral variants from geographically distant populations suggests recent introductions, likely driven by global trade. These findings highlight the need for effective regulation of international trade in live parrots, particularly in regions with high parrot endemism or vulnerable taxa where P. krameri could act as a reservoir host.},
}
@article {pmid30152089,
year = {2019},
author = {Heberling, JM and Cassidy, ST and Fridley, JD and Kalisz, S},
title = {Carbon gain phenologies of spring-flowering perennials in a deciduous forest indicate a novel niche for a widespread invader.},
journal = {The New phytologist},
volume = {221},
number = {2},
pages = {778-788},
doi = {10.1111/nph.15404},
pmid = {30152089},
issn = {1469-8137},
support = {DEB 1457531//US National Science Foundation/ ; DEB 144552//US National Science Foundation/ ; DEB 0958676//US National Science Foundation/ ; DBI 1612079//US National Science Foundation/ ; //University of Tennessee Knoxville/ ; },
abstract = {Strategies of herbaceous species in deciduous forests are often characterized by the timing of life history phases (e.g. emergence, flowering, leaf senescence) relative to overstory tree canopy closure. Although springtime photosynthesis is assumed to account for the majority of their annual carbon budgets, the 12-month photosynthetic trajectories of forest herbs have not been quantified. We measured the temporal dynamics of carbon assimilation for seven native herbaceous perennials and the biennial Alliaria petiolata, a widespread invader in eastern North American forests. We assessed the relative importance of spring, summer, and autumn to species-level annual carbon budgets. Spring-emerging species showed significant variation in carbon assimilation patterns. High spring irradiance before canopy closure accounted for 39-100% of species-level annual carbon assimilation, but summer and autumn accounted for large proportions of some species' carbon budgets (up to 58% and 19%, respectively). Alliaria was phenologically unique, taking advantage both autumn and spring irradiance. Although spring-emerging understory species are often expected to rely on early-season irradiance, our results highlight interspecific differences and the importance of mid-late season carbon gain. Phenological strategies of forest herbs are a continuum rather than discrete categories, and invasive species may follow strategies that are underrepresented in the native flora.},
}
@article {pmid30151173,
year = {2018},
author = {Poidatz, J and Monceau, K and Bonnard, O and Thiéry, D},
title = {Activity rhythm and action range of workers of the invasive hornet predator of honeybees Vespa velutina, measured by radio frequency identification tags.},
journal = {Ecology and evolution},
volume = {8},
number = {15},
pages = {7588-7598},
pmid = {30151173},
issn = {2045-7758},
abstract = {In social insects, the activity rhythm of foragers and their action range determinate the activity of the colony. In vespids, which are mostly predators, the foraging range of workers determines their maximum predation pressure round the nest. One of these species, Vespa velutina, a recently invasive species introduced into Europe, exerts a strong predation on honeybees at the hive. Therefore, the definition of its activity rhythm and spatial range of predation is of primary importance. Using radio frequency identification tags (RFID), two experiments were carried out to (a) determine their return ability (called homing) in releasing 318 individuals at different distance from their colony and (b) monitor their foraging activity rhythm and the duration of their flights based on 71 individuals followed 24 hr/24 during 2 months. The homing ability of V. velutina was evaluated to be up to 5,000 m and was not affected by the cardinal orientation of release point. The lag time to return to the nest increased with the distance of release. Most of the flight activity took place between 07:00 a.m. and 08:00 p.m., hornets doing principally short flights of less than an hour. Foraging range was thus estimated ca. 1,000 m around the nest. This study of V. velutina assisted by RFID tags provides for the first time a baseline for its potential foraging distance that increase our knowledge of this species to (a) refine more accurately models for risk assessment and (b) define security perimeter for early detection of predation on invasion front.},
}
@article {pmid30151157,
year = {2018},
author = {Montesinos, D and Callaway, RM},
title = {Traits correlate with invasive success more than plasticity: A comparison of three Centaurea congeners.},
journal = {Ecology and evolution},
volume = {8},
number = {15},
pages = {7378-7385},
pmid = {30151157},
issn = {2045-7758},
abstract = {The importance of phenotypic plasticity for successful invasion by exotic plant species has been well studied, but with contradictory and inconclusive results. However, many previous studies focused on comparisons of native and invasive species that co-occur in a single invaded region, and thus on species with potentially very different evolutionary histories. We took a different approach by comparing three closely related Centaurea species: the highly invasive C. solstitialis, and the noninvasive but exotic C. calcitrapa and C. sulphurea. These species have overlapping distributions both in their native range of Spain and in their non-native range of California. We collected seeds from 3 to 10 populations from each region and species and grew them in common garden greenhouse conditions to obtain an F1 generation in order to reduce maternal effects. Then, F1 seeds were grown subjected to simulated herbivory, variation in nutrient availability, and competition, to explore plasticity in the responses to these conditions. We found little variation in phenotypic plasticity among species and regions, but C. solstitialis plants from California produced more biomass in competition than their Spanish conspecifics. This species also had the highest relative growth rates when in competition and when grown under low nutrient availability. Noninvasive congeners produced intermediate or opposite patterns.},
}
@article {pmid30149024,
year = {2018},
author = {de Oliveira Santos, F and Teixeira, BR and Passos Cordeiro, JL and de Sousa, RHA and Lucio, CDS and Gonçalves, PR and Lemos, H and de Oliveira, RC and Fernandes, J and Cavalcanti, GR and de Lemos, ERS and D'Andrea, PS},
title = {Expansion of the range of Necromys lasiurus (Lund, 1841) into open areas of the Atlantic Forest biome in Rio de Janeiro state, Brazil, and the role of the species as a host of the hantavirus.},
journal = {Acta tropica},
volume = {188},
number = {},
pages = {195-205},
doi = {10.1016/j.actatropica.2018.08.026},
pmid = {30149024},
issn = {1873-6254},
mesh = {Animals ; Brazil/epidemiology ; Disease Reservoirs ; Forests ; *Hantavirus ; Hantavirus Infections/*veterinary ; Rodentia/*virology ; },
abstract = {Necromys lasiurus is a generalist rodent that is thought to be the main reservoir of the Araraquara hantavirus, which causes Hantavirus Pulmonary Syndrome, in the Brazilian Cerrado savanna. This species occurs naturally in the open habitats of the Cerrado, Pantanal and Caatinga biomes, where it often occurs at high densities, although the distribution of the species has recently been observed expanding into the Brazilian state of Rio de Janeiro. This study aimed to map the occurrence of N. lasiurus within the Atlantic Forest of Rio de Janeiro state and discuss the potential role of the species as a reservoir of the Araraquara hantavirus in these areas. The study was based on a comprehensive literature search and four expeditions for the collection of specimens in the state of Rio de Janeiro. The data were used to predict the distribution of N. lasiurus, confirm the distribution of the species in the state, and detect the rates of hantavirus infection in these rodents. Necromys lasiurus has been recorded at 16 localities in 10 municipalities of Rio de Janeiro state. The relative abundance of N. lasiurus was low at all localities, except for the REBIO Poço das Antas and APA-BRSJ, two protected areas. Necromys lasiurus was associated primarily with landscapes dominated by farmland (plantations or pasture) at relatively low altitudes in the vicinity of bodies of water. A total of 204 serum samples were collected, but none were reactive for hantavirus. The distribution of N. lasiurus is expanding into many areas of the anthropogenic matrix, but it is not usually either abundant or dominant in these areas. The relatively reduced abundance of N. lasiurus in Rio de Janeiro and the lack of infection in all the areas investigated indicate that it is unlikely to be a reservoir of hantavirus in this region in the near future.},
}
@article {pmid30145614,
year = {2019},
author = {Tyburska-Woś, J and Nowak, K and Kieliszewska-Rokicka, B},
title = {Influence of leaf damage by the horse chestnut leafminer (Cameraria ohridella Deschka &amp; Dimić) on mycorrhiza of Aesculus hippocastanum L.},
journal = {Mycorrhiza},
volume = {29},
number = {1},
pages = {61-67},
doi = {10.1007/s00572-018-0862-8},
pmid = {30145614},
issn = {1432-1890},
mesh = {Aesculus/*microbiology/*physiology ; Animals ; *Herbivory ; Introduced Species ; Larva/growth &amp; development/physiology ; Moths/growth &amp; development/*physiology ; Mycorrhizae/*physiology ; Plant Leaves/*physiology ; Poland ; },
abstract = {In many parts of Europe, the white horse chestnut (Aesculus hippocastanum L.) has been attacked by the horse chestnut leafminer (Cameraria ohridella Deschka &amp; Dimić), which causes premature leaf dieback. A. hippocastanum L. establishes mutualistic symbiosis with arbuscular mycorrhizal (AM) fungi. This study involved a comparison of mature A. hippocastanum individuals susceptible to C. ohridella and individuals resistant to this insect after a one-time treatment with a chemical preparation injected into the tree trunks 7 years before the investigation began. Concentration of macronutrients in soil and the activity of soil nonspecific dehydrogenase did not differ between soils under canopies of the treated and untreated trees. Concentrations of C and N were significantly higher in leaves of the treated than those of the untreated trees. The infestation by C. ohridella and defoliation of leaves of the untreated trees did not significantly influence the frequency and intensity of AM colonization compared to the chemically treated trees, although a tendency towards higher average AM colonization of roots of the untreated trees, infested by the herbivores, than roots of the non-infested trees was observed. The results also indicated a tendency for higher biomass of fine roots per soil volume under the trees treated against C. ohridella than under the trees invaded by the insect.},
}
@article {pmid30145518,
year = {2018},
author = {D'Alessandro, M and Esposito, V and Porporato, EMD and Berto, D and Renzi, M and Giacobbe, S and Scotti, G and Consoli, P and Valastro, G and Andaloro, F and Romeo, T},
title = {Relationships between plastic litter and chemical pollutants on benthic biodiversity.},
journal = {Environmental pollution (Barking, Essex : 1987)},
volume = {242},
number = {Pt B},
pages = {1546-1556},
doi = {10.1016/j.envpol.2018.08.002},
pmid = {30145518},
issn = {1873-6424},
mesh = {Animals ; *Biodiversity ; Ecology ; Environmental Monitoring ; Introduced Species ; Mediterranean Sea ; Mollusca/classification ; Plastics/*analysis ; Polychaeta/classification ; Water Pollutants, Chemical/*analysis ; },
abstract = {Five Descriptors (D) of Marine Strategy Framework Directive (MSFD): marine litter (D10), non-indigenous species (D2) and organic and inorganic pollutants (D8), were estimated in a coastal area of GSA 16 (Augusta harbour, Central Mediterranean Sea) in order to study their effects on the biodiversity (D1) of the benthic community D6) and to improve data for the MSFD. Investigation of plastic debris had led to the identification of 38 fragments divided into four categories, among which microplastics resulted as the most abundant. Six non-indigenous species, belonging to Polychaeta (Kirkegaardia dorsobranchialis, Notomastus aberans, Pista unibranchia, Pseudonereis anomala, Branchiomma bairdi) and Mollusca (Brachidontes pharaonis) were found. Biodiversity and benthic indices suggested a generalised, slightly disturbed ecological status. Anthracene, Zinc and Chrome were the most abundant chemical compounds in analysed sediments. Significant correlations were found between the abundance of trace elements vs biotic indices and between plastic debris vs biodiversity and benthic indices. This study represents the first report about the abundance of plastic debris and its relationship to contaminants and infauna in Augusta harbour. Our results can provide useful information for national and international laws and directives.},
}
@article {pmid30145257,
year = {2018},
author = {Kuhlisch, C and Kampen, H and Walther, D},
title = {The Asian tiger mosquito Aedes albopictus (Diptera: Culicidae) in Central Germany: Surveillance in its northernmost distribution area.},
journal = {Acta tropica},
volume = {188},
number = {},
pages = {78-85},
doi = {10.1016/j.actatropica.2018.08.019},
pmid = {30145257},
issn = {1873-6254},
mesh = {*Aedes ; Animals ; Germany ; Population Density ; Population Surveillance ; Temperature ; },
abstract = {The invasive Asian tiger mosquito Aedes albopictus has recently been observed in southern Germany for the first time to reproduce and even overwinter north of the Alps. After the accidental capture of adult specimens in Jena, German federal state of Thuringia, in mid-2015, regular inspections brought forth developmental stages until autumn 2015, indicating local reproduction. Surveillance activities implemented in 2016 showed larvae already in early May, suggesting overwintering, and throughout the season until late October, although population densities remained low. Further sporadic specimens found in 2017 argue for establishment. Jena is located in Central Germany, north of all known distribution areas of Ae. albopictus, with the area of the municipality affected by the tiger mosquito characterised by a relatively mild climate. To check the suitability of the local climate for Ae. albopictus, winter temperatures, measured in a cemetery of Jena where larvae had regularly been found in 2015 and 2016, were analysed and compared with two sites of establishment in southern Germany. The conditions were similar at all three locations, suggesting that the Jena population might also be able to survive in the long term. While the municipality authorities have been informed and education of the Jena citizens to avoid producing potential breeding places has started, insecticidal control has not yet been implemented.},
}
@article {pmid30143314,
year = {2019},
author = {Villatoro, FJ and Naughton-Treves, L and Sepúlveda, MA and Stowhas, P and Mardones, FO and Silva-Rodríguez, EA},
title = {When free-ranging dogs threaten wildlife: Public attitudes toward management strategies in southern Chile.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {67-75},
doi = {10.1016/j.jenvman.2018.06.035},
pmid = {30143314},
issn = {1095-8630},
abstract = {Free-ranging dogs (Canis familiaris) significantly threaten wildlife, including endangered species. Although this problem resembles threats from other invasive animals, managing roaming dogs is even more fraught due to their close association with humans. Here we use interviews (n = 166) to document patterns of dog ownership and care and to measure public attitudes toward management strategies to control free-roaming dogs that threaten wildlife in rural areas of southern Chile. We compare attitudes toward lethal control and fines in scenarios where dogs attack livestock, children or wild animals or enter protected areas. We also test for variation in attitudes according to gender, age, education and proximity to urban areas. Most respondents (98.1%) opposed lethal control for at least one scenario and they were more likely to accept killing dogs that attacked sheep than those attacking wildlife. Similarly, support for fines was higher when dogs attacked livestock or people versus wild animals. Respondents consistently favored fining the owner over eliminating the problem dog. When asked about their management preferences, many respondents indicated that the movement of problem dogs-including to a lesser extent those threatening wildlife-should be restricted. However, in practice most dog-owners allowed one or more of their dogs to move freely at least part of the time. Finally, the wildlife species of concern mattered, e.g. 40% thought no action was necessary when dogs attack foxes, but this dropped to 12% for pudu (a small deer). In sum, participants had significantly more concern for livestock and human safety than for wildlife protection. We close by discussing management and policy implications.},
}
@article {pmid30143130,
year = {2018},
author = {Martínez-Sanz, M and Erboz, E and Fontes, C and López-Rubio, A},
title = {Valorization of Arundo donax for the production of high performance lignocellulosic films.},
journal = {Carbohydrate polymers},
volume = {199},
number = {},
pages = {276-285},
doi = {10.1016/j.carbpol.2018.07.029},
pmid = {30143130},
issn = {1879-1344},
abstract = {This work reports on the valorization of the biomass from the aquatic invasive species Arundo donax for the extraction of lignocellulosic fractions and the development of films with interest in food packaging. Stems and leaves were separately evaluated, with the stems producing higher yields and better properties for the extracted fractions. The purification of cellulose by removing hemicelluloses led to more crystalline and thermally stable fractions, which were more homogeneously dispersed in water and produced films with enhanced transparency, mechanical and water barrier properties. The application of a simplified extraction protocol, avoiding the use of organic solvents, led to the presence of minor amounts of lipidic impurities in the fractions, which, surprisingly, had a positive impact in the properties of the films. In particular, the film obtained from the purified cellulose without Soxhlet treatment (F3A) outperforms biopolymeric materials such as starch and PLA in terms of mechanical and water barrier performance.},
}
@article {pmid30141233,
year = {2019},
author = {Chen, S and Chen, H and Xu, Y},
title = {Safe chemical repellents to prevent the spread of invasive ants.},
journal = {Pest management science},
volume = {75},
number = {3},
pages = {821-827},
doi = {10.1002/ps.5184},
pmid = {30141233},
issn = {1526-4998},
support = {2016YFC1201200//The National Key Research and Development Project/ ; },
abstract = {BACKGROUND: The red imported fire ant, Solenopsis invicta, is one of the most dangerous invasive species in the world. Fire ants can spread by hiding among plant material and soil that are transported from infested areas in vehicles and vessels. Therefore, efficient repellents may be used to prevent fire ants from infesting transported goods. Although some fire ant repellants have been identified, novel, cost-effective and environmentally friendly materials for fire ant control are still needed. Recent studies with other model insects have suggested readily available, non-toxic alternatives (e.g., anthranilates) to commercial repellents.<br><br>RESULTS: We measured the repellent effects of the food additives ethyl anthranilate and butyl anthranilate against nesting by fire ant workers, and the results demonstrated that extremely low concentrations of these compounds can prevent fire ant nesting in pots. The tested compounds remained active at concentrations < 100 µL/L, which is many times lower than the minimum active concentration of any other proposed compound, including the established insect repellent N,N-diethyl-3-methylbenzamide (DEET).<br><br>CONCLUSION: These inexpensive chemicals are safely used by the food and cosmetics industries, and their high efficiency differentiates them as the most promising chemicals for use in preventing the spread of fire ants; thus, these chemicals should be evaluated for further potential applications. © 2018 Society of Chemical Industry.},
}
@article {pmid30135718,
year = {2018},
author = {Kumar, A and Pandeya, A and Malik, G and Sharma, M and P, HK and S, AK and Gahlaut, V and Gajula, MNVP and Singh, KP and Suravajhala, P and Balyan, HS and Gupta, PK},
title = {---A web resource for nutrient use efficiency-related genes, quantitative trait loci and microRNAs in important cereals and model plants.},
journal = {F1000Research},
volume = {7},
number = {},
pages = {},
pmid = {30135718},
issn = {2046-1402},
abstract = {Cereals are key contributors to global food security. Genes involved in the uptake (transport), assimilation and utilization of macro- and micronutrients are responsible for the presence of these nutrients in grain and straw. Although many genomic databases for cereals are available, there is currently no cohesive web resource of manually curated nutrient use efficiency (NtUE)-related genes and quantitative trait loci (QTLs). In this study, we present a web-resource containing information on NtUE-related genes/QTLs and the corresponding available microRNAs for some of these genes in four major cereal crops (wheat (Triticum aestivum), rice (Oryza sativa), maize (Zea mays), barley (Hordeum vulgare)), two alien species related to wheat (Triticum urartu and Aegilops tauschii), and two model species (Brachypodium distachyon and Arabidopsis thaliana). Gene annotations integrated in the current web resource were manually curated from the existing databases and the available literature. The primary goal of developing this web resource is to provide descriptions of the NtUE-related genes and their functional annotation. MicroRNAs targeting some of the NtUE related genes and the QTLs for NtUE-related traits are also included. The genomic information embedded in the web resource should help users to search for the desired information.},
}
@article {pmid30135153,
year = {2018},
author = {Banks, PB and Carthey, AJR and Bytheway, JP},
title = {Australian native mammals recognize and respond to alien predators: a meta-analysis.},
journal = {Proceedings. Biological sciences},
volume = {285},
number = {1885},
pages = {},
pmid = {30135153},
issn = {1471-2954},
abstract = {Prey naiveté is a failure to recognize novel predators and thought to cause exaggerated impacts of alien predators on native wildlife. Yet there is equivocal evidence in the literature for native prey naiveté towards aliens. To address this, we conducted a meta-analysis of Australian mammal responses to native and alien predators. Australia has the world's worst record of extinction and declines of native mammals, largely owing to two alien predators introduced more than 150 years ago: the feral cat, Felis catus, and European red fox, Vulpes vulpes Analysis of 94 responses to predator cues shows that Australian mammals consistently recognize alien foxes as a predation threat, possibly because of thousands of years of experience with another canid predator, the dingo, Canis lupus dingo We also found recognition responses towards cats; however, in four of the seven studies available, these responses were of risk-taking behaviour rather than antipredator behaviour. Our results suggest that a simple failure to recognize alien predators is not behind the ongoing exaggerated impacts of alien predators in Australia. Instead, our results highlight an urgent need to better understand the appropriateness of antipredator responses in prey towards alien predators in order to understand native prey vulnerability.},
}
@article {pmid30133819,
year = {2018},
author = {Wells, K and Fordham, DA and Brook, BW and Cassey, P and Cox, T and O'Hara, RB and Schwensow, NI},
title = {Disentangling synergistic disease dynamics: Implications for the viral biocontrol of rabbits.},
journal = {The Journal of animal ecology},
volume = {87},
number = {5},
pages = {1418-1428},
doi = {10.1111/1365-2656.12871},
pmid = {30133819},
issn = {1365-2656},
abstract = {European rabbits (Oryctolagus cuniculus) have been exposed to rabbit haemorrhagic disease virus (RHDV) and myxoma virus (MYXV) in their native and invasive ranges for decades. Yet, the long-term effects of these viruses on rabbit population dynamics remain poorly understood. In this context, we analysed 17 years of detailed capture-mark-recapture data (2000-2016) from Turretfield, South Australia, using a probabilistic state-space hierarchical modelling framework to estimate rabbit survival and epidemiological dynamics. While RHDV infection and disease-induced death were most prominent during annual epidemics in winter and spring, we found evidence for continuous infection of susceptible individuals with RHDV throughout the year. RHDV-susceptible rabbits had, on average, 25% lower monthly survival rates compared to immune individuals, while the average monthly force of infection in winter and spring was ~38%. These combined to result in an average infection-induced mortality rate of 69% in winter and spring. Individuals susceptible to MYXV and immune to RHDV had similar survival probabilities to those having survived infections from both viruses, whereas individuals susceptible to both RHDV and MYXV had higher survival probabilities than those susceptible to RHDV and immune to MYXV. This suggests that MYXV may reduce the future survival rates of individuals that endure initial MYXV infection. There was no evidence for long-term changes in disease-induced mortality and infection rates for either RHDV or MYXV. We conclude that continuous, year-round virus perpetuation (and perhaps heterogeneity in modes of transmission and infectious doses during and after epidemics) acts to reduce the efficiency of RHDV and MYXV as biocontrol agents of rabbits in their invasive range. However, if virulence can be maintained as relatively constant through time, RHDV and MYXV will likely continue realizing strong benefits as biocontrol agents.},
}
@article {pmid30133520,
year = {2018},
author = {Hewitt, MJ and Hourston, M and McDonald, JI},
title = {A long way from home: Biosecurity lessons learnt from the impact of La Niña on the transportation and establishment of tropical portunid species.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0202766},
pmid = {30133520},
issn = {1932-6203},
mesh = {Animals ; Brachyura/*classification/*growth &amp; development ; El Nino-Southern Oscillation ; Introduced Species ; Oceans and Seas ; Population Dynamics ; Population Surveillance ; Tropical Climate ; Western Australia ; },
abstract = {Marine ecosystems can be modified and shaped by irregular interannual variations in oceanic current patterns and temperatures, such as El Niño and La Niña. These large scale oceanic events have also been shown to influence environmental stressors such as invasive marine species (IMS). Our study indicates that there is a causative link between these climatic events, and atypical detections of native and IMS. Significant La Niña events between 1970 and 2014 were associated with sightings of tropical crab species in temperate waters following a lag period of 18-24 months from the onset of the event. We identified a total of 72 records of six tropical portunid crabs species (from both Charybdis and Scylla) in temperate waters of south-western Australia following these La Niña events, based on reports in published scientific literature, grey literature and museum records, as well as citizen science networks such as FishWatch and PestWatch apps. We suggest that La Niña conditions facilitated transportation and temporary establishment of crab larvae from their native tropical habitat to temperate regions. As the strength of La Niña events is likely to increase into the future due to the escalating effects of climate change, it is likely that there will be a growth in associated atypical establishment events of IMS. Consequently, biosecurity managers will need to reprioritise resources in order to accommodate the potential impacts of these large scale oceanic events as part of their surveillance programmes.},
}
@article {pmid30133512,
year = {2018},
author = {Junaedi, DI and McCarthy, MA and Guillera-Arroita, G and Catford, JA and Burgman, MA},
title = {Traits influence detection of exotic plant species in tropical forests.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0202254},
pmid = {30133512},
issn = {1932-6203},
mesh = {Forestry/methods ; Indonesia ; Introduced Species ; Models, Biological ; Plant Leaves/anatomy &amp; histology ; Plants/*anatomy &amp; histology/*classification ; *Rainforest ; },
abstract = {Detecting exotic plant species is essential for invasive species management. By accounting for factors likely to affect species' detection rates (e.g. survey conditions, observer experience), detectability models can help choose search methods and allocate search effort. Integrating information on species' traits can refine detectability models, and might be particularly valuable if these traits can help improve estimates of detectability where data on particular species are rare. Analysing data collected during line transect distance sampling surveys in Indonesia, we used a multi-species hierarchical distance sampling model to evaluate how plant height, leaf size, leaf shape, and survey location influenced plant species detectability in secondary tropical rainforests. Detectability of the exotic plant species increased with plant height and leaf size. Detectability varied among the different survey locations. We failed to detect a clear effect of leaf shape on detectability. This study indicates that information on traits might improve predictions about exotic species detection, which can then be used to optimise the allocation of search effort for efficient species management. The innovation of the study lies in the multi-species distance sampling model, where the distance-detection function depends on leaf traits and height. The method can be applied elsewhere, including for different traits that may be relevant in other contexts. Trait-based multispecies distance sampling can be a practical approach for sampling exotic shrubs, herbs, or grasses species in the understorey of tropical forests.},
}
@article {pmid30131888,
year = {2018},
author = {Weickardt, I and Zehnsdorf, A and Durka, W},
title = {Development and characterization of simple sequence repeat markers for the invasive tetraploid waterweed Elodea nuttallii (Hydrocharitaceae).},
journal = {Applications in plant sciences},
volume = {6},
number = {4},
pages = {e1146},
pmid = {30131888},
issn = {2168-0450},
abstract = {Premise of the Study: To enhance the understanding of the recent invasion process of the clonal waterweed Elodea nuttallii (Hydrocharitaceae), analyses of population structure and genotypic diversity need to be undertaken, for which genetic markers are needed.<br><br>Methods and Results: High-throughput sequencing of DNA enriched for microsatellites was used to develop 24 loci that were characterized in E. nuttallii, 21 of which were polymorphic, with the number of alleles ranging from two to 10. In two populations, expected heterozygosity ranged among loci between zero and 0.796. In the congener E. canadensis, all markers yielded PCR products, 19 of which were polymorphic, with two to nine alleles and expected heterozygosity ranging from zero to 0.690 in two populations.<br><br>Conclusions: The markers described should be useful for future studies of population structure and clonal diversity of E. nuttallii as well as E. canadensis in their native and invasive range.},
}
@article {pmid30130492,
year = {2018},
author = {Xu, M and Lu, Z and Lu, YY and Balusu, RR and Ajayi, OS and Fadamiro, HY and Appel, AG and Chen, L},
title = {Cuticular hydrocarbon chemistry, an important factor shaping the current distribution pattern of the imported fire ants in the USA.},
journal = {Journal of insect physiology},
volume = {110},
number = {},
pages = {34-43},
doi = {10.1016/j.jinsphys.2018.08.006},
pmid = {30130492},
issn = {1879-1611},
abstract = {Two sibling species, Solenopsis richteri and S. invicta, were both introduced into the southern USA from South America in the early 20th century. Today, S. richteri occupies higher latitudes and colder areas, while S. invicta occupies lower latitudes. Between the distributions of the two species, there is a large area of viable hybrid (S. richteri × S. invicta) populations. This study aimed to characterize the forces driving this distribution pattern and the underlying mechanisms. Cuticular hydrocarbons (CHCs) of freshly killed workers of S. invicta, hybrids, and S. richteri were removed using hexane. Both intact and CHCs-extracted workers were subjected to a constant rate of increasing temperature from 10 to 60 °C to obtain relative water loss and the water loss transition temperature (Tc-ant). Mass loss and Tc-ant were both significantly increased with CHCs removal. We then examined the CHC composition of three species. CHC profiles of S. richteri are characterized by significant amounts of short-chain (C23-C27) saturated and unsaturated hydrocarbons. In contrast, profiles of S. invicta consist primarily of long-chain (C27-C29) saturated hydrocarbons; unsaturated alkenes are completely lacking. Hybrid fire ants show intermediate profiles of the two parent species. We measured the melting point (Tm) and water-loss transition temperature of CHC blends (Tc-CHC) of different ant species colonies using differential scanning calorimetry (DSC) and an artificial membrane system, respectively. There were 3-5 Tms of each CHCs sample of different ant colonies due to their complex chemistry. The highest Tms (Tm-maxs) of CHCs samples from S. invicta and the hybrid were significantly higher than that from S. richteri. The correlation between Tc-CHC and Tm-max obtained from the same CHCs sample was highly significant. These results reveal that species having higher Tc and Tm-max retain more water under relatively higher temperature, and consequently are able to occupy warmer environments. We conclude that CHC chemistry plays a role in shaping current distribution patterns of S. richteri, S. invicta and their hybrid in the United States.},
}
@article {pmid30130456,
year = {2018},
author = {Grupe, AC and Sulzbacher, MA and Grebenc, T and Healy, R and Bonito, G and Smith, ME},
title = {Tuber brennemanii and Tuber floridanum: Two new Tuber species are among the most commonly detected ectomycorrhizal taxa within commercial pecan (Carya illinoinensis) orchards.},
journal = {Mycologia},
volume = {110},
number = {4},
pages = {780-790},
doi = {10.1080/00275514.2018.1490121},
pmid = {30130456},
issn = {1557-2536},
mesh = {Biodiversity ; Brazil ; Carya/*microbiology ; DNA, Fungal/genetics ; DNA, Ribosomal/genetics ; Mycorrhizae/*classification/*genetics/isolation &amp; purification/ultrastructure ; Phylogeny ; Plant Roots/microbiology ; Seedlings/microbiology ; },
abstract = {Truffles are sequestrate hypogeous fungi, and most form ectomycorrhizal (ECM) associations with trees. Truffles belonging to the genus Tuber (Pezizales, Ascomycota), &quot;true truffles,&quot; associate with diverse plant hosts, including economically important species such as pecan (Carya illinoinensis). Morphological and phylogenetic studies delimited several major lineages of Tuber, which include many cryptic and undescribed species. One of these, the Maculatum clade, is a speciose group characterized by relatively small, light-colored ascomata that have alveolate-reticulate spores. Here, we describe two new species in the Maculatum clade, Tuber brennemanii and T. floridanum (previously identified as Tuber sp. 36 and Tuber sp. 47). We delineate these two species by phylogenetic analyses of nuc ITS1-5.8S-ITS2 (= ITS) and partial 28S rDNA (= LSU), and through morphological analysis. A recent collection of T. floridanum from a pecan orchard in Brazil indicates that this species was introduced there on the roots of pecan seedlings. Systematic studies of ascomata and ECM fungal communities indicate that these species are geographically widespread and common ECM symbionts of pecans and other members of the Fagales, particularly in sites with disturbed soils and nutrient enrichment.},
}
@article {pmid30128204,
year = {2018},
author = {Hudson, DM and Sexton, DJ and Wint, D and Capizzano, C and Crivello, JF},
title = {Physiological and behavioral response of the Asian shore crab, Hemigrapsus sanguineus, to salinity: implications for estuarine distribution and invasion.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5446},
pmid = {30128204},
issn = {2167-8359},
abstract = {The invasive Asian shore crab, Hemigrapsus sanguineus, is ubiquitous in the rocky intertidal zone of the western North Atlantic. A likely contributor to this colonization is that H. sanguineus is able to handle a wide range of salinities, and is thus more likely to spread through a greater geographic area of estuaries. This study investigated the salinity effects on this animal by observing survival across a range of salinities, the maintenance of hemolymph osmolality under different salinities, and behavioral preference for and avoidance of salinities. H. sanguineus showed high survival across a broad range of salinities, had little change in hemolymph osmolality over a short-term salinity shock, and behaviorally distinguished between salinities when presented with a choice, under both acclimation salinities of 5 PSU or 35 PSU. Such results suggest H. sanguineus has a hardiness for the rapid changes in salinity that happen in the intertidal zone, yet is capable of physically moving to a more optimal salinity. This enhances their competitiveness as an invader, particularly surviving lower salinities that present challenges during high-precipitation events in rocky intertidal areas, and partially explains this species' dominance in this habitat type.},
}
@article {pmid30128203,
year = {2018},
author = {Sánchez-Blanco, J and Vega-Peña, EV and Espinosa-García, FJ},
title = {Darwin's naturalization hypothesis does not explain the spread of nonnative weed species naturalized in México.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5444},
pmid = {30128203},
issn = {2167-8359},
abstract = {Background: Despite numerous tests of Darwin's naturalization hypothesis (DNH) evidence for its support or rejection is still contradictory. We tested a DNH derived prediction stating that nonnative species (NNS) without native congeneric relatives (NCR) will spread to a greater number of localities than species with close relatives in the new range. This test controlled the effect of residence time (Rt) on the spread of NNS and used naturalized species beyond their lag phase to avoid the effect of stochastic events in the establishment and the lag phases that could obscure the NCR effects on NNS.<br><br>Methods: We compared the number of localities (spread) occupied by NNS with and without NCR using 13,977 herbarium records for 305 NNS of weeds. We regressed the number of localities occupied by NNS versus Rt to determine the effect of time on the spread of NNS. Then, we selected the species with Rt greater than the expected span of the lag phase, whose residuals were above and below the regression confidence limits; these NNS were classified as widespread (those occupying more localities than expected by Rt) and limited-spread (those occupying fewer localities than expected). These sets were again subclassified into two groups: NNS with and without NCR at the genus level. The number of NNS with and without NCR was compared using χ2 tests and Spearman correlations between the residuals and the number of relatives. Then, we grouped the NNS using 34 biological attributes and five usages to identify the groups' possible associations with spread and to test DNH. To identify species groups, we performed a nonmetric multidimensional scaling (NMDS) analysis and evaluated the influences of the number of relatives, localities, herbarium specimens, Rt, and residuals of regression. The Spearman correlation and the Mann-Whitney U test were used to determine if the DNH prediction was met. Additionally, we used the clustering objects on subsets of attributes (COSA) method to identify possible syndromes (sets of biological attributes and usages) associated to four groups of NNS useful to test DNH (those with and without NCR and those in more and fewer localities than expected by Rt).<br><br>Results: Residence time explained 33% of the variation in localities occupied by nonnative trees and shrubs and 46% of the variation for herbs and subshrubs. The residuals of the regression for NNS were not associated with the number or presence of NCR. In each of the NMDS groups, the number of localities occupied by NNS with and without NCR did not significantly differ. The COSA analysis detected that only NNS with NCR in more and fewer localities than expected share biological attributes and usages, but they differ in their relative importance.<br><br>Discussion: Our results suggest that DNH does not explain the spread of naturalized species in a highly heterogeneous country. Thus, the presence of NCR is not a useful characteristic in risk analyses for naturalized NNS.},
}
@article {pmid30128194,
year = {2018},
author = {Potocka, M and Krzemińska, E},
title = {Trichocera maculipennis (Diptera)-an invasive species in Maritime Antarctica.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5408},
pmid = {30128194},
issn = {2167-8359},
abstract = {Antarctica, with its severe conditions, is poor in terrestrial fauna species. However, an increase in human presence together with climate change may cause an influx of non-native species. Here we report a significant increase in colonized area of one of the few known invasive species to date in Antarctica. Non-native flies of Trichocera maculipennis have been recently observed in the Admiralty Bay area on King George Island, South Shetlands Islands, West Antarctica, 10 years after its first record in Maritime Antarctica (Maxwell Bay, King George Island). Its rapid spread across the island, despite geographic barriers such as glaciers, indicates successful adaptation to local environmental conditions and suggests this species is invasive. The mode of life of T. maculipennis, observed in natural and anthropogenous habitat and in laboratory conditions, is reported. The following adaptations enabled its invasion and existence within the sewage system in Antarctic scientific stations: the ability to survive in complete darkness, male ability to mate on the substrate surface without prior swarming in flight, and adaptation of terrestrial larvae to survive in semi-liquid food. Possible routes of introduction to Antarctica and between two bays on King George Island are discussed, as well as further research leading to the containment and eradication of this species.},
}
@article {pmid30127531,
year = {2018},
author = {Bower, DS and Yasumiba, K and Trumbo, DR and Alford, RA and Schwarzkopf, L},
title = {Spinal arthritis in cane toads across the Australian landscape.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {12458},
pmid = {30127531},
issn = {2045-2322},
abstract = {Loss of fitness can be a consequence of selection for rapid dispersal ability in invasive species. Increased prevalence of spinal arthritis may occur in cane toad populations at the invasion front as a cost of increased invasiveness, but our knowledge of the ecological drivers of this condition is lacking. We aimed to determine the factors explaining the prevalence of spinal arthritis in populations across the Australian landscape. We studied populations across a gradient of invasion histories. We collected 2415 toads over five years and determined the presence and size of spondylosis for each individual. We examined the effect of host size, leg length and invasion history on the prevalence of spondylosis. Host size was a significant predictor of spondylosis across populations. Contrary to our expectation, the overall prevalence of spondylosis was not positively related to invasion history and did not correlate with toad relative leg length. Rather than invasion age, the latitude at which populations were sampled provided an alternate explanation for the prevalence of spondylosis in cane toad populations and suggested that the incidence of this condition did not increase as a physiological cost of invasion, but is instead related to physical variables, such as climate.},
}
@article {pmid30124918,
year = {2018},
author = {Ali, H and Muhammad, A and Sanda Bala, N and Hou, Y},
title = {The Endosymbiotic Wolbachia and Host COI Gene Enables to Distinguish Between Two Invasive Palm Pests; Coconut Leaf Beetle, Brontispa longissima and Hispid Leaf Beetle, Octodonta nipae.},
journal = {Journal of economic entomology},
volume = {111},
number = {6},
pages = {2894-2902},
doi = {10.1093/jee/toy233},
pmid = {30124918},
issn = {1938-291X},
abstract = {To elucidate taxonomic eminence of identical pest species is essential for many ecological and conservation studies. Without proficient skills, accurate molecular identification and characterization are laborious and time-consuming. The coconut leaf beetle, Brontispa longissima (Gestro) (Coleoptera: Chrysomelidae), is biologically and morphologically identical to hispid leaf beetle, Octodonta nipae (Maulik) (Coleoptera: Chrysomelidae), and is known as the most harming nuisances of palm cultivation worldwide. The present examination was to establish Wolbachia genotyping analysis along with host cytochrome oxidase subunit I (COI) gene for accurate identification between these individuals of the same family (Chrysomelidae). Here, we have cloned and sequenced a gene coding Wolbachia surface protein (wsp) and COI gene regions amplified from both species by polymerase chain reaction. The nucleotide sequences were directly determined (≈600 bp for wsp and ≈804 bp for COI) and aligned using the multiple alignment algorithms in the ESPript3 package and the MEGA5 program. Comparative sequence analysis indicated that the representative of wsp and COI sequences from these two beetles were highly variable. To ensure this bacterial variation, multilocus sequence typing (MLST) of bacterial genes was conducted, and the results vindicated the same trend of variations. Furthermore, the phylogenetic analysis also indicates that B. longissima and O. nipae being the two different species harbors two distinct Wolbachia Hertig and Burt (Rickettsiales: Anaplamataceae) supergroups B and A, respectively. The present outcomes quickly discriminate between these two species. Considering its simplicity and cost-effectiveness, it can be used as a diagnostic tool for discriminating such invasive species particularly B. longissima and O. nipae which has overlapping morphologic characters.},
}
@article {pmid30123697,
year = {2018},
author = {Arias, MB and Elfekih, S and Vogler, AP},
title = {Population genetics and migration pathways of the Mediterranean fruit fly Ceratitis capitata inferred with coalescent methods.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5340},
pmid = {30123697},
issn = {2167-8359},
abstract = {Background: Invasive species are a growing threat to food biosecurity and cause significant economic losses in agricultural systems. Despite their damaging effect, they are attractive models for the study of evolution and adaptation in newly colonised environments. The Mediterranean fruit fly, Ceratitis capitata, as a member of the family Tephritidae, is one of the most studied invasive species feeding on many fruit crops in the tropics and subtropics worldwide. This study aims to determine the global macrogeographic population structure of Ceratitis capitata and reconstruct its potential migration routes.<br><br>Method: A partial mitochondrial cytochrome oxidase I gene from >400 individual medflies and 14 populations from four continents was sequenced and subjected to Bayesian demographic modelling.<br><br>Results: The Afrotropical populations (Kenya, South Africa and Ghana) harbour the majority of haplotypes detected, which also are highly divergent, in accordance with the presumed ancestral range of medflies in Sub-Saharan Africa. All other populations in the presumed non-native areas were dominated by a single haplotype also present in South Africa, in addition to a few, closely related haplotypes unique to a single local population or regional set, but missing from Africa. Bayesian coalescence methods revealed recent migration pathways from Africa to all continents, in addition to limited bidirectional migration among many local and intercontinental routes.<br><br>Conclusion: The detailed investigation of the recent migration history highlights the interconnectedness of affected crop production regions worldwide and pinpoints the routes and potential source areas requiring more specific quarantine measures.},
}
@article {pmid30123695,
year = {2018},
author = {Neilson, BJ and Wall, CB and Mancini, FT and Gewecke, CA},
title = {Herbivore biocontrol and manual removal successfully reduce invasive macroalgae on coral reefs.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5332},
pmid = {30123695},
issn = {2167-8359},
abstract = {Invasive macroalgae pose a serious threat to coral reef biodiversity by monopolizing reef habitats, competing with native species, and directly overgrowing, and smothering reef corals. Several invasive macroalgae (Eucheuma clade E, Kappaphycus clade A and B, Gracilaria salicornia, and Acanthophora spicifera) are established within Kāne'ohe Bay (O'ahu, Hawai'i, USA), and reducing invasive macroalgae cover is a coral reef conservation and management priority. Invasive macroalgae control techniques, however, are limited and few successful large-scale applications exist. Therefore, a two-tiered invasive macroalgae control approach was designed, where first, divers manually remove invasive macroalgae (Eucheuma and Kappaphycus) aided by an underwater vacuum system (&quot;The Super Sucker&quot;). Second, hatchery-raised juvenile sea urchins (Tripneustes gratilla), were outplanted to graze and control invasive macroalgae regrowth. To test the effectiveness of this approach in a natural reef ecosystem, four discrete patch reefs with high invasive macroalgae cover (15-26%) were selected, and macroalgae removal plus urchin biocontrol (treatment reefs, n = 2), or no treatment (control reefs, n = 2), was applied at the patch reef-scale. In applying the invasive macroalgae treatment, the control effort manually removed ∼19,000 kg of invasive macroalgae and ∼99,000 juvenile sea urchins were outplanted across to two patch reefs, totaling ∼24,000 m2 of reef area. Changes in benthic cover were monitored over 2 years (five sampling periods) before-and-after the treatment was applied. Over the study period, removal and biocontrol reduced invasive macroalgae cover by 85% at treatment reefs. Our results show manual removal in combination with hatchery raised urchin biocontrol to be an effective management approach in controlling invasive macroalgae at reef-wide spatial scales and temporal scales of months to years.},
}
@article {pmid30121427,
year = {2018},
author = {Kang, KB and Kang, SJ and Kim, MS and Lee, DY and Han, SI and Kim, TB and Park, JY and Kim, J and Yang, TJ and Sung, SH},
title = {Chemical and genomic diversity of six Lonicera species occurring in Korea.},
journal = {Phytochemistry},
volume = {155},
number = {},
pages = {126-135},
doi = {10.1016/j.phytochem.2018.07.012},
pmid = {30121427},
issn = {1873-3700},
mesh = {Lonicera/*chemistry/classification/*genetics ; Metabolomics ; Plant Components, Aerial/chemistry ; Plant Roots/chemistry/metabolism ; Plants, Medicinal/*chemistry ; Republic of Korea ; Species Specificity ; },
abstract = {Lonicera spp. (Caprifoliaceae) are important not only as a common medicinal herb in East Asia but also as one of the most problematic invasive species in North America. In the present study, we performed a systemic analysis of genomic and chemical diversity among six Lonicera species occurring in Korea, L. japonica, L. maackii, L. insularis, L. sachalinensis, L. praeflorens, and L. vesicaria, using chloroplast DNA whole genome shotgun (WGS) sequencing and LC-MS analyses. The phylogenetic and phylochemical relationships did not coincide with each other, but partial consistency could be found among them. InDel-based cDNA marker for authentication was developed based on the genome sequences. Flavonoids, iridoids, and organic acids were identified in the LC-MS analyses, and their inter-species distribution and localization were also revealed.},
}
@article {pmid30120791,
year = {2018},
author = {Marchini, GL and Arredondo, TM and Cruzan, MB},
title = {Selective differentiation during the colonization and establishment of a newly invasive species.},
journal = {Journal of evolutionary biology},
volume = {31},
number = {11},
pages = {1689-1703},
doi = {10.1111/jeb.13369},
pmid = {30120791},
issn = {1420-9101},
support = {2005-35320-15317//USDA CSREES/ ; },
abstract = {The potential for rapid evolution in invasive species makes them useful for studying adaptive responses of populations to novel environments. However, phenotypic divergence during invasion is not necessarily due to selection, but may be a product of neutral processes resulting from population bottlenecks during colonization and range expansion. We investigated phenotypic adaptation during the establishment and range expansion of the invasive bunchgrass, slender false brome (Brachypodium sylvaticum; Poaceae). Utilizing a novel approach, we made robust comparisons of functional traits using genetic similarity based on unique alleles to determine the genetic probability of contribution from native source regions and integrated these probabilities into our QST -FST comparisons for 12 physiological and anatomical traits associated with drought stress in the introduced range. Our results indicate phenotypic divergence greater than neutral expectations in five traits between native and invasive populations, indicating selective divergence occurred during invasive species establishment. The results indicate that the majority of divergence in B. sylvaticum occurred after introduction to the novel environment, but prior to invasive range expansion. This study provides evidence for adaptive genetic differentiation during the establishment of an invasive species, while also describing a robust method for the detection of selective processes after species introduction to a novel environment.},
}
@article {pmid30115135,
year = {2018},
author = {Canavan, K and Paterson, ID and Hill, MP and Dudley, TL},
title = {Testing the Enemy Release Hypothesis on tall-statured grasses in South Africa, using Arundo donax, Phragmites australis, and Phragmites mauritianus as models.},
journal = {Bulletin of entomological research},
volume = {},
number = {},
pages = {1-14},
doi = {10.1017/S0007485318000627},
pmid = {30115135},
issn = {1475-2670},
abstract = {The Enemy Release Hypothesis (ERH) predicts that introduced plant species can escape herbivory and therefore have a competitive advantage over native plants, which are exposed to both generalist and specialist natural enemies. In this study, the ERH was explored using the invasive alien species, Arundo donax and two native tall-statured grasses, the cosmopolitan Phragmites australis and African endemic Phragmites mauritianus in South Africa. It was predicted that A. donax would have reduced species richness of herbivores compared with the native Phragmites spp., that it would be devoid of specialist herbivores and would thus be experiencing enemy escape in the adventive range. The herbivore assemblages were determined from both field surveys and a literature review. The assumptions of the ERH were for the most part not met; 13 herbivores were found on A. donax compared with 17 on P. australis and 20 on P. mauritianus. Arundo donax had two specialist herbivores from its native range, and shared native herbivores with Phragmites spp. Although A. donax had reduced species richness and diversity compared with that found in the native distribution, it has partially re-acquired a herbivore assemblage which is similar to that found on analogous native species. This suggests that enemy release may not fully explain the invasive success of A. donax in South Africa.},
}
@article {pmid30114232,
year = {2018},
author = {Ojaveer, H and Galil, BS and Carlton, JT and Alleway, H and Goulletquer, P and Lehtiniemi, M and Marchini, A and Miller, W and Occhipinti-Ambrogi, A and Peharda, M and Ruiz, GM and Williams, SL and Zaiko, A},
title = {Historical baselines in marine bioinvasions: Implications for policy and management.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0202383},
pmid = {30114232},
issn = {1932-6203},
mesh = {Animals ; Conservation of Natural Resources/history/legislation &amp; jurisprudence/*methods ; Environmental Monitoring/history/legislation &amp; jurisprudence/methods ; Fisheries/history/legislation &amp; jurisprudence ; History, 16th Century ; History, 17th Century ; History, 18th Century ; History, 19th Century ; History, 20th Century ; History, 21st Century ; Humans ; *Introduced Species/history/legislation &amp; jurisprudence ; Marine Biology/history/legislation &amp; jurisprudence/*methods ; Oceans and Seas ; Public Health ; Ships/history/legislation &amp; jurisprudence ; },
abstract = {The human-mediated introduction of marine non-indigenous species is a centuries- if not millennia-old phenomenon, but was only recently acknowledged as a potent driver of change in the sea. We provide a synopsis of key historical milestones for marine bioinvasions, including timelines of (a) discovery and understanding of the invasion process, focusing on transfer mechanisms and outcomes, (b) methodologies used for detection and monitoring, (c) approaches to ecological impacts research, and (d) management and policy responses. Early (until the mid-1900s) marine bioinvasions were given little attention, and in a number of cases actively and routinely facilitated. Beginning in the second half of the 20th century, several conspicuous non-indigenous species outbreaks with strong environmental, economic, and public health impacts raised widespread concerns and initiated shifts in public and scientific perceptions. These high-profile invasions led to policy documents and strategies to reduce the introduction and spread of non-indigenous species, although with significant time lags and limited success and focused on only a subset of transfer mechanisms. Integrated, multi-vector management within an ecosystem-based marine management context is urgently needed to address the complex interactions of natural and human pressures that drive invasions in marine ecosystems.},
}
@article {pmid30111864,
year = {2018},
author = {O'Dea, A and De Gracia, B and Figuerola, B and Jagadeeshan, S},
title = {Young species of cupuladriid bryozoans occupied new Caribbean habitats faster than old species.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {12168},
pmid = {30111864},
issn = {2045-2322},
abstract = {The breadth of habitat occupied by a species, and the rate at which a species can expand into new habitats has important ecological and evolutionary consequences. Here we explore when extant species of free-living cupuladriid bryozoans expanded into new benthic Caribbean habitats that emerged during the final stages of formation of the Isthmus of Panama. Habitat breadth was estimated using the abundances of over 90,000 colonies in ten cupuladriid species, along with the ecological and sedimentary characteristics of the samples in which they occurred. Data reveal that all species expanded their habitat breadths during the last 6 Myr, but did so at a different tempo. 'Young' species - those that originated after 5 Ma - expanded relatively quickly, whereas 'old' species - those that originated before 9 Ma - took a further 2 Myr to achieve a comparable level of expansion. We propose that, like invasive species, young species are less restrained when expanding their habitat breadths compared to older well-established species. Understanding the mechanism causing this restraint requires further research.},
}
@article {pmid30110360,
year = {2018},
author = {Johnston, CA and Wilson Rankin, EE and Gruner, DS},
title = {Foraging connections: Patterns of prey use linked to invasive predator diel movement.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0201883},
pmid = {30110360},
issn = {1932-6203},
mesh = {Amphipoda/metabolism ; Animal Distribution ; Animals ; Ants/metabolism ; Anura/metabolism ; Carbon Isotopes/analysis ; *Diet ; Feeding Behavior ; Food Chain ; Hawaii ; *Introduced Species ; Models, Biological ; Photoperiod ; *Predatory Behavior ; },
abstract = {Invasive predators can profoundly impact native communities, especially in insular ecosystems where functionally equivalent predators were evolutionarily absent. Beyond direct consumption, predators can affect communities indirectly by creating or altering food web linkages among existing species. Where invasive predators consume prey from multiple distinct resource channels, novel links may couple the dynamics of disjunct modules and create indirect interactions between them. Our study focuses on invasive populations of Eleutherodactylus coqui (Anura: Leptodactylidae) on Hawaii Island. Coqui actively forage in the understory and lower canopy at night but return to the forest floor and belowground retreats by day. Recent dietary studies using gut contents and naturally occurring stable isotopes indicate higher than expected consumption of litter arthropods, which in these Hawaiian forests are primarily non-native species. We used laboratory studies to observe diurnal and nocturnal foraging behavior, and experimental field additions of C4 vegetation as a litter tracer to distinguish epigaeic sources from food web pools in the C3 canopy. Lab trials revealed that prey consumption during diurnal foraging was half that consumed during nocturnal foraging. Analysis of δ13C isotopes showed incorporation of C4 carbon into litter arthropods within one month, and Bayesian mixing models estimated that 15-25% of the carbon in coqui tissue was derived from litter sources. These results support recent findings that E. coqui are not quiescent diurnally but instead actively forage. Such activity by a mobile invasive predator may introduce a novel linkage that integrates detrital and foliar resource pools, potentially distributing influences of invasive litter arthropods through the broader system to amplify impacts on native species.},
}
@article {pmid30110359,
year = {2018},
author = {Moir, ML and Renton, M and Hoffmann, BD and Leng, MC and Lach, L},
title = {Development and testing of a standardized method to estimate honeydew production.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0201845},
pmid = {30110359},
issn = {1932-6203},
mesh = {Animals ; *Hemiptera/anatomy &amp; histology/growth &amp; development ; Introduced Species ; *Models, Biological ; North America ; Species Specificity ; Symbiosis ; },
abstract = {Honeydew production by Hemiptera is an ecologically important process that facilitates mutualisms and increases nutrient cycling. Accurate estimates of the amount of honeydew available in a system are essential for quantifying food web dynamics, energy flow, and the potential growth of sooty mould that inhibits plant growth. Despite the importance of honeydew, there is no standardized method to estimate its production when intensive laboratory testing is not feasible. We developed two new models to predict honeydew production, one based on insect body mass and taxonomic family, and one based on body mass and life stage. We tested the accuracy of both models' predictions for a diverse range of honeydew-producing hemipteran families (Aphididae, Pseudococcidae, Coccidae, Psyllidae, Aleyrodidae, Delphacidae, Cicadellidae). The method based on body mass and family provided more accurate estimates of honeydew production, due to large variation in honeydew production among families. We apply our methodology to a case study, the recalculation of honeydew available to invasive red imported fire ant (Solenopsis invicta) in the United States. We find that the amount of honeydew may be an order of magnitude lower than that previously estimated (2.16 versus 21.6 grams of honeydew per day) and discuss possible reasons for the difference. We anticipate that being able to estimate honeydew production based on minimal biological information will have applications to agriculture, invasion biology, forestry, and carbon farming.},
}
@article {pmid30108623,
year = {2018},
author = {Lettoof, DC and Lyons, JA and Shine, R and Maniel, G and Mayer, M and Natusch, DJD},
title = {Cane toads beneath bird rookeries: utilization of a natural disturbance by an invasive species.},
journal = {Current zoology},
volume = {64},
number = {4},
pages = {433-439},
pmid = {30108623},
issn = {1674-5507},
abstract = {Many invasive species exploit anthropogenically disturbed habitats, but most of those taxa evolved long before humans. Presumably, then, an ability to use natural (non-anthropogenic) disturbances pre-adapted invaders to a world later degraded by people. Studies on invasive species in naturally disturbed habitats thus can clarify the ancestral niche of invaders. In the Australian tropics, metallic starlings Aplonis metallica nest communally in emergent rainforest trees during the wet-season, and invasive cane toads Rhinella marina join other predators (mammals, birds, reptiles, and other anurans) to exploit the food resources beneath those trees. Compared to conspecifics found along nearby roads through the forest, cane toads beneath bird-nesting trees occur at higher densities, and are smaller in body size. The sex ratio is female-biased, and recapture records suggest that females may be philopatric at these sites (whereas recaptures were rare for both sexes found along the roads). Some toads were found under the same trees in successive wet-seasons. Spooling showed that distances moved per night were similar along the road versus under the trees, but toads under trees showed lower net displacements. Diets also differed (based upon scat analysis), with tree toads feeding more on beetles and less on ants. These nutrient-rich hotspots are exploited primarily by adult females and juvenile toads, whereas adult males congregate at breeding sites. By magnifying pre-existing intraspecific divergences in habitat use, bird rookeries may enhance population viability of cane toads by enabling critical age and sex classes to exploit food-rich patches that are rarely used by adult males.},
}
@article {pmid30108429,
year = {2018},
author = {Taylor, PJ and Neef, G and Keith, M and Weier, S and Monadjem, A and Parker, DM},
title = {Tapping into technology and the biodiversity informatics revolution: updated terrestrial mammal list of Angola, with new records from the Okavango Basin.},
journal = {ZooKeys},
volume = {},
number = {779},
pages = {51-88},
pmid = {30108429},
issn = {1313-2989},
abstract = {Using various sources, including the Global Biodiversity Information Facility (GBIF), published literature, recent (2015-2017) collections, as well as bat detector and camera trap surveys with opportunistic sightings and live capture in the upper Okavango catchment in central Angola, we present an updated mammal checklist of 275 species from 15 different orders for Angola (including the Cabinda region). Recent surveys (captures and bat detectors) of small mammals from the upper Okavango catchment yielded 46 species (33 species of bats, ten species of rodents and three species of shrews). One bat (Pipistrellusrusticus, rusty pipistrelle); two rodents (Mussetzeri, Setzer's mouse and Zelotomyswoosnami, Woosnam's broad-faced mouse) and one shrew (Suncusvarilla, lesser dwarf shrew) were captured for the first time, in Angola. While our species lists of bats conformed to predicted totals, terrestrial small mammals were under sampled, with only 13 species recorded by our trapping survey compared to a total of 42 shrew and rodent species expected based on GBIF records for the central Angolan highlands. Seven terrestrial small mammal species (one shrew and six rodents) are endemic to the central and western Angolan highlands but none of these were captured in our survey. The bat detector surveys added three further bat species to the country list: Pipistrellushesperidus, Kerivoulaargentata, and Mopsmidas. Camera trap surveys and opportunistic sightings in the upper Okavango catchment in 2016 yielded a total of 35 species of medium-large mammals, from 17 families, although all of these had been reported previously in Angola. GBIF proved to be an excellent source of biodiversity data for Angolan mammals, most importantly for documenting dramatic historical range changes of larger mammals such as the sable (Hippotragusnigerniger), Kirk's sable (H.nigerkirkii) and the giant sable (H.nigervariani).},
}
@article {pmid30108295,
year = {2018},
author = {Liebhold, AM and Yamanaka, T and Roques, A and Augustin, S and Chown, SL and Brockerhoff, EG and Pyšek, P},
title = {Plant diversity drives global patterns of insect invasions.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {12095},
pmid = {30108295},
issn = {2045-2322},
abstract = {During the last two centuries, thousands of insect species have been transported (largely inadvertently) and established outside of their native ranges worldwide, some with catastrophic ecological and economic impacts. Global variation in numbers of invading species depends on geographic variation in propagule pressure and heterogeneity of environmental resistance to invasions. Elton's diversity-invasibility hypothesis, proposed over sixty years ago, has been widely explored for plants but little is known on how biodiversity affects insect invasions. Here we use species inventories from 44 land areas, ranging from small oceanic islands to entire continents in various world regions, to show that numbers of established insect species are primarily driven by diversity of plants, with both native and non-native plant species richness being the strongest predictor of insect invasions. We find that at large spatial scales, plant diversity directly explains variation in non-native insect species richness among world regions, while geographic factors such as land area, climate and insularity largely affect insect invasions indirectly via their effects on local plant richness.},
}
@article {pmid30107859,
year = {2018},
author = {Xia, D and Guo, X and Hu, T and Li, L and Teng, PY and Yin, QQ and Luo, L and Xie, T and Wei, YH and Yang, Q and Li, SK and Wang, YJ and Xie, Y and Li, YJ and Wang, CM and Yang, ZC and Chen, XG and Zhou, XH},
title = {Photoperiodic diapause in a subtropical population of Aedes albopictus in Guangzhou, China: optimized field-laboratory-based study and statistical models for comprehensive characterization.},
journal = {Infectious diseases of poverty},
volume = {7},
number = {1},
pages = {89},
pmid = {30107859},
issn = {2049-9957},
support = {2016YFC1200500//National Key Reasearch and Development Program of China/ ; 201508020263//the Guangzhou Synergy Innovation Key Program for Health/ ; 2016A020251001//the Science and Technology Planning Project of Guangdong Province of China/ ; 2012J5100026//the Guangzhou International Science and Technology Cooperation Program/ ; },
mesh = {Adaptation, Physiological ; Aedes/*physiology/virology ; Animals ; China/epidemiology ; Dengue/epidemiology/*prevention &amp; control/transmission ; Dengue Virus/pathogenicity ; Diapause/physiology ; Female ; Male ; *Models, Statistical ; Mosquito Vectors/*physiology/virology ; Photoperiod ; Population Dynamics ; Seasons ; Zygote/physiology ; },
abstract = {BACKGROUND: Aedes albopictus is among the 100 most invasive species worldwide and poses a major risk to public health. Photoperiodic diapause provides a crucial ecological basis for the adaptation of this species to adverse environments. Ae. albopictus is the vital vector transmitting dengue virus in Guangzhou, but its diapause activities herein remain obscure.<br><br>METHODS: In the laboratory, yeast powder and food slurry were compared for a proper diapause determination method, and the critical photoperiod (CPP) was tested at illumination times of 11, 11.5, 12, 12.5, 13, and 13.5 h. A 4-parameter logistic (4PL) regression model was selected to estimate the CPP. In the field, the seasonal dynamics of the Ae. albopictus population, egg diapause, and hatching of overwintering eggs were investigated monthly, weekly, and daily, respectively. A distributed lag non-linear model (DLNM) was used to assess the associations of diapause with meteorological factors.<br><br>RESULTS: In the laboratory, both the wild population and the Foshan strain of Ae. albopictus were induced to diapause at an incidence greater than 80%, and no significant difference (P > 0.1) was observed between the two methods for identifying diapause. The CPP of this population was estimated to be 12.312 h of light. In the field, all of the indexes of the wild population were at the lowest levels from December to February, and the Route Index was the first to increase in March. Diapause incidence displayed pronounced seasonal dynamics. It was estimated that the day lengths of 12.111 h at week2016, 43 and 12.373 h at week2017, 41 contributed to diapause in 50% of the eggs. Day length was estimated to be the main meteorological factor related to diapause.<br><br>CONCLUSIONS: Photoperiodic diapause of Ae. albopictus in Guangzhou of China was confirmed and comprehensively elucidated in both the laboratory and the field. Diapause eggs are the main form for overwintering and begin to hatch in large quantities in March in Guangzhou. Furthermore, this study also established an optimized investigation system and statistical models for the study of Ae. albopictus diapause. These findings will contribute to the prevention and control of Ae. albopictus and mosquito-borne diseases.},
}
@article {pmid30107827,
year = {2018},
author = {Fernando, GKAW and Jayakody, S and Wijenayake, WMHK and Galappaththy, GNL and Yatawara, M and Harishchandra, J},
title = {A comparison of the larvivorous habits of exotic Poecilia reticulata and native Aplocheilus parvus.},
journal = {BMC ecology},
volume = {18},
number = {1},
pages = {25},
pmid = {30107827},
issn = {1472-6785},
mesh = {Animals ; Cyprinodontiformes/*physiology ; Diet ; *Ecosystem ; *Feeding Behavior ; Female ; Introduced Species ; Male ; Poecilia/physiology ; Sri Lanka ; },
abstract = {BACKGROUND: The exotic fish Poecilia reticulata is promoted in the tropics as a biological control agent for aquatic pathogenic carriers, such as mosquitoes. Such control measures are often adopted blindly, ignoring the potential of native species and the adverse effects of introduced species. The present study was conducted to assess the diet composition of two species of fish, the native Aplocheilus parvus and exotic P. reticulata, and to assess the availability of food items in their natural environment in four types of aquatic systems. Diet composition was estimated using 24 h gut contents analysis, in a clay quarry pit and a perennial reservoir for A. parvus, and in a man-made canal and a second-order natural stream for P. reticulata. Food items in these environments were quantified by analyzing water samples collected every 2 h.<br><br>RESULTS: The diet of A. parvus in the clay quarry pit and reservoir consisted of adult or larval stages of Insecta, Maxillopoda and Malacostraca. In both habitats, A. parvus selectively fed on insect parts and insect larvae. The diet of P. reticulata consisted of filamentous algae, diatoms and detritus. The diet of A. parvus showed active selection of insectivore food items against their low availability. In contrast, the diet of P. reticulata showed consumption of food items in accordance with their availability in the environment. The highest mean number of food items in the gut for A. parvus was recorded around mid-day in the clay quarry pit, but no peak feeding time was identified in the perennial reservoir. For P. reticulata, peak feeding was recorded around mid-day in both the habitats.<br><br>CONCLUSION: Irrespective of the type of environment and rate of occurrence, A. parvus preferred insect and insect larvae, whereas P. reticulata consumed the most readily available food items. The active selection of insects by A. parvus suggests they may have value as a biological control agent.},
}
@article {pmid30107526,
year = {2018},
author = {Liu, C and Zhang, Y and Ren, Y and Wang, H and Li, S and Jiang, F and Yin, L and Qiao, X and Zhang, G and Qian, W and Liu, B and Fan, W},
title = {The genome of the golden apple snail Pomacea canaliculata provides insight into stress tolerance and invasive adaptation.},
journal = {GigaScience},
volume = {7},
number = {9},
pages = {},
pmid = {30107526},
issn = {2047-217X},
mesh = {Acclimatization/*genetics ; Animals ; *Genome ; *Introduced Species ; Snails/*genetics ; Stress, Physiological/*genetics ; },
abstract = {Background: The golden apple snail (Pomacea canaliculata) is a freshwater snail listed among the top 100 worst invasive species worldwide and a noted agricultural and quarantine pest that causes great economic losses. It is characterized by fast growth, strong stress tolerance, a high reproduction rate, and adaptation to a broad range of environments.<br><br>Results: Here, we used long-read sequencing to produce a 440-Mb high-quality, chromosome-level assembly of the P. canaliculata genome. In total, 50 Mb (11.4%) repeat sequences and 21,533 gene models were identified in the genome. The major findings of this study include the recent explosion of DNA/hAT-Charlie transposable elements, the expansion of the P450 gene family, and the constitution of the cellular homeostasis system, which contributes to ecological plasticity in stress adaptation. In addition, the high transcriptional levels of perivitelline genes in the ovary and albumen gland promote the function of nutrient supply and defense ability in eggs. Furthermore, the gut metagenome also contains diverse genes for food digestion and xenobiotic degradation.<br><br>Conclusions: These findings collectively provide novel insights into the molecular mechanisms of the ecological plasticity and high invasiveness.},
}
@article {pmid30105041,
year = {2018},
author = {Hietala, AM and Børja, I and Solheim, H and Nagy, NE and Timmermann, V},
title = {Propagule Pressure Build-Up by the Invasive Hymenoscyphus fraxineus Following Its Introduction to an Ash Forest Inhabited by the Native Hymenoscyphus albidus.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {1087},
pmid = {30105041},
issn = {1664-462X},
abstract = {Dieback of European ash, caused by the ascomycete Hymenoscyphus fraxineus originating from Asia, has rapidly spread across Europe, and is threatening this keystone tree at a continental scale. High propagule pressure is characteristic to invasive species. Consistently, the enormous production of windborne ascospores by H. fraxineus in an ash forest with epidemic level of disease obviously facilitates its invasiveness and long distance spread. To understand the rate of build-up of propagule pressure by this pathogen following its local introduction, during 2011-2017 we monitored its sporulation at a newly infested ash stand in south-western Norway characterized with mild winters and cool summers. We also monitored the propagule pressure by Hymenoscyphus albidus, a non-pathogenic native species that competes for the same sporulation niche with H. fraxineus. During the monitoring period, crown condition of ash trees had impaired, and 20% of the dominant trees were severely damaged in 2017. H. fraxineus showed an exponential increase in spore production between 2012 and 2015, followed by drastic decline in 2016 and 2017. During 2011-2013, the two Hymenoscyphus species showed similar sporulation level, but thereafter spores of H. albidus were no longer detected. The data suggest that following local introduction, the population of H. fraxineus reaches rapidly an exponential growth stage if the local weather conditions are favorable for ascomata maturation across years. In the North Atlantic climate, summer temperatures critically influence the pathogen infection pressure, warm summers allowing the population to grow according to its biotic potential, whereas cold summers can cause a drastic decline in propagule pressure.},
}
@article {pmid30103413,
year = {2018},
author = {Lemos, RPM and Matielo, CBD and Beise, DC and da Rosa, VG and Sarzi, DS and Roesch, LFW and Stefenon, VM},
title = {Characterization of Plastidial and Nuclear SSR Markers for Understanding Invasion Histories and Genetic Diversity of Schinus molle L.},
journal = {Biology},
volume = {7},
number = {3},
pages = {},
pmid = {30103413},
issn = {2079-7737},
abstract = {Invasive plant species are expected to display high dispersal capacity but low levels of genetic diversity due to the founder effect occurring at each invasion episode. Understanding the history of invasions and the levels of genetic diversity of such species is an important task for planning management and monitoring strategy for these events. Peruvian Peppertree (Schinus molle L.) is a pioneer tree species native from South America which was introduced in North America, Europe and Africa, becoming a threat to these non-native habitats. In this study, we report the discovery and characterization of 17 plastidial (ptSSR) and seven nuclear (nSSR) markers for S. molle based on low-coverage whole-genome sequencing data acquired through next-generation sequencing. The markers were tested in 56 individuals from two natural populations sampled in the Brazilian Caatinga and Pampa biomes. All loci are moderately to highly polymorphic and revealed to be suitable for genetic monitoring of new invasions, for understanding the history of old invasions, as well as for genetic studies of native populations in their natural occurrence range and of orchards established with commercial purposes.},
}
@article {pmid30102718,
year = {2018},
author = {Knuesting, J and Brinkmann, MC and Silva, B and Schorsch, M and Bendix, J and Beck, E and Scheibe, R},
title = {Who will win where and why? An ecophysiological dissection of the competition between a tropical pasture grass and the invasive weed Bracken over an elevation range of 1000 m in the tropical Andes.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0202255},
pmid = {30102718},
issn = {1932-6203},
mesh = {Agriculture ; *Altitude ; Biomass ; Coumaric Acids ; Ecuador ; *Introduced Species ; Photosynthesis ; Plant Weeds ; Pteridium/chemistry/*growth &amp; development/radiation effects ; Setaria Plant/chemistry/*growth &amp; development/radiation effects ; Temperature ; Tyramine/analogs &amp; derivatives ; Ultraviolet Rays ; },
abstract = {In tropical agriculture, the vigorously growing Bracken fern causes severe problems by invading pastures and out-competing the common pasture grasses. Due to infestation by that weed, pastures are abandoned after a few years, and as a fatal consequence, the biodiversity-rich tropical forest is progressively cleared for new grazing areas. Here we present a broad physiological comparison of the two plant species that are the main competitors on the pastures in the tropical Ecuadorian Andes, the planted forage grass Setaria sphacelata and the weed Bracken (Pteridium arachnoideum). With increasing elevation, the competitive power of Bracken increases as shown by satellite data of the study region. Using data obtained from field measurements, the annual biomass production of both plant species, as a measure of their competitive strength, was modeled over an elevational gradient from 1800 to 2800 m. The model shows that with increasing elevation, biomass production of the two species shifts in favor of Bracken which, above 1800 m, is capable of outgrowing the grass. In greenhouse experiments, the effects on plant growth of the presumed key variables of the elevational gradient, temperature and UV radiation, were separately analyzed. Low temperature, as well as UV irradiation, inhibited carbon uptake of the C4-grass more than that of the C3-plant Bracken. The less temperature-sensitive photosynthesis of Bracken and its effective protection from UV radiation contribute to the success of the weed on the highland pastures. In field samples of Bracken but not of Setaria, the content of flavonoids as UV-scavengers increased with the elevation. Combining modeling with measurements in greenhouse and field allowed to explain the invasive growth of a common weed in upland pastures. The performance of Setaria decreases with elevation due to suboptimal photosynthesis at lower temperatures and the inability to adapt its cellular UV screen.},
}
@article {pmid30102286,
year = {2018},
author = {Cohnstaedt, LW and Disberger, JC and Paulsen, E and Duehl, AJ},
title = {Key Elements of Photo Attraction Bioassay for Insect Studies or Monitoring Programs.},
journal = {Journal of visualized experiments : JoVE},
volume = {},
number = {137},
pages = {},
pmid = {30102286},
issn = {1940-087X},
mesh = {Animals ; Biological Assay/*methods ; Insect Control/*methods ; Insecta ; },
abstract = {Optimized visual attractants will increase insect trapping efficiency by using the target insect's innate behaviors (positive photo-taxis) as a means to lure the insect into a population control or monitoring trap. Light emitting diodes (LEDs) have created customizable lighting options with specific wavelengths (colors), intensities, and bandwidths, all of which can be customized to the target insects. Photo-attraction behavioral bioassays can use LEDs to optimize the attractive color(s) for an insect species down to specific life history stages or behaviors (mating, feeding, or seeking shelter). Researchers must then confirm the bioassay results in the field and understand the limited attractive distance of the visual attractants. The cloverleaf bioassay arena is a flexible method to assess photo attraction while also assessing a range of natural insect behaviors such as escape and feeding responses. The arena can be used for terrestrial or aerial insect experiments, as well as diurnal, and nocturnal insects. Data collection techniques with the arena are videotaping, counting contact with the lights, or physically collecting the insects as they are attracted towards the lights. The assay accounts for insects that make no-choice and the arenas can be single (noncompetitive) color or multiple (competitive) colors. The cloverleaf design causes insects with strong thigmotaxis to return to the center of the arena where they can view all the options in a competitive LED tests. The cloverleaf arena presented here has been used with mosquitoes, bed bugs, Hessian fly, house flies, biting midges, red flour beetles, and psocids. Bioassays are used to develop accurate and effective insect traps to guide the development and optimization of insect traps used to monitor pest population fluctuations for disease vector risk assessments, the introduction of invasive species, and/or be used for population suppression.},
}
@article {pmid30101298,
year = {2018},
author = {Edwards, RJ and Tuipulotu, DE and Amos, TG and O'Meally, D and Richardson, MF and Russell, TL and Vallinoto, M and Carneiro, M and Ferrand, N and Wilkins, MR and Sequeira, F and Rollins, LA and Holmes, EC and Shine, R and White, PA},
title = {Draft genome assembly of the invasive cane toad, Rhinella marina.},
journal = {GigaScience},
volume = {7},
number = {9},
pages = {},
pmid = {30101298},
issn = {2047-217X},
mesh = {Animals ; Bufonidae/*genetics ; *Genome ; *Introduced Species ; *Molecular Sequence Annotation ; },
abstract = {Background: The cane toad (Rhinella marina formerly Bufo marinus) is a species native to Central and South America that has spread across many regions of the globe. Cane toads are known for their rapid adaptation and deleterious impacts on native fauna in invaded regions. However, despite an iconic status, there are major gaps in our understanding of cane toad genetics. The availability of a genome would help to close these gaps and accelerate cane toad research.<br><br>Findings: We report a draft genome assembly for R. marina, the first of its kind for the Bufonidae family. We used a combination of long-read Pacific Biosciences RS II and short-read Illumina HiSeq X sequencing to generate 359.5 Gb of raw sequence data. The final hybrid assembly of 31,392 scaffolds was 2.55 Gb in length with a scaffold N50 of 168 kb. BUSCO analysis revealed that the assembly included full length or partial fragments of 90.6% of tetrapod universal single-copy orthologs (n = 3950), illustrating that the gene-containing regions have been well assembled. Annotation predicted 25,846 protein coding genes with similarity to known proteins in Swiss-Prot. Repeat sequences were estimated to account for 63.9% of the assembly.<br><br>Conclusions: The R. marina draft genome assembly will be an invaluable resource that can be used to further probe the biology of this invasive species. Future analysis of the genome will provide insights into cane toad evolution and enrich our understanding of their interplay with the ecosystem at large.},
}
@article {pmid30097317,
year = {2018},
author = {Chen, K and Wu, M and Zhang, Y and Zhang, F and Wang, H and Liang, J and Yan, P and Li, E and Yao, L and Xu, J and Wu, X},
title = {Two introduced crocodile species had changed reproductive characteristics in China.},
journal = {Animal reproduction science},
volume = {196},
number = {},
pages = {150-159},
doi = {10.1016/j.anireprosci.2018.07.008},
pmid = {30097317},
issn = {1873-2232},
mesh = {Alligators and Crocodiles/*physiology ; Animals ; China ; *Introduced Species ; Ovum ; Reproduction/*physiology ; },
abstract = {The purpose of this study was to study the reproductive characteristics of the Nile crocodile and Siamese crocodiles after introduction into China since the time this occurred near the end of the last century. The data for the eggs and young crocodiles (recently hatched crocodiles) of two introduced species were collected at a Sanya crocodile breeding farm in Hainan. The characteristic variables of crocodile eggs were statistically analyzed, and the results indicated that: egg mass of the Nile and Siamese crocodile was significantly correlated with the egg length and width. Regression analyses were used to develop the linear equation between the egg length, egg width and egg mass. There was a strong positive correlation between the egg mass and initial weight of young crocodiles. The linear equation for assessing egg mass and initial weight of young crocodile was developed for regression analyses. There was no significant linear relationship between clutch size and egg characteristics. Mating time of the Nile crocodile in Hainan (November-April) and the spawning season (March-May) are significantly earlier than in the Zimbabwe region of origin. The average of clutch size and the mean size of eggs for Nile crocodiles in their native habitat is greater than the introduced region as indicated by analyzing data using a two-sample t-test. The Siamese crocodile spawning time was similar in the Hainan and Zimbabwe regions, but the size of clutches and the mean size of eggs in the introduced region were greater than in their native region as indicated by results using a two-sample t-test.},
}
@article {pmid30097257,
year = {2019},
author = {Borah, AJ and Agarwal, M and Goyal, A and Moholkar, VS},
title = {Physical insights of ultrasound-assisted ethanol production from composite feedstock of invasive weeds.},
journal = {Ultrasonics sonochemistry},
volume = {51},
number = {},
pages = {378-385},
doi = {10.1016/j.ultsonch.2018.07.046},
pmid = {30097257},
issn = {1873-2828},
mesh = {Biomass ; Ethanol/*metabolism ; Fermentation ; Hexoses/metabolism ; Hydrogen-Ion Concentration ; Hydrolysis ; *Introduced Species ; Pentoses/metabolism ; *Physical Phenomena ; Plant Weeds/*chemistry ; Saccharomyces cerevisiae/metabolism ; *Ultrasonic Waves ; },
abstract = {Invasive weeds ubiquitously found in terrestrial and aquatic ecosystems form potential feedstock for lignocellulosic ethanol production. The present study has reported a bioprocess for production of ethanol using mixed feedstock of 8 invasive weeds found in India. The feedstock was subjected to pretreatment comprising dilute acid hydrolysis (for hydrolysis of hemicellulosic fraction), alkaline delignification and enzymatic hydrolysis of cellulosic fraction. Pentose-rich and hexose-rich hydrolyzates obtained from pretreatment were fermented separately using microbial cultures of S. cerevisiae and C. shehatae. Fermentation mixture was sonicated at 35 kHz at 10% duty cycle. The time profiles of total reducing sugars, ethanol and biomass was fitted to a kinetic model using Genetic Algorithm. Sonication boosted the kinetics of fermentation 2-fold. The net bioethanol yield of the process was ∼220 g/kg raw biomass (with contributions of 86.8 and 133 g/kg raw biomass from pentose and hexose fermentations, respectively). Comparative evaluation of parameters of kinetic model under control and test conditions revealed several beneficial influences of sonication on both pentose and hexose fermentation systems such as faster transport of nutrients, substrate and products across cell membrane, rise in Monod saturation constant for substrate with concurrent reduction in substrate inhibition, and reduction of energy requirements for cell maintenance. Flow cytometry analysis of native and ultrasound-treated cells revealed no adverse influence of sonication on cell viability.},
}
@article {pmid30093592,
year = {2018},
author = {Hulme, PE},
title = {Protected land: Threat of invasive species.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6402},
pages = {561-562},
doi = {10.1126/science.aau3784},
pmid = {30093592},
issn = {1095-9203},
mesh = {Biodiversity ; *Conservation of Natural Resources ; Ecosystem ; *Introduced Species ; },
}
@article {pmid30093236,
year = {2018},
author = {Navarro-Barranco, C and Florido, M and Ros, M and González-Romero, P and Guerra-García, JM},
title = {Impoverished mobile epifaunal assemblages associated with the invasive macroalga Asparagopsis taxiformis in the Mediterranean Sea.},
journal = {Marine environmental research},
volume = {141},
number = {},
pages = {44-52},
doi = {10.1016/j.marenvres.2018.07.016},
pmid = {30093236},
issn = {1879-0291},
abstract = {There is an increasing concern about the ecosystem consequences of altering macroalgal assemblages. Many macrophytes are foundation species in coastal habitats, supporting much of the biodiversity of these ecosystems by providing essential resources such as food and habitat. The addition of invasive species strongly contributes to habitat modification, but the bottom-up impacts of non-native macroalgae on higher trophic levels remains difficult to predict. The main aim of this study was to evaluate the effects of the invasive macroalga Asparagopsis taxiformis on biodiversity by comparing the mobile macrofauna inhabiting this species to the dominant native species Halopteris scoparia. This is the first comprehensive study of the possible effects of this widespread invasive species on higher trophic levels. A hierarchical sampling design with two different spatial scales was conducted to explore the consistency of the patterns observed. Fifty-nine species belonging to superorder Peracarida were found, accounting 90% of all organisms. A. taxiformis hosted an impoverished epifaunal assemblage in comparison to that associated with the native seaweed, showing significantly lower values of diversity, abundance and number of epifaunal species across study locations. The structure of the associated macrofauna (both in terms of species composition, variability among samples and relative abundance of the species) was also different. Our results highlighted the strong influence of A. taxiformis in the resident community, with differences among the two macroalgae in all the parameters considered. Finally, our results also reflect a biotic homogenization of the epifaunal assemblages associated to A. taxiformis, a scarcely explored consequence of invasive processes in marine environments. Future studies exploring the cascading effects of the observed changes in the epifaunal assemblages would be necessary in order to estimate system responses to macroalgal invasions.},
}
@article {pmid30092038,
year = {2018},
author = {Burford, BP and Lee, G and Friedman, DA and Brachmann, E and Khan, R and MacArthur-Waltz, DJ and McCarty, AD and Gordon, DM},
title = {Foraging behavior and locomotion of the invasive Argentine ant from winter aggregations.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0202117},
pmid = {30092038},
issn = {1932-6203},
mesh = {Animals ; Ants/*physiology ; *Appetitive Behavior ; California ; Ecosystem ; *Feeding Behavior ; Geography ; Introduced Species ; *Locomotion ; Movement ; Population Dynamics ; Rain ; *Seasons ; Temperature ; },
abstract = {The collective behavior of ant colonies, and locomotion of individuals within a colony, both respond to changing conditions. The invasive Argentine ant (Linepithema humile) thrives in Mediterranean climates with hot, dry summers and colder, wet winters. However, its foraging behavior and locomotion has rarely been studied in the winter. We examined how the foraging behavior of three distinct L. humile colonies was related to environmental conditions and the locomotion of workers during winter in northern California. We found that colonies foraged most between 10 and 15°C, regardless of the maximum daily temperature. Worker walking speed was positively associated with temperature (range 6-24°C) and negatively associated with humidity (range 25-93%RH). All colonies foraged during all day and night hours in a predictable daily cycle, with a correlation between the rate of incoming and outgoing foragers. Foraging activity was unrelated to the activity of a competing native ant species, Prenolepis imparis, which was present in low abundance, and ceased only during heavy rain when ants left foraging trails and aggregated in small sheltered areas on trees.},
}
@article {pmid30088687,
year = {2018},
author = {Horwood, PF and McBryde, ES and Peniyamina, D and Ritchie, SA},
title = {The Indo-Papuan conduit: a biosecurity challenge for Northern Australia.},
journal = {Australian and New Zealand journal of public health},
volume = {42},
number = {5},
pages = {434-436},
doi = {10.1111/1753-6405.12808},
pmid = {30088687},
issn = {1753-6405},
mesh = {Australia ; Humans ; Indonesia ; *Introduced Species ; Pandemics/*prevention &amp; control/statistics &amp; numerical data ; Papua New Guinea ; },
}
@article {pmid30088085,
year = {2018},
author = {Searle, CL and Hochstedler, BR and Merrick, AM and Ilmain, JK and Wigren, MA},
title = {High resources and infectious disease facilitate invasion by a freshwater crustacean.},
journal = {Oecologia},
volume = {188},
number = {2},
pages = {571-581},
pmid = {30088085},
issn = {1432-1939},
abstract = {It is well-established that both resources and infectious disease can influence species invasions, but little is known regarding interactive effects of these two factors. We performed a series of experiments to understand how resources and parasites can jointly affect the ability of a freshwater invasive zooplankton to establish in a population of a native zooplankton. In a life history trial, we found that both species increased offspring production to the same degree as algal resources increased, suggesting that changes in resources would have similar effects on both species. In a microcosm experiment simulating an invasion, we found that the invasive species reached its highest densities when there was a combination of both high resources and the presence of a shared parasite, but not for each of these conditions alone (i.e., a significant resource x parasite interaction). This result can be explained by changes in native host population density; high resource levels initially led to an increase in the density of the native host, which caused larger epidemics when the parasite was present. This high infection prevalence caused a subsequent reduction in native host density, increasing available resources and allowing the invasive species to establish relatively dense populations. Thus, in this system, native communities with a combination of high resource levels and parasitism may be the most vulnerable to invasions. More generally, our results suggest that parasitism and resource availability can have interactive, non-additive effects on the outcome of invasions.},
}
@article {pmid30087693,
year = {2018},
author = {Sales, NG and Mariani, S and Salvador, GN and Pessali, TC and Carvalho, DC},
title = {Hidden Diversity Hampers Conservation Efforts in a Highly Impacted Neotropical River System.},
journal = {Frontiers in genetics},
volume = {9},
number = {},
pages = {271},
pmid = {30087693},
issn = {1664-8021},
abstract = {Neotropical Rivers host a highly diverse ichthyofauna, but taxonomic uncertainty prevents appropriate conservation measures. The Doce River Basin (DRB), lying within two Brazilian threatened hotspots (Atlantic Forest and Brazilian Savanna) in south-east Brazil, faced the worst ever environmental accident reported for South American catchments, due to a dam collapse that spread toxic mining tailings along the course of its main river. Its ichthyofauna was known to comprise 71 native freshwater fish species, of which 13 endemic. Here, we build a DNA barcode library for the DRB ichthyofauna, using samples obtained before the 2015 mining disaster, in order to provide a more robust biodiversity record for this basin, as a baseline for future management actions. Throughout the whole DRB, we obtained a total of 306 barcodes, assigned to 69 putative species (with a mean of 4.54 barcodes per species), belonging to 45 genera, 18 families, and 5 orders. Average genetic distances within species, genus, and families were 2.59, 11.4, and 20.5%, respectively. The 69 species identified represent over 76% of the known DRB ichthyofauna, comprising 43 native (five endemic, of which three threatened by extinction), 13 already known introduced species, and 13 unknown species (such as Characidium sp., Neoplecostomus sp., and specimens identified only at the sub-family level Neoplecostominae, according to morphological identification provided by the museum collections). Over one fifth of all analyzed species (N = 16) had a mean intraspecific genetic divergence higher than 2%. An integrative approach, combining NND (nearest neighbor distance), BIN (barcode index number), ABGD (automatic barcode gap discovery), and bPTP (Bayesian Poisson Tree Processes model) analyses, suggested the occurrence of potential cryptic species, species complex, or historical errors in morphological identification. The evidence presented calls for a more robust, DNA-assisted cataloging of biodiversity-rich ecosystems, in order to enable effective monitoring and informed actions to preserve and restore these delicate habitats.},
}
@article {pmid30085189,
year = {2018},
author = {McClure, KM and Lawrence, C and Kilpatrick, AM},
title = {Land Use and Larval Habitat Increase Aedes albopictus (Diptera: Culicidae) and Culex quinquefasciatus (Diptera: Culicidae) Abundance in Lowland Hawaii.},
journal = {Journal of medical entomology},
volume = {55},
number = {6},
pages = {1509-1516},
pmid = {30085189},
issn = {1938-2928},
support = {R01 AI090159/AI/NIAID NIH HHS/United States ; },
abstract = {Vector abundance plays a key role in transmission of mosquito-borne disease. In Hawaii, Aedes albopictus (Skuse) (Diptera: Culicidae), the Asian tiger mosquito, has been implicated in locally-transmitted dengue outbreaks, while Culex quinquefasciatus Say (Diptera: Culicidae), the southern house mosquito, is the primary vector of avian malaria, a wildlife disease that has contributed to declines and extinctions of native Hawaiian birds. Despite the importance of these introduced species to human and wildlife health, little is known about the local-scale drivers that shape mosquito abundance across lowland Hawaii, where forest, agricultural, and residential land uses are prevalent. We examined landscape, larval habitat, and climate drivers of Ae. albopictus and Cx. quinquefasciatus abundance in eight lowland wet forest fragments on the Big Island of Hawaii. We found that the abundance of both species increased with the proportion of surrounding developed land and the availability of larval habitat, which were themselves correlated. Our findings suggest that conversion of natural habitats to residential and agricultural land increases mosquito larval habitats, increasing the abundance of Ae. albopictus and Cx. quinquefasciatus and increasing disease risk to humans and wildlife in Hawaii. Our results further indicate that while source reduction of artificial larval habitats-particularly moderately-sized human-made habitats including abandoned cars and tires-could reduce mosquito abundance, eliminating larval habitat will be challenging because both species utilize both natural and human-made larval habitats in lowland Hawaii.},
}
@article {pmid30084201,
year = {2019},
author = {Johnson, AL and Ashman, TL},
title = {Consequences of invasion for pollen transfer and pollination revealed in a tropical island ecosystem.},
journal = {The New phytologist},
volume = {221},
number = {1},
pages = {142-154},
doi = {10.1111/nph.15366},
pmid = {30084201},
issn = {1469-8137},
support = {DBI-1523771//National Science Foundation/ ; DEB 1241006//National Science Foundation/ ; DEB 1452386//National Science Foundation/ ; },
abstract = {Pollination is known to be sensitive to environmental change but we lack direct estimates of how quantity and quality of pollen transferred between plant species shifts along disturbance gradients. This limits our understanding of how species compositional change impacts pollen receipt per species and structure of pollen transfer networks. We constructed pollen transfer networks along a plant invasion gradient in the Hawaiian dry tropical forest ecosystem. Flowers and stigmas were collected from both native and introduced plants, pollen was identified and enumerated and floral traits were measured. We also characterized pollen loads carried by individuals of the dominant invasive pollinator, Apis mellifera. Species flowering in native-dominated sites were more tightly connected by pollen transfer than those in heavily invaded sites. Compositional turnover in the pollen loads of A. mellifera was correlated (70%) with turnover in the composition of pollen transfer networks. Floral traits predicted species roles within pollen transfer networks, but many of these differed qualitatively depending on whether plants were native or introduced. Our work indicates that pollen transfer networks change with invasion. Floral morphology and foraging behaviour of the introduced super-generalist pollinator are implicated as key in determining the roles introduced species play within native pollen transfer networks.},
}
@article {pmid30084019,
year = {2018},
author = {Potgieter, LJ and Gaertner, M and Irlich, UM and O'Farrell, PJ and Stafford, L and Vogt, H and Richardson, DM},
title = {Managing Urban Plant Invasions: a Multi-Criteria Prioritization Approach.},
journal = {Environmental management},
volume = {62},
number = {6},
pages = {1168-1185},
pmid = {30084019},
issn = {1432-1009},
support = {85417//National Research Foundation/ ; },
abstract = {Alien plant invasions in urban areas can have considerable impact on biodiversity and ecosystem services (ES). Managing urban plant invasions is particularly challenging given the complex interactions between ecological, economic and social elements that exist in the urban milieu. Strategic landscape-scale insights are crucial for guiding management, as are tactical site-scale perspectives to plan and coordinate control efforts on the ground. Integrating these requirements to enhance management efficiency is a major challenge. Decision-support models have considerable potential for guiding and informing management strategies when problems are complex. This study uses multi-criteria decision tools to develop a prioritization framework for managing invasive alien plants (IAPs) in urban areas at landscape and local scales. We used the Analytic Hierarchy Process (AHP; a multi-criteria decision support model) to develop and rank criteria for prioritising IAP management in the City of Cape Town (CoCT), South Africa. Located within a global biodiversity hotspot, Cape Town has a long history of alien plant introductions and a complex socio-political make-up, creating a useful system to explore the challenges associated with managing urban plant invasions. To guide the prioritization of areas for IAP management across the CoCT, a stakeholder workshop was held to identify a goal and criteria for consideration, and to assess the relative importance given to each criterion in IAP management. Workshop attendees were drawn from multiple disciplines involved with different aspects of IAP research and management: government departments, scientists and researchers, and managers with a diverse set of skills and interests. We selected spatial datasets and applied our multi-criteria decision analysis in a Geographic Information System (GIS) to develop a landscape-scale prioritization map. To address issues relevant in an urban setting, we also modified an existing IAP management framework to develop a tactical (site-level) prioritization scheme for guiding on-the-ground control operations. High-priority sites for IAP management were identified at landscape- and local scales across the study area. Factors related to safety and security emerged as pivotal features for setting spatially-explicit priorities for management. The approach applied in this study can be useful for managers in all urban settings to guide the selection and prioritization of areas for IAP management.},
}
@article {pmid30083900,
year = {2018},
author = {Luellen, DR and LaGuardia, MJ and Tuckey, TD and Fabrizio, MC and Rice, GW and Hale, RC},
title = {Assessment of legacy and emerging contaminants in an introduced catfish and implications for the fishery.},
journal = {Environmental science and pollution research international},
volume = {25},
number = {28},
pages = {28355-28366},
doi = {10.1007/s11356-018-2801-9},
pmid = {30083900},
issn = {1614-7499},
support = {NA11NMF4570220//National Oceanic and Atmospheric Administration/ ; },
mesh = {Animals ; Catfishes/growth &amp; development/*metabolism ; District of Columbia ; Environmental Exposure/*analysis ; *Fisheries ; Humans ; Mercury/analysis ; Polychlorinated Biphenyls/analysis ; Rivers/*chemistry ; Virginia ; Water Pollutants, Chemical/*analysis ; },
abstract = {Since introduction into the Chesapeake Bay watershed in the 1970s, blue catfish (Ictalurus furcatus) populations have increased, impacting native species. One strategy suggested to limit their growing numbers is to expand the existing commercial fishery. However, the promotion of human consumption of this large, omnivorous fish may increase exposure to contaminants of concern (COC). However, there are few published data on contaminants in blue catfish. To evaluate this possibility, we measured COC (PCBs, PBDEs, OCs, Hg) in individual fillets and compared levels to established consumption advisory limits. James River (near Richmond, Virginia) and Upper Potomac River (downstream of Washington DC) fish exhibited higher burdens of most COC than those from the lower James and rural Rappahannock rivers. Fish sex and δ15N values (surrogate for trophic position) did not correlate with COC concentrations. Potomac River fish exhibited greatest δ15N, perhaps related to local wastewater inputs. Despite differences in human population densities among watersheds, fish mercury (Hg) levels were similar. Most fillets surpassed US EPA advisory limits for unrestricted consumption (> 16 meals/month) for Hg and PCBs. Hg and PCB advisories in the region typically restrict consumption to two 220 g meals/month. Hence, individuals who rely on fish for a large portion of their diet may be exposed to unacceptable Hg and PCB concentrations. COC levels typically increased with fish length; in particular, fish > 550 mm often exceeded unrestricted consumption limits for chlordanes and DDTs. PBDEs, pentachloroanisole, hexachlorobenzene, and mirex levels were generally below established advisories. However, because fish advisories are based on the expected consequences from single contaminants and a single or limited number of toxicological endpoints, consumers face greater risks due to cumulative effects from all coincident COCs, as well as additional exposure pathways, such as other food and air. The additional data on contaminant levels reported here will increase the accuracy of forecasted risks. However, it also illustrates the complexity in communicating the risks from multi-contaminant exposure.},
}
@article {pmid30083455,
year = {2018},
author = {Jermacz, Ł and Kobak, J},
title = {The Braveheart amphipod: a review of responses of invasive Dikerogammarus villosus to predation signals.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5311},
pmid = {30083455},
issn = {2167-8359},
abstract = {Predator pressure is a fundamental force driving changes at all levels of the community structure. It may protect native ecosystems from alien species. Therefore, resistance to diverse predators resulting from a universal anti-predator strategy seems crucial for invasion success. We present a comprehensive review of the responses of an invasive amphipod Dikerogammarus villosus to sympatric and allopatric predator signals. We summarize diverse aspects of the gammarid anti-predator strategy, including predator identification, morphological and behavioural adaptations, effectiveness of shelter use and resistance to indirect predator effects. The response of D. villosus is independent of predator species (including totally allopatric taxa), which assures the high flexibility of its predator recognition system. It has a harder exoskeleton and better capability of utilizing shelters compared to other gammarids, resulting in relatively high resistance to predators. Therefore, it can use predator kairomones as indirect food signals (sharing the diet with the predator) and follow the predator scent. This resistance may allow D. villosus to reduce the costs of its physiological responses to predators and sustain growth in their presence. This might facilitate invasion success by increasing its competitive advantage.},
}
@article {pmid30079610,
year = {2019},
author = {Bucciarelli, GM and Suh, D and Lamb, AD and Roberts, D and Sharpton, D and Shaffer, HB and Fisher, RN and Kats, LB},
title = {Assessing effects of non-native crayfish on mosquito survival.},
journal = {Conservation biology : the journal of the Society for Conservation Biology},
volume = {33},
number = {1},
pages = {122-131},
doi = {10.1111/cobi.13198},
pmid = {30079610},
issn = {1523-1739},
support = {//United States Geological Survey/ ; //Las Virgenes Municipal Water District/ ; },
abstract = {Introductions of non-native predators often reduce biodiversity and affect natural predator-prey relationships and may increase the abundance of potential disease vectors (e.g., mosquitoes) indirectly through competition or predation cascades. The Santa Monica Mountains (California, U.S.A.), situated in a global biodiversity hotspot, is an area of conservation concern due to climate change, urbanization, and the introduction of non-native species. We examined the effect of non-native crayfish (Procambarus clarkii) on an existing native predator, dragonfly nymphs (Aeshna sp.), and their mosquito larvae (Anopheles sp.) prey. We used laboratory experiments to compare the predation efficiency of both predators, separately and together, and field data on counts of dragonfly nymphs and mosquito larvae sampled from 13 local streams. We predicted a lower predation efficiency of crayfish compared with native dragonfly nymphs and a reduced predation efficiency of dragonfly nymphs in the presence of crayfish. Dragonfly nymphs were an order of magnitude more efficient predators than crayfish, and dragonfly nymph predation efficiency was reduced in the presence of crayfish. Field count data showed that populations of dragonfly nymphs and mosquito larvae were strongly correlated with crayfish presence in streams, such that sites with crayfish tended to have fewer dragonfly nymphs and more mosquito larvae. Under natural conditions, it is likely that crayfish reduce the abundance of dragonfly nymphs and their predation efficiency and thereby, directly and indirectly, lead to higher mosquito populations and a loss of ecosystem services related to disease vector control.},
}
@article {pmid30079101,
year = {2018},
author = {Collins, JP},
title = {Gene drives in our future: challenges of and opportunities for using a self-sustaining technology in pest and vector management.},
journal = {BMC proceedings},
volume = {12},
number = {Suppl 8},
pages = {9},
pmid = {30079101},
issn = {1753-6561},
abstract = {Gene drives are systems of biased inheritance that enhance the likelihood a sequence of DNA passes between generations through sexual reproduction and potentially throughout a local population and ultimately all connected populations of a species. Gaps in our knowledge of gene drive systems prompted the US National Institutes of Health (NIH) and the Foundation for the NIH to ask the US National Academies of Sciences, Engineering, and Medicine (NASEM) to convene an expert panel to provide an independent, objective examination of what we know about gene drive systems. The report, &quot;Gene drives on the horizon: Advancing science, navigating uncertainty, and aligning research with public values,&quot; outlines our understanding of the science, ethics, public engagement, governance, and risk assessment pertaining to gene drive research. Researchers have studied naturally occurring gene drive systems for more than a century. While CRISPR/Cas9 was not the first molecular tool considered to create an engineered gene drive, the advent of the CRISPR/Cas9 technology for gene editing gave a renewed impetus to developing gene drives in the laboratory for eventual release in the field. Recent experiments demonstrate that a CRISPR/Cas9-based gene drive can spread a targeted gene throughout nearly all of laboratory populations of yeast, fruit flies, or mosquitoes. Applying this basic science, there are proposals to use gene drive modified organisms to address such things as eradication of insect-borne infectious diseases and conservation of threatened and endangered species. Gene drives could potentially support agriculture by reversing pesticide and herbicide resistance in insects and weeds, and by control of damaging, invasive species. A major recommendation of the NASEM report is that there is insufficient evidence at this time to support release of gene-drive modified organisms into the environment. Importantly, the committee also recognized that the potential benefits of gene drives for basic and applied research are significant and justify proceeding with laboratory research and controlled field trials. This review summarizes highlights of the NASEM report with its focus on using the CRISPR/Cas9 genome-editing technology to develop gene drive modified organisms.},
}
@article {pmid30077401,
year = {2019},
author = {Shackleton, RT and Adriaens, T and Brundu, G and Dehnen-Schmutz, K and Estévez, RA and Fried, J and Larson, BMH and Liu, S and Marchante, E and Marchante, H and Moshobane, MC and Novoa, A and Reed, M and Richardson, DM},
title = {Stakeholder engagement in the study and management of invasive alien species.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {88-101},
doi = {10.1016/j.jenvman.2018.04.044},
pmid = {30077401},
issn = {1095-8630},
abstract = {Invasive alien species are a major driver of global environmental change and a range of management interventions are needed to manage their effects on biodiversity, ecosystem services, human well-being and local livelihoods. Stakeholder engagement is widely advocated to integrate diverse knowledge and perspectives in the management of invasive species and to deal with potential conflicts of interest. We reviewed the literature in the ISI Web of Science on stakeholder engagement (the process of involving stakeholders (actors) in decision making, management actions and knowledge creation) in invasion science to assess and understand what has been done (looking at approaches and methodologies used, stakeholders involved, and outcomes from engagement) and to make recommendations for future work. Research on stakeholder engagement in invasion science has increased over the last decade, helping to improve scientific knowledge and contributing towards policy formulation and co-implementation of management. However, many challenges remain and engagement could be made more effective. For example, most studies engage only one stakeholder group passively using questionnaires, primarily for assessing local knowledge and perceptions. Although useful for management and policy planning, these stakeholders are not active participants and there is no two-way flow of knowledge. To make stakeholder involvement more useful, we encourage more integrative and collaborative engagement to (1) improve co-design, co-creation and co-implementation of research and management actions; (2) promote social learning and provide feedback to stakeholders; (3) enhance collaboration and partnerships beyond the natural sciences and academia (interdisciplinary and transdisciplinary collaboration); and (4) discuss some practical and policy suggestions for improving stakeholder engagement in invasion science research and management. This will help facilitate different stakeholders to work better together, allowing problems associated with biological invasions to be tackled more holistically and successfully.},
}
@article {pmid30077400,
year = {2019},
author = {Shackleton, RT and Richardson, DM and Shackleton, CM and Bennett, B and Crowley, SL and Dehnen-Schmutz, K and Estévez, RA and Fischer, A and Kueffer, C and Kull, CA and Marchante, E and Novoa, A and Potgieter, LJ and Vaas, J and Vaz, AS and Larson, BMH},
title = {Explaining people's perceptions of invasive alien species: A conceptual framework.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {10-26},
doi = {10.1016/j.jenvman.2018.04.045},
pmid = {30077400},
issn = {1095-8630},
abstract = {Human perceptions of nature and the environment are increasingly being recognised as important for environmental management and conservation. Understanding people's perceptions is crucial for understanding behaviour and developing effective management strategies to maintain, preserve and improve biodiversity, ecosystem services and human well-being. As an interdisciplinary team, we produced a synthesis of the key factors that influence people's perceptions of invasive alien species, and ordered them in a conceptual framework. In a context of considerable complexity and variation across time and space, we identified six broad-scale dimensions: (1) attributes of the individual perceiving the invasive alien species; (2) characteristics of the invasive alien species itself; (3) effects of the invasion (including negative and positive impacts, i.e. benefits and costs); (4) socio-cultural context; (5) landscape context; and (6) institutional and policy context. A number of underlying and facilitating aspects for each of these six overarching dimensions are also identified and discussed. Synthesising and understanding the main factors that influence people's perceptions is useful to guide future research, to facilitate dialogue and negotiation between actors, and to aid management and policy formulation and governance of invasive alien species. This can help to circumvent and mitigate conflicts, support prioritisation plans, improve stakeholder engagement platforms, and implement control measures.},
}
@article {pmid30075029,
year = {2018},
author = {Martínez, JJ and de Aranzamendi, MC and Bucher, EH},
title = {Quantitative genetics in the monk parakeet (Myiopsitta monachus) from central Argentina: Estimation of heritability and maternal effects on external morphological traits.},
journal = {PloS one},
volume = {13},
number = {8},
pages = {e0201823},
pmid = {30075029},
issn = {1932-6203},
mesh = {Animals ; Argentina ; Beak/anatomy &amp; histology ; Biological Evolution ; Body Weight/genetics ; Genetic Association Studies ; *Maternal Inheritance ; Microsatellite Repeats ; Models, Genetic ; Parakeets/*anatomy &amp; histology/*genetics ; Phenotype ; Tail/anatomy &amp; histology ; Tarsus, Animal/anatomy &amp; histology ; Wings, Animal/anatomy &amp; histology ; },
abstract = {The monk parakeet (Myiopsitta monachus) is a South American species unique among parrots; it builds communal stick nests that allow independence from tree or cliff cavities required by most parrots. As a very successful invasive species, it has expanded into several countries around the world. Questions remain around the factors that allowed this species to be such a successful invader in its native range as in other countries, and particularly the extent that evolutionary processes may be involved in adapting to new areas. Along with this line of analysis, we focused on assessing whether morphological characteristics are sufficiently heritable, and therefore responsive to selection. As the first step in this direction, we have estimated heritability of monk parakeet in six external morphological traits considered of potential adaptability value. Samples were obtained in the province of Córdoba in central Argentina. Data from seven microsatellites were used to determine the familial relationships among individuals. Heritabilities and genetic correlations were estimated by means of animal models. We found evidence for significant heritability in the six traits measured, particularly in weight, tarsus length and bill width. We also found evidence of maternal effects on morphological traits, particularly in the traits with lower heritability: wing length, bill length and tail length. Genetic correlations between traits were significant and associated with phenotypic correlations, suggesting that these traits are constrained in terms of evolutionary potential, whereas the amount of additive genetic variance in weight, tarsus length and bill width indicate that these traits could be responsive to selection.},
}
@article {pmid30073748,
year = {2018},
author = {Vieira, A and Silva, DN and Várzea, V and Paulo, OS and Batista, D},
title = {Novel insights on colonization routes and evolutionary potential of Colletotrichum kahawae, a severe pathogen of Coffea arabica.},
journal = {Molecular plant pathology},
volume = {19},
number = {11},
pages = {2488-2501},
doi = {10.1111/mpp.12726},
pmid = {30073748},
issn = {1364-3703},
support = {112217//Fundação para a Ciência e a Tecnologia/ ; 2009//Fundação para a Ciência e a Tecnologia/ ; 89397//Fundação para a Ciência e a Tecnologia/ ; 86736//Fundação para a Ciência e a Tecnologia/ ; 2012//Fundação para a Ciência e a Tecnologia/ ; 104629//Fundação para a Ciência e a Tecnologia/ ; 2014//Fundação para a Ciência e a Tecnologia/ ; 04129//Fundação para a Ciência e a Tecnologia/ ; 2013//Fundação para a Ciência e a Tecnologia/ ; 00329//Fundação para a Ciência e a Tecnologia/ ; 2013//Fundação para a Ciência e a Tecnologia/ ; },
abstract = {Pathogenic fungi are emerging at an increasing rate on a wide range of host plants, leading to tremendous threats to the global economy and food safety. Several plant pathogens have been considered to be invasive species, rendering large-scale population genomic analyses crucial to better understand their demographic history and evolutionary potential. Colletotrichum kahawae (Ck) is a highly aggressive and specialized pathogen, causing coffee berry disease in Arabica coffee in Africa. This pathogen leads to severe production losses and its dissemination out of Africa is greatly feared. To address this issue, a population genomic approach using thousands of single nucleotide polymorphisms (SNPs) spaced throughout the genome was used to unveil its demographic history and evolutionary potential. The current study confirms that Ck is a true clonal pathogen, perfectly adapted to green coffee berries, with three completely differentiated populations (Angolan, Cameroonian and East African). Two independent clonal lineages were found within the Angolan population as opposed to the remaining single clonal populations. The most probable colonization scenario suggests that this pathogen emerged in Angola and immediately dispersed to East Africa, where these two populations began to differentiate, followed by the introduction in Cameroon from an Angolan population. However, the differentiation between the two Angolan clonal lineages masks the mechanism for the emergence of the Cameroonian population. Our results suggest that Ck is completely differentiated from the ancestral lineage, has a low evolutionary potential and a low dispersion ability, with human transport the most likely scenario for its potential dispersion, which makes the fulfilment of the quarantine measures and management practices implemented crucial.},
}
@article {pmid30073135,
year = {2018},
author = {Shashank, PR and Twinkle, S and Chandrashekar, K and Meshram, NM and Suroshe, SS and Bajracharya, ASR},
title = {Genetic homogeneity in South American tomato pinworm, Tuta absoluta: a new invasive pest to oriental region.},
journal = {3 Biotech},
volume = {8},
number = {8},
pages = {350},
pmid = {30073135},
issn = {2190-572X},
abstract = {South American tomato leaf miner, Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae), is an important invasive pest of Tomato which invaded India and Nepal in 2014 and 2016, respectively. In the present study, samples from five localities of India and one from Nepal were used for the investigation of genetic diversity of T. absoluta by employing a fragment in the mtDNA gene-encoding cytochrome oxidase I (COI). Based on the partial COI gene, high genetic homogeneity was detected in T. absoluta populations of India and Nepal with rest of the world. Less nucleotide diversity (π 0.00137) was also detected in the populations of T. absoluta from different countries. This is first attempt to analyze molecular data for this new invasive species from India and Nepal.},
}
@article {pmid30072602,
year = {2018},
author = {Máximo, P and Ferreira, LM and Branco, P and Lima, P and Lourenço, A},
title = {Secondary Metabolites and Biological Activity of Invasive Macroalgae of Southern Europe.},
journal = {Marine drugs},
volume = {16},
number = {8},
pages = {},
pmid = {30072602},
issn = {1660-3397},
mesh = {*Introduced Species ; Mediterranean Region ; Seaweed/*chemistry/*metabolism ; Species Specificity ; },
abstract = {In this review a brief description of the invasive phenomena associated with algae and its consequences on the ecosystem are presented. Three examples of invasive algae of Southern Europe, belonging to Rodophyta, Chlorophyta, and Phaeophyta, were selected, and a brief description of each genus is presented. A full description of their secondary metabolites and biological activity is given and a summary of the biological activity of extracts is also included. In Asparagopsis we encounter mainly halogenated compounds. From Caulerpa, several terpenoids and alkaloids were isolated, while in Sargassum, meroterpenoids prevail.},
}
@article {pmid30069966,
year = {2018},
author = {Burford Reiskind, MO and Labadie, P and Bargielowski, I and Lounibos, LP and Reiskind, MH},
title = {Rapid evolution and the genomic consequences of selection against interspecific mating.},
journal = {Molecular ecology},
volume = {27},
number = {18},
pages = {3641-3654},
doi = {10.1111/mec.14821},
pmid = {30069966},
issn = {1365-294X},
support = {AI095780//NIH Exploratory/Developmental Research Grant Award (R21)/ ; //Wynne Innovation Grant from the CALS Dean's Enrichment Grant program at NCSU/ ; //Applied Ecology and Entomology and Plant Pathology Departments at NCSU/ ; },
abstract = {While few species introduced into a new environment become invasive, those that do provide critical information on ecological mechanisms that determine invasions success and the evolutionary responses that follow invasion. Aedes albopictus (the Asian tiger mosquito) was introduced into the naturalized range of Aedes aegypti (the yellow fever mosquito) in the United States in the mid-1980s, resulting in the displacement of A. aegypti in much of the south-eastern United States. The rapid displacement was likely due to the superior competitive ability of A. albopictus as larvae and asymmetric mating interference competition, in which male A. albopictus mate with and sterilize A. aegypti females, a process called &quot;satyrization.&quot; The goal of this study was to examine the genomic responses of a resident species to an invasive species in which the mechanism of character displacement is understood. We used double-digest restriction enzyme DNA sequencing (ddRADseq) to analyse outlier loci between selected and control lines of laboratory-reared A. aegypti females from two populations (Tucson, AZ and Key West, Florida, USA), and individual females classified as either &quot;resisted&quot; or &quot;mated with&quot; A. albopictus males via mating trials of wild-derived females from four populations in Florida. We found significant outlier loci in comparing selected and control lines and between mated and nonmated A. aegypti females in the laboratory and wild-derived populations, respectively. We found overlap in specific outlier loci between different source populations that support consistent genomic signatures of selection within A. aegypti. Our results point to regions of the A. aegypti genome and potential candidate genes that may be involved in mating behaviour, and specifically in avoiding interspecific mating choices.},
}
@article {pmid30068678,
year = {2018},
author = {Qiu, S and Xu, X and Liu, S and Liu, W and Liu, J and Nie, M and Shi, F and Zhang, Y and Weiner, J and Li, B},
title = {Latitudinal pattern of flowering synchrony in an invasive wind-pollinated plant.},
journal = {Proceedings. Biological sciences},
volume = {285},
number = {1884},
pages = {},
pmid = {30068678},
issn = {1471-2954},
abstract = {Flowering synchrony can play an important role in plants' reproductive success, which is essential for the successful establishment and spread of invasive plants. Although flowering synchrony has been found to be closely related to climatic factors, the effects of variation in such factors along latitudinal gradient on flowering synchrony and the role of flowering synchrony in the reproductive success of invading populations remain largely unexplored. In a 2-year field study, we examined the latitudinal variation of flowering phenology, especially flowering synchrony, in an invasive plant, Spartina alterniflora, along coastal China, and its relationship with population seed set across three climatic zones. We found that first flowering date was delayed, and flowering synchrony increased with increasing latitude. Flowering synchrony was negatively related to temperature during flowering season but not to soil properties or precipitation, suggesting that climate has shaped the latitudinal pattern of flowering synchrony. Moreover, a positive correlation between flowering synchrony and seed set across latitudes indicates the possible role of flowering synchrony in the latitudinal pattern of sexual reproduction in S. alterniflora These results suggest that, in addition to the effects of climate on the growth of invasive species, climatic factors can play an important role in the invasion success of alien plants by regulating the flowering synchrony and thus the reproductive success of invasive plants.},
}
@article {pmid30068321,
year = {2018},
author = {Dörler, D and Kropf, M and Laaha, G and Zaller, JG},
title = {Occurrence of the invasive Spanish slug in gardens: can a citizen science approach help deciphering underlying factors?.},
journal = {BMC ecology},
volume = {18},
number = {1},
pages = {23},
pmid = {30068321},
issn = {1472-6785},
support = {100994//Bundesministerium für Land- und Forstwirtschaft, Umwelt und Wasserwirtschaft/International ; },
mesh = {*Animal Distribution ; Animals ; Austria ; DNA Barcoding, Taxonomic ; *Environment ; Gardens ; Gastropoda/genetics/*physiology ; *Introduced Species ; Phylogeny ; Sequence Analysis, DNA ; *Weather ; },
abstract = {BACKGROUND: The Spanish slug (Arion vulgaris, also known as A. lusitanicus) is considered one of the most invasive species in agriculture, horticulture and private gardens all over Europe. Although this slug has been problematic for decades, there is still not much known about its occurrence across private gardens and the underlying meteorological and ecological factors. One reason for this knowledge gap is the limited access of researchers to private gardens. Here we used a citizen science approach to overcome this obstacle and examined whether the occurrence of Arionidae in Austrian gardens was associated with meteorological (air temperature, precipitation, global solar radiation, relative humidity) or ecological factors (plant diversity, earthworm activity). Occurrence of the invasive A. vulgaris versus the similar-looking native A. rufus was compared using a DNA-barcoding approach.<br><br>RESULTS: Slugs were collected from 1061 gardens from the dry Pannonian lowland to the wet alpine climate (altitudinal range 742 m). Slug abundance in gardens was best explained and negatively associated with the parameters &quot;sum of the mean air temperature in spring&quot;, &quot;number of frost days in the previous winter&quot; and &quot;mean daily global solar radiation on the day of data collection&quot;. Precipitation, plant diversity and earthworm activity were also related to slug abundance, but positively. Out of our genetic sampling of collected slugs, 92% belonged to A. vulgaris.<br><br>CONCLUSIONS: Our study showed that citizen science (i) is a feasible approach to record species occurrence in restricted areas across a wide geographical range and (ii) could be more widely employed in order to identify underlying environmental factors of species occurrence.},
}
@article {pmid30065865,
year = {2018},
author = {Fennell, M and Wade, M and Bacon, KL},
title = {Japanese knotweed (Fallopia japonica): an analysis of capacity to cause structural damage (compared to other plants) and typical rhizome extension.},
journal = {PeerJ},
volume = {6},
number = {},
pages = {e5246},
pmid = {30065865},
issn = {2167-8359},
abstract = {Fallopia japonica (Japanese knotweed) is a well-known invasive alien species in the UK and elsewhere in Europe and North America. The plant is known to have a negative impact on local biodiversity, flood risk and ecosystem services; but in the UK it is also considered to pose a significant risk to the structural integrity of buildings that are within seven m of the above ground portions of the plant. This has led to the presence of the plant on residential properties regularly being used to refuse mortgage applications. Despite the significant socioeconomic impacts of such automatic mortgage option restriction, little research has been conducted to investigate this issue. The 'seven-m rule' is derived from widely adopted government guidance in the UK. This study considered if there is evidence to support this phenomenon in the literature, reports the findings of a survey of invasive species control contractors and property surveyors to determine if field observations support these assertions, and reports a case study of 68 properties, located on three streets in northern England where F. japonica was recorded. Additionally, given the importance of proximity, the seven-m rule is also tested based on data collected during the excavation based removal of F. japonica from 81 sites. No support was found to suggest that F. japonica causes significant damage to built structures, even when it is growing in close proximity to them and certainly no more damage than other plant species that are not subject to such stringent lending policies. It was found that the seven-m rule is not a statistically robust tool for estimating likely rhizome extension. F. japonica rhizome rarely extends more than four m from above ground plants and is typically found within two m for small stands and 2.5 m for large stands. Based on these findings, the practice of automatically restricting mortgage options for home buyers when F. japonica is present, is not commensurate with the risk.},
}
@article {pmid30065735,
year = {2018},
author = {Gendron St-Marseille, AF and Lord, E and Véronneau, PY and Brodeur, J and Mimee, B},
title = {Genome Scans Reveal Homogenization and Local Adaptations in Populations of the Soybean Cyst Nematode.},
journal = {Frontiers in plant science},
volume = {9},
number = {},
pages = {987},
pmid = {30065735},
issn = {1664-462X},
abstract = {Determining the adaptive potential of alien invasive species in a new environment is a key concern for risk assessment. As climate change is affecting local climatic conditions, widespread modifications in species distribution are expected. Therefore, the genetic mechanisms underlying local adaptations must be understood in order to predict future species distribution. The soybean cyst nematode (SCN), Heterodera glycines Ichinohe, is a major pathogen of soybean that was accidentally introduced in most soybean-producing countries. In this study, we explored patterns of genetic exchange between North American populations of SCN and the effect of isolation by geographical distance. Genotyping-by-sequencing was used to sequence and compare 64 SCN populations from the United States and Canada. At large scale, only a weak correlation was found between genetic distance (Wright's fixation index, FST) and geographic distance, but local effects were strong in recently infested states. Our results also showed a high level of genetic differentiation within some populations, allowing them to adapt to new environments and become established in new soybean-producing areas. Bayesian genome scan methods identified 15 loci under selection for climatic or geographic co-variables. Among these loci, two non-synonymous mutations were detected in SMAD-4 (mothers against decapentaplegic homolog 4) and DOP-3 (dopamine receptor 3). High-impact variants linked to these loci by genetic hitchhiking were also highlighted as putatively involved in local adaptation of SCN populations to new environments. Overall, it appears that strong selective pressure by resistant cultivars is causing a large scale homogenization with virulent populations.},
}
@article {pmid30060026,
year = {2018},
author = {Wang, YS and Zhou, P and Tian, H and Wan, FH and Zhang, GF},
title = {First Record of the Invasive Pest Pseudococcus jackbeardsleyi (Hemiptera: Pseudococcidae) on the Chinese Mainland and Its Rapid Identification Based on Species-Specific Polymerase Chain Reaction.},
journal = {Journal of economic entomology},
volume = {111},
number = {5},
pages = {2120-2128},
doi = {10.1093/jee/toy223},
pmid = {30060026},
issn = {1938-291X},
abstract = {The Jack Beardsley mealybug, Pseudococcus jackbeardsleyi Gimpel &amp; Miller (Hemiptera: Pseudococcidae), a globally devastating, invasive polyphagous insect, causes great damage to many fruits, ornamentals, vegetables, and food crops worldwide. It is of Neotropical origin and has invaded throughout America and in parts of Asia, Africa and Oceania, and is still expanding its invasion ranges. Therefore, a method for quick and correct identification of this invasive species is crucial for quarantine and spreading interruption of it. In present study, we report the first record of P. jackbeardsleyi on the Chinese mainland, which would cause great damage to many crops. The identification of P. jackbeardsleyi was verified via morphological characters and DNA barcoding. One pair of species-specific polymerase chain reaction (SS-PCR) primers was designed based on variations in the sequences of the mitochondrial cytochromecoxidasesubunitI gene among P. jackbeardsleyi and 28 other mealybug species. No cross-reaction was detected among 21 closely related species using this SS-PCR assay, demonstrating the specificity of this marker. Furthermore, this method was successfully applied to detect individuals from different developmental stages and adult debris across four geographic populations of P. jackbeardsleyi, showing the high stability of the assay. Additionally, the detection limit of the marker was 55.94 ± 5.05 pg/µl of P. jackbeardsleyi DNA, illustrating the high sensitivity of the assay. The SS-PCR assay developed in this study provides a rapid, simple and reliable method for the identification of P. jackbeardsleyi, which should be crucial in the plant quarantine, early detection and sustainable management of this globally invasive pest.},
}
@article {pmid30058030,
year = {2018},
author = {Mori, E and Pisanu, B and Zozzoli, R and Solano, E and Olivieri, E and Sassera, D and Montagna, M},
title = {Arthropods and associated pathogens from native and introduced rodents in Northeastern Italy.},
journal = {Parasitology research},
volume = {117},
number = {10},
pages = {3237-3243},
pmid = {30058030},
issn = {1432-1955},
mesh = {Anaplasma/genetics/*isolation &amp; purification/physiology ; Animals ; Borrelia/genetics/isolation &amp; purification/*physiology ; Disease Reservoirs/microbiology ; Humans ; Introduced Species ; Italy ; Ixodes/classification/*microbiology ; Lyme Disease/epidemiology/*microbiology/transmission ; Rickettsia/genetics/isolation &amp; purification/physiology ; Rodentia/classification/*microbiology ; Sciuridae/microbiology/parasitology ; },
abstract = {Introduced Siberian chipmunks Eutamias sibiricus have been reported to be important reservoirs for human Lyme disease, as they may host high numbers of hard ticks carrying Borrelia spp. and other pathogens. In the present study, we assessed the prevalence of Borrelia spp. and other pathogenic bacteria in ectoparasite arthropod species infesting Siberian chipmunks and coexisting native small rodents. Small rodents were trapped with Sherman traps in Veneto (NE Italy), where the largest Italian populations of chipmunks occur. A total of 14 individual ticks were found on 223 rodents, with 6 more ticks obtained from stored dead chipmunks from the same study area. Ectoparasites were screened for pathogens by molecular analyses including species-specific PCR amplifications. Rickettsia monacensis, Borrelia lusitaniae, and Anaplasma platys were present in the parasites of both native rodents and introduced chipmunks. The present findings suggest a role for the invasive species E. sibiricus in the maintenance of the Ixodes ricinus life cycle, which may result in the modification of the transmission dynamics of tick-borne pathogens. Moreover, the presence of Rickettsia in urban populations of chipmunks may represent a serious risk for human health and should be investigated further.},
}
@article {pmid30057479,
year = {2018},
author = {Pellegrini, MOO},
title = {Erratum: Wandering throughout South America: Taxonomic revision of Tradescantia subg. Austrotradescantia (D.R.Hunt) M.Pell. (Commelinaceae).},
journal = {PhytoKeys},
volume = {},
number = {104},
pages = {1-97},
pmid = {30057479},
issn = {1314-2011},
abstract = {[This corrects the article DOI: 10.3897/phytokeys.101.25057.].},
}
@article {pmid30056805,
year = {2018},
author = {Seixas, FA and Boursot, P and Melo-Ferreira, J},
title = {The genomic impact of historical hybridization with massive mitochondrial DNA introgression.},
journal = {Genome biology},
volume = {19},
number = {1},
pages = {91},
pmid = {30056805},
issn = {1474-760X},
support = {FCT-ANR/BIA-EVF/0250/2012//Fundação para a Ciência e a Tecnologia/International ; IF/00033/2014/CP1256/CT0005//Fundação para a Ciência e a Tecnologia/International ; SFRH/BD/87126/2012//Fundação para a Ciência e a Tecnologia/International ; ANR-12-ISV7-0002-01//Agence Nationale de la Recherche/International ; NORTE-01-0145-FEDER-000007//NORTE2020, ERDF/International ; },
mesh = {Adaptation, Biological/genetics ; *Animal Migration ; Animals ; Cell Nucleus/genetics ; DNA, Mitochondrial/*genetics ; Europe ; Genetics, Population ; *Genome ; *Hybridization, Genetic ; Lagomorpha/classification/*genetics ; Mitochondria/genetics ; Models, Genetic ; Phylogeny ; Recombination, Genetic ; Selection, Genetic ; Whole Genome Sequencing ; X Chromosome/chemistry ; },
abstract = {BACKGROUND: The extent to which selection determines interspecific patterns of genetic exchange enlightens the role of adaptation in evolution and speciation. Often reported extensive interspecific introgression could be selection-driven, but also result from demographic processes, especially in cases of invasive species replacements, which can promote introgression at their invasion front. Because invasion and selective sweeps similarly mold variation, population genetics evidence for selection can only be gathered in an explicit demographic framework. The Iberian hare, Lepus granatensis, displays in its northern range extensive mitochondrial DNA introgression from L. timidus, an arctic/boreal species that it replaced locally after the last glacial maximum. We use whole-genome sequencing to infer geographic and genomic patterns of nuclear introgression and fit a neutral model of species replacement with hybridization, allowing us to evaluate how selection influenced introgression genome-wide, including for mtDNA.<br><br>RESULTS: Although the average nuclear and mtDNA introgression patterns contrast strongly, they fit a single demographic model of post-glacial invasive replacement of timidus by granatensis. Outliers of elevated introgression include several genes related to immunity, spermatogenesis, and mitochondrial metabolism. Introgression is reduced on the X chromosome and in low recombining regions.<br><br>CONCLUSIONS: General nuclear and mtDNA patterns of introgression can be explained by purely demographic processes. Hybrid incompatibilities and interplay between selection and recombination locally modulate levels of nuclear introgression. Selection promoted introgression of some genes involved in conflicts, either interspecific (parasites) or possibly cytonuclear. In the latter case, nuclear introgression could mitigate the potential negative effects of alien mtDNA on mitochondrial metabolism and male-specific traits.},
}
@article {pmid30055910,
year = {2018},
author = {Bailey, NW and Moore, AJ},
title = {Evolutionary Consequences of Social Isolation.},
journal = {Trends in ecology &amp; evolution},
volume = {33},
number = {8},
pages = {595-607},
doi = {10.1016/j.tree.2018.05.008},
pmid = {30055910},
issn = {1872-8383},
abstract = {Social isolation has profound impacts. Most animal research focuses on negative phenotypic consequences of social isolation within individual lifetimes. Less is known about how it affects genetics, selection, and evolution over longer timescales, though ample indirect evidence suggests that it might. We advocate that evolutionary consequences of social isolation be tested more directly. We suggest that the 'index of social isolation', the mismatch between actual and optimal social interaction experienced by individuals within a population, may play a key role in releasing cryptic genetic variation, adaptation rates, diversification patterns, and ecosystem-level processes. Evolutionary dynamics arising from social isolation could have significant impacts in applied settings such as conservation, animal breeding, control of biological invasions, and evolutionary resilience to anthropogenic change.},
}
@article {pmid30051843,
year = {2018},
author = {Johnson, MTJ and Prashad, CM and Lavoignat, M and Saini, HS},
title = {Contrasting the effects of natural selection, genetic drift and gene flow on urban evolution in white clover (Trifolium repens).},
journal = {Proceedings. Biological sciences},
volume = {285},
number = {1883},
pages = {},
pmid = {30051843},
issn = {1471-2954},
abstract = {Urbanization is a global phenomenon with profound effects on the ecology and evolution of organisms. We examined the relative roles of natural selection, genetic drift and gene flow in influencing the evolution of white clover (Trifolium repens), which thrives in urban and rural areas. Trifolium repens exhibits a Mendelian polymorphism for the production of hydrogen cyanide (HCN), a potent antiherbivore defence. We quantified the relative frequency of HCN in 490 populations sampled along urban-rural transects in 20 cities. We also characterized genetic variation within 120 populations in eight cities using 16 microsatellite loci. HCN frequency increased by 0.6% for every kilometre from an urban centre, and the strength of this relationship did not significantly vary between cities. Populations did not exhibit changes in genetic diversity with increasing urbanization, indicating that genetic drift is unlikely to explain urban-rural clines in HCN frequency. Populations frequently exhibited isolation-by-distance and extensive gene flow along most urban-rural transects, with the exception of a single city that exhibited genetic differentiation between urban and rural populations. Our results show that urbanization repeatedly drives parallel evolution of an ecologically important trait across many cities that vary in size, and this evolution is best explained by urban-rural gradients in natural selection.},
}
@article {pmid30049620,
year = {2019},
author = {Shackleton, RT and Shackleton, CM and Kull, CA},
title = {The role of invasive alien species in shaping local livelihoods and human well-being: A review.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {145-157},
doi = {10.1016/j.jenvman.2018.05.007},
pmid = {30049620},
issn = {1095-8630},
abstract = {Invasive alien species are a well-recognised driver of social-ecological change globally. Much research has focused on ecological impacts, but the role of invasive species for livelihoods and human well-being is less well known. Understanding the effects (benefits and costs) of invasive species on livelihoods and human well-being is important for guiding policy formulation and management. Here we review the literature on the role of invasive species in livelihoods to assess what is known, identify knowledge gaps and provide recommendations for future research. Literature was collected using key word searches and included both journal publications and grey literature. Slightly less than half (48%) of species studied had both substantial positive and negative impacts on local livelihoods (e.g. Australian Acacia spp. species; Camelus dromedaries; Lantana camara; Prosopis spp.), with 37% inducing mainly costs (Chromolaena odorata; Lissachatina fulica; Opuntia stricta) and 16% producing mainly benefits (Opuntia ficus-indica; Acacia spp.). Some species, such as Acacia dealbata, fell into different categories depending on the social-ecological context. Key benefits or services included the provision of fuelwood, fodder, timber and food products for local households communities and to a lesser extent supporting and regulating services such as soil improvement and shade. A number of species also provided cultural services such as recreation and spiritual values and provided many with an opportunity to earn a cash income. However, invasive species also harm livelihoods and increase vulnerability through encroaching on land and reducing mobility or access. They can also decrease the supply of natural resources used by households and reduce agricultural production (livestock and/or crops) which can result in losses of income and increased vulnerability. Furthermore, some invasive species were seen to have negative implications for human health and safety and reduce the cultural value of landscapes. Economic impacts on livelihoods as a result of invasive species were highly variable and very dependent on the social-ecological contexts. These negative implications can reduce resilience and adaptive capacity of households and communities thus increasing their vulnerability to change. Drawing on case studies we highlight that efforts for managing invasive species need to safeguard livelihood benefits while mitigating negative impacts. In concluding we highlight future research and policy needs on the topic of invasive species, livelihoods and human well-being.},
}
@article {pmid30047994,
year = {2018},
author = {Felden, A and Paris, CI and Chapple, DG and Haywood, J and Suarez, AV and Tsutsui, ND and Lester, PJ and Gruber, MAM},
title = {Behavioural variation and plasticity along an invasive ant introduction pathway.},
journal = {The Journal of animal ecology},
volume = {87},
number = {6},
pages = {1653-1666},
doi = {10.1111/1365-2656.12886},
pmid = {30047994},
issn = {1365-2656},
support = {13-VUW-038//Royal Society of New Zealand Marsden/ ; },
abstract = {Once established in new areas, introduced species may exhibit changes in their biology due to phenotypic plasticity, novel selection pressures and genetic drift. Moreover, the introduction process itself has been hypothesised to act as a selective filter for traits that promote invasiveness. We tested the hypothesis that behaviours thought to promote invasiveness-such as increased foraging activity and aggression-are selected for during invasion by comparing traits among native and introduced populations of the widespread Argentine ant (Linepithema humile). We studied Argentine ant populations in the native range in Argentina and in three invaded regions along an introduction pathway: California, Australia and New Zealand. In each region, we set up 32 experimental colonies to measure foraging activity and interspecific aggression in a subset of the study regions. These colonies were subject to experimental manipulation of carbohydrate availability and octopamine, a biogenic amine known to modulate behaviour in insects, to measure variation in behavioural plasticity. We found variation in foraging activity among populations, but this variation was not consistent with selection on behaviour in relation to the invasion process. We found that colonies with limited access to carbohydrates exhibited unchanged exploratory behaviour, but higher exploitation activity and lower aggression. Colonies given octopamine consistently increased foraging behaviour (both exploration and exploitation), as well as aggression when also sugar-deprived. There was no difference in the degree of behavioural response to our experimental treatments along the introduction pathway. We did not find support for selection of behavioural traits associated with invasiveness along the Argentine ant's introduction pathway or clear evidence for an association between the introduction process and variation in behavioural plasticity. These results indicate that mechanisms promote behavioural variation in a similar fashion both in native and introduced ranges. Our results challenge the assumption that introduced populations always perform better in key behavioural traits hypothesised to be associated with invasion success.},
}
@article {pmid30047186,
year = {2018},
author = {Baker, DJ and Garnett, ST and O'Connor, J and Ehmke, G and Clarke, RH and Woinarski, JCZ and McGeoch, MA},
title = {Conserving the abundance of nonthreatened species.},
journal = {Conservation biology : the journal of the Society for Conservation Biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/cobi.13197},
pmid = {30047186},
issn = {1523-1739},
support = {Linkage Development Grant//Faculty of Science, Monash University/ ; DP150103017//Australian Research Council/ ; },
abstract = {Human modification of the environment is driving declines in population size and distributional extent of much of the world's biota. These declines extend to many of the most abundant and widespread species, for which proportionally small declines can result in the loss of vast numbers of individuals, biomass, and interactions. These losses could have major localized effects on ecological and cultural processes and services without elevating a species' global extinction risk. Although most conservation effort is directed at species threatened with extinction in the very near term, the value of retaining abundance regardless of global extinction risk is justifiable based on many biodiversity or ecosystem service metrics, including cultural services, at scales from local to global. The challenges of identifying conservation priorities for widespread and abundant species include quantifying the effects of species' abundance on services and understanding how these effects are realized as populations decline. Negative effects of population declines may be disconnected from the threat processes driving declines because of species movements and environment flows (e.g., hydrology). Conservation prioritization for these species shares greater similarity with invasive species risk assessments than extinction risk assessments because of the importance of local context and per capita effects of abundance on other species. Because conservation priorities usually focus on preventing the extinction of threatened species, the rationale and objectives for incorporating declines of nonthreatened species must be clearly articulated, going beyond extinction risk to encompass the range of likely harmful effects (e.g., secondary extinctions, loss of ecosystem services) if declines persist or are not reversed. Research should focus on characterizing the effects of local declines in species that are not threatened globally across a range of ecosystem services and quantifying the spatial distribution of these effects through the distribution of abundance. The case for conserving abundance in nonthreatened species can be made most powerfully when the costs of losing this abundance are better understood.},
}
@article {pmid30046845,
year = {2018},
author = {Floress, K and Connolly, S and Halvorsen, KE and Egan, A and Schuler, T and Hill, A and DeSenze, P and Fenimore, S and Karriker, K},
title = {Implementing Landscape Scale Conservation across Organizational Boundaries: Lessons from the Central Appalachian Region, United States.},
journal = {Environmental management},
volume = {62},
number = {5},
pages = {845-857},
pmid = {30046845},
issn = {1432-1009},
abstract = {Natural resources across the United States are increasingly managed at the landscape scale through cooperation among multiple organizations and landowners. United States Department of Agriculture Forest Service (USFS) agency leaders have widely promoted this approach since 2009 when Secretary of Agriculture Vilsack called for &quot;all lands&quot; management. Landscape scale projects have been undertaken to address multiple goals such as single species conservation, resilience to fire, invasive species eradication, and others. The West Virginia Restoration Venture (WVRV)-one of five landscape scale conservation projects funded 2014-2016 across the Northeast and Midwest and known as &quot;Joint Chiefs'&quot; projects-was evaluated by an interdisciplinary team of USFS employees to gain insight into how cross-boundary landscape scale conservation projects are implemented in the region. In this paper, the team used qualitative interview data from project participants to explore processes related to developing a shared vision for the landscape, implementation priorities, and methods to work across institutional and property ownership boundaries. Grounded in the landscape and collaborative resource management literatures, the report shows how established inter-organizational networks, flexible approaches to management, and a &quot;shelf-stock&quot; of ready-to-implement projects led to on-the-ground success. The authors provide insight about factors that constrain and facilitate the implementation of landscape scale conservation projects that have multiple goals, landowners, and organizational partners.},
}
@article {pmid30046208,
year = {2018},
author = {Kollars, TM},
title = {Potential for the Invasive Species Aedes Albopictus and Arboviral Transmission through the Chabahar Port in Iran.},
journal = {Iranian journal of medical sciences},
volume = {43},
number = {4},
pages = {393-400},
pmid = {30046208},
issn = {0253-0716},
abstract = {Background: Dengue, chikungunya, and Zika viruses are emerging infectious disease threats wherever suitable vectors, hosts, and habitat are present. The aim of the present study was to use the bioagent transport and environmental modeling system (BioTEMS) to identify the potential for arbovirus-infected Aedes species to invade the Chabahar area in southeastern Iran.<br><br>Methods: ArcGIS geospatial analysis software, Statistica software, and BioTEMS were used to analyze geographic information and conduct data analysis. BioTEMS utilizes up to several hundred abiotic and biotic factors to produce risk and vulnerability assessments for biological agents and infectious diseases. The output of BioTEMS was validated using published predictive models, and most importantly published collection data of Aedes species in Iran.<br><br>Results: There appears to have been two separate invasion events by Ae. albopictus into the southern region of Iran, first preceding 2009 and then again in 2013. BioTEMS identified two probable areas of introduction during the 2009 time frame, either through one or both the Chabahar ports or the Iranshahr airport with subsequent spread through vehicular transport. BioTEMS identified the port as an introduction zone for ZIKAV with high-risk zones and identifies gap zones during the 2013 time frame. Recommended surveillance sites are provided.<br><br>Conclusion: The air and maritime ports of Iran serve international customers, and are therefore vulnerable to import and invasion of mosquito vectors and arboviruses. Based on comparisons with other published low-resolution models, BioTEMS provides information for medical and public health professionals conducting integrated mosquito management, preventive medicine, and epidemiological surveillance.},
}
@article {pmid30043494,
year = {2018},
author = {Bose, APH and McCallum, ES and Raymond, K and Marentette, JR and Balshine, S},
title = {Growth and otolith morphology vary with alternative reproductive tactics and contaminant exposure in the round goby Neogobius melanostomus.},
journal = {Journal of fish biology},
volume = {93},
number = {4},
pages = {674-684},
doi = {10.1111/jfb.13756},
pmid = {30043494},
issn = {1095-8649},
support = {//Natural Sciences and Engineering Research Council of Canada/ ; },
mesh = {Animals ; Body Size ; Environmental Exposure/adverse effects ; Fishes/anatomy &amp; histology/growth &amp; development/*physiology ; Male ; Otolithic Membrane/anatomy &amp; histology/drug effects ; Reproduction ; *Sexual Behavior, Animal ; },
abstract = {Round goby Neogobius melanostomus sagittal (saccular) otolith morphology was compared between males of the two alternative reproductive tactics (termed guarder and sneaker males) and between males captured from sites of high or low contamination. Otolith size increased with fish size and also displayed an ontogenetic shift in shape, becoming relatively taller as otoliths grew in size. Despite a considerable overlap in age between males adopting the two reproductive tactics, size-at-age measurements revealed that guarder males are significantly larger than sneakers at any given age and that they invest more into somatic growth than sneaker males. Controlling for body size, sneaker males possessed heavier sagittal otoliths than guarder males. Subtle otolith shape differences were also found between the two male tactics and between sites of high and low contaminant exposure. Sneaker males had relatively shorter otoliths with more pronounced notching than guarder males. Fish captured at sites of high contamination had otoliths showing slower growth rates in relation to body size and their shapes had more pronounced caudal points and ventral protrusions when compared with fish captured at sites of low contamination. The results are discussed in relation to life-history tradeoffs between the male tactics in terms of reproductive and somatic investment as well as the putative metabolic costs of exposure to contaminants. Overall, this study reveals that male alternative reproductive tactics and environmental contaminants can have small, yet measurable, effects on otolith morphology and these factors should be accounted for in future research when possible.},
}
@article {pmid30042477,
year = {2018},
author = {Ouyang, X and Gao, J and Xie, M and Liu, B and Zhou, L and Chen, B and Jourdan, J and Riesch, R and Plath, M},
title = {Natural and sexual selection drive multivariate phenotypic divergence along climatic gradients in an invasive fish.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {11164},
pmid = {30042477},
issn = {2045-2322},
support = {Z111021403//Northwest A and F University (Northwest A &amp; F University)/ ; },
abstract = {Invasive species that rapidly spread throughout novel distribution ranges are prime models to investigate climate-driven phenotypic diversification on a contemporary scale. Previous studies on adaptive diversification along latitudinal gradients in fish have mainly considered body size and reported either increased or decreased body size towards higher latitudes (i.e. Bergmann's rule). Our study is the first to investigate phenotypic divergence in multiple traits, including sexually selected traits (size and shape of the male copulatory organ, the gonopodium) of invasive Gambusia affinis in China. We studied body size, life history traits and morphological variation across populations spanning 17 degrees of latitude and 16 degrees of longitude. Even though we found phenotypic variation along climatic gradients to be strongest in naturally selected traits, some sexually selected traits also showed systematic gradual divergence. For example, males from southern populations possessed wider gonopodia with increased armament. Generally, males and females diverged in response to different components of climatic gradients (latitudinal or longitudinal variation) and in different trait suites. We discuss that not only temperature regimes, but also indirect effects of increased resource and mate competition (as a function of different extrinsic overwinter mortality rates) alter the selective landscape along climatic gradients.},
}
@article {pmid30042428,
year = {2018},
author = {Lin, ZH and Wu, CH and Ho, CK},
title = {Warming neutralizes host-specific competitive advantages between a native and invasive herbivore.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {11130},
pmid = {30042428},
issn = {2045-2322},
support = {105-2621-B-002-001//Ministry of Science and Technology, Taiwan (Ministry of Science and Technology of Taiwan)/ ; 106-2313-B-002-002//Ministry of Science and Technology, Taiwan (Ministry of Science and Technology of Taiwan)/ ; N/A//National Taiwan University (NTU)/ ; },
abstract = {Although native-invasive species interactions have become a common mechanism shaping ecosystems, whether these interactions shift under warming remains unclear. To investigate how warming may affect native and invasive species separately and together (intraspecific and interspecific competition, respectively) and whether any warming impact is resource dependent, we examined the performance of two competing herbivores (native Pieris canidia and invasive P. rapae) on two common host plants under three temperature settings (control, 3 °C, and 6 °C warming using environmental chambers). The results revealed that warming benefited the development and growth of both Pieris under intraspecific competition, but the benefits were host-plant dependent. Notably, the native or invasive Pieris gained an advantage from interspecific competition (host-plant dependent), but warming neutralized the competitive advantages of either Pieris species. These findings raise the possibility that warming-induced shifts in competitive status may become a crucial mechanism shaping ecosystems worldwide, because most ecosystems are challenged by species invasion and warming. Moreover, this study revealed a discrepancy in species thermal performance between intra- and interspecific competition. Therefore, to predict native-invasive species competition under warming, current thermal performance applications should use species performance curves derived from interspecific rather than intraspecific competition studies (although the latter is more readily available).},
}
@article {pmid30041841,
year = {2019},
author = {Kull, CA and Harimanana, SL and Radaniela Andrianoro, A and Rajoelison, LG},
title = {Divergent perceptions of the 'neo-Australian' forests of lowland eastern Madagascar: Invasions, transitions, and livelihoods.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {48-56},
doi = {10.1016/j.jenvman.2018.06.004},
pmid = {30041841},
issn = {1095-8630},
abstract = {Grevillea banksii (Proteaceae), a non-native shrubby tree, has in the past five decades expanded to cover hundreds of thousands of hectares in lowland eastern Madagascar, accompanied by other Australian and pan-tropical species, including Melaleuca quinquenervia, Acacia mangium, and Eucalyptus spp. We investigate contrasting perceptions of this new landscape with view to facilitate future management. Field research was based on 290 surveys, key informant interviews, and ecological inventories at six sites from Farafangana in the south to Fenerive Est in the north. After documenting the ecology and usage of grevillea, we analyse differing ways in which it can be perceived. Perceptions promoted by scientists and administrators include the contrasting ideas of beneficial landscape greening, rampant biological invasion, novel ecosystems, and forest transition. Perceptions held by local actors are highly determined by practical livelihood concerns. These local views are largely positive due to the major role of grevillea firewood and charcoal sales in livelihoods; however, context plays a major role and a number of disadvantages are perceived as well, including difficulty of removal, competition with crop and pasture land, and the respiratory health impacts of involvement in charcoal production. We conclude that policymakers and managers - in this case and in similar cases around the world - need to be more reflexive on the ways in which environmental problems are framed and to put those frames more in conversation with local people's experiences in order to productively resolve invasive species management dilemmas.},
}
@article {pmid30041398,
year = {2018},
author = {Kenworthy, JM and Rolland, G and Samadi, S and Lejeusne, C},
title = {Local variation within marinas: Effects of pollutants and implications for invasive species.},
journal = {Marine pollution bulletin},
volume = {133},
number = {},
pages = {96-106},
doi = {10.1016/j.marpolbul.2018.05.001},
pmid = {30041398},
issn = {1879-3363},
mesh = {Animals ; *Biodiversity ; Copper/analysis ; Environmental Monitoring ; *Introduced Species ; *Ships ; Water Pollutants, Chemical/analysis ; },
abstract = {Urban structures like marinas are dominant features of our coasts, often hotspots for invasive species. The processes that govern the distribution of invasive species within and between marinas are not well understood. We therefore investigated the impacts of local-scale variability within and between marinas, analysing fouling communities at two zones (inner and outer) within three close marinas in accordance with pollutants recorded in the water and sediment. Communities varied between zones, however no significant differences in abundances of invasive species was recorded. The inner zones contained higher levels of copper and other pollutants and were correlated with lower biodiversity and abundances of many species in comparison to the outer zones. Only the native Ascidiella aspersa was found in greater abundances in the inner zones. This local-scale variability and how it impacts biodiversity is important for consideration for coastal managers in mitigating the build-up of pollutants and spread of invasive species.},
}
@article {pmid30041369,
year = {2018},
author = {Glynn, PW and Feingold, JS and Baker, A and Banks, S and Baums, IB and Cole, J and Colgan, MW and Fong, P and Glynn, PJ and Keith, I and Manzello, D and Riegl, B and Ruttenberg, BI and Smith, TB and Vera-Zambrano, M},
title = {State of corals and coral reefs of the Galápagos Islands (Ecuador): Past, present and future.},
journal = {Marine pollution bulletin},
volume = {133},
number = {},
pages = {717-733},
doi = {10.1016/j.marpolbul.2018.06.002},
pmid = {30041369},
issn = {1879-3363},
mesh = {Animals ; Anthozoa/*physiology ; Carbonates ; Climate ; *Coral Reefs ; Ecosystem ; Ecuador ; El Nino-Southern Oscillation ; Humans ; Pacific Ocean ; Retrospective Studies ; },
abstract = {Coral populations and structural coral reefs have undergone severe reductions and losses respectively over large parts of the Galápagos Islands during and following the 1982-83 El Niño event. Coral tissue loss amounted to 95% across the Archipelago. Also at that time, all coral reefs in the central and southern islands disappeared following severe degradation and eventual collapse due primarily to intense bioerosion and low recruitment. Six sites in the southern islands have demonstrated low to moderate coral community (scattered colonies, but no carbonate framework) recovery. The iconic pocilloporid reef at Devil's Crown (Floreana Island) experienced recovery to 2007, then severe mortality during a La Niña cooling event, and is again (as of 2017) undergoing rapid recovery. Notable recovery has occurred at the central (Marchena) and northern islands (Darwin and Wolf). Of the 17 structural reefs first observed in the mid-1970s, the single surviving reef (Wellington Reef) at Darwin Island remains in a positive growth mode. The remainder either degraded to a coral community or was lost. Retrospective analyses of the age structure of corals killed in 1983, and isotopic signatures of the skeletal growth record of massive corals suggest the occurrence of robust coral populations during at least a 500-year period before 1983. The greatest potential threats to the recovery and persistence of coral reefs include: ocean warming and acidification, bioerosion, coral diseases, human population growth (increasing numbers of residents and tourists), overfishing, invasive species, pollution, and habitat destruction. Such a diverse spectrum of disturbances, acting alone or in combination, are expected to continue to cause local and archipelago-wide mortality and degradation of the coral reef ecosystem.},
}
@article {pmid30041321,
year = {2018},
author = {Montes, A and Lorenzo-Abalde, S and González-Fernández, Á and Vázquez, E and Olabarria, C},
title = {Use of a monoclonal antibody-based assay for the early detection of an invasive bivalve in plankton samples.},
journal = {Marine pollution bulletin},
volume = {133},
number = {},
pages = {320-327},
doi = {10.1016/j.marpolbul.2018.05.004},
pmid = {30041321},
issn = {1879-3363},
mesh = {Animals ; Antibodies, Monoclonal ; Aquaculture ; Fluorescent Antibody Technique, Indirect/*methods ; *Introduced Species ; Larva/immunology ; Mytilidae/*immunology ; Mytilus ; Plankton/*immunology ; Reproducibility of Results ; Spain ; },
abstract = {The invasive mussel Xenostrobus securis was recorded for the first time in the Galician Rias Baixas (NW Spain) in 2007, within an area characterized by intense commercial culture of Mytilus galloprovincialis. The main aims of this study were to evaluate whether an immunological assay can be used to detect larvae of this species in field samples of plankton and to determine whether the distribution of larvae matched that of adults. The ability of two monoclonal antibodies to recognize the bivalve was tested by immunofluorescence. Only the M22.8 antibody recognized X. securis larvae. The staining pattern distinguished X. securis from M. galloprovincialis larvae in both laboratory cultures and field samples of plankton. The distribution of larvae did not match that of adults. This tool may prove very useful for monitoring the presence of this invasive species in the plankton, allowing rapid and specific recognition.},
}
@article {pmid30041305,
year = {2018},
author = {Ziegler, G and Tamburri, MN and Fisher, DJ},
title = {Long-term algal toxicity of oxidant treated ballast water.},
journal = {Marine pollution bulletin},
volume = {133},
number = {},
pages = {18-29},
doi = {10.1016/j.marpolbul.2018.05.013},
pmid = {30041305},
issn = {1879-3363},
mesh = {Chlorine/chemistry/toxicity ; Diatoms/*drug effects/growth &amp; development ; Disinfection ; *Halogenation ; Haptophyta/*drug effects/growth &amp; development ; Introduced Species ; Oxidants/chemistry/toxicity ; *Ships ; Water Pollutants, Chemical/chemistry/*toxicity ; Water Purification ; },
abstract = {National and international regulations require that ships' ballast water is treated to minimize the risk of introducing potentially invasive species. A common approach employed by commercial ballast water management systems is chlorination. This study presents the algal toxicity findings for three chlorination-based BWMS and their implications to environmental safety of port waters receiving treated ballast water from ships. Discharged treated ballast water from all three BWMS was toxic to algae with IC25s (25% growth inhibition) ranging from 9.9% to 17.9%, despite having total residual oxidant concentrations below 0.02 mg/l, based on Whole Effluent Toxicity assays. When held at 4 °C, some of the ballast water samples continued to exhibit toxic effects with no observed effect concentrations as low as 18% after a 134 day holding time. Thirteen individual disinfection by-products were measured above the detected limit at the time of discharge. No correlation between DBPs and algal toxicity was observed.},
}
@article {pmid30039841,
year = {2018},
author = {Leal-Galicia, P and Betancourt, D and Gonzalez-Gonzalez, A and Romo-Parra, H},
title = {[A brief history of marijuana in the western world].},
journal = {Revista de neurologia},
volume = {67},
number = {4},
pages = {133-140},
pmid = {30039841},
issn = {1576-6578},
mesh = {Americas ; Cannabidiol/therapeutic use ; Cannabinoids/adverse effects/*history/therapeutic use ; *Cannabis/chemistry ; History, 16th Century ; History, 17th Century ; History, 18th Century ; History, 19th Century ; History, 20th Century ; History, 21st Century ; History, Ancient ; Humans ; Introduced Species ; Legislation, Drug/history ; Marijuana Abuse/history ; Medical Marijuana/history/therapeutic use ; Medicine, Traditional/history ; Public Policy/history ; },
abstract = {Marijuana is a substance with a long and controversial history. At different times in its history, which goes back over 5,000 years, this plant has been used for different purposes, ranging from recreational and leisure to its use in the treatment of several diseases or to offer relief in processes that entail a certain type of malaise, and including its consideration as a means of relaxation and meditation. Although it was supposed that the roots of marijuana lay in Central America, it is now known that this is but an urban legend with little credibility and that its origins can be found recorded in Chinese medical references dating back to the year 2737 BC. Although this plant was not originally from Central America, it has aroused interest around the world, and above all in Mexico. It is in this country where the use of cannabis has gone from applications in textiles and medicine to its free sale, the bans on its use due to political and social pressures, its tolerance and, recently, its decriminalisation for recreational and medicinal use. Unfortunately there are few references on the history of this plant in Mexico, and thus we have considered it interesting to present some data about the generalities of marijuana, a brief history in the world, the development of decriminalisation in North America, its medicinal uses and its course through Mexico to the present day.},
}
@article {pmid30038761,
year = {2018},
author = {Liu, L and Pei, C and Liu, S and Guo, X and Du, N and Guo, W},
title = {Genetic and epigenetic changes during the invasion of a cosmopolitan species (Phragmites australis).},
journal = {Ecology and evolution},
volume = {8},
number = {13},
pages = {6615-6624},
pmid = {30038761},
issn = {2045-7758},
abstract = {While many introduced invasive species can increase genetic diversity through multiple introductions and/or hybridization to colonize successfully in new environments, others with low genetic diversity have to persist by alternative mechanisms such as epigenetic variation. Given that Phragmites australis is a cosmopolitan reed growing in a wide range of habitats and its invasion history, especially in North America, has been relatively well studied, it provides an ideal system for studying the role and relationship of genetic and epigenetic variation in biological invasions. We used amplified fragment length polymorphism (AFLP) and methylation-sensitive (MS) AFLP methods to evaluate genetic and epigenetic diversity and structure in groups of the common reed across its range in the world. Evidence from analysis of molecular variance (AMOVA) based on AFLP and MS-AFLP data supported the previous conclusion that the invasive introduced populations of P. australis in North America were from European and Mediterranean regions. In the Gulf Coast region, the introduced group harbored a high level of genetic variation relative to originating group from its native location, and it showed epigenetic diversity equal to that of the native group, if not higher, while the introduced group held lower genetic diversity than the native. In the Great Lakes region, the native group displayed very low genetic and epigenetic variation, and the introduced one showed slightly lower genetic and epigenetic diversity than the original one. Unexpectedly, AMOVA and principal component analysis did not demonstrate any epigenetic convergence between native and introduced groups before genetic convergence. Our results suggested that intertwined changes in genetic and epigenetic variation were involved in the invasion success in North America. Although our study did not provide strong evidence proving the importance of epigenetic variation prior to genetic, it implied the similar role of stable epigenetic diversity to genetic diversity in the adaptation of P. australis to local environment.},
}
@article {pmid30038323,
year = {2018},
author = {Naeem, M and Yuan, X and Huang, J and An, J},
title = {Habitat suitability for the invasion of Bombus terrestris in East Asian countries: A case study of spatial overlap with local Chinese bumblebees.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {11035},
pmid = {30038323},
issn = {2045-2322},
abstract = {Invasive species such as Bombus terrestris represent a severe threat that can result in the decline of local biodiversity. We examined the habitat suitability for B. terrestris invasion in East Asian countries and the risk of habitat overlap with 24 bumblebee species from different groups in China. All East Asian countries were predicted to be susceptible to invasion by B. terrestris, with the highest habitat suitability occurring in China followed by Japan, North Korea, South Korea and Mongolia. Within China, which is a global biodiversity hotspot for bumblebees, three different regions, north-west, central to south-east and north-east, were predicted as being highly suitable for invasion. In China, the group of species closely related to B. terrestris showed higher sensitivity (89%) to habitat overlap with B. terrestris than did the group of non-closely related species (73%). The risk of overlap for the three major regional bumblebees within China decreased in the order southern region, northern region and Tibetan Plateau region. Due to the sensitivity of habitat suitability and overlap, the use of the introduced European bumblebee B. terrestris for pollination services should be discouraged in regions with overlapping habitats in China, and management strategies should be implemented to conserve the vulnerable bumblebees in all East Asian countries.},
}
@article {pmid30034679,
year = {2018},
author = {Nuñez, MA and Paritsis, J},
title = {How are monospecific stands of invasive trees formed? Spatio-temporal evidence from Douglas fir invasions.},
journal = {AoB PLANTS},
volume = {10},
number = {4},
pages = {ply041},
pmid = {30034679},
issn = {2041-2851},
abstract = {Invasive plant species can produce many impacts on native communities. Impacts can be especially important when the non-natives reach high densities, producing monospecific stands where little grows besides the non-native species. We propose three basic pathways by which monospecific stands of invasive tree species are formed: (i) gradually from the propagule source, (ii) via synchronous establishment and (iii) following several pulses of synchronous establishment. Different patterns can produce different impacts through time and may require different management techniques. This study aims to further our understanding of how monotypic stands of invasive species arise. We documented how monospecific stands are formed during invasion processes by studying patterns of spatio-temporal establishment of several monospecific stands of Douglas fir in Patagonia. We obtained data on tree density, year of establishment, size, distance to the seed source and other related measurements for this tree species along transects from the original seed source (80-year-old plantations) to the edge of the monospecific stand. We found that these monospecific stands arose in a more complex way than expected. While individuals established on average simultaneously over all distances from the seed source, there was substantial variation in time of establishment at all distances. Also, tree density was higher near the source than far from it. Different factors can account for the observed pattern of tree establishment, including seed dispersal, mycorrhizal facilitation and herbivory. Our results elucidate the complexities of spatio-temporal pattern of formation in monospecific stands. This understanding can improve management strategies and techniques for this invasion and other plant invasions in different regions.},
}
@article {pmid30033490,
year = {2018},
author = {Zhao, L and Ahmad, F and Lu, M and Zhang, W and Wickham, JD and Sun, J},
title = {Ascarosides Promote the Prevalence of Ophiostomatoid Fungi and an Invasive Pathogenic Nematode, Bursaphelenchus xylophilus.},
journal = {Journal of chemical ecology},
volume = {44},
number = {7-8},
pages = {701-710},
pmid = {30033490},
issn = {1573-1561},
support = {31630013, 31272323//National Natural Science Foundation of China/ ; XDB11050100, XDB11030600//Chinese Academy of Sciences (CAS) Strategic Priority Research Program/ ; 863 plan: 2014AA020529//High Technology Research and Development Program (HTRDP) of China/ ; },
mesh = {Animals ; Biological Evolution ; China ; Coleoptera/*physiology ; Fungi/physiology ; Glycolipids/*metabolism ; Insect Vectors/physiology ; Pinus/*parasitology ; Plant Diseases/*parasitology ; Symbiosis ; Tylenchida/*microbiology/*physiology ; },
abstract = {Understanding the coevolution of pathogens and their associated mycoflora depend upon a proper elucidation of the basis of their chemical communication. In the case of pine wilt disease, the mutual interactions between cerambycid beetles, invasive pathogenic nematodes, (Bursaphelenchus xylophilus) and their symbiotic ophiostomatoid fungi provide a unique opportunity to understand the role of small molecules in mediating their chemical communication. Nematodes produce ascarosides, a highly conserved family of small molecules that serve essential functions in nematode biology and ecology. Here we demonstrated that the associated fungi, one of the key natural food resources of pine wood nematodes, can detect and respond to these ascarosides. We found that ascarosides significantly increase the growth of L. pini-densiflorae and Sporothrix sp. 1, which are native fungal species in China that form a symbiotic relationship with pinewood nematodes. Hyphal mass of L. pini-densiflorae increased when treated with asc-C5 compared to other ophiostomatoid species. Field results demonstrated that in forests where higher numbers of PWN were isolated from beetle galleries, L. pini-densiflorae had been prevalent; the same results were confirmed in laboratory studies. Furthermore, when treated with asc-C5, L. pini-densiflorae responded by increasing its production of spores, which leads to a higher likelihood of dispersal by insect vectors, hence explaining the dominance of L. pini-densiflorae over S. sp. 1 in the Tianwang and Nanlu Mountains within the Northern Forestry Centre of China. These findings provide an emphatic representation of coevolution of pine wood nematode and its associated fungi. Our results lay a broader foundation for a better understanding of inter-kingdom mutualisms and the chemical signals that mediate their establishment.},
}
@article {pmid30032998,
year = {2019},
author = {Shrestha, BB and Shrestha, UB and Sharma, KP and Thapa-Parajuli, RB and Devkota, A and Siwakoti, M},
title = {Community perception and prioritization of invasive alien plants in Chitwan-Annapurna Landscape, Nepal.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {38-47},
doi = {10.1016/j.jenvman.2018.06.034},
pmid = {30032998},
issn = {1095-8630},
abstract = {The management of invasive species is a complex, yet an essential component of biodiversity conservation and environmental management for sustainable futures. Despite a well-established linkage between biological invasions and human activities, the social dimension of invasive species management is less explored as compared to the ecological aspects. In recent years, the active participation of local communities, such as assessing levels of awareness and the selection of targeted species prioritized by communities, has been considered as a crucial element for managing invasive species. We conducted 32 focus group discussions (FGDs) including 218 participants in Chitwan-Annapurna Landscape (ChAL) of central Nepal, to assess knowledge and perceptions of agrarian and forest-dependent communities about invasive alien plants (IAPs), document the efforts of the community management of IAPs and prioritize IAPs for management. In the prioritization exercise, participants of each FGD were asked to rank three IAPs using scoring methods and to express their experience about the effects of the selected IAPs on humans and the environment. We found that communities had a living memory of the arrival of some of the IAPs in their locality without knowing the exotic nature of IAPs. Biodiversity loss, livestock poisoning, reduced agricultural production and forage supply, and negative impact on forest regeneration were reported as major negative impacts of IAPs. Communities also reportedly utilized IAPs for medicinal purposes, making compost by using biomass, and controlling floods and landslides. None of the government and non-governmental organizations working in the sectors of biodiversity conservation and environmental management has informed local forest-dependent agrarian communities about the consequences of biological invasions and management of IAPs. However, local communities had already started controlling the spread of some IAPs through manual uprooting. They were able to spot, identify and prioritize IAPs for management and some of the prioritized species were among the world's worst invasive species. Ageratum houstonianum was the top-ranked worst invasive species in agroecosystems while Chromolaena odorata and Ageratina adenophora were the top-ranked worst species in natural ecosystems. Our findings will be useful for guiding community education programs as well as the management of IAPs through formal policy and management plans, such as Nepal's National Biodiversity Strategy and Action Plan.},
}
@article {pmid30031771,
year = {2018},
author = {Wade, RM and Sherwood, AR},
title = {Updating Plakobranchus cf. ianthobapsus (Gastropoda, Sacoglossa) host use: Diverse algal-animal interactions revealed by NGS with implications for invasive species management.},
journal = {Molecular phylogenetics and evolution},
volume = {128},
number = {},
pages = {172-181},
doi = {10.1016/j.ympev.2018.07.010},
pmid = {30031771},
issn = {1095-9513},
abstract = {Sacoglossa, the &quot;sap sucking&quot; sea slugs, are highly specialized herbivores and the only metazoans that exhibit kleptoplasty, the sequestration and retention of chloroplasts from algae. Plakobranchus is one of the most generalistic herbivores within this order, with as many as 12 reported &quot;algal host&quot; (i.e. kleptoplast source) species. However, kleptoplast diversity studies conducted on Plakobranchus to date most likely underestimated the full diversity of kleptoplast sources within the studied populations due to limitations of the molecular techniques employed. Here, we apply a high throughput sequencing technique to assess kleptoplast diversity of Plakobranchus cf. ianthobapsus' from 10 sites across the Main Hawaiian Islands during winter and summer seasons. In so doing, we effectively used P. cf. ianthobapsus as a novel sampling tool to explore diminutive algal communities, including the current distribution of the invasive alga &quot;Avrainvillea amadelpha.&quot; Our results show that P. cf. ianthobapsus sequesters chloroplasts from 23 algal species from across the siphonous green algal order Bryopsidales. We identified &quot;Avrainvillea amadelpha&quot; and Codium edule as new host species for P. cf. ianthobapusus, but their rarity among the data suggests they were most likely less preferential as hosts and were possibly utilized due to low abundance or unavailability of more preferable species, and therefore a response to starvation risk. Additionally, the identification of the highly invasive siphonous green alga &quot;A. amadelpha&quot; as a kleptoplast source provides new fine-scale range and distribution data for this problematic species. Overall kleptoplast diversity does not differ among sites, except in a coral-dominated, (i.e. not algal dominated) environment, suggesting that siphonous algal assemblages are common in algal-dominated ecosystems in the Hawaiian Islands. Diversity dissimilarity among seasons was recovered from the majority of sites sampled, supporting the need for seasonal data collection in algal diversity assessments. This case study using metabarcoding of sacoglossan kleptoplasts provides deeper insights into these plant-animal interactions with a better understanding of host use than previous studies using traditional molecular methods and illustrates how algal diversity studies on the scale of plastids can have implications for understanding algal community structure and invasive species dynamics.},
}
@article {pmid30030104,
year = {2018},
author = {Gardner, S and Assis, VR and Zhao, H and Gomes, FR and Peatman, E and Mendonça, MT},
title = {Differential gene expression to an LPS challenge in relation to exogenous corticosterone in the invasive cane toad (Rhinella marina).},
journal = {Developmental and comparative immunology},
volume = {88},
number = {},
pages = {114-123},
doi = {10.1016/j.dci.2018.07.016},
pmid = {30030104},
issn = {1879-0089},
mesh = {Amphibian Proteins/*immunology ; Animals ; Bufo marinus/genetics/*immunology ; Corticosterone/pharmacology ; Cytokines/immunology ; Down-Regulation/immunology ; Female ; Gene Expression Profiling ; Immunity, Cellular/drug effects/genetics ; Immunity, Humoral/drug effects/genetics ; Immunity, Innate/drug effects/genetics ; *Introduced Species ; Lipopolysaccharides/*immunology ; Male ; Sequence Analysis, RNA ; Spleen/immunology ; Stress, Physiological/immunology ; Up-Regulation/immunology ; },
abstract = {The cane toad (Rhinella marina) is an invasive amphibian in several parts of the world. Much of the research performed on assessing the dispersal potential of invasive species has focused immunity. Invaders are predicted to rely less on pro-inflammatory immunity, allowing them to allocate energy to dispersal. Elevated stress may play a role in regulation of immune responses used by invasive species. RNA sequencing of spleen tissue from cane toads subjected to an acute LPS challenge revealed genes coding for cytokines involved in typical innate responses such as phagocytic cell recruitment, extravasation, inflammation, and lymphocyte differentiation were significantly upregulated, while toads receiving transdermal application of corticosterone in addition to an LPS injection showed downregulation of genes involved with cell mediated immunity. These results indicate hormonal changes associated with acute stress may alter investment into mounting cell-mediated or humoral responses while allowing for prolonged phagocytic innate responses in this invasive species.},
}
@article {pmid30029120,
year = {2018},
author = {Ghezzo, M and Pellizzato, M and De Pascalis, F and Silvestri, S and Umgiesser, G},
title = {Natural resources and climate change: A study of the potential impact on Manila clam in the Venice lagoon.},
journal = {The Science of the total environment},
volume = {645},
number = {},
pages = {419-430},
doi = {10.1016/j.scitotenv.2018.07.060},
pmid = {30029120},
issn = {1879-1026},
mesh = {Animals ; Aquaculture/methods ; Bivalvia/*physiology ; *Climate Change ; *Ecosystem ; *Introduced Species ; *Natural Resources ; },
abstract = {A crucial aspect in climate change is to understand how an ecosystem will adapt under different environmental conditions and how it will influence the ecological resources and the connected human activities. In this study, a numerical model reproduces the growth dynamics, dispersion and settlement of clam's larvae in the Venice lagoon. On the basis of the last IPCC scenarios for the years 2050 and 2100, the model simulates the changes in larval settlement, showing how the geographical distribution and, consequently, the nursery area changes over time. Our results indicate that climate change will modify, not only the timing of the settlements (from spring-summer to winter autumn) and the spatial distribution of nursery areas (from central to southern lagoon), but also the absolute quantity of settled larvae in the lagoon. This can strongly affect aquaculture in terms of availability of seed and farming practice. Given that these changes are due to the variations in temperature and circulation, similar processes are likely to happen in other transitional environments all over the world affecting the global aquaculture resources. In this regard, the tool we developed could support local policymakers in the knowledge-based planning and sustainable management of clam aquaculture in vulnerable environments.},
}
@article {pmid30026511,
year = {2018},
author = {McClure, ML and Burdett, CL and Farnsworth, ML and Sweeney, SJ and Miller, RS},
title = {Publisher Correction: A globally-distributed alien invasive species poses risks to United States imperiled species.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {11153},
doi = {10.1038/s41598-018-26014-2},
pmid = {30026511},
issn = {2045-2322},
abstract = {A correction to this article has been published and is linked from the HTML and PDF versions of this paper. The error has been fixed in the paper.},
}
@article {pmid30022298,
year = {2018},
author = {El-Sayed, AM and Jósvai, JK and Brown, RL and Twidle, A and Suckling, DM},
title = {Associative Learning of Food Odor by Social Wasps in a Natural Ecosystem.},
journal = {Journal of chemical ecology},
volume = {44},
number = {10},
pages = {915-921},
pmid = {30022298},
issn = {1573-1561},
mesh = {Animal Feed/*analysis ; Animals ; DNA/genetics ; *Ecosystem ; *Learning ; Odorants/*analysis ; Social Behavior ; Wasps/genetics/*physiology ; },
abstract = {The ability of insects to associate olfactory cues with food from their environment has been well documented with various insect orders. However, these studies were based on prior training of insects to associate odors with food sources in the laboratory or in the field with almost no evidence for the development of this phenomenon in natural ecosystems. In New Zealand's ancient Fuscospora spp. or beech forests, invasive Vespula social wasps were attracted to odor from honeydew (benzaldehyde and n-octanol) but did not respond to a known wasp attractant (isobutanol and acetic acid). On the other hand, wasps in a rural/suburban area in New Zealand did not respond to honeydew odor but responded instead to the known wasp attractant. Similarly, social wasps in Hungary did not respond to honeydew odor, but responded to the known wasp attractant. DNA sequences of Vespula vulgaris from the two locations in New Zealand were 100% identical. Similarly, DNA sequences of V. germanica from the two locations in New Zealand were 100% identical, indicating little or no intra-specific variation. On the other hand, DNA sequences of V. vulgaris and V. germanica from New Zealand were 99.56 and 99.78% matches with V. vulgaris and V. germanica samples from Hungary, respectively. Electroantennogram (EAG) response profiles of wasps from the three locations to benzaldehyde, isobutanol, acetic acid, n-octanol and heptyl butyrate were similar. The high similarity in DNA sequences and EAG profiles, with only a behavioral difference in the response to odor sources, suggests that social wasps in New Zealand's beech forest have naturally developed associative learning for the odor of the carbohydrate-rich honeydew. This is the first study to provide conclusive evidence of the occurrence and the development of associative learning of food odor by social insects in a natural ecosystem free of human interference. The ability of social wasps to naturally develop associative learning of food odor might in part explain why they are extremely successful invaders of new ecosystems, especially those with rich honeydew resources. The finding of our study will have significant implications for the use of attractants in wasp monitoring and control in different habitats.},
}
@article {pmid30022289,
year = {2018},
author = {Habibi, F and Shamsi, S},
title = {Preliminary report of occurrence of Corynosoma spp. (Acanthocephala: Polymorphidae) in Southern Caspian sprat (Clupeonella grimmi).},
journal = {Parasitology research},
volume = {117},
number = {10},
pages = {3327-3331},
pmid = {30022289},
issn = {1432-1955},
mesh = {Acanthocephala/classification/genetics/*isolation &amp; purification ; Animals ; Caspian Sea ; Female ; Fish Diseases/*parasitology ; Fishes/parasitology ; Helminthiasis, Animal/*parasitology ; Male ; },
abstract = {In recent years, there has been a steady decline in the populations of clupeid fish in the Caspian Sea which has been attributed to factors such as overfishing and introduced invasive species of jellyfish. Very little is known about the diseases and possible health impacts of infectious agents such as parasites on the population of these important fish in the Caspian Sea. The aim of this study was to determine if infection with parasites can have adverse impacts on fish health and population. Sixty fish were collected, measured for weight and length, aged, and then examined for presence of Acanthocephala. Ages were recorded, as well as length and weight data for each age category and the number of acanthocephalan parasites. The internal organs, including the liver, ovary, and testis, were subjected to histopathological examination. Ninety percent of fish were found to be infected with acanthocephalan parasites, identified as Corynosoma strumosum. Fish data including the number of parasites, age, length, and weight showed that there was no significant difference in length and weight between different age groups, e.g., between 2 and 6 years old, suggesting that those fish may not grow fully as they age. There were several granuloma of different sizes in the liver and gonads, indicating the occurrence of a chronic inflammation. It is known that large numbers of granuloma may disturb the normal function of the liver and gonads and if associated with long term infection this may cause sterility, affecting the population numbers. Further research, with targeted aims, is needed to understand the impact of infection with acanthocephala on this fish and to determine the causative agents of the histopathological changes observed in the present study.},
}
@article {pmid30018391,
year = {2018},
author = {Ardura, A and Clusa, L and Zaiko, A and Garcia-Vazquez, E and Miralles, L},
title = {Stress related epigenetic changes may explain opportunistic success in biological invasions in Antipode mussels.},
journal = {Scientific reports},
volume = {8},
number = {1},
pages = {10793},
pmid = {30018391},
issn = {2045-2322},
abstract = {Different environmental factors could induce epigenetic changes, which are likely involved in the biological invasion process. Some of these factors are driven by humans as, for example, the pollution and deliberate or accidental introductions and others are due to natural conditions such as salinity. In this study, we have analysed the relationship between different stress factors: time in the new location, pollution and salinity with the methylation changes that could be involved in the invasive species tolerance to new environments. For this purpose, we have analysed two different mussels' species, reciprocally introduced in antipode areas: the Mediterranean blue mussel Mytilus galloprovincialis and the New Zealand pygmy mussel Xenostrobus securis, widely recognized invaders outside their native distribution ranges. The demetylathion was higher in more stressed population, supporting the idea of epigenetic is involved in plasticity process. These results can open a new management protocols, using the epigenetic signals as potential pollution monitoring tool. We could use these epigenetic marks to recognise the invasive status in a population and determine potential biopollutants.},
}
@article {pmid30017857,
year = {2018},
author = {Xu, L and Zhang, Y and Zhang, S and Deng, J and Lu, M and Zhang, L and Zhang, J},
title = {Comparative analysis of the immune system of an invasive bark beetle, Dendroctonus valens, infected by an entomopathogenic fungus.},
journal = {Developmental and comparative immunology},
volume = {88},
number = {},
pages = {65-69},
doi = {10.1016/j.dci.2018.07.002},
pmid = {30017857},
issn = {1879-0089},
mesh = {Animals ; Beauveria/*immunology/pathogenicity ; China ; Coleoptera/*immunology/microbiology ; Forests ; Gene Expression Profiling ; Host-Pathogen Interactions/*immunology ; Introduced Species ; Larva/immunology/microbiology ; Ophiostomatales/*immunology/pathogenicity ; Pest Control, Biological/*methods ; Phylogeny ; Pinus ; Symbiosis/immunology ; Transcriptome/immunology ; },
abstract = {Dendroctonus valens LeConte is one of the most economically important forest pest in China. Leptographium procerum, a mutualistic fungus can assist the host beetle in overcoming the pine's chemical defenses, and Beauveria bassiana, an entomopathogenic fungus has shown high beetle killing efficiency. Considering that the D. valens immune system remains unknown at the genomic level, a mutualistic and antagonistic fungus associated with the beetle provides an ideal model for studying immune interactions between the insect and associated fungi. Here, B. bassiana killed most tested larvae more effectively than L. procerum and Tween. The entomopathogenic fungus provoked stronger responses than the symbiotic fungus at the transcriptome level. We identified 185 immunity-related genes, including pattern recognition receptors, signal modulators, members of immune pathways (Toll, IMD, and JAK/STAT), and immune effectors. Quantitative real-time PCR analysis confirmed that several recognition receptors and effector genes were activated at 1 or 2 days post infection, while the effector genes were suppressed at 4 days post infection by B. bassiana, respectively. In contrast, effector genes were upregulated in response to L. procerum. Together, this study provides a comprehensive sequence resource and insight into the D. valens immune system and lays a basis for understanding the molecular aspects of the interaction between the host and associated fungi.},
}
@article {pmid30017053,
year = {2018},
author = {Clemente, M and Fusco, G and Tonina, L and Giomi, F},
title = {Temperature-induced phenotypic plasticity in the ovipositor of the invasive species Drosophila suzukii.},
journal = {Journal of thermal biology},
volume = {75},
number = {},
pages = {62-68},
doi = {10.1016/j.jtherbio.2018.05.001},
pmid = {30017053},
issn = {0306-4565},
mesh = {Animals ; Body Size ; Drosophila/*anatomy &amp; histology ; Female ; Introduced Species ; Larva ; *Oviposition ; Phenotype ; *Temperature ; },
abstract = {Drosophila suzukii (Matsumura, 1931) is a highly successful invasive dipteran which represents a serious threat for global fruit industry. Among other adaptive traits, D. suzukii owes its success to the derived morphological features of its ovipositor, which allows the insect to exploit the exclusive ecological niche of fresh fruit, thus avoiding competition with other closely related species. With the aim of investigating temperature-induced phenotypic plasticity of D. suzukii ovipositor, we reared this insect in four different laboratory conditions, represented by the combination of two developmental temperatures and two diet regimes for the larvae. We recorded the effects of these two factors on ovipositor size and shape and overall body size through a combination of distance-based and geometric morphometric analyses. Results showed that insects attain the largest body sizes at lower temperature, whereas the diet does not determine significant difference in size. However, the effect on size of the two factors is less pronounced in the ovipositor, which shows a negative allometry with respect to body size in all treatments. At higher temperature, ovipositor shape tends also to co-vary with its own size. Neither temperature nor diet have significant effect on ovipositor bilateral fluctuating asymmetry. These results confirm the hypothesis that in D. suzukii the toughened valve of the ovipositor are subjected to effective morpho-functional constraints, while probably being under strong selection by reason of their mechanical role.},
}
@article {pmid30016760,
year = {2018},
author = {Vo, NTK and Moore, LC and Spiteri, KW and Hanner, R and Wilkie, MP and DeWitte-Orr, SJ},
title = {Assessing off-target cytotoxicity of the field lampricide 3-trifluoromethyl-4-nitrophenol using novel lake sturgeon cell lines.},
journal = {Ecotoxicology and environmental safety},
volume = {162},
number = {},
pages = {536-545},
doi = {10.1016/j.ecoenv.2018.07.017},
pmid = {30016760},
issn = {1090-2414},
mesh = {Animals ; Cell Line ; *Fishes ; Gills/cytology/drug effects ; Intestines/cytology/drug effects ; Lakes ; Larva/drug effects/metabolism ; Lethal Dose 50 ; Liver/cytology/drug effects ; Nitrophenols/*toxicity ; Oncorhynchus mykiss ; Petromyzon ; Rivers/chemistry ; Skin/cytology/drug effects ; Toxicity Tests, Acute ; Water Pollutants, Chemical/*toxicity ; },
abstract = {Lampricides are currently being applied to streams and rivers to control the population of sea lamprey, an invasive species, in the Great Lakes. The most commonly used lampricide agent used in the field is 3-trifluoromethyl-4-nitrophenol (TFM), which targets larval sea lamprey in lamprey-infested rivers and streams. The specificity of TFM is due to the relative inability of sea lamprey to detoxify the agent relative to non-target fishes. There is increasing concern, however, about non-target effects on fishes, particularly threatened populations of juvenile lake sturgeon (LS; Acipenser fulvescens). There is therefore a need to develop models to better define lake sturgeon's response to TFM. Here we report the establishment of five LS cell lines derived from the liver, gill, skin and intestinal tract of juvenile LS and some of their cellular characteristics. All LS cell lines grew well at 25 °C in Leibovitz's (L)- 15 medium supplemented with 10% FBS. All cell lines demonstrated high senescence-associated β-galactosidase activity and varying levels of Periodic acid Schiff-positive polysaccharides, indicating substantial production of glycoproteins and mucosubstances by the cells. Comparative toxicity of TFM in the five LS cell lines was assessed by two fluorescent cell viability dyes, Alamar Blue and CFDA-AM, in conditions with and without serum and at 24 or 72 h exposure. Deduced EC50 values were compared between the cell lines and to the reported in vivo LC50s. Tissues sensitive to the effects of TFM in vivo correlated with cell lines from the same tissues being most sensitive to TFM in vitro. EC50 values for the LSliver-e cells was significantly lower than the EC50 for the rainbow trout (RBT) liver cells RTL-W1, reaffirming the in vivo observation that LS was generally more TFM-sensitive than rainbow trout. Our data suggests that whole-fish sensitivity of LS to TFM is likely attributable to sensitivity at the cellular level. Thus, LS cell lines, as well as those of RBT, can be used to screen and evaluate the toxicity of the next generation of lampricides on non-target fish such as lake sturgeon.},
}
@article {pmid30016347,
year = {2018},
author = {Wolf, CA and Young, HS and Zilliacus, KM and Wegmann, AS and McKown, M and Holmes, ND and Tershy, BR and Dirzo, R and Kropidlowski, S and Croll, DA},
title = {Invasive rat eradication strongly impacts plant recruitment on a tropical atoll.},
journal = {PloS one},
volume = {13},
number = {7},
pages = {e0200743},
pmid = {30016347},
issn = {1932-6203},
mesh = {Animals ; Biodiversity ; Cocos/*physiology ; *Conservation of Natural Resources ; Ecology ; *Ecosystem ; Hawaii ; *Introduced Species ; Islands ; Pacific Ocean ; Rats ; Seedlings ; Trees/*physiology ; Tropical Climate ; },
abstract = {Rat eradication has become a common conservation intervention in island ecosystems and its effectiveness in protecting native vertebrates is increasingly well documented. Yet, the impacts of rat eradication on plant communities remain poorly understood. Here we compare native and non-native tree and palm seedling abundance before and after eradication of invasive rats (Rattus rattus) from Palmyra Atoll, Line Islands, Central Pacific Ocean. Overall, seedling recruitment increased for five of the six native trees species examined. While pre-eradication monitoring found no seedlings of Pisonia grandis, a dominant tree species that is important throughout the Pacific region, post-eradication monitoring documented a notable recruitment event immediately following eradication, with up to 688 individual P. grandis seedlings per 100m2 recorded one month post-eradication. Two other locally rare native trees with no observed recruitment in pre-eradication surveys had recruitment post-rat eradication. However, we also found, by five years post-eradication, a 13-fold increase in recruitment of the naturalized and range-expanding coconut palm Cocos nucifera. Our results emphasize the strong effects that a rat eradication can have on tree recruitment with expected long-term effects on canopy composition. Rat eradication released non-native C. nucifera, likely with long-term implications for community composition, potentially necessitating future management interventions. Eradication, nevertheless, greatly benefitted recruitment of native tree species. If this pattern persists over time, we expect long-term benefits for flora and fauna dependent on these native species.},
}
@article {pmid30015612,
year = {2018},
author = {Shilton, CM and Šlapeta, J and Shine, R and Brown, GP},
title = {Invasive Colonic Entamoebiasis in Wild Cane Toads, Australia.},
journal = {Emerging infectious diseases},
volume = {24},
number = {8},
pages = {1541-1543},
pmid = {30015612},
issn = {1080-6059},
abstract = {We detected a disease syndrome in free-ranging Australian cane toads involving atypical behavior and emaciation that is associated with a previously undescribed Entamoeba sp. that infiltrates the colonic lining, causing it to slough. The organism may become seasonally pathogenic when toads are under hydric and nutritional stress.},
}
@article {pmid30015117,
year = {2018},
author = {Hesselschwerdt, J and Wantzen, KM},
title = {Global warming may lower thermal barriers against invasive species in freshwater ecosystems - A study from Lake Constance.},
journal = {The Science of the total environment},
volume = {645},
number = {},
pages = {44-50},
doi = {10.1016/j.scitotenv.2018.07.078},
pmid = {30015117},
issn = {1879-1026},
abstract = {European freshwater ecosystems are increasingly invaded by exotic animal and plant species. Apart from increased connectivity between previously separated watersheds, the increasing temperature of the hydrosystems favors the spread of exotic species. The freshwater fauna of Central Europe is still shaped by the cold-adapted animal assemblages resulting from the last glaciation. It is less diverse, and the species are putatively less performant competitors, compared to the warm-adapted, species-rich fauna of the Ponto-Caspian realm, from which many current aquatic invaders are coming. Our study analyses potential mechanisms explaining the coexistence between one of the most impacting aquatic invaders of the past decades, the 'killer shrimp' Dikerogammarus villosus and the previously dominating amphipod Gammarus roeselii in Lake Constance, using laboratory predation experiments and field surveys. Our results indicate two key drivers for coexistence: low winter temperatures and the substrate structure of the alga Chara sp. At temperatures below 6 °C, the predation pressure on G. roeselii was strongly reduced; G. roeselii can therefore disperse throughout the littoral in winter, avoiding predation by D. villosus. Artificial heating of a section of the lake shore, however, resulted in local extinction of G. roeselii by D. villosus. The macroalga Chara sp. completely inhibited predation by D. villosus on G. roeselii. Climate change scenarios indicate that global warming might destroy this thermal refuge during winter until 2085. For the survival of G. roeselii it will then be crucial, which part of the Chara population will maintain epigeic plant parts during winter. The complex interplay between thermal and physical refuges for native species in the context of climate change and changing trophic status of freshwater systems, as disentangled by our study, shows that ecosystem management and restoration strategies need to better consider multiple stressors (and their rather complex mitigation strategies).},
}
@article {pmid30014781,
year = {2018},
author = {Hennessy, E},
title = {The politics of a natural laboratory: Claiming territory and governing life in the Galápagos Islands.},
journal = {Social studies of science},
volume = {48},
number = {4},
pages = {483-506},
doi = {10.1177/0306312718788179},
pmid = {30014781},
issn = {0306-3127},
abstract = {The Galápagos Islands are often called a natural laboratory of evolution. This metaphor provides a powerful way of understanding space that, through scientific research, conservation and tourism, has shaped the archipelago over the past century. Combining environmental histories of field science with political ecologies of conservation biopower, this article foregrounds the territorial production of the archipelago as a living laboratory. In the mid-twentieth century, foreign naturalists used the metaphor to make land claims as they campaigned to create the Galápagos National Park and Charles Darwin Research Station. Unlike earlier 'parks for science', these institutions were not established under colonial rule, but through postwar institutions of transnational environmental governance that nonetheless continued colonial approaches to nature protection. In the following decades, the metaphor became a rationale for territorial management through biopolitical strategies designed to ensure isolation by controlling human access and introduced species. This article's approach extends the scope of what is at stake in histories of field science: not only the production of knowledge and authority of knowledge claims, but also the foundation of global environmental governance and authority over life and death in particular places. Yet while the natural laboratory was a powerful geographical imagination, analysis shows that it was also an unsustainable goal.},
}
@article {pmid30012277,
year = {2018},
author = {Ingrosso, G and Abbiati, M and Badalamenti, F and Bavestrello, G and Belmonte, G and Cannas, R and Benedetti-Cecchi, L and Bertolino, M and Bevilacqua, S and Bianchi, CN and Bo, M and Boscari, E and Cardone, F and Cattaneo-Vietti, R and Cau, A and Cerrano, C and Chemello, R and Chimienti, G and Congiu, L and Corriero, G and Costantini, F and De Leo, F and Donnarumma, L and Falace, A and Fraschetti, S and Giangrande, A and Gravina, MF and Guarnieri, G and Mastrototaro, F and Milazzo, M and Morri, C and Musco, L and Pezzolesi, L and Piraino, S and Prada, F and Ponti, M and Rindi, F and Russo, GF and Sandulli, R and Villamor, A and Zane, L and Boero, F},
title = {Mediterranean Bioconstructions Along the Italian Coast.},
journal = {Advances in marine biology},
volume = {79},
number = {},
pages = {61-136},
doi = {10.1016/bs.amb.2018.05.001},
pmid = {30012277},
issn = {0065-2881},
mesh = {Animals ; *Biodiversity ; Conservation of Natural Resources ; *Coral Reefs ; *Environmental Monitoring ; Italy ; Mediterranean Sea ; },
abstract = {Marine bioconstructions are biodiversity-rich, three-dimensional biogenic structures, regulating key ecological functions of benthic ecosystems worldwide. Tropical coral reefs are outstanding for their beauty, diversity and complexity, but analogous types of bioconstructions are also present in temperate seas. The main bioconstructions in the Mediterranean Sea are represented by coralligenous formations, vermetid reefs, deep-sea cold-water corals, Lithophyllum byssoides trottoirs, coral banks formed by the shallow-water corals Cladocora caespitosa or Astroides calycularis, and sabellariid or serpulid worm reefs. Bioconstructions change the morphological and chemicophysical features of primary substrates and create new habitats for a large variety of organisms, playing pivotal roles in ecosystem functioning. In spite of their importance, Mediterranean bioconstructions have not received the same attention that tropical coral reefs have, and the knowledge of their biology, ecology and distribution is still fragmentary. All existing data about the spatial distribution of Italian bioconstructions have been collected, together with information about their growth patterns, dynamics and connectivity. The degradation of these habitats as a consequence of anthropogenic pressures (pollution, organic enrichment, fishery, coastal development, direct physical disturbance), climate change and the spread of invasive species was also investigated. The study of bioconstructions requires a holistic approach leading to a better understanding of their ecology and the application of more insightful management and conservation measures at basin scale, within ecologically coherent units based on connectivity: the cells of ecosystem functioning.},
}
@article {pmid30011076,
year = {2018},
author = {Winkler, DE and Gremer, JR and Chapin, KJ and Kao, M and Huxman, TE},
title = {Rapid alignment of functional trait variation with locality across the invaded range of Sahara mustard (Brassica tournefortii).},
journal = {American journal of botany},
volume = {105},
number = {7},
pages = {1188-1197},
doi = {10.1002/ajb2.1126},
pmid = {30011076},
issn = {1537-2197},
abstract = {PREMISE OF STUDY: Mechanisms by which invasive species succeed across multiple novel environmental contexts are poorly understood. Functional traits show promise for identifying such mechanisms, yet we lack knowledge of which functional traits are critical for success and how they vary across invaded ranges and with environmental features. We evaluated the widespread recent invasion of Sahara mustard (Brassica tournefortii) in the southwestern United States to understand the extent of functional trait variation across the invaded range and how such variation is related to spatial and climatic gradients.<br><br>METHODS: We used a common garden approach, growing two generations of plants in controlled conditions sourced from 10 locations across the invaded range. We measured variation within and among populations in phenological, morphological, and physiological traits, as well as performance.<br><br>KEY RESULTS: We found nine key traits that varied among populations. These traits were related to phenology and early growth strategies, such as the timing of germination and flowering, as well as relative allocation of biomass to reproduction and individual seed mass. Trait variation was related most strongly to variation in winter precipitation patterns across localities, though variations in temperature and latitude also had significant contributions.<br><br>CONCLUSIONS: Our results identify key functional traits of this invasive species that showed significant variation among introduced populations across a broad geographic and climatic range. Further, trait variation among populations was strongly related to key climatic variables, which suggests that population divergence in these traits may explain the successful colonization of Sahara mustard across its invaded US range.},
}
@article {pmid30010927,
year = {2018},
author = {May, C and Hillerbrand, N and Thompson, LM and Faske, TM and Martinez, E and Parry, D and Agosta, SJ and Grayson, KL},
title = {Geographic Variation in Larval Metabolic Rate Between Northern and Southern Populations of the Invasive Gypsy Moth.},
journal = {Journal of insect science (Online)},
volume = {18},
number = {4},
pages = {},
pmid = {30010927},
issn = {1536-2442},
mesh = {Acclimatization ; *Adaptation, Biological ; Animals ; *Basal Metabolism ; *Climate ; Introduced Species ; Larva/growth &amp; development/metabolism ; Massachusetts ; Moths/growth &amp; development/*metabolism ; Quebec ; Southeastern United States ; },
abstract = {Thermal regimes can diverge considerably across the geographic range of a species, and accordingly, populations can vary in their response to changing environmental conditions. Both local adaptation and acclimatization are important mechanisms for ectotherms to maintain homeostasis as environments become thermally stressful, which organisms often experience at their geographic range limits. The spatial spread of the gypsy moth (Lymantria dispar L.) (Lepidoptera: Erebidae) after introduction to North America provides an exemplary system for studying population variation in physiological traits given the gradient of climates encompassed by its current invasive range. This study quantifies differences in resting metabolic rate (RMR) across temperature for four populations of gypsy moth, two from the northern and two from southern regions of their introduced range in North America. Gypsy moth larvae were reared at high and low thermal regimes, and then metabolic activity was monitored at four temperatures using stop-flow respirometry to test for an acclimation response. For all populations, there was a significant increase in RMR as respirometry test temperature increased. Contrary to our expectations, we did not find evidence for metabolic adaptation to colder environments based on our comparisons between northern and southern populations. We also found no evidence for an acclimation response of RMR to rearing temperature for three of the four pairwise comparisons examined. Understanding the thermal sensitivity of metabolic rate in gypsy moth, and understanding the potential for changes in physiology at range extremes, is critical for estimating continued spatial spread of this invasive species both under current and potential future climatic constraints.},
}
@article {pmid30010926,
year = {2018},
author = {Sibilia, CD and Brosko, KA and Hickling, CH and Thompson, LM and Grayson, KL and Olson, JR},
title = {Thermal Physiology and Developmental Plasticity of Pigmentation in the Harlequin Bug (Hemiptera: Pentatomidae).},
journal = {Journal of insect science (Online)},
volume = {18},
number = {4},
pages = {},
pmid = {30010926},
issn = {1536-2442},
mesh = {Animals ; *Cold Temperature ; Heteroptera/growth &amp; development/*physiology ; *Hot Temperature ; Nymph/growth &amp; development/physiology ; *Photoperiod ; *Pigmentation ; Seasons ; Virginia ; },
abstract = {Traits that promote the maintenance of body temperatures within an optimal range provide advantages to ectothermic species. Pigmentation plasticity is found in many insects and enhances thermoregulatory potential as increased melanization can result in greater heat retention. The thermal melanism hypothesis predicts that species with developmental plasticity will have darker pigmentation in colder environments, which can be an important adaptation for temperate species experiencing seasonal variation in climate. The harlequin bug (Murgantia histrionica, Hemiptera: Pentatomidae, Hahn 1834) is a widespread invasive crop pest with variable patterning where developmental plasticity in melanization could affect performance. To investigate the impact of temperature and photoperiod on melanization and size, nymphs were reared under two temperatures and two photoperiods simulating summer and fall seasons. The size and degree of melanization of adults were quantified using digital imagery. To assess the effect of coloration on the amount of heat absorption, we monitored the temperature of adults in a heating experiment. Overall, our results supported the thermal melanism hypothesis and temperature had a comparatively larger effect on coloration and size than photoperiod. When heated, the body temperature of individuals with darker pigmentation increased more relative to the ambient air temperature than individuals with lighter pigmentation. These results suggest that colder temperatures experienced late in the season can induce developmental plasticity for a phenotype that improves thermoregulation in this species. Our work highlights environmental signals and consequences for individual performance due to thermal melanism in a common invasive species, where capacity to respond to changing environments is likely contributing to its spread.},
}
@article {pmid30008279,
year = {2018},
author = {Giovanetti, M},
title = {Foraging choices balanced between resource abundance and handling concerns: how the honeybee, Apis mellifera, select the flowers of Robinia pseudoacacia.},
journal = {Bulletin of entomological research},
volume = {},
number = {},
pages = {1-9},
doi = {10.1017/S0007485318000561},
pmid = {30008279},
issn = {1475-2670},
abstract = {Nectar is a main resource harvested by foraging honeybees: their ability in selecting among flowers is the key to optimize resource collection. This ability is expected to be the result of co-evolutionary traits between the plant and the pollinator visiting it; notwithstanding, novel interactions may occur between native and invasive species. Analysing foraging efforts, flexibility and individual constrains has to be taken into account. The foraging pattern of the ubiquitous honeybee on Robinia pseudoacacia, a North-American species widely naturalized in European countries, grounds a perfect case study. The plant shows papilionate flowers especially reach in nectar, but their tripping mechanism is difficult for the small/light-weight honeybee. Yet Apis mellifera is known to pay frequent and constant visits to them: in fact, one of the most appreciated unifloral honey is produced out of R. pseudoacacia. The aim of this study was to understand when and how the bees overcome physical constraints to succeed in flower visits, and to what extent this flexibility extend from the individual to the species. Data were collected in Italy, through focal observations of foraging individuals, nectar content measurements and experiments with manipulated inflorescences. Results clearly indicate that nectar content changes accordingly to the state of flowers (visited or unvisited), which also show slight changes in appearance. Foraging individuals, able to detect these differences, perform active choices preferentially selecting already-visited flowers: lower in nectar content but easier to manipulate. Even if the choice is primarily driven by handling constraints, individual experience and strength of stimuli are prompting visits also to unvisited flowers, notwithstanding a higher risk of failure in resource collection. Behavioural plasticity matching a satisfactory compromise grounds the decision that maximizes the intake of resource balanced with the effort to gain it.},
}
@article {pmid30005837,
year = {2018},
author = {Raimundo, RLG and Guimarães, PR and Evans, DM},
title = {Adaptive Networks for Restoration Ecology.},
journal = {Trends in ecology &amp; evolution},
volume = {33},
number = {9},
pages = {664-675},
doi = {10.1016/j.tree.2018.06.002},
pmid = {30005837},
issn = {1872-8383},
mesh = {*Biodiversity ; *Conservation of Natural Resources ; Environmental Restoration and Remediation/*methods ; },
abstract = {The urgent need to restore biodiversity and ecosystem functioning challenges ecology as a predictive science. Restoration ecology would benefit from evolutionary principles embedded within a framework that combines adaptive network models and the phylogenetic structure of ecological interactions. Adaptive network models capture feedbacks between trait evolution, species abundances, and interactions to explain resilience and functional diversity within communities. Phylogenetically-structured network data, increasingly available via next-generation sequencing, inform constraints affecting interaction rewiring. Combined, these approaches can predict eco-evolutionary changes triggered by community manipulation practices, such as translocations and eradications of invasive species. We discuss theoretical and methodological opportunities to bridge network models and data from restoration projects and propose how this can be applied to the functional restoration of ecological interactions.},
}
@article {pmid30005416,
year = {2018},
author = {Kral, K and Limb, R and Ganguli, A and Hovick, T and Sedivec, K},
title = {Seasonal prescribed fire variation decreases inhibitory ability of Poa pratensis L. and promotes native plant diversity.},
journal = {Journal of environmental management},
volume = {223},
number = {},
pages = {908-916},
doi = {10.1016/j.jenvman.2018.06.096},
pmid = {30005416},
issn = {1095-8630},
mesh = {Biodiversity ; *Ecosystem ; *Fires ; Plants ; *Poa ; Seasons ; },
abstract = {Global biodiversity is threatened by invasive plant species. Without a thorough understanding of effective management strategies, minimizing their impacts while improving native species diversity will be challenging. Burning in fire-prone landscapes has been successful for managing invasive species and increasing native biodiversity, but it is unclear how specific fire regimes improve restoration practices in novel ecosystems where invasive plants have a similar growth phenology to native plants. We investigated fire as a restoration practice in the Northern Great Plains to decrease the cover of Kentucky bluegrass Poa pratensis (bluegrass), a perennial cool-season invasive grass phenologically similar to dominant native cool-season grasses, by 1) evaluating season of burn (early-growing season, late-growing season, and dormant season) in a field experiment to test differences in plant community composition and 2) manipulating fine fuels (3000-5000 kg ha-1) in an experimental approach to determine the effects of fire on plant survivability of selected native grasses and bluegrass. Bluegrass cover decreased 27% on all field burned plots the first year post-fire. Three years post-fire, late-growing season and dormant season treatments had 35% less bluegrass, whereas the early-growing season treatment was not significantly different from the control. Overall, fire altered the native plant community, with native plants more associated with burned plots. However, native plant community changes were only evident three years post-fire in late-growing season and dormant season burn treatments. In the experimental approach, native grasses and bluegrass experienced high rates of mortality (40-50%) at fuel loads above 4000 kg ha-1 and heat dosages above 30,000 °C·sec, features commonly associated with early-growing season burns. Therefore, early-growing season burns meant to reduce bluegrass may also impact native plants dominant in the region. Invasive species management is complicated in novel ecosystems when invasive plants have similar growth phenologies to native species. Control efforts should consider how different management strategies impact invasive and native plants alike. We found that late-growing season and dormant season burns, along with higher fuel loads, decreased bluegrass cover. Determining mechanisms of control in fire-prone landscapes is a crucial step to improving invasive plant control and increasing native biodiversity.},
}
@article {pmid30004584,
year = {2018},
author = {Medger, K and Bennett, NC and Chimimba, CT and Oosthuizen, MK and Mikkelsen, JD and Coen, CW},
title = {Analysis of gonadotrophin-releasing hormone-1 and kisspeptin neuronal systems in the nonphotoregulated seasonally breeding eastern rock elephant-shrew (Elephantulus myurus).},
journal = {The Journal of comparative neurology},
volume = {526},
number = {15},
pages = {2388-2405},
doi = {10.1002/cne.24498},
pmid = {30004584},
issn = {1096-9861},
support = {//Augustinus Fonden/ ; BBD5231861//Biotechnology and Biological Sciences Research Council/United Kingdom ; //South African National Research Foundation/ ; },
abstract = {Of the 18 sub-Saharan elephant-shrew species, only eastern rock elephant-shrews reproduce seasonally throughout their distribution, a process seemingly independent of photoperiod. The present study characterizes gonadal status and location/intensity of gonadotrophin-releasing hormone-1 (GnRH-1) and kisspeptin immunoreactivities in this polyovulating species in the breeding and nonbreeding seasons. GnRH-1-immunoreactive (ir) cell bodies are predominantly in the medial septum, diagonal band, and medial preoptic area; processes are generally sparse except in the external median eminence. Kisspeptin-ir cell bodies are detected only within the arcuate nucleus; the density of processes is generally low, except in the septohypothalamic nucleus, ventromedial bed nucleus of the stria terminalis, arcuate nucleus, and internal and external median eminence. Kisspeptin-ir processes are negligible at locations containing GnRH-1-ir cell bodies. The external median eminence is the only site with conspicuously overlapping distributions of the respective immunoreactivities and, accordingly, a putative site for kisspeptin's regulation of GnRH-1 release in this species. In the nonbreeding season in males, there is an increase in the rostral population of GnRH-1-ir cell bodies and density of GnRH-1-ir processes in the median eminence. In both sexes, the breeding season is associated with increased kisspeptin-ir process density in the rostral periventricular area of the third ventricle and arcuate nucleus; at the latter site, this is positively correlated with gonadal mass. Cross-species comparisons lead us to hypothesize differential mechanisms within these peptidergic systems: that increased GnRH-1 immunoreactivity during the nonbreeding season reflects increased accumulation with reduced release; that increased kisspeptin immunoreactivity during the breeding season reflects increased synthesis with increased release.},
}
@article {pmid30002245,
year = {2018},
author = {Brito, MFG and Magalhães, ALB and Lima-Junior, DP and Pelicice, FM and Azevedo-Santos, VM and Garcia, DAZ and Cunico, AM and Vitule, JRS},
title = {Brazil naturalizes non-native species.},
journal = {Science (New York, N.Y.)},
volume = {361},
number = {6398},
pages = {139},
doi = {10.1126/science.aau3368},
pmid = {30002245},
issn = {1095-9203},
mesh = {Animals ; *Biodiversity ; Brazil ; *Fishes ; Introduced Species/*legislation &amp; jurisprudence ; *Rana catesbeiana ; },
}
@article {pmid30001886,
year = {2019},
author = {Pagès, M and Fischer, A and van der Wal, R and Lambin, X},
title = {Empowered communities or &quot;cheap labour&quot;? Engaging volunteers in the rationalised management of invasive alien species in Great Britain.},
journal = {Journal of environmental management},
volume = {229},
number = {},
pages = {102-111},
doi = {10.1016/j.jenvman.2018.06.053},
pmid = {30001886},
issn = {1095-8630},
abstract = {Volunteers are increasingly involved in the delivery of nature conservation policies, usually supported by a twofold rationale: volunteering can (a) enhance citizen participation in environmental governance and (b) ensure a workforce is in place to support conservation work in times of budget shortages. Here, we ask how these two rationales correspond to volunteers' own motivations to engage in a specific nature conservation activity, namely the control of invasive alien species (IAS). We use qualitative interviews with professional project managers, local group leaders, and volunteers to examine the interactions between policies aiming to rationalise the management of IAS and the motivations for and goals of volunteer engagement. Our findings suggest that although volunteering can lead to positive conservation outcomes, satisfying experiences and empowerment, the different interests do not always align in practice. We investigate the implications of strategies that aim to improve the efficiency of invasive species and volunteer management, and discuss organisational arrangements that reconcile different objectives.},
}
@article {pmid30001394,
year = {2018},
author = {Wilson, J and Matejusova, I and McIntosh, RE and Carboni, S and Bekaert, M},
title = {New diagnostic SNP molecular markers for the Mytilus species complex.},
journal = {PloS one},
volume = {13},
number = {7},
pages = {e0200654},
pmid = {30001394},
issn = {1932-6203},
mesh = {Animals ; Genetic Markers ; *Genotyping Techniques ; Mytilus/classification/*genetics ; *Polymorphism, Single Nucleotide ; Species Specificity ; },
abstract = {The development of diagnostic markers has been a long-standing interest of population geneticists as it allows clarification of taxonomic uncertainties. Historically, there has been much debate on the taxonomic status of species belonging to the Mytilus species complex (M. edulis, M. galloprovincialis and M. trossulus), and whether they are discrete species. We analysed reference pure specimens of M. edulis, M. galloprovincialis and M. trossulus, using Restriction site associated DNA (RAD) sequencing and identified over 6,000 SNP markers separating the three species unambiguously. We developed a panel of diagnostic SNP markers for the genotyping of Mytilus species complex as well as the identification of hybrids and interspecies introgression events in Mytilus species. We validated a panel of twelve diagnostic SNP markers which can be used for species genotyping. Being able to accurately identify species and hybrids within the Mytilus species complex is important for the selective mussel stock management, the exclusion of invasive species, basic physiology and bio-diversity studies.},
}
@article {pmid29998601,
year = {2018},
author = {Silacci, P and Biolley, C and Jud, C and Charrière, JD and Dainat, B},
title = {An improved DNA method to unambiguously detect small hive beetle Aethina tumida, an invasive pest of honeybee colonies.},
journal = {Pest management science},
volume = {74},
number = {12},
pages = {2667-2670},
pmid = {29998601},
issn = {1526-4998},
support = {//Swiss Veterinary Office/ ; //German Federal Ministry for Education and Research/ ; },
mesh = {Animals ; *Bees ; Coleoptera/*genetics ; DNA/*genetics ; Insect Control ; *Introduced Species ; Polymerase Chain Reaction/*methods ; },
abstract = {The scavenger and invasive species Aethina tumida threatening the honey bee has been recently introduced in Europe. We present a new, reliable and rapid multiplex real-time PCR for efficient diagnostics enabling surveillance programs. © 2018 The Authors. Pest Management Science published by John Wiley &amp; Sons Ltd on behalf of Society of Chemical Industry.},
}
@article {pmid29997443,
year = {2018},
author = {Pellegrini, MOO},
title = {Wandering throughout South America: Taxonomic revision of Tradescantia subg. Austrotradescantia (D.R.Hunt) M.Pell. (Commelinaceae).},
journal = {PhytoKeys},
volume = {},
number = {101},
pages = {1-97},
pmid = {29997443},
issn = {1314-2011},
abstract = {I present the first taxonomic revision for T. subg. Austrotradescantia, based on extensive field, cultivation and herbaria studies. I accept 13 species, three of them (i.e. T. atlantica, T. hertweckii and T. tucumanensis) being described as new in the present study. I provide an identification key to the species, distribution maps, descriptions, comments, conservation assessments and illustrations for all species. The troublesome weed T. fluminensis has its specific limits clarified and its native range is presented so it can serve as a basis to better understanding its ecological requirements and to help control it throughout its invasive range. Furthermore, I highlight that T. mundula, a commonly neglected species closely related to T. fluminensis, might also represent a troublesome weed. Tradescantia mundula has been widely introduced in cultivation under the name T. albiflora and seems to have also escaped from cultivation. However, due to the hitherto poorly understood specific limits of T. fluminensis, T. mundula has been treated as a mere cultivar of T. fluminensiss.s.},
}
@article {pmid29995864,
year = {2018},
author = {Graham, NAJ and Wilson, SK and Carr, P and Hoey, AS and Jennings, S and MacNeil, MA},
title = {Seabirds enhance coral reef productivity and functioning in the absence of invasive rats.},
journal = {Nature},
volume = {559},
number = {7713},
pages = {250-253},
doi = {10.1038/s41586-018-0202-3},
pmid = {29995864},
issn = {1476-4687},
mesh = {Animals ; Anthozoa/*physiology ; Aquatic Organisms/metabolism ; Biomass ; Birds/*physiology ; Charadriiformes/physiology ; *Coral Reefs ; Data Analysis ; Fishes/metabolism ; *Food Chain ; Herbivory ; Indian Ocean ; *Introduced Species ; Islands ; Nitrogen/metabolism ; Porifera/metabolism ; Rats ; Seaweed/metabolism ; },
abstract = {Biotic connectivity between ecosystems can provide major transport of organic matter and nutrients, influencing ecosystem structure and productivity1, yet the implications are poorly understood owing to human disruptions of natural flows2. When abundant, seabirds feeding in the open ocean transport large quantities of nutrients onto islands, enhancing the productivity of island fauna and flora3,4. Whether leaching of these nutrients back into the sea influences the productivity, structure and functioning of adjacent coral reef ecosystems is not known. Here we address this question using a rare natural experiment in the Chagos Archipelago, in which some islands are rat-infested and others are rat-free. We found that seabird densities and nitrogen deposition rates are 760 and 251 times higher, respectively, on islands where humans have not introduced rats. Consequently, rat-free islands had substantially higher nitrogen stable isotope (δ15N) values in soils and shrubs, reflecting pelagic nutrient sources. These higher values of δ15N were also apparent in macroalgae, filter-feeding sponges, turf algae and fish on adjacent coral ree